ElevatedExpressionofWntAntagonistsIsaCommonEvent ... · cesium chloride cushion or by Trizol...

Elevated Expression ofWnt Antagonists Is a Common Eventin HepatoblastomasArend Koch,1Andreas Waha,1Wolfgang Hartmann,1Aksana Hrychyk,1Ulrich Schu« ller,1AnkeWaha,1

Keith A.Wharton Jr,2 Serge Y. Fuchs,3 Dietrich von Schweinitz,4 and Torsten Pietsch1

Abstract Hepatoblastomas are the most frequent malignant liver tumors of childhood. A high frequency ofactivating b-catenin mutations in hepatoblastomas indicates that the Wnt signaling pathwayplays an important role in the development of this embryonic neoplasm. Stabilization of B-catenin leads to an increased formation of nuclear B-catenin-T-cell factor complexes and alteredexpression of Wnt-inducible target genes. In this study, we analyzed the mRNA expressionlevels of nine Wnt genes, including c-JUN, c-MYC, CYCLIN D1, FRA-1, NKD-1, ITF-2, MMP-7,uPAR, and b-TRCP, by competitive reverse transcription-PCR.We analyzed 23 hepatoblastomabiopsies for which matching liver tissue was available, 5 hepatoblastoma cell lines, and 3human fetal liver samples. b-TRCP and NKD-1 were highly expressed in all hepatoblastomasamples, independent of the b-catenin mutational status, in comparison with their nontumo-rous counterparts. b-TRCP mRNA overexpression was associated with accumulation of intra-cytoplasmic and nuclear B-TrCP protein. In human liver tumor cells without b-catenin mutations,Nkd-1 inhibited theWnt-3a-activated Tcf-responsive-luciferase reporter activity, whereas Nkd-1in hepatoblastomas with b-catenin mutations had no antagonistic effect. Our data emphasizethe inhibitory effect of B-TrCP and Nkd-1on theWnt signaling pathway in a manner analogousto Conductin (AXIN2) and Dkk-1, inhibitors shown previously to be up-regulated in hepato-blastomas. Our findings indicate that overexpression of theWnt antagonists Nkd-1and B-TrCPreveals an activation of theWnt signaling pathway as a common event in hepatoblastomas.Wepropose that Nkd-1 and B-TrCP may be used as possible diagnostic markers for the activatedWnt signaling pathway in hepatoblastomas.

Wnts are secreted glycoproteins that play a major role in theregulation of cell proliferation and differentiation duringdevelopment. Activation of the Wnt signaling pathway, whichis a common event in the development of various humancancers (1), leads to stabilization and accumulation of h-catenin, one of the main components in this pathway (2, 3).Cytoplasmic h-catenin abundance is controlled by the negativeregulators AXIN1 and Conductin (AXIN2), which functionallyinteract with APC and GSK3h in a multiprotein complex (4, 5).This multiprotein complex promotes NH2-terminal phosphor-

ylation of h-catenin by GSK3h resulting in its degradation (6)via the ubiquitin ligase receptor h-transducin repeat-containingprotein (h-TrCP), which is also activated by the Wnt signalingpathway (7). Accumulated h-catenin interacts with transcrip-tion factors of the T-cell factor/lymphoid enhancer factor familyand induces the expression of target genes with T-cell factor–binding sites in their regulatory regions, such as CYCLIN D1 (8)as well as downstream inducible genes whose transcription isnot directly activated by h-catenin, such as h-TrCP (7).

The Wnt signaling pathway is also activated in hepatoblas-tomas, which are the most frequent malignant type ofpediatric liver tumors that occur with an incidence of 1.5cases per 1 million children (9). Activation of the Wntpathway in these malignancies is attributed to the oncogenicactivation of the h-catenin protein (by amino acid substitu-tions or interstitial deletions; refs. 10–13) as well as to theinactivating mutations of the Wnt negative regulators AXIN1and Conductin (AXIN2; refs. 14, 15). Dysregulation of Wntsignaling components in cancer typically results in expressionof target genes, which are well characterized in vitro and inanimal models.

Known Wnt target genes in cancer cells are oncogenesthat include c-MYC and CYCLIN D1 (8, 16) as well asConductin (AXIN2; refs. 17, 18), matrix metalloproteinase-7(MMP-7; ref. 19), FRA-1 , c-JUN , urokinase-type plasminogenactivator receptor (uPAR ; ref. 20), and immunoglobulin transcrip-tion factor-2 (ITF-2 ; ref. 21).

www.aacrjournals.org Clin Cancer Res 2005;11(12) June15, 20054295

Authors’ Affiliations: 1Department of Neuropathology, University of BonnMedical Center, Bonn, Germany; 2Department of Pathology, University of TexasSouthwestern Medical School, Dallas, Texas; 3Department of Animal Biology,School of Veterinary Medicine, University of Pennsylvania, Philadelphia; and4Department of Pediatric Surgery, Ludwig-Maximilians-University, Munich,GermanyReceived 6/15/04; revised1/2/05; accepted1/25/05.Grant support: Deutsche Forschungsgemeinschaft grant Pi191/9-2, MedicalFaculty of the University of Bonn (Bonfor), Bennigsen-Foerder-Foundation, andUniversity of Pennsylvania Cancer Center.The costs of publication of this article were defrayed in part by the payment of pagecharges.This article must therefore be hereby marked advertisement in accordancewith18 U.S.C. Section1734 solely to indicate this fact.Requests for reprints:TorstenPietsch,DepartmentofNeuropathology,UniversityofBonnMedicalCenter,SigmundFreudStreet25,D-53105Bonn,Germany.Phone:49-228-287-4398; Fax: 49-228-287-4331; E-mail: [email protected].

F2005 American Association for Cancer Research.

Human Cancer Biology

Research. on April 25, 2021. © 2005 American Association for Cancerclincancerres.aacrjournals.org Downloaded from

http://clincancerres.aacrjournals.org/

Most studies in which Wnt target genes have been identifiedand mRNA expression was analyzed were done on colorectaltumors and ovarian endometrioid adenocarcinomas. In thesehuman cancers, the expression of presumptive target geneswas documented and correlated with the mutational status ofb-catenin and the nuclear accumulation of h-catenin protein.For instance, in samples from 70 patients with colorectalcancers, a correlation between deregulated h-catenin andcyclin D1 expression was shown by immunohistochemicalanalyses (22). Furthermore, a correlation between b-cateninmutations and increased expression of MMP-7 and uPAR wasreported in colorectal tumors (23, 24). Zhai et al. analyzed theexpression of six putative Wnt target genes in a panel of 44primary ovarian endometrioid adenocarcinomas. Five genesrevealed altered expression in cases with b-catenin mutationsin contrast to the subset of tumors without mutations in theb-catenin gene (25). In hepatoblastomas, a correlationbetween b-catenin mutations and CYCLIN D1 expression butnot with c-MYC overexpression was found (26).

In contrast, very few studies have been carried out with othertumor types as hepatoblastomas. Moreover, the relationshipbetween gene expression in tumorous tissue and the respectivenormal tissue has not been documented in detail.

To find out whether the expression of known Wnt-induciblegenes is altered in hepatoblastomas, in which Wnt signaling isactivated, we investigated the expression of nine candidategenes in a panel of 23 hepatoblastoma cases for whichmatching normal liver tissue was available.

Materials andMethods

Patients, tumors, and cell lines. A total of 23 hepatoblastomabiopsies and 5 hepatoblastoma cell lines from sporadic hepatoblasto-mas were analyzed. Furthermore, we analyzed the cell line HepG2derived from a childhood hepatocellular carcinoma (27). The age ofpatients with hepatoblastomas varied between 4 months and 12 years(Table 1). As control tissues, matching normal liver of each patient andthree fetal livers (gestational age, 13.5-18 weeks) were available.Informed consent was given by the parents of all patients for theinvestigations and data analysis. The study was approved by the EthicsCommittee of the University of Bonn Medical Center (Bonn, Germany).Cell culture experiments were done with the hepatoblastoma cell linesHepT1 (28) and HUH6 (29) and the hepatocellular carcinoma cell lineHUH7 generously provided by Dr. Peter Schirmacher (Department ofPathology, University of Heidelberg, Heidelberg, Germany). Cells werecultured in RPMI 1640 (Life Technologies, Gaithersburg, MD), eachsupplemented with 10% fetal bovine serum.

RNA extraction and cDNA synthesis. Total cellular RNA was extractedby lysis in guanidinium isocyanate and ultracentrifugation through acesium chloride cushion or by Trizol reagent according to the protocolof the supplier (Life Technologies). To remove any contaminatinggenomic DNA, RNA was digested with 10 units RNase-free DNase I(Promega, Madison, WI) and 40 units RNasin (Promega) in a volume of30 AL before reverse transcription. The RNAs were reverse transcribedusing the SuperScript II Preamplification System (Life Technologies)with random hexamers as primers. Absence of contaminating genomicDNA was confirmed by amplification of a PCR fragment of the CDK4gene with primers spanning an intronic sequence. All individual tissuesamples selected for RNA extraction were preexamined by frozen sectionhistology to document the histopathologic appearance of the specimenand to exclude contaminating necrotic or normal tissue. Only fragmentswith a tumor cell content of at least 80% were used for RNA extraction.

b-catenin mutation analysis in hepatoblastoma samples. All hepato-

blastoma biopsies and all hepatoblastoma cell lines were examined for

point mutations and deletions in exon 3 of the b-catenin gene using

PCR/reverse transcription-PCR (RT-PCR) and single-strand conforma-

tional polymorphism analysis. The PCR conditions and primer

sequences for single-strand conformational polymorphism analysis

and the conditions for the detection of deletions are described

elsewhere (13).mRNA expression of Wnt-inducible genes in hepatoblastomas by

semiquantitative reverse transcription-PCR. To measure gene expres-sion levels, we first created exogenous RNA standards with internaldeletions of f20 bp for all nine Wnt-inducible genes and thehousekeeping gene b2-microglobulin by in vitro mutagenesis andin vitro transcription as described elsewhere (30, 31). Resulting cDNAtemplates (500 ng) were used for in vitro transcription (T7-polymerasekit, Fermentas, St. Leon-Rot, Germany). The resulting competitor RNAwas DNase digested as described above and purified (RNeasyQuickspin columns, Qiagen, Hilden, Germany) and the concentrationwas determined photometrically. To ensure coverage of the equimolarrange of the competitors and the corresponding RNA transcripts in thefinal assay, a titration experiment was done. Total RNA (250 ng) of apool from tumor and normal liver tissues was reverse transcribedtogether with defined amounts of exogenous standards (range, 5 �10�10 - 5 � 10�6 mg). Reverse transcription was done as describedabove. The primers used for RT-PCR, the PCR conditions, and thefragment sizes of all analyzed Wnt genes and the housekeeping geneb2-microglobulin are listed in Table 2. The reverse primer of each genewas fluorescently labeled with dye at the 5V position (FAM, JOE;MWG-Biotech, Ebersberg, Germany). Forward and reverse primers ofeach amplicon were chosen to span intronic sequences to excludesignals from contaminating genomic DNA. The resulting PCRproducts were separated on 4.5% denaturating acrylamide gels on aDNA sequencer (ABI377). The results were analyzed with theGenescan software (ABI, Darmstadt, Germany). Optimal titrationwas defined as the point of equal signal intensity of exogenouscompetitor and target transcript.

After determination of the optimal titration point of each exogenousstandard found in the titration experiment, total RNA (250 ng) fromeach tumor and normal liver tissue were reverse transcribed togetherwith the respective amount of each exogenous standard using the sameprocedure as described above. The objective was to ensure optimalcoverage of even higher differences of expression level. The sameprimers and PCR conditions were used as described for the titrationexperiment. All PCRs were done thrice to increase the validity. The ratioof target PCR product intensity and standard intensity was used todetermine the levels of gene expression. RNA expression levels werecalculated by the following algorithm: TARGETsample/TARGETstandard /b2-microglobulin sample/b2-microglobulin standard. The optimal titrationfor the genes in most of the samples was found for the followingcompetitor amounts: 50 pg for b2-microglobulin ; 500 fg for c-MYC ,FRA-1 , ITF-2 , c-JUN , MMP-7 , human naked cuticle (NKD-1), anduPAR ; and 100 fg for CYCLIN D1 and b-TRCP .

Luciferase reporter assay. HepT1, HUH6, and HUH7 cells weregrown in 12-well plates in a volume of 1 mL. To avoid any effectsfrom external factors, such as insulin, hepatoblastoma/hepatocellularcarcinoma cell lines were washed with PBS and then transferred fromtheir usual culture conditions to serum-free Neurobasal medium(Invitrogen, Karlsruhe, Germany) before transfection at an initialconfluence of 50% to 60%. Cells were cotransfected with plasmids bylipofection (FuGene6, Roche, Mannheim, Germany). The followingexpression constructs were used: TOP-FLASH (0.5 Ag, containing threeTcf consensus-binding sites upstream of firefly luciferase cDNA) orFOP-FLASH (0.5 Ag, a plasmid with mutated Tcf-binding sites)reporters (Upstate, Hamburg, Germany), pcDNA-mNkd-1 (0.5 Ag)expression construct, and NH2-terminally deleted b-catenin expressionplasmid (0.5 Ag; a kind gift from Dr. Walter Birchmeier, Max-Delbruck-Center for Molecular Medicine, Berlin, Germany). TheRenilla SV40 construct (0.01 Ag) was used as an internal controlfor transfection efficiency. The overall amount of DNA in transfection

www.aacrjournals.orgClin Cancer Res 2005;11(12) June15, 2005 4296




mixtures was kept constant by addition of pcDNA3.1 (0.5 Ag).Twenty-four hours after transfection, individual assays were costimu-lated with Wnt-3a (100 ng, R&D Systems, Wiesbaden, Germany) foranother 24 hours. Individual assays were done in triplicates, andthe luciferase/Renilla activity was measured using Dual-LuciferaseReporter Assay System (Promega) 48 hours following the transienttransfection.

Immunohistochemistry. To determine whether the levels of transcriptsof Wnt-regulated genes are associated with the nuclear accumulation ofh-catenin protein, we did immunohistochemical staining of hepato-blastoma tissues. Sections of paraffin-embedded hepatoblastomabiopsies were available in 19 cases. The sections were stained with themonoclonal anti-h-catenin antibody clone 14 (IgG1, 0.25 Ag/mL in PBS,0.1% bovine serum albumin, Transduction Laboratories, Lexington, KY).


Table 1. Clinical data, histology, and status of b-catenin mutations and nuclear accumulation of B-catenin proteinin 23 hepatoblastomas, 5 hepatoblastoma cell lines, and 1 cell line derived from a hepatocellular carcinoma

Age (mo)/sex

Specimen Chemotherapy Histology B-Cateninmutation Nuclear B-cateninaccumulation

Tumor sampleD269 9/F Primary tumor No Mixed D76 amino acids,

exon 3Yes

D272 12/M Primary tumor No Mixed D46 amino acids,exon 3

Yes

D266 8/F Primary tumor No Mixed D76 amino acids,exon 3

Yes

D263 12/M Primary tumor No Epithelial No YesD166 48/M Recurrent tumor Yes Epithelial No YesD162 19/M Recurrent tumor Yes Epithelial,

multifocalGly34Val Yes

DZ23II 22/M Primary tumor No Epithelial No NAD195 19/M Recurrent tumor No Epithelial No YesD197 54/M Recurrent tumor Yes Epithelial D76 amino acids,

exon 3Yes

D104 27/F Primary tumor No Epithelial Thr41Ala YesD107 6/M Primary tumor No Epithelial No YesD377 20/M Primary tumor No Mixed No YesM12 13/M Primary tumor No Epithelial No NAM14 20/M Recurrent tumor Yes Epithelial No NAM16 36/M Primary tumor No Epithelial Ser37Cys YesD401 9/F Primary tumor Yes Mixed Thr41Ala YesD675 12*/F ND No Epithelial Ser45Phe YesD700 20/F Primary tumor Yes Epithelial D76 amino acids,

exon 3Yes

D717 11/F Primary tumor Yes Epithelial D76 amino acids,exon 3

Yes

D840 14/M Primary tumor Yes Mixed No YesDZ29II 13/M Primary tumor No Epithelial No NAD697 36/M Recurrent tumor Yes Epithelial D76 amino acids,

exon 3Yes

D399II 10/M Primary tumor No Epithelial D76 amino acids,exon 3

Yes

Cell linesHepT8 Cell line No NAHepT4 Cell line No NAHepT5 Cell line of D717 D76 amino acids,

exon 3Yes

HepT1 Cell line D76 amino acids,exon 3

Yes

HepG2 Hepatocellularcarcinoma cell line

D116 amino acids,exon 3/4

Yes

HepT2 Cell line of D166 No Yes

Abbreviations: ND, no data; NA, not analyzed.*In years.

Wnt Antagonists and Hepatoblastomas



Binding of the primary antibody was detected by avidin-biotin complexmethod (DAKO, Copenhagen, Denmark) and visualized by diamino-benzidine tetrahydrochloride. The exact protocol for the h-cateninimmunostaining has been described in a previous work (13).

To determine the patterns of subcellular localization of h-TrCP,sections were incubated with an antibody against h-TrCP (in PBS,2 Ag/mL). h-TrCP was detected using avidin-biotin complex methodin microwaved tissue sections as described (13). Normal liverparenchyma adjacent to the tumor was available as an internal positivecontrol in five cases.

Statistical analysis. After quantification of the signals by semiquan-titative RT-PCR and normalization of the values to b2-microglobulinlevels, the expression of each Wnt-inducible gene in hepatoblastomasamples was compared with the expression in the correspondingnormal liver tissue. Student’s t test was used to determine thesignificance of difference in the expression levels (ratio hepatoblas-toma/liver tissue) of each Wnt gene in hepatoblastomas with andwithout b-catenin mutations.

Results

b-catenin mutations in hepatoblastoma samples. All hepato-blastoma biopsies and cell lines used for expression analysiswere examined for b-catenin exon 3 mutations by single-strandconformational polymorphism analysis. For the detection oflarger deletions, we analyzed a region spanning exon 2 to exon4 of the b-catenin gene by PCR/RT-PCR. Five of 23 hepato-blastoma cases harbored somatic point mutations (Table 1).Large deletions which lead to exon 3 deletion were identified ineight hepatoblastoma cases and in two of five hepatoblastomatumor cell lines (Table 1).

mRNA expression analysis. mRNA expression of ninecandidate Wnt-inducible genes in 23 hepatoblastoma biopsiesand their corresponding liver tissues are shown in Table 3. Inhepatoblastomas, expression levels were calculated as ratios of

the expression in the tumor normalized to the expression in therespective liver tissue. An expression level of >200% was scoredas overexpressed, 50% to 200% as no difference, and <50% asrepressed.

CYCLIN D1, c-MYC, MMP-7 , FRA-1 , uPAR , c-JUN , and ITF-2showed no statistically significant differences in the expressionlevels of the tumors compared with the corresponding livertissues in our set of 23 hepatoblastomas (t test). Furthermore,t tests did not show a significant correlation of the b-cateninmutational status and the expression of the CYCLIN D1,c-MYC , MMP-7 , FRA-1 , uPAR , c-JUN , and ITF-2 genes(Table 3). There was no statistical difference (t test) in theexpression of the cell lines compared with fetal and adult livertissue (data not shown).

For instance, CYCLIN D1 transcripts were expressed at higherlevels in tumors from 12 of the 23 patients compared with theirnormal corresponding liver tissue. The increase in the level ofmRNA transcript (as ratio tumor/liver) ranged from 3.23 to137.49 (mean, 23.96). Three cases showed no difference in theexpression and eight cases showed reduced levels in the tumorcompared with liver ranging from 0.03 to 0.34 (Table 3).There was no statistically significant correlation between theexpression levels of CYCLIN D1 and the presence of activatingb-catenin mutations (P = 0.41, t test).

mRNA expression of NKD-1. All hepatoblastomas showed asignificant up-regulation of NKD-1 mRNA compared withadjacent normal liver tissues. The tumor to normal tissue mRNAratio ranged from 6.63 to 517.73 (mean, 179.32; Table 3;Fig. 1A). Neither a correlation between the expression levelsof NKD-1 and the presence of activating b-catenin mutations(P = 0.95, t test) nor a correlation between NKD-1 expressionand tumor histology could be found (Fig. 2). All cell linesrevealed increased NKD-1 expression (range, 3.64-107.96;


Table 2. Primer sequences, fragment sizes, and PCRconditions for mRNA expression analysis

Primer designation Sequence (5V-3V) Fragment size (bp) Annealing temperature (jC)/MgCl2 concentration(mmol/L)

FRA-1-forward GCATCAACACCATGAGTGGC 278 61/2.0FRA-1-reverse GAAGTCGGTCAGTTCCTTCCb2-microglobulin-forward TGTCTTTCAGCAAGGACTGG 148 57/1.5b2-microglobulin-reverse GATGCTGCTTACATGTCTCGuPAR-forward TAACTCCAACACGCAAGGGG 162 54/1.5uPAR-reverse GATGGTCTGTATAGTCCGGGhNKD-forward GCAGCTGAAGTTTGAAGAGC 340 56/2.0hNKD-reverse ATCTACGCAATGGTGGTAGCb-TRCP-forward ACTGCCGAAGTGAAACAAGC 168 54/2.0b-TRCP-reverse CATCATACTGGAGACAGAGGc-MYC-forward TGAAAGGCTCTCCTTGCAGC 175 58/1.0c-MYC-reverse GCTGGTAGAAGTTCTCCTCCCYCLIND1-forward ATGTGTGCAGAAGGAGGTCC 199 61/1.5CYCLIND1-reverse CTTAGAGGCCACGAACATGCITF2-forward TCCACCTCAAGAGTGACAAG 147 56/2.0ITF2-reverse ACACCTTCTCTTCCTCCCTTCc-JUN-forward AACCTCAGCAACTTCAACCC 306 56/1.0c-JUN-reverse CTTCCTTTTTCGGCACTTGGMMP-7-forward AGATCCCCCTGCATTTCAGG 163 61/2.0MMP-7-reverse TCGAAGTGAGCATCTCCTCC





Table 3. Results of themRNA expression analysis of theWnt genes in 23 hepatoblastomas

Gene b-catenin mutations (13 hepatoblastoma cases) No b-catenin mutations (10 hepatoblastoma cases)

Ratiohepatoblastoma/liver >200%

Ratiohepatoblastoma/liver 50-200%

Ratiohepatoblastoma/liver <50%

Ratiohepatoblastoma/liver >200%

Ratiohepatoblastoma/liver 50-200%

Ratiohepatoblastoma/liver <50%

CYCLIND1 6 3 4 6 0 4FRA-1 4 4 5 5 2 3ITF-2 1 9 3 3 5 2c-JUN 2 6 5 3 4 3MMP-7 7 4 2 7 2 1c-MYC 7 5 1 2 7 1NKD-1 13 0 0 10 0 0b-TRCP 13 0 0 9 1 0uPAR 8 4 1 2 7 1

NOTE:The mRNA levels were determined by competitive RT-PCR.The factors are calculated as ratios of mRNA expression in tumor versus expression in the adjacentnormal liver tissue. Expression level >200%was defined as overexpressed, 50% to 200% as no difference, and <50% as repressed.The significance of the expression incases with and without b-catenin mutations was determined with the t test.

Fig.1. Results of the mRNA expression analysis of NKD-1 (A) and b-TRCP (C) in 23 hepatoblastomas. The expression levels were determined by competitive RT-PCR.Ratio of mRNA expression in tumor versus mRNA expression of the adjacent normal tissue. Student’s t test was used to determine the significance of differences inNKD-1 and b-TRCP expression in hepatoblastomas with and without b-catenin mutations. NKD-1 (B) and b-TRCP (D) mRNA levels in human hepatoblastoma cell lines,a hepatocellular carcinoma cell line (HepG2), and fetal liver tissue. mRNA expression was normalized to b2-microglobulin. Expression levels were compared with themean values of the liver tissue.




mean, 39.87 (ratio NKD-1/b2-microglobulin) compared with theaverage NKD-1 expression level in the normal liver tissue (mean,0.11; Fig. 1B). In addition, the cell line HepG2, which wasderived from a pediatric hepatocellular carcinoma biopsy, alsorevealed high NKD-1 mRNA levels. There was no difference inNKD-1 mRNA levels between fetal and adult liver tissues.

mRNA expression of b-TRCP. Determination of the b-TRCPmRNA levels by competitive RT-PCR revealed that all hepato-blastomas displayed transcript levels higher than thecorresponding normal liver tissue. mRNA expression levelsranged from 1.36 to 48.58 (mean, 9.33; Table 3; Fig. 1C).Expression differences for b-TRCP between tumors withb-catenin mutations and tumors without b-catenin mutationswere not apparent (P = 0.40, t test). The five hepatoblastomacell lines and the hepatocellular carcinoma cell line HepG2showed an increased expression of b-TRCP (range, 1.36-75.59;mean, 24.55) compared with the average expression level in thenormal liver tissue (mean, 0.17; Fig. 1D). There was no

significant difference in b-TRCP expression between fetal andadult liver tissues.b-catenin immunostaining. Immunostaining with antibod-

ies against h-catenin showed a nuclear accumulation of h-catenin protein in all of the 19 analyzed cases (Fig. 2A and C).b-TrCP immunostaining. Hepatoblastomas were next eval-

uated for expression and localization of h-TrCP protein byimmunohistochemistry. Consistent with the mRNA data, thenormal liver parenchyma showed weak cytoplasmic staining ofh-TrCP (Fig. 3B). In contrast, hepatoblastomas show aconstitutively cytoplasmic distribution of h-TrCP (Fig. 3A). Inagreement with other studies, nuclear accumulation of h-TrCPprotein was also observed in cases with nuclear accumulationof h-catenin protein (32).

Nkd-1 antagonizes Wnt signaling in liver tumor cells. Therole of Nkd-1 in the Wnt signaling pathway in humanhepatoblastoma and hepatocellular carcinoma cell lineswas tested by using a Wnt-3a ligand-responsive TOP-FLASH/


Fig. 2. A, immunohistochemical staining of h-catenin protein in the hepatoblastoma sample D272 with a b-catenin mutation.The nuclei were strongly positive for h-catenin.The cytoplasm of the tumor cells was also strongly stained.B, result of a competitive RT-PCR forNKD-1 in the tumor (D272) and the corresponding liver tissue (D270). Equalamounts of competitor RNAwere present in the tumor and the liver sample.C, immunohistochemical staining of h-catenin protein in a hepatoblastoma sample (D166) withoutb-catenin mutation.Tumor tissue with normal liver was shown. In the liver, h-catenin immunoreactivity is restricted to the cytoplasm and weakly stained (left). Although thiscase does not carry a b-catenin mutation, nuclei and cytoplasm are strongly positive for h-catenin in the hepatoblastoma cells (right).D, expressionofNKD-1mRNA transcriptin the hepatoblastoma D166 and the adjacent liver tissue (D167). Equal amounts of competitor RNAwere present in tumor and matching normal liver tissue.




FOP-FLASH luciferase reporter assay. First, cell line HUH7,derived from a human hepatocellular carcinoma and known toexhibit low levels of h-catenin and harbor no known mutationsin any of the genes encoding for components of the multi-protein complex, was stimulated with Wnt-3a. This results in a2.5-fold increase in the TOP-FLASH luciferase activity (Fig. 4A).Activation of the TOP-FLASH reporter by Wnt-3a was com-pletely inhibited by coexpression of Nkd-1. Expression of Nkd-1 in the absence of Wnt-3a down-regulates the TOP-FLASHluciferase activity (factor, 0.66; Fig. 4A). Moreover, Nkd-1 failedto inhibit the gene response by overexpression of NH2-terminally deleted h-catenin.

No inhibitory effect of Nkd-1 in hepatoblastoma cell lines withb-catenin mutations. Next, we transfected the hepatoblas-toma cell lines HepT1 and HUH6. Both cell lines carryactivating mutations of the b-catenin gene, which wasreflected in a marked TOP-FLASH luciferase activity. Cotrans-fection with Nkd-1 had no effect on the activity of theluciferase reporter in any of the cell lines (Fig. 4B). Thesedata suggest that Nkd-1 is not able to antagonize the Wntsignal in tumors in which the Wnt signaling pathway isactivated by mutations in b-catenin.

Discussion

Several components of the Wnt signaling pathway arealtered in a variety of human cancers. Mutational defects result

in nuclear accumulation of h-catenin protein and increasedexpression of specific Wnt target genes that play key roles inproliferation and survival of cancer cells. In particular, theexpression of Wnt target genes has been well characterized incolon cancers and ovarian endometrioid adenocarcinomas.Because it is known that the Wnt signaling pathway is involvedin the pathogenesis of sporadic hepatoblastomas by oncogenicactivation of the h-catenin protein by amino acid substitutionsand interstitial deletions in high frequency (10, 11, 13), wefirst investigated whether the expression of known Wnt-inducible genes is dependent on the mutational status of


Fig. 3. A, immunohistochemical staining of h-TrCP protein in the hepatoblastomaD840. This tumor does not carry a b-catenin mutation. B, immunostainingshowing constitutive cytoplasmic and nuclear expression of b-TrCP protein incontrast to a weak b-TrCP expression in the corresponding liver tissue from thesame section.

Fig. 4. A, Nkd-1 inhibits the Wnt signaling pathway in liver tumor cells withoutb-catenin mutations. HUH7 cells were transfected with expression constructsTOP-FLASH (0.5 Ag), pcDNA-mNkd-1 (0.5 Ag), NH2-terminally deletedh-catenin (0.5 Ag), and pRL-SV40 (0.01 Ag). Twenty-four hours after transfection,individual assays were costimulated with Wnt-3a (100 ng). TOP-FLASHluciferase reporter assays were determined. B, no inhibitory effect of Nkd-1 inhepatoblastoma cells with b-catenin mutations. HepT1 and HUH6 carryactivating mutations of the b-catenin gene, which was reflected in a markedTOP-FLASH activity in comparison with the FOP-FLASH (0.5 Ag) luciferasereporter. Cotransfection with Nkd-1 had no effect on the activity ofthe luciferase reporter.




b-catenin. Expression analysis was done in 23 hepatoblastomasand their matching normal liver tissue as well as in 3 fetal liversamples and 6 cell lines.

We show here that mRNA transcripts of all nine analyzedWnt genes were detectable in all samples examined. However,in contrast to colon carcinomas and ovarian endometrioidadenocarcinomas, the expression of c-JUN , c-MYC, FRA-1 , ITF-2 , MMP-7 , uPAR , and CYCLIN D1 revealed no statisticalsignificant differences between hepatoblastomas with andwithout b-catenin mutations (Table 3). Moreover, in eachgroup (with/without b-catenin mutations) of our hepatoblas-toma series, we compared gene expression of the tumor withnormal liver tissue. No statistically significant correlation wasobserved (Table 3; Fig. 1A and C).

In particular, CYCLIN D1 was one of the first genes to beimplicated as a Wnt-regulated target gene in hepatoblastomas(26). Our competitive RT-PCR assay revealed increasedexpression of CYCLIN D1 in 12 hepatoblastomas and areduced expression in 8 of the 23 cases compared withcorresponding liver tissue, whereas 3 cases showed nodifference (Table 3). A significant correlation between theexpression levels of CYCLIN D1 mRNA and the presence orabsence of activating b-catenin mutations in hepatoblastomascould not be shown. Previous studies of the cyclin D1expression in hepatoblastomas have yielded different results.Kim et al. (33) showed by immunohistochemistry in 17paraffin-embedded hepatoblastoma tissues that 11 casesshowed overexpression of cyclin D1, whereas Iolascon et al.(34) showed that CYCLIN D1 mRNA expression is reduced inhepatoblastomas compared with normal liver tissue.

Overall, the finding that CYCLIN D1 is heterogeneouslyexpressed in hepatoblastomas is not a surprising result, asCYCLIN D1 expression is likely to be regulated by multipledifferent signaling pathways. For that matter, the above-listedgenes were described as Wnt targets in different cancers.However, our results show a lack of association between anactivated Wnt signaling pathway and expression of c-JUN, c-MYC , FRA-1 , ITF-2 , MMP-7 , uPAR , and CYCLIN D1 inhepatoblastomas. These results are in line with the findings ofother groups. For example, although a high degree of correlationbetween nuclear h-catenin accumulation and overexpression ofc-myc protein was seen in colon tumors (35), similar studies inhepatoblastomas and breast cancers found no such correlation(26, 36). A possible explanation for the absence of a strictcorrelation between b-catenin mutations and gene expression isthat h-catenin-binding proteins, such as Chibby or ICAT, mightmodulate h-catenin function and its ability to activate T-cellfactor–regulated transcription (37, 38). A further explanationfor the striking variation in the expression of the above-described Wnt target genes is that expression of these genes iscontrolled by other signaling pathways.

Interestingly, the Wnt-inducible genes b-TRCP and NKD-1were found to be overexpressed in all analyzed hepatoblastomasamples in comparison with the respective tumor normal livertissue. A comparison between cases with and withoutoncogenic b-catenin mutations revealed no significant differ-ence in the expression level (Table 3; Fig. 1A and C). Moreover,our analysis revealed a higher expression of b-TRCP and NKD-1 mRNA in all hepatoblastoma and hepatocellular carcinomacell lines compared with normal liver tissue (Table 3; Fig. 1Band D).

These findings prompted us to analyze the status of theh-catenin protein in the cases used for expression analysis. Of the23 hepatoblastoma biopsies, paraffin-embedded material wasavailable in 19 cases. All 19 hepatoblastomas showed a nuclearaccumulation of h-catenin protein, support of activation of theWnt signaling pathway regardless to the presence of b-cateninmutations.

It is important to note that h-TrCP and Nkd-1 encode forknown inhibitors of the Wnt signaling pathway. h-TrCP is acomponent of the ubiquitin ligase complex targeting h-cateninfor proteasomal degradation and is thus a negative regulatorof Wnt signaling. Activation of the Wnt signaling pathwayby Wnt-1 or overexpression of a stabilized h-catenin mutantin human embryo kidney 293T cells resulted in an increase ofb-TRCP mRNA (7), indicating an induction of h-TrCP by theWnt signaling pathway.

Apart from the induction of b-TRCP mRNA by theactivated Wnt signaling pathway in hepatoblastomas, wefound that in hepatoblastomas increased levels of h-TrCPprotein were associated with nuclear accumulation ofh-catenin (Fig. 3A). Immunohistochemistry showed thath-TrCP protein was accumulated in both the cytoplasm and thenucleus of hepatoblastomas cells as in their respective normalliver cells, which only showed a weak h-TrCP expression(Fig. 3B). These results agree with the studies of Ougolkov et al.in which increased levels of h-TrCP protein were found incolorectal cancers compared with colorectal crypt epithelialcells (32).

The gene encoding NKD-1 has been identified as afurther antagonist of the Wnt signaling pathway. Actingupstream of h-catenin, Nkd-1 targets dishevelled to antagonizeWnt signal transduction (39, 40), and a putative calcium-binding (EF hand) motif is required for the inhibitory function(41). Yan et al. (41) showed that Nkd-1 inhibits the Wnt-1activated lymphoid enhancer factor-1 luciferase reporter inhuman embryo kidney 293 cells. Moreover, mRNA expressionof NKD-1 was shown to be increased in colon cancer cell lineswith oncogenic b-catenin mutations (41). Having found NKD-1being overexpressed in comparison with the matching normalliver tissue in all hepatoblastoma samples analyzed (Table 3;Fig. 1), we wanted to know to which extent Nkd-1 has thepossibility to antagonize Wnt signaling in liver tumor cells withand without b-catenin mutations.

The role of Nkd-1 in the Wnt pathway was first tested in thehuman liver tumor cell line HUH7 (no b-catenin mutation/noh-catenin accumulation) by using a Wnt-3a ligand-responsiveluciferase reporter assay. Activation of the TOP-FLASH reporterby Wnt-3a was completely inhibited by coexpression of Nkd-1.Coexpression of Nkd-1 with mutated Dh-catenin had noinhibitory effect on the activity of the reporter in HUH7 cells(Fig. 4A). The same luciferase reporter assays were done in thehepatoblastoma cell lines HepT1 and HUH6, which carrymutations in the b-catenin gene. Here, overexpression of Nkd-1had no antagonistic effect on the activity of the reporter(Fig. 4B). These results are in line with observations of othergroups who showed that Nkd-1 performs its inhibitory actionupstream of h-catenin and thus is not capable of decreasing theWnt signaling in the cells that have already accumulated h-catenin. It allows to assume that, most likely, alterations inthe Wnt pathway downstream of Nkd-1 cause nuclearaccumulation of h-catenin protein in hepatoblastomas





without b-catenin mutations or that other signaling pathwaysaffect Tcf transcription downstream of Nkd-1.

It is important to note that although b-TRCP and NKD-1 areoverexpressed in all hepatoblastomas compared with thenormal liver tissue, there is a variation in the up-regulationof these genes in hepatoblastomas. As above mentioned, apossible explanation for this finding is that signaling pathwaysother than Wnt could contribute to induction of b-TRCP andNKD-1 expression. For example, the phosphatidylinositol3-kinase/Akt pathway modulates h-catenin/T-cell factor–mediated gene transcription through inactivation of GSK3hand nuclear accumulation of h-catenin in prostate cancer cells(42). In addition, the above-described h-catenin-bindingproteins Chibby and ICAT could contribute to the variationin the levels of b-TRCP and NKD-1 mRNA expression.Nevertheless, up-regulation of b-TRCP and NKD-1 mRNAtranscripts are detectable in all analyzed hepatoblastomabiopsies in contrast to the other Wnt target genes in whichno significant overexpression could be found. Interestingly h-TrCP and Nkd-1 encode for known antagonists of the Wntpathway.

Very recently, two other antagonists of the Wnt signalingpathway, Dkk-1 and Conductin (AXIN2), have been identifiedto be significantly overexpressed in hepatoblastomas. DKK-1, a

direct target gene of Wnt signaling (43, 44), antagonizes Wnt byblocking the LRP6-Frizzled complex (45, 46). We identifiedDKK-1 as a differentially expressed gene in hepatoblastomasusing the subtractive suppression hybridization method.Therein, we showed that >80% of the analyzed hepatoblasto-mas showed overexpression of the DKK-1 gene (47), suggestingthe existence of a novel but apparently nonfunctional Wntfeedback loop in hepatoblastomas (Fig. 5).

The findings of Lustig et al. (17) indicate that the Wntantagonist Conductin (AXIN2) as a direct target gene of the Wntsignaling pathway constitute an essential compound of anegative feedback mechanism of Wnt signaling. We examinedthe AXIN2 expression levels in our set of hepatoblastomabiopsies and in the corresponding liver samples usingcompetitive RT-PCR and Western blot. Interestingly, hepato-blastomas showed AXIN2 overexpression in comparison withthe liver tissue (15).

These findings support the view that increased expressionof Wnt-inducible genes, such as AXIN2, DKK-1, NKD-1, andb-TRCP , which act as inhibitors of the Wnt pathway, is acommon event in hepatoblastomas. This indicates thatactivation of the Wnt pathway is present in most hepato-blastoma tissues. The biological capability of these antago-nists to inhibit Wnt signaling through a negative feedback


Fig. 5. Mutations in components of the Wnt multiprotein complex (gray symbols) result in h-catenin stabilization and elevation of expression of specific Wnt-induciblegenes (Conductin, DKK-1, NKD-1, and b-TRCP), which function as inhibitors of the Wnt pathway itself. The resulting negative feedback is not functional inhepatoblastomas because of the mutations in the multiprotein complex.




loop seems to be abrogated in hepatoblastomas, mostlikely because genetic alterations disrupt the central multi-protein complex that controls the stability of h-catenin(Fig. 5).

Because the strong expression of Wnt antagonists is acommon theme in hepatoblastomas, we propose that Axin2,Dkk-1, h-TrCP, and Nkd-1 may be used as biological anddiagnostic markers for these embryonic liver malignancies.


References1. Miller JR, Hocking AM, Brown JD, Moon RT.Mechanism and function of signal transduction by theWnt/h-catenin andWnt/Ca2+ pathways. Oncogene1999;18:7860^72.

2. Papkoff J, Rubinfeld B, Schryver B, Polakis P.Wnt-1regulates free pools of catenins and stabilizes APC-catenin complexes. Mol Cell Biol1996;16:2128^34.

3. Aberle H, Bauer A, Stappert J, Kispert A, Kemler R.h-Catenin is a target for the ubiquitin-proteasomepathway. EMBO J 1997;16:3797^804.

4. Hart MJ, de los Santos R, Albert IN, Rubinfeld B,Polakis P. Downregulation of h-catenin by humanAxin and its association with the APC tumor sup-pressor, h-catenin and GSK3h. Curr Biol 1998;8:573^81.

5. Behrens J, Jerchow BA, Wurtele M, et al. Func-tional interaction of an axin homolog, conductin,with h-catenin, APC, and GSK3h. Science 1998;280:596^9.

6. Orford K, Crockett C, Jensen JP, Weissman AM,Byers SW. Serine phosphorylation-regulated ubiquiti-nation and degradation of h-catenin. J Biol Chem1997;272:24735^8.

7. Spiegelman VS, SlagaTJ, Pagano M, Minamoto T,Ronai Z, Fuchs SY.Wnt/h-catenin signaling inducesthe expression and activity of hTrCP ubiquitin ligasereceptor. Mol Cell 2000;5:877^82.

8. Shtutman M, Zhurinsky J, Simcha I, et al. The cyclinD1gene is a target of the h-catenin/LEF-1pathway.Proc Natl Acad Sci USA1999;96:5522^7.

9. Mann JR, Kasthuri N, Raafat F, et al. Malignanthepatic tumours in children: incidence, clinical featuresand aetiology. Paediatr Perinat Epidemiol 1990;4:276^89.

10.WeiY, FabreM, Branchereau S, Gauthier F, PerilongoG, Buendia MA. Activation of h-catenin in epithelialandmesenchymalhepatoblastomas.Oncogene 2000;19:498^504.

11. Blaker H, HofmannWJ, Rieker RJ, Penzel R, Graf M,Otto HF. h-Catenin accumulation and mutation of theCTNNB1gene in hepatoblastoma. Genes Chromo-somes Cancer1999;25:399^402.

12. UdatsuY, KusafukaT, Kuroda S, Miao J, Okada A.High frequency of h-catenin mutations in hepatoblas-toma. Pediatr Surg Int 2001;17:508^12.

13. Koch A, Denkhaus D, Albrecht S, Leuschner I,von Schweinitz D, PietschT. Childhood hepato-blastomas frequently carry a mutated degradationtargeting box of the h-catenin gene. Cancer Res1999;59:269^73.

14.Taniguchi K, Roberts LR, Aderca IN, et al. Mutationalspectrum of h-catenin, AXIN1, and AXIN2 in hepato-cellular carcinomas and hepatoblastomas. Oncogene2002;21:4863^71.

15. Koch A,Weber N,Waha A, et al. Mutations andelevated transcriptional activity of conductin (AXIN2)in hepatoblastomas. JPathol 2004;204:546^54.

16. He TC, Sparks AB, Rago C, et al. Identification ofc-MYC as a target of the APC pathway. Science1998;281:1509^12.

17. Lustig B, Jerchow B, Sachs M, et al. Negative feed-

back loop of Wnt signaling through upregulationof conductin/axin2 in colorectal and liver tumors.Mol Cell Biol 2002;22:1184^93.

18. Jho EH, Zhang T, Domon C, Joo CK, Freund JN,Costantini F. Wnt/h-catenin/Tcf signaling inducesthe transcription of Axin2, a negative regulator ofthe signaling pathway. Mol Cell Biol 2002;22:1172^83.

19. Crawford HC, Fingleton BM, Rudolph-Owen LA,et al. The metalloproteinase matrilysin is a target ofh-catenin transactivation in intestinal tumors. On-cogene 1999;18:2883^91.

20.Mann B, Gelos M, SiedowA, et al. Target genes ofh-catenin-T cell-factor/lymphoid-enhancer-factorsignaling in human colorectal carcinomas. Proc NatlAcad Sci U S A 1999;96:1603^8.

21. Kolligs FT, Nieman MT, Winer I, et al. ITF-2,a downstream target of the Wnt/TCF pathway, isactivated in human cancers with h-catenin defectsand promotes neoplastic transformation. Cancer Cell2002;1:145^55.

22. UtsunomiyaT, DokiY,Takemoto H, et al. Correlationofh-catenin and cyclinD1expression in coloncancers.Oncology 2001;61:226^33.

23. Brabletz T, Jung A, Dag S, Hlubek F, Kirchner T.h-Catenin regulates the expression of the matrixmetalloproteinase-7 in human colorectal cancer. AmJ Pathol 1999;155:1033^8.

24. Hiendlmeyer E, Regus S, Wassermann S, et al.h-Catenin up-regulates the expression of the uroki-nase plasminogen activator in human colorectaltumors. Cancer Res 2004;64:1209^14.

25. Zhai Y,WuR, Schwartz DR, et al. Role ofh-catenin/T-cell factor-regulated genes in ovarian endome-trioid adenocarcinomas. Am J Pathol 2002;160:1229^38.

26. Takayasu H, Horie H, Hiyama E, et al. Frequentdeletions and mutations of the h-catenin gene areassociated with overexpression of cyclin D1 andfibronectin and poorly differentiated histology inchildhood hepatoblastoma. Clin Cancer Res 2001;7:901^8.

27. Aden DP, Fogel A, Plotkin S, Damjanov I,Knowles BB. Controlled synthesis of HBsAg in adifferentiated human liver carcinoma-derived cellline. Nature1979;282:615^6.

28. Pietsch T, Fonatsch C, Albrecht S, Maschek H,Wolf HK, von Schweinitz D. Characterization of thecontinuous cell line HepT1 derived from a humanhepatoblastoma. Lab Invest1996;74:809^18.

29. Doi I. Establishment of a cell line and its clonalsublines from a patient with hepatoblastoma. Gann1976;67:1^10.

30.Waha A, Watzka M, Koch A, et al. A rapid andsensitive protocol for competitive reverse transcriptase(cRT) PCR analysis of cellular genes. Brain Pathol1998;8:13^8.

31. Hartmann W, Waha A, Koch A, et al. Promoter-specific transcription of the IGF2 gene: a novel rapid,non-radioactive and highly sensitive protocol formRNA analysis.Virchows Arch 2001;439:803^7.

32. OugolkovA, Zhang B,Yamashita K, et al. Associa-tions among h-TrCP, an E3 ubiquitin ligase receptor,h-catenin, and NF-nB in colorectal cancer. J NatlCancer Inst 2004;96:1161^70.

33. Kim H, Ham EK, Kim YI, et al. Overexpressionof cyclin D1and cdk4 in tumorigenesis of sporadichepatoblastomas. Cancer Lett1998;131:177^83.

34. Iolascon A, Giordani L, Moretti A, Basso G,Borriello A, Della Ragione F. Analysis of CDKN2A,CDKN2B, CDKN2C, and cyclin Ds gene status inhepatoblastoma. Hepatology1998;27:989^95.

35. BrabletzT, Herrmann K, Jung A, Faller G, Kirchner T.Expression of nuclear h-catenin and c-myc iscorrelated with tumor size but not with proliferativeactivity of colorectal adenomas. Am J Pathol 2000;156:865^70.

36. Jonsson M, Borg A, Nilbert M, Andersson T.Involvement of adenomatous polyposis coli (APC)/h-catenin signalling in human breast cancer. Eur JCancer 2000;36:242^8.

37.Takemaru K,Yamaguchi S, LeeYS, ZhangY, CarthewRW,MoonRT. Chibby, a nuclear h-catenin-associatedantagonist of the Wnt/Wingless pathway. Nature2003;422:905^9.

38. Tago K, NakamuraT, Nishita M, et al. Inhibition ofWnt signaling by ICAT, a novel h-catenin-interactingprotein. Genes Dev 2000;14:1741^9.

39. Rousset R, Mack JA,Wharton KA Jr, et al. Nakedcuticle targets dishevelled to antagonizeWnt signaltransduction. Genes Dev 2001;15:658^71.

40. Wharton KA Jr, Zimmermann G, Rousset R,Scott MP.Vertebrate proteins related to DrosophilaNaked Cuticle bind Dishevelled and antagonizeWntsignaling. Dev Biol 2001;234:93^106.

41.YanD,WallingfordJB, SunTQ, et al. Cell autonomousregulation of multiple Dishevelled-dependentpathways by mammalian Nkd. Proc Natl Acad SciUS A 2001;98:3802^7.

42. Sharma M, Chuang WW, Sun Z. Phosphatidyli-nositol 3-kinase/Akt stimulates androgen pathwaythrough GSK3h inhibition and nuclear h-cateninaccumulation. J Biol Chem 2002;277:30935^41.

43. Niida A, HirokoT, Kasai M, et al. DKK1, a negativeregulator ofWnt signaling, is a target of the h-catenin/TCF pathway. Oncogene 2004;23:8520^6.

44.Gonzalez-Sancho JM, Aguilera O, Garcia JM, et al.The Wnt antagonist DICKKOPF-1 gene is a down-stream target of h-catenin/TCF and is downregu-lated in human colon cancer. Oncogene 2005;24:1098^103.

45. Mao B, Wu W, Li Y, et al. LDL-receptor-relatedprotein 6 is a receptor for Dickkopf proteins. Nature2001;411:321^5.

46. Bafico A, Liu G,Yaniv A, Gazit A, Aaronson SA.Novel mechanism of Wnt signalling inhibitionmediated by Dickkopf-1interaction with LRP6/Arrow.Nat Cell Biol 2001;3:683^6.

47.Wirths O,Waha A,Weggen S, et al. Overexpressionof human Dickkopf-1, an antagonist of wingless/WNTsignaling, in human hepatoblastomas and Wilms’tumors. Lab Invest 2003;83:429^34.




2005;11:4295-4304. Clin Cancer Res Arend Koch, Andreas Waha, Wolfgang Hartmann, et al. in HepatoblastomasElevated Expression of Wnt Antagonists Is a Common Event

Updated version

http://clincancerres.aacrjournals.org/content/11/12/4295

Access the most recent version of this article at:

Cited articles

http://clincancerres.aacrjournals.org/content/11/12/4295.full#ref-list-1

This article cites 45 articles, 16 of which you can access for free at:

Citing articles

http://clincancerres.aacrjournals.org/content/11/12/4295.full#related-urls

This article has been cited by 10 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://clincancerres.aacrjournals.org/content/11/12/4295To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/content/11/12/4295.full#ref-list-1

http://clincancerres.aacrjournals.org/content/11/12/4295.full#related-urls

http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]



ElevatedExpressionofWntAntagonistsIsaCommonEvent ... · cesium chloride cushion or by Trizol...

Documents

Transcript of ElevatedExpressionofWntAntagonistsIsaCommonEvent ... · cesium chloride cushion or by Trizol...