Effects of Simultaneous Knockdown of HER2 and …...and hormonal and chemo- or radiotherapy, an...

Oncogenes and Tumor Suppressors

Effects of Simultaneous Knockdown of HER2 and PTK6 onMalignancy and Tumor Progression in Human BreastCancer Cells

Natalie Ludyga1, Natasa Anastasov2, Michael Rosemann2, Jana Seiler1, Nadine Lohmann1,Herbert Braselmann3, Karin Mengele4, Manfred Schmitt4, Heinz H€ofler1,5, and Michaela Aubele1

AbstractBreast cancer is themost commonmalignancy in women of theWestern world. One prominent feature of breast

cancer is the co- and overexpression of HER2 and protein tyrosine kinase 6 (PTK6). According to the currentclinical cancer therapy guidelines, HER2-overexpressing tumors are routinely treated with trastuzumab, ahumanized monoclonal antibody targeting HER2. Approximately, 30% of HER2-overexpressing breast tumorsat least initially respond to the anti-HER2 therapy, but a subgroup of these tumors develops resistance shortly afterthe administration of trastuzumab. A PTK6-targeted therapy does not yet exist.Here, we show for the first time thatthe simultaneous knockdown in vitro, compared with the single knockdown of HER2 and PTK6, in particular inthe trastuzumab-resistant JIMT-1 cells, leads to a significantly decreased phosphorylation of crucial signalingproteins: mitogen-activated protein kinase 1/3 (MAPK 1/3, ERK 1/2) and p38 MAPK, and (phosphatase andtensin homologue deleted on chromosome ten) PTEN that are involved in tumorigenesis. In addition, dualknockdown strongly reduced the migration and invasion of the JIMT-1 cells. Moreover, the downregulation ofHER2 and PTK6 led to an induction of p27, and the dual knockdown significantly diminished cell proliferation inJIMT-1 and T47D cells. In vivo experiments showed significantly reduced levels of tumor growth following HER2or PTK6 knockdown. Our results indicate a novel strategy also for the treatment of trastuzumab resistance intumors. Thus, the inhibition of these two signaling proteins may lead to a more effective control of breast cancer.Mol Cancer Res; 11(4); 381–92. �2013 AACR.

IntroductionHER2 is a member of the HER (EGFR/ErbB) receptor

family encompassing the 4 HER receptors (HER1–HER4)that are involved in signal transduction (1). Each of thesereceptors contains an extracellular, a trans-membrane, andan intracellular domain. In response to extracellular stimuli,the HER receptors form a homo- or heterodimer via autop-hosphorylation of the intracellular domains of the receptors(2). Subsequently, the HERs activate many signaling pro-teins that are linked to cell proliferation and tumor malig-nancy. The HER receptors are highly involved in breastcancer progression, and for HER2 in particular, there is alarge body of experimental and clinical data underlining its

significance. Regarding its clinical relevance, HER2 is over-expressed in 25% to 30% of patients with breast cancer andis associated with a poor prognosis (3). In addition to surgeryand hormonal and chemo- or radiotherapy, an antibody-based immunotherapy for HER2-positive tumors has beensuccessfully administered in the last decade (4, 5). However,only a third of breast tumors highly overexpress HER2 andtherefore may be considered for the anti-HER2–targetedantibody (trastuzumab). Moreover, trastuzumab therapycauses side effects (cardiotoxicity; ref. 6), and after approx-imately one year of application, the development of resistanceis not uncommon (7, 8). Combinations of trastuzumab withthe small-molecule tyrosine kinase inhibitor lapatinib target-ing EGF receptor (EGFR) and HER2 seem to provideremedy to some extent. Still, also lapatinib, either as a singleagent, or in combination with various chemotherapeuticagents, or trastuzumab, could not fulfill the high expectationsas initially hoped for (5). HER2 knockdown in vitro led toreduced proliferation and induced apoptosis of HER2-over-expressing breast cancer cell lines (9). In addition, thesimultaneous knockdown of HER2 and uPAR (urokinaseplasminogen activator receptor) resulted in a higher induc-tion of apoptosis and a stronger inhibition of cell proliferationthan the single knockdown of either HER2 or uPAR (10).Another factor with relevance in tumor progression is

PTK6, also known as Brk (breast tumor kinase). This

Authors' Affiliations: 1Institute of Pathology, 2Institute of RadiationBiology, 3Department of Radiation Cytogenetics, Helmholtz ZentrumM€unchen,GermanResearchCenter for Environmental Health,Neuherberg;4Clinical Research Unit, Department of Obstetrics and Gynecology; and5Institute of Pathology, Klinikum rechts der Isar, Technische Universit€atM€unchen, M€unchen, Germany

Corresponding Author: Michaela Aubele, Institut f€ur Pathologie, Helm-holtz Zentrum M€unchen, Ingolstaedter Landstrasse 1, 85764 Neuherberg,Germany. Phone: 49-89-3187-4132; Fax: 49-89-3187-3360; E-mail:[email protected]

doi: 10.1158/1541-7786.MCR-12-0378

�2013 American Association for Cancer Research.

MolecularCancer

Research

www.aacrjournals.org 381

on July 4, 2020. © 2013 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst January 30, 2013; DOI: 10.1158/1541-7786.MCR-12-0378

http://mcr.aacrjournals.org/

nonreceptor Src-related tyrosine kinase is highly expressed inup to 80% of breast cancers, as well as in colon and prostatetumors (11, 12). PTK6 was also shown to be expressed inseveral cancer cell lines (11–13). In the last decade, we andothers have identified several interaction partners of PTK6,such as STAT3, (p38)MAPK, Paxillin, and PTEN (14–17).Therefore, PTK6 seems to be involved in several cellularprocesses, such as proliferation, migration and invasion.PTK6 was also shown to regulate the cell cycle (18). PTK6knockdown led to a diminished phosphorylation of STAT3,(p38) MAPK, and PTEN, as well as to a reduced migrationof breast cancer cells (15, 19).Studies conducted by our group and others showed that

HER2 and PTK6 are coexpressed and colocalized, and theydirectly interact with each other in breast cancer tissue.Furthermore, the HER2 and PTK6 mRNA and proteinlevels are positively correlated, emphasizing their role ascrucial molecules in breast cancer (17, 20–22). In 2004,Tanner and colleagues identified a novel HER2-overexpres-sing cell line that is intrinsically resistant to trastuzumab andnamed it JIMT-1 (23). Since then, an appropriate experi-mental model system has been established to study thepossible causes of intrinsic and acquired trastuzumab resis-tance. In themeantime, several mechanisms for trastuzumabresistance have been hypothesized among others includingtruncation of extracellular HER2, activation of alternativepathways, loss of the tumor suppressor PTEN, or an inter-action with Mucin-4 that potentially inhibits the binding oftrastuzumab to HER2 (8, 24, 25). A recent study describedsurvivin (an inhibitor of apoptosis) as indispensable for thesurvival of HER2-overexpressing and trastuzumab-resistantbreast cancer cells (26). However, the underlying mechan-isms for the development of resistance are not yet exactlyknown, and additional therapeutic approaches in breastcancer are strongly needed. To date, no information existsconcerning the effects of the simultaneous inhibition ofHER2 and PTK6 on tumor cell biology and tumor pro-gression. In addition, in trastuzumab-resistant JIMT-1 cells,this information could give valuable hints towards strategiessuited to circumvent the resistance to the clinical trastuzu-mab-based regimens.In our present study, we show for the first time the cell

line-dependent effects on the deactivation of key proteinsand a reduction in migration, invasion, and cell proliferationin vitro following the simultaneous knockdown of HER2and PTK6 in breast cancer cells. Subsequent xenograftexperiments revealed the effectiveness of silencing thesesignaling proteins in vivo. Therefore, the inhibition ofHER2and/or PTK6 may offer an attractive tool for targeted breastcancer therapy, specifically in a subgroup of patients whodevelop a resistance to trastuzumab during the course oftreatment.

Materials and MethodsCell culture and transient transfectionsThe following 2 permanent human breast cancer cell lines

were used: T47D and JIMT-1. The trastuzumab-sensitive

T47D cell line (HTB-133) was acquired from AmericanType Culture Collection. It was maintained in RPMI-1640with GlutaMAX (Life Technologies GmbH) and trastuzu-mab-resistant cell line JIMT-1 (ACC 589) was acquiredfrom the German Collection of Microorganisms and CellCultures. The last cell line authentication was conducted inspring 2012. Therefore, genetic profiles were generated bythe companyEurofins (MWGOperon). For this, the Power-Plex 16 System, a multiplex short tandem repeat (STR)system, was conducted. Subsequently, the obtained profileswere introduced into the online STR matching analysisdatabase that is provided by the DSMZ. The cells weremaintained in Dulbecco's modified Eagle's medium withGlutaMAX (Life Technologies GmbH). Both media weresupplemented with human insulin (10 mg/mL, Sigma, St.Louis), 10% FBS (Life Technologies GmbH), 0.25% eachof penicillin and streptomycin (Life Technologies GmbH),and also with 0.1% FBS when the serum-independenteffects [in the migration, invasion assays, and matrix metal-loproteinase (MMP) activation, as described below] wereanalyzed and the cells were maintained at 37�C in 5%CO2.The medium for JIMT-1 cells was supplemented withtrastuzumab (10 mg/mL, Roche Diagnostics).For transient transfections, 1 � 106 breast cancer cells

were transfected with small-interfering RNAs (siRNA; 200pmol) for PTK6 andHER2 knockdown and control siRNAs[positive control: siRNAs for glyceraldehyde-3-phosphatedehydrogenase (GAPDH) silencing, and negative control: anon-targeting siRNA) as described; ref. 19]. All siRNAswerepurchased from Thermo Scientific Dharmacon. Two inde-pendent transfections were conducted.

Generation of lentiviral constructs for PTK6 and HER2knockdownPreviously tested siRNAs leading to specific and efficient

knockdown of PTK6 and HER2 were used as templates forthe generation of corresponding shRNAs. The 50-30sequence of the forward primer for shRNA_PTK6 is:GATCCCCCCATTAAGGTGATTTCTCGTTCAAGA-GACGAGAAATCACCTTAATGGTTTTTGGAAA, andthe sequence of the respective reverse primer is: AGCTT-TTCCAAAAACCATTAAGGTG ATTTCTCGTCTCT-TGAACGAGAAATCACCTTAATGGGGG. The 50-30sequence of the forward primer for shRNA_HER2 is:GATCCCCGCTCATCGCTCACAACCAATT CAAGA-GATTGGTTGTGAGCGATGAGCTTTTTGGAAA, thesequence of the respective reverse primer is: AG-CTTTTCCAAAAAGCTCATCGCTCACAACCAATCTCTTGAATTGGTTGTGAGCGATGAGCGGG. Theconstruction of lentiviral vectors was conducted as pub-lished previously (27). In addition to specific shRNAs, allof the vectors encoded the GFP gene for visualization andquantification of infections.

Lentiviral transductions of breast cancer cellsA total of 2.5� 105 T47D and JIMT-1 breast cancer cells

were infected with lentiviral vectors encoding short hairpinRNAs (shRNA): shRNA_PTK6, shRNA_HER2, the

Ludyga et al.

Mol Cancer Res; 11(4) April 2013 Molecular Cancer Research382




shRNA_control (lacking the sequence for shRNA), andpolybrene (Invitrogen) as described (27). The supernatantswere removed 24 hours after infection. Fresh medium wasadded, and the cells were furthermaintained for several weeks.The infected JIMT-1 cells were cultivated in parallel with orwithout the addition of trastuzumab (10 mg/mL, RocheDiagnostics) to ensure the maintenance of resistance. Onceper week, a defined fraction of infected cells was used forWestern blot analysis to control for knockdown efficiency,whereas the residual fraction was further cultivated. As con-trols, cells were infected only with the transduction reagents(mock) or with the lentiviral vectors lacking a shRNAsequence, but containing theGFP gene (control vector). Theinfections were conducted in triplicates. The infection effi-ciency of T47D and JIMT-1 cells was measured by fluores-cence-activated cell sorting as described previously (19).

Western blot analysisFor SDS-PAGE and the subsequentWestern blot analysis,

T47D and JIMT-1 breast cancer cells were treated asdescribed previously (19). The proteins were detected withprimary antibodies targeting PTK6 (sc-1188), GAPDH (sc-25778) (Santa Cruz Biotechnology), HER2 (A0485)(DAKO), (phospho, 9554) PTEN (9559), (phospho4051) Akt (9272), (phospho, 4376) MAPK 1/3, (ERK 1/2; 4695), (phospho 9211) p38MAPK (9212), MMP9(3852), phospho-STAT3 (9134), PARP (9532; Cell Sig-naling Technology), STAT3 (610190), p27 (610242; BDTransduction Laboratories), and tubulin as a loading control(T5168, Sigma). The following peroxidase-conjugated sec-ondary antibodies were used: anti-rabbit (NA934V) andanti-mouse (NA931V; GE Healthcare). All of the bandsshowing changed intensities were quantified relative to thecontrol bands using the Molecular Imager ChemiDoc XRSand the analysis software Quantity One (Bio-RadLaboratories).

WST-1 cell proliferation assayCell proliferation was determined using the water-soluble

tetrazolium WST-1 (4-[3-(4-Iodophenyl)-2-(4-nitrophe-nyl)-2H-5-tetrazolio]-1,3-benzene disulfonate) for the spec-trophotometric assay according to the manufacturer's pro-tocol (05015944001, Roche Diagnostics\). T47D andJIMT-1 cells were seeded at a concentration of 1 � 104

cells per well in a 96-well tissue culture plate. After 48 hours,the WST-1 reagent was added and the cells were incubatedfor 0.5 to 4 hours at 37�C. The absorbance of the infectedand the control cells was measured against a backgroundcontrol using a microplate ELISA reader (Bio-Rad) at 450nm (reference wavelength at 655 nm). Five independentexperiments were carried out. For statistical analysis, theStudent t test was used.

Wound scratch migration assayThe migration assay was conducted in triplicates under

serum-reduced conditions to reduce proliferation (28) asdescribed previously (19) with minor modifications. Thewound was scratched into a confluent monolayer 5 weeks

postinfection and then documented once a day with phasecontrast microscopy on an inverted microscope Evos(AMG). The quantification was conducted using TScratchsoftware (29). All open areas at time point 0 hours were set to100%, and the open areas at the later time points werecalculated in relation to the respective value at 0 hours. Forstatistical analysis, the Student t test was used.

Matrigel invasion assayControl or infected JIMT-1 breast cancer cells were seeded

at a concentration of 5� 104 cells in serum-reducedmediumonto BD BioCoat Matrigel Invasion Chambers (354480,BD Biosciences), inserted in 24-well cell culture plates, andincubated for 24 hours at 37�C. FBS (10%) was used as achemoattractant in the lower chamber, and the invasionassay was conducted according to the manufacturer'sinstructions. After the incubation, noninvading cells wereremoved with a cotton swab from the apical side of themembrane, and then the invading cells were fixed withmethanol and stained with toluidine blue. The invadingcells were counted microscopically (Olympus). The assaywas conducted after 2 independent infections.

In vivo experiments in female nude miceThe animal studies were conducted in accordance with the

German and European laws on animal welfare. The treat-ments were approved by the Bavarian authorities on veter-inary issues (file no. 55.2-1-54-2531-118-10). The femaleathymic nude mice (Crl:NU-Foxn1 nu; originating fromCharles River Laboratories) were maintained in a pathogen-free environment. Five-week-old female nude mice wereinoculated once into the mammary fat pad with 1 � 106

T47D or JIMT-1 cells in 50 mL. The cells were suspended inPBS and mixed with an equal volume of Matrigel (354234,BDMatrigel, BD Biosciences). The tumor size was estimat-ed as the product of the length and width of the xenograftmeasured once a week with a caliper. The data were collectedbetween day 16 postinjection and day 56 postinjection.Eight weeks postinjection, or when the xenograft reachedapproximately 1 cm3, the mice were euthanized. Theincreases in the tumor size over time were estimated byANOVA, and the individual size measurements from eachday were normalized to the average size on day 23 postin-jection for the JIMT-1 cell xenografts or on day 56 post-injection for the T47D cell xenografts. These normalizedtumor sizes were tested for differences between the 4 injectedcell line approaches using the Mann–Whitney U test. Pvalues that were less than 0.05 were considered to bestatistically significant. The median and SEs of the normal-ized tumor sizes were calculated.

ResultsThe simultaneous knockdown of PTK6 and HER2 inbreast cancer cells led to stronger effects in the HERreceptor signaling pathwayBefore stably downregulating HER2 and PTK6, their

expression was transiently downregulated with siRNAs in

Combined HER2 and PTK6 RNAi Reduce Breast Cancer Progression

www.aacrjournals.org Mol Cancer Res; 11(4) April 2013 383




the T47D and JIMT-1 cell lines to investigate the effect ofsimultaneous knockdown. As recently shown by us, spe-cific and efficient siRNAs for PTK6 knockdown wereidentified as described (19). The siRNAs for HER2knockdown led to a specific and effective downregulation(Fig. 1A). The simultaneous knockdown of PTK6 andHER2 after 72 hours (using the most efficient siRNAs,respectively) shows that the phosphorylation of MAPK 1/3 (ERK 1/2) at Thr202/Tyr204 and of STAT3 at Ser727is further reduced compared with the phosphorylationstatus following single HER2 or PTK6 downregulation(Fig. 1B).On the basis of these results, for stable and simultaneous

knockdown ofHER2 andPTK6, theT47D and JIMT-1 celllines were efficiently infected with lentiviral particles encod-ing sequences for shRNAs. Because of the stable integrationof the sequences into the host genome, the infections led to astable downregulation of the target proteins. We show theeffects of the stable and simultaneous knockdown of PTK6and HER2 on selected signaling proteins downstream ofHER2 and PTK6 (Figs. 2 and 3). Because the results fromJIMT-1 cells that were incubated with and without trastu-zumab were comparable, we only show the results obtainedfrom cells cultivated with trastuzumab (Fig. 2). In JIMT-1and T47D cells, the protein expression levels of HER1,HER3, HER4, were not changed (data not shown) fol-lowing the knockdown of HER2 and PTK6, but thephosphorylation of HER receptor-dependent signalingproteins was affected. Compared with the mock and vector

controls, the phosphorylation of MAPK 1/3 (ERK 1/2) atThr202/Tyr204 in the JIMT-1 cell line was significantlyreduced after HER2 (P < 0.001) or PTK6 (P < 0.001)silencing, and in both cell lines, it was significantlydecreased due to the combined downregulation (Figs. 2Band 3B). Phosphorylated, and therefore activated, MAPKmediates cellular processes such as proliferation, differen-tiation, and migration by phosphorylation of its substrates(15). In contrast, p38 MAPK is activated due to environ-mental stress and is involved in regulating cell death (15).The phosphorylation of p38 MAPK at Thr180/Tyr182leads to the activation of other MAPK and transcriptionfactors. In T47D and JIMT-1 cells, the simultaneousdownregulation of HER2 and PTK6 resulted in a furtherreduced phosphorylation of this kinase than single knock-down alone (Figs. 2A and 3A). However, in JIMT-1 cells,the dual knockdown significantly reduced the phosphory-lation compared with single knockdowns (Fig. 2B). Con-sequently, antiapoptotic signaling via p38 MAPK may bereduced.In addition, Akt is activated by phosphorylation at

Thr308 and Ser473, regulating survival and apoptosis byinhibiting the target proteins (30). The single and thesimultaneous knockdowns of HER2 and PTK6 led to areduced phosphorylation of Akt at Ser473 in both cell lines(Figs. 2 and 3). In particular, in T47D cells, compared withPTK6-depleted cells, the dual knockdown significantlyreduced the phosphorylation (Fig. 3B). The phosphoryla-tion status at Thr308 was not changed (data not shown).

Figure 1. The effective transientdownregulation of HER2 and PTK6 in T47Dand JIMT-1 breast cancer cells by siRNA.A, the protein expression levels of T47Dcells after transfection with siRNA_HER2,si_GAPDH (positive control), anontargeting siRNA (negative control), andmock (cells transfected with transfectionreagents without siRNA). B, the proteinexpression levels of JIMT-1 and T47D cellsafter transfections with siRNA_HER2,siRNA_PTK6 and a combination of siRNAsagainst HER2, PTK6, and mock. Theprotein extracts were analyzed byimmunoblotting using primary antibodiestargeting HER2, PTK6, phospho-STAT3,phospho-MAPK 1/3 (ERK 1/2), and tubulin(loading control). For quantification, themeans of 2 independent transfectionswerecalculated.

Ludyga et al.





STAT3 is an additional signaling protein that mediates cellgrowth, survival, differentiation, and gene expression viaphosphorylation at Tyr705 followed by dimerization andtranslocation to the nucleus and DNA binding (31). STAT3that is phosphorylated at Ser727 promotes gene expression.Following combined downregulation in JIMT-1 cells, weobserved a slightly diminished phosphorylation of STAT3 atSer727 (Fig. 2). InT47Dcells, the phosphorylation at this sitewas significantly reduced inHER2-depleted cells (P¼ 0.002)and also significantly decreased in cells depleted of bothcompared with the PTK6 knockdown alone (Fig. 3B). Thephosphorylation of STAT3 at Tyr705 was not analyzedbecause this phosphorylation site was marginal detectable inthe cells.The phosphatase PTEN is a tumor suppressor that neg-

atively regulates the phosphoinositide-3-kinase(PI3K)/Aktpathway, and PTEN phosphorylation at Ser380/Thr382/383 lessens its activity as a tumor suppressor (32). In bothcell lines, only the simultaneous silencing of HER2 and

PTK6 significantly reduced the phosphorylation of PTENin comparison with controls and single knockdowns (Figs. 2and 3).

The simultaneous knockdown of PTK6 and HER2enhanced p27 expression and significantly reduced cellproliferationThe induction of apoptosis as a consequence ofHER2 and

PTK6 knockdown was investigated on the basis of PARPcleavage usingWestern blot analysis. PARP was only cleavedwhen the breast cancer cells were incubated for 24 hours withstaurosporine, an unspecific kinase inhibitor that inducesapoptosis (positive control), and not after PTK6 and HER2downregulation (Fig. 4A).We also analyzed the expression of cell-cycle proteins

depending on HER2 and PTK6 protein levels. Theprotein expression of cyclins and cdk2 following singleand simultaneous knockdown of HER2 and PTK6 wasnot affected in T47D and JIMT-1 cells (data not shown).

Figure 2. The reduced phosphorylation of tumor-promoting signaling proteins following stable single and simultaneous knockdown of HER2 and PTK6 in thetrastuzumab-resistant JIMT-1 cells. A, Western blot analysis of protein extracts using primary antibodies targeting HER2, PTK6, (phospho) STAT3,(phospho) Akt, (phospho) PTEN, (phospho) MAPK 1/3 (ERK 1/2), (phospho) p38 MAPK, and tubulin (loading control). For quantification, the meansof 3 independent infectionswere calculated. B, the graphs show the quantifications of the phosphorylation status relative tomock control. Themean values of3 independent infections, the SDs, and the significant P values of single and simultaneous knockdown in comparison are shown. 1: mock, 2: control vector,3: shRNAHER2, 4: shRNAPTK6, 5: shRNAHER2 þ shRNAPTK6.






However, compared with the mock and vector controls, inboth cell lines, an induction of the cell-cycle inhibitor p27was observed because of HER2 and PTK6 knockdown(Fig. 4B).We examined the proliferation of T47D and JIMT-1 cells

by analyzing the enzymatic cleavage of tetrazolium salts intoformazan (WST-1 assay). This reaction can be proceeded inmetabolically active cells, and the amount of formazan dye isdirectly associated with the amount of viable cells (33).Compared with control cells (mock), the number of cellsfollowingHER2 knockdown is significantly reduced (T47Dcells: P < 0.008, JIMT-1 cells: P¼ 0.004; Fig. 4C). It is alsoreduced when PTK6 is silenced (T47D and JIMT-1 cells: P< 0.001, respectively), and following simultaneous knock-down, the number of metabolically active cells is additivelydiminished (T47D cells and JIMT-1 cells: P < 0.001,respectively). The differences between HER2-depleted cellsand cells depleted of both proteins (T47D and JIMT-1 cells:P < 0.001, respectively), or between PTK6-depleted cells

and cells depleted of both proteins (T47D cells: P < 0.001,JIMT-1 cells: P ¼ 0.04), were also statistically significant(Fig. 4C).

Stronger reducedmigration and invasion of breast cancercells due to the simultaneous knockdown of PTK6 andHER2To further determine the effects of HER2 and PTK6

silencing in breast cancer cells, the migration and invasion ofthe cells were analyzed in vitro. JIMT-1 cells were seeded into6-well plates, then a wound was scratched into the confluentmonolayer and the cells were observed for the following 72hours under serum-reduced conditions, as exemplarilyshown (Fig. 5A). Although the control JIMT-1 cells almostovergrow the open area [mock (6%) and control vector(5%); Fig. 5B), the open area of HER2-depleted cells was at39% (P¼ 0.037), of PTK6-depleted cells was at 42% (P¼0.008) indicating a significantly reduced migration. More-over, the simultaneous HER2 and PTK6 knockdown

Figure3. The reducedphosphorylation of tumor-promoting signaling proteins following stable single and simultaneous knockdownofHER2andPTK6 inT47Dcells. A, Western blot analysis of protein extracts using primary antibodies targeting HER2, PTK6, (phospho) STAT3, (phospho) Akt, (phospho) PTEN,(phospho)MAPK1/3 (ERK 1/2), (phospho) p38MAPK, and tubulin (loading control). For quantification, themeans of 3 independent infectionswere calculated.B, the graphs show the quantifications of the phosphorylation status relative to mock control. The mean values of 3 independent infections, the SDs, and thesignificant P values of single and simultaneous knockdown in comparison are shown. 1: mock, 2: control vector, 3: shRNAHER2, 4: shRNAPTK6, 5:shRNAHER2 þ shRNAPTK6.

Ludyga et al.





further reduced the cell migration, as indicated by an areathat remained more than 52% opened (P¼ 0.003, Fig. 5B)but it is not significant compared with single knockdowns.Because of a very strong HER2 knockdown effect in theT47D cell line, these cells (approaches with HER2-depletedand cells depleted of both: HER2 and PTK6) did notbecome confluent and as this is a prerequisite for the scratchassay, the cells could not be used for the migration assay.Furthermore, the invasion of JIMT-1 cells was also reducedin vitro due to the combined silencing of HER2 and PTK6when compared with single downregulation of the respectiveproteins (Fig. 6A). Indeed, the values were statistically notsignificant, but a clear tendency was observed. In the controlexperiments, the amount of invasive cells was approximately100% (mock) or 90% (empty vector), respectively. Follow-ing HER2, PTK6, or simultaneous silencing, the amount of

invasive cells was approximately 60%, 40%, and 20%,respectively (Fig. 6A).To confirm the outcome of reduced invasion, we analyzed

the cleavage, and therefore the activation, of MMP9 byimmunoblotting using supernatants of JIMT-1 cells thatwere cultivated in serum-reduced medium. MMPs mediatethe digestion of the extracellular matrix and play an impor-tant role in wound healing, tumor invasion, angiogenesis,and carcinogenesis (34). The cleavage of the precursorprotein into the active MMP is required for invasion(34). In comparison with controls (mock and control vec-tor), the cleavage, and thus the activation of MMP9 (illus-trated by the band at 84 kDa), is diminishedwhen PTK6 andboth proteins are downregulated (Fig. 6B). Here, we onlyshow the results obtained with JIMT-1 cells because T47Dcells are less invasive and express lower levels of MMP9.

Figure 4. The simultaneous knockdown of HER2 and PTK6 does not induce apoptosis, but it elevates the protein expression of p27 and leads to significantlyreduced cell proliferation. A, Western blot analysis of JIMT-1 and T47D cell extracts using primary antibodies targeting full-length (116 kDa) and cleaved (89kDa) PARP and tubulin (loading control). B, Western blot analysis of JIMT-1 and T47D cell extracts using primary antibodies targeting HER2, PTK6, p27, andtubulin (loading control). For quantification, the mean values of 3 independent infections were calculated. C, JIMT-1 and T47D cells were seeded at aconcentration of 1� 104 cells per well and incubated for 48 hours. The WST-1 reagent was added and the absorbance measured after 1 hour is shown. Thegraph represents the amount of viable cells in relation to the mock control. The mean values of 5 independent experiments and the SDs are shown. Thedifferences between the mock control and cells depleted of HER2 (T47D cells P < 0.008, JIMT-1 cells: P¼ 0.004), of PTK6 (T47D and JIMT-1 cells: P < 0.001,respectively), and of both (T47D and JIMT-1 cells: P < 0.001, respectively), as well as between HER2-depleted cells and cells depleted of both proteins (T47Dand JIMT-1 cells: P < 0.001, respectively), and PTK6-depleted cells and cells depleted of both proteins (T47D cells: P < 0.001, JIMT-1 cells: P ¼ 0.04) werestatistically significant. ��, P < 0.001; �, P � 0.05.






Significantly reduced in vivo tumor growth followingHER2 and PTK6 knockdownFemale nude mice were inoculated with control cells

(T47D cells and JIMT-1 cells infected with the controlvector), and with T47D or JIMT-1 cells that were depletedof HER2, PTK6, and with cells containing the combinedknockdown. The median tumor size (normalized to theaverage on day 23 postinjection) in JIMT-1 xenografts wassignificantly reduced following PTK6 knockdown (32.7–25.9 mm2 ¼ �21%; P ¼ 0.0003), HER2 knockdown(32.7–29.4 mm2 ¼ �10.2%; P ¼ 0.0008), and the com-bined PTK6 and HER2 knockdown (32.7–29.3 mm2 ¼�10.4%, P ¼ 0.0007; Fig. 7). Concerning T47D cellxenografts, the median tumor size was estimated at the endof the experiment (day 56 postinjection) due to a slowerproliferation of the T47D cells. In all approaches, thereduction of xenograft size of HER2- and PTK6-depletedT47D cells was statistically significant (P� 0.0001; Fig. 7).In comparison with control xenografts (10.2 mm2), the sizeof HER2-depleted xenografts was reduced to approximately5.2 mm2 (�49%), of PTK6-depleted xenografts to approx-imately 8.7 mm2 (�15%) and the size of xenografts

depleted of both were reduced to approximately 6.4mm2 (�37%).

DiscussionA possible approach for a targeted therapy for breast

cancer is the anti-HER2 treatment by means of using thehumanized antibody trastuzumab in HER2-overexpressingtumors. However, a percentage of them become resistantwithin a year of administration of the antibody (7, 8).Therefore, novel biomarkers and targets are needed foradditional tailored therapies in breast cancer. One expedi-ent concept to circumvent the development of resistance tobreast cancer therapy would be simultaneous targeting ofdifferent, but physiologically related, targets within alreadyvalidated cancer-related signaling pathways. Nevertheless,to date, studies that examine and confirm the advantageouseffects of simultaneous knockdown of such target pairs arestill scarce, although some groups have reported stronger orsynergistic effects following the simultaneous knockdownof uPAR and HER2, uPAR and MMP9, or uPA and uPAR(10, 35, 36).

Figure 5. The simultaneous knockdownofHER2 andPTK6 additively reduces JIMT-1 cellmigration. A, representative figures illustrating themigration of JIMT-1 mock, cells infected with empty vector, vectors for HER2 and PTK6 single knockdown, respectively, and both vectors simultaneously. The percentages ofthe open area were calculated using the TScratch software. B, the graph shows the mean values, the SDs, and respective P values of 3 independentexperiments. The scale bars are 400 mm.

Ludyga et al.





In previous studies, we have shown the association ofHER2 with PTK6 in breast cancer (19, 20, 22). Thesestudies led us to investigate the effects of simultaneousknockdown of HER2 and PTK6. To show stronger effectsin regards to the reduction of tumor progression, we simul-taneously knocked down HER2 and PTK6 in T47D cellsand in trastuzumab-resistant JIMT-1 cells. This inhibitionmay offer an attractive approach for directed therapy ofresistant breast tumors.Prompted by preliminary results in which the transient

and simultaneous downregulation of HER2 and PTK6revealed to be more efficient involving the reduced phos-phorylation of HER2-associated signaling proteins, we sta-bly silenced HER2 and PTK6 in 2 human breast cancer celllines. MAPKs, STAT3, Akt, and PTEN are involved intumorigenic processes, and reduced phosphorylations ofthese signaling proteins may more strongly inhibit cellproliferation, migration, and antiapoptotic pathways (14,

15, 30, 32). Consequently, the tumor cell growth regulatedby these proteins may be reduced. In the JIMT-1 cell line,the effects concerning reduced phosphorylation ofMAPK 1/3 (ERK 1/2) were the most extensive and compared withsingle knockdowns, the simultaneous silencing of bothproteins resulted in a further statistically significant reduc-tion of phosphorylation. Our results are in agreement withprevious studies showing decreased phosphorylations of(p38) MAPK (MAPK 1/3, ERK 1/2) following PTK6knockdown (15).Regarding the STAT3 activation at Ser727, we observed a

slightly reduced phosphorylation after simultaneous knock-down in JIMT-1 cells, whereas in T47D cells, a HER2knockdown-dependent phosphorylationwas observed.Usu-ally, PTK6 is involved in the phosphorylation of STAT3 atTyr705 (31), but phosphorylation at this site was notdetectable in JIMT-1 and T47D cells. Because the phos-phorylation of STAT3 at Ser727 is affected by the MAPKpathway (37), we assume that there is an indirect regulationof STAT3 at Ser727 via the MAPK that was explicitlyreduced following the combined silencing. Interestingly,due to siRNA-mediated downregulation, the phosphoryla-tion of STAT3 at Ser727 was already reduced following thesingle HER2 or PTK6 knockdown.We hypothesize that the

Figure 6. The simultaneous knockdown of HER2 and PTK6 and reducedJIMT-1 cell invasion. A, control (mock) and infected with empty vector,and vectors for HER2 and PTK6 single knockdown, respectively, andboth vectors simultaneously were seeded at a concentration of 5 � 104

cells onto invasion chambers in 24-well cell culture plates and wereincubated for 24 hours at 37�C. Invasive cells were stained and counted.The graph shows the means and the SDs of 2 independent infections. B,Western blot analysis of the extracts from JIMT-1 cells (mock, infectedwith the empty vector, and vectors for HER2 and PTK6 singleknockdown, respectively, and both vectors simultaneously) usingprimary antibodies targeting HER2, PTK6, and cleaved (84 kDa) MMP9.For quantifications, the means of 3 independent infections werecalculated.

Figure 7. The knockdown of HER2 or PTK6 significantly reduces tumorgrowth in vivo. Nudemicewere orthotopically inoculatedwith JIMT-1 andT47D cells carrying a control vector, cells depleted of HER2, PTK6, or ofboth proteins. The median and SE of the normalized tumor sizes areplotted, (n ¼ 11 animals per group).






long-term downregulation causes a time-dependent adap-tation of the cells and compensates for the absent phosphor-ylation at Ser727 by activation of alternative kinases. Thereduced phosphorylation of Akt at Ser473 in particular afterHER2 and simultaneous silencing suggests a HER2-depen-dent regulation. This result correlates with a study presentedby Knuefermann and colleagues (38), showing Akt activa-tion through the HER2/PI-3K pathway in breast adenocar-cinoma cells. In addition, study conducted byOstrander andcolleagues showed no change in the phosphorylation of Aktfollowing PTK6 knockdown (15). The phosphorylation,and therefore the inactivation of the tumor suppressorPTEN, was significantly reduced only when both proteinswere silenced in combination. Here, we also assume a time-dependent compensation regulated by other kinases whenHER2 or PTK6 were stably knocked down. According toour observations, the effects following the dual knockdownmay be based on the inhibition of HER2-associated path-ways, and additionally, by diminished PTK6-regulated sig-naling involved in EGFR and insulin-like growth factor-1receptor pathways (e.g., refs. 21, 39).Although the simultaneous knockdown led to a reduced

activation of several signaling proteins involved in tumor-igenesis, an induction of apoptosis was not observed. Itseems that even a combined knockdown of HER2 andPTK6 was not powerful enough to induce apoptosis neitherin T47D nor in JIMT-1 cells. Our results regarding theadditive effects due to simultaneous knockdown are inagreement with previous studies showing stronger effectsfollowing combined silencing of other target proteins(10, 35, 36, 40). However, RNAi of HER2 and uPARtogether, with the addition of trastuzumab, induced apo-ptosis in breast cancer cells (10). This outcome may beexplained by the application of different cell lines, forexample, SKBR-3 or BT474, which are sensitive to trastu-zumab in contrast to JIMT-1 cells, and by the fact that theproliferation in these cell lines is more dependent on HER2expression levels than in JIMT-1 cells (9, 10).While the cell-cycle protein expression (cyclin A, cyclin

D1, cyclin, E and cdk2; data not shown) was not affectedfollowing downregulation, the expression of the cell-cycleinhibitor p27 was clearly elevated in T47D and JIMT-1 cellswhen HER2, PTK6, and both were knocked down. Thismay result in a G1 arrest and therefore in a reduced cell-cycleprogression. This outcome corresponds to the significantlypronounced decrease in the percentage of viable cells fol-lowing the combined downregulation of HER2 and PTK6.Our results are in accordance with a previous study showingregulation of p27 expression by PTK6 in MDA-MB-231breast cancer cells through the activity of its transcriptionfactor FoxO3a (18). Another study reported an epigalloca-techin-3 gallate-induced inhibition of growth in HER2-positive breast cancer cells via repression of FoxO3a andinduction of p27 (41). However, PTK6 silencing seemed toinfluence the trastuzumab-resistant JIMT-1 cell prolifera-tion more than HER2 knockdown. In T47D cells, theHER2 knockdown impaired the cell proliferationmore thanthe PTK6 downregulation.

The stronger effects due to simultaneous RNAi were alsounderpinned by reduced migration and invasion of JIMT-1cells in vitro, correlated with a reduced activation of MAPK1/3 (ERK 1/2), and MMP9. Both proteins are also involvedin cell motility, wound healing, and invasion (15, 34).Migration and invasion are complex processes, and bothhighly contribute to the malignancy of tumor cells (42).Although each single silencing statistically reduced JIMT-1cell migration and the simultaneous approach further dimin-ished themigration, in comparison with single knockdowns,it was not statistically significant. We suggest that the singlesilencing effect, in particular the PTK6 RNAi, was so strongthat the dual knockdown does not lead to significant changesanymore. However, the migration and invasion of JIMT-1cells seemed to be more affected by the depletion of PTK6than of HER2.To show the effect of HER2 and PTK6 silencing in vivo,

we carried out animal experiments with female immuno-suppressed nude mice. The tumor growth was significantlyreduced following HER2, PTK6, and simultaneous knock-down. Interestingly, in JIMT-1 cells, PTK6 downregulationseemed to have a greater impact on reducing tumor growththan HER2 RNAi, whereas in T47D cells, the HER2knockdown stronger impaired the cells in vivo. These resultspartly reflect our observations from the previously conductedin vitro assays. This outcomemight be related to the differentgenotypic features of the respective cell line, namely that thesurvival of the JIMT-1 cells is not as strongly regulated byHER2 protein expression, as it may be in other HER2-overexpressing andHER2-dependent cell lines, for example,SKBR-3 or BT474 (9, 10, 43). In addition, the strong effectof PTK6 knockdown may also be associated with the factthat PTK6 is expressed in approximately 80% of breasttissues (13), and therefore, it may be an additional target inparticular considering the therapy of trastuzumab-resistantbreast cancers. Furthermore, although the HER2 expres-sion in T47D cells is not very high, the HER2 knockdownin this cell line has a greater impact than the PTK6 RNAi.This indicates a highly HER2-dependent proliferationwhich may also be correlated with the trastuzumab-sensi-tivity of T47D cells (data not shown). Consistent with ourfindings, some research groups showed that overexpressionof HER2 and PTK6 in vitro and in vivo increases breastcancer tumorigenesis (21, 44, 45). Accordingly, whenHER2 was downregulated, the cell proliferation ofJIMT-1 breast cancer cells was also reduced in vivo(9, 46). Concerning PTK6 knockdown in vivo only, inves-tigations in the murine small intestine are described andshow a contrary role compared with its role in breast cancer(47, 48).Unexpectedly, although the reduction of tumor growth in

vivo following single PTK6 or HER2 knockdown wassignificantly reduced in both cell line xenografts, the com-bined approach led to an intermediate reduction of thetumor size and not to an additive one. Here, we hypothesizethat in contrast to the positively infected cells of the com-bined knockdown approach (which significantly reduced thecell proliferation), the minimal number of noninfected cells,

Ludyga et al.





which have a survival benefit, may strongely proliferateduring the experiment duration of upto 8 weeks.In summary, our experiments for the first time provide

evidence that the knockdown of HER2 and/or PTK6 canstronger inhibit tumor progression through the significantlyreduced activation of key proteins that are linked to tumor-igenesis, and via diminished migration, invasion, and cellproliferation leading to significantly decreased tumorgrowth. Consequently, our results show that the inhibitionof HER2 and/or PTK6 proteins represent an attractive toolin targeted breast cancer therapy.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: N. Ludyga, M. Schmitt, H. H€oflerAcquisition of data (provided animals, acquired and managed patients, providedfacilities, etc.): N. Anastasov, K. Mengele, H. H€ofler

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, compu-tational analysis): N. Ludyga, N. Anastasov, M. Rosemann, J. Seiler, N. Lohmann,H. Braselmann, M. SchmittWriting, review, and/or revision of the manuscript: N. Ludyga, N. Anastasov, M.Rosemann, K. Mengele, M. Schmitt, M. AubeleAdministrative, technical, or material support (i.e., reporting or organizing data,constructing databases): M. RosemannStudy supervision: M. Schmitt, H. H€ofler, M. Aubele

AcknowledgmentsThe authors thank Michaela H€ausler, Katrin Lindner, and Stefanie Winkler for

high technical expertise. The authors also thank Boris Sch€on for animal care andElenore Samson and Jacqueline M€uller for assistance related to animal treatment.

Grant supportThis work was supported by the Deutsche Forschungsgemeinschaft (DFG, grant

no. 1671/1-1; to N. Ludyga).The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be herebymarked advertisement in accordance with18 U.S.C. Section 1734 solely to indicate this fact.

Received June 25, 2012; revisedDecember 11, 2012; acceptedDecember 28, 2012;published OnlineFirst January 30, 2013.

References1. Moasser MM. Targeting the function of the HER2 oncogene in human

cancer therapeutics. Oncogene 2007;26:6577–92.2. Sergina NV, Moasser MM. The HER family and cancer: emerging

molecular mechanisms and therapeutic targets. Trends Mol Med2007;13:527–34.

3. Ross JS, Fletcher JA, BloomKJ, LinetteGP, Stec J, Clark E, et al. HER-2/neu testing in breast cancer. Am J Clin Pathol 2003;120:53–71.

4. M�enard S, Pupa SM, Campiglio M, Tagliabue E. Biologic and thera-peutic role of HER2 in cancer. Oncogene 2003;22:6570–8.

5. Awada A, Bozovic-Spasojevic I, Chow L. New therapies in HER2-positive breast cancer: a major step towards a cure of the disease?Cancer Treat Rev 2012;38:494–504

6. Sparano JA. Cardiac toxicity of trastuzumab (Herceptin): implicationsfor the design of adjuvant trials. Semin Oncol 2001;28:20–7.

7. Kopper L. Lapatinib: a sword with two edges. Pathol Oncol Res2008;14:1–8.

8. Nagy P, Friedl€ander E, Tanner M, Kapanen AI, Carraway KL, Isola J,et al. Decreased accessibility and lack of activation of ErbB2 in JIMT-1,a herceptin-resistant, MUC4-expressing breast cancer cell line. Can-cer Res 2005;65:473–82.

9. Faltus T, Yuan J, Zimmer B, Kr€amer A, Loibl S, Kaufmann M, et al.Silencing of the HER2/neu gene by siRNA inhibits proliferation andinduces apoptosis in HER2/neu-overexpressing breast cancer cells.Neoplasia 2004;6:786–95.

10. Li C, Cao S, Liu Z, Ye X, Chen L, Meng S. RNAi-mediated down-regulation of uPAR synergizes with targeting of HER2 through theERK pathway in breast cancer cells. Int J Cancer 2010;127:1507–16.

11. Llor X, SerfasW, Bie V, VasioukhinM, Polonskaia J, Derry J, et al. BRK/Sik expression in the gastrointestinal tract and in colon tumours, ClinCancer Res 1999;5:1767–77.

12. Derry JJ, Rins GS, Ray V, Tyner AL. Altered localization and activity ofthe intracellular tyrosine kinase BRK/Sik in prostate tumour cells.Oncogene 2003;22:4212–20.

13. Mitchell PJ, Barker KT, Martindale JE, Kamalati T, Lowe PN, Page MJ,et al. Cloning and characterisation of cDNAs encoding a novel non-receptor tyrosine kinase, brk, expressed in human breast tumours.Oncogene 1994;9:2383–90.

14. Ikeda O, Miyasaka Y, Sekine Y, Mizushima A, Muromoto R, Nanbo A,et al. STAP-2 is phosphorylated at tyrosine-250 by Brk and modulatesBrk-mediated STAT3 activation. Biochem Biophys Res Commun2009;384:71–5.

15. Ostrander JH, Daniel AR, Lofgren K, Kleer CG, LangeCA. Breast tumorkinase (protein tyrosine kinase 6) regulates heregulin-induced activa-

tion of ERK5 and p38 MAP kinases in breast cancer cells. Cancer Res2007;67:4199–209.

16. ChenHY,ShenCH, Tsai YT, Lin FC,HuangYP,ChenRH. Brk activatesrac1 and promotes cell migration and invasion by phosphorylatingpaxillin. Mol Cell Biol 2004;24:10558–72.

17. Aubele M, Walch AK, Ludyga N, Braselmann H, Atkinson MJ, LuberB, et al. Prognostic value of protein tyrosine kinase 6 (PTK6) for long-term survival of breast cancer patients. Br J Cancer 2008;99:1089–95.

18. Chan E, Nimnual AS. Deregulation of the cell cycle by breast tumorkinase (Brk). Int J Cancer 2010;127:2723–31.

19. Ludyga N, Anastasov N, Gonzalez-Vasconcellos I, Ram M, H€ofler H,Aubele M. Impact of protein tyrosine kinase 6 (PTK6) on humanepidermal growth factor receptor (HER) signalling in breast cancer.Mol Biosyst 2011;7:1603–12.

20. BornM,Quintanilla-Fend L, BraselmannH, ReichU, RichterM, HutzlerP, et al. Simultaneous over-expression of the Her2/neu and PTK6tyrosine kinases in archival invasive ductal breast carcinomas. JPathol2005;205:592–6.

21. Xiang B, Chatti K, Qiu H, Lakshmi B, Krasnitz A, Hicks J, et al. Brk iscoamplified with ErbB2 to promote proliferation in breast cancer. ProcNatl Acad Sci U S A 2008;105:12463–8.

22. Aubele M, Spears M, Ludyga N, Braselmann H, Feuchtinger A, TaylorKJ, et al. In situ quantification of HER2-protein tyrosine kinase 6 (PTK6)protein-protein complexes in paraffin sections from breast cancertissues. Br J Cancer 2010;103:663–7.

23. Tanner M, Kapanen AI, Junttila T, Raheem O, Grenman S, Elo J, et al.Characterization of a novel cell line established from a patient withHerceptin-resistant breast cancer. Mol Cancer Ther 2004;3:1585–92.

24. Valabrega G, Montemurro F, Aglietta M. Trastuzumab: mechanism ofaction, resistance and future perspectives in HER2-overexpressingbreast cancer. Ann Oncol 2007;18:977–84.

25. Nagata Y, Lan KH, Zhou X, Tan M, Esteva FJ, Sahin AA, et al. PTENactivation contributes to tumor inhibition by trastuzumab, and loss ofPTEN predicts trastuzumab resistance in patients. Cancer Cell2004;6:117–27.

26. Oliveras-Ferraros C, Vazquez-Martin A, Cufí S, Torres-Garcia VZ,Sauri-Nadal T, Barco SD, et al. Inhibitor of Apoptosis (IAP) survivin isindispensable for survival of HER2 gene-amplified breast cancer cellswith primary resistance to HER1/2-targeted therapies. Biochem Bio-phys Res Commun 2011;407:412–9.

27. Anastasov N, Klier M, Koch I, Angermeier D, H€ofler H, Fend F, et al.Efficient shRNA delivery into B and T lymphoma cells using lentiviralvector-mediated transfer. J Hematop 2009;2:9–19.






28. Liang CC, Park AY, Guan JL. In vitro scratch assay: a convenient andinexpensive method for analysis of cell migration in vitro. Nat Protoc2007;2:329–33.

29. Geb€ack T, Schulz MM, Koumoutsakos P, Detmar M. TScratch: a noveland simple software tool for automated analysis of monolayer woundhealing assays. Biotechniques 2009;46:265–74.

30. Songyang Z, Baltimore D, Cantley LC, Kaplan DR, Franke TF. Inter-leukin 3-dependent survival by the Akt protein kinase. Proc Natl AcadSci U S A 1997;94:11345–50.

31. Liu L, GaoY, QiuH,MillerWT, Poli V, ReichNC. Identification of STAT3as a specific substrate of breast tumor kinase. Oncogene 2006;25:4904–12.

32. Vazquez F, RamaswamyS, Nakamura N, SellersWR. Phosphorylationof the PTEN tail regulates protein stability and function. Mol Cell Biol2000;20:5010–8.

33. Berridge MV, Tan AS, McCoy KD, Wang R. The biochemical andcellular basis of cell proliferation assays that use tetrazolium salts.Biochemica 1996;4:15–9.

34. EgebladM,Werb Z. New functions for thematrixmetalloproteinases incancer progression. Nat Rev Cancer 2002;2:161–74.

35. Kunigal S, Lakka SS, Gondi CS, Estes N, Rao JS. RNAi-mediateddownregulation of urokinase plasminogen activator receptor andmatrix metalloprotease-9 in human breast cancer cells results indecreased tumor invasion, angiogenesis and growth. Int J Cancer2007;121:2307–16.

36. Subramanian R, Gondi CS, Lakka SS, Jutla A, Rao JS. siRNA-medi-ated simultaneous downregulation of uPA and its receptor inhibitsangiogenesis and invasiveness triggering apoptosis in breast cancercells. Int J Oncol 2006;28:831–9.

37. Wen Z, Zhong Z, Darnell JE Jr. Maximal activation of transcription byStat1 andStat3 requires both tyrosine and serine phosphorylation.Cell1995;82:241–50.

38. Knuefermann C, Lu Y, Liu B, Jin W, Liang K, Wu L, et al. HER2/PI-3K/Akt activation leads to a multidrug resistance in human breast ade-nocarcinoma cells. Oncogene 2003;22:3205–12.

39. Irie HY, Shrestha Y, Selfors LM, Frye F, Iida N, Wang Z, et al. PTK6regulates IGF-1-induced anchorage-independent survival. PLoS ONE2010;5:e11729.

40. Gondi CS, Rao JS. Therapeutic potential of siRNA-mediated targetingof urokinase plasminogen activator, its receptor, and matrix metallo-proteinases. Methods Mol Biol 2009;487:267–81

41. Eddy SF, Kane SE, Sonenshein GE. Trastuzumab-resistant HER2-driven breast cancer cells are sensitive to epigallocatechin-3 gallate.Cancer Res 2007;67:9018–23.

42. Stetler-Stevenson WG, Aznavoorian S, Liotta LA. Tumor cell interac-tionswith the extracellularmatrix during invasionandmetastasis. AnnuRev Cell Biol 1993;9:541–73.

43. Choudhury A, Charo J, Parapuram SK, Hunt RC, Hunt DM, Seliger B,et al. Small interfering RNA (siRNA) inhibits the expression of the Her2/neu gene, upregulates HLA class I and induces apoptosis of Her2/neupositive tumor cell lines. Int J Cancer 2004;108:71–7.

44. Shen CH, Chen HY, Lin MS, Li FY, Chang CC, Kuo ML, et al. Breasttumor kinasephosphorylatesp190RhoGAP to regulate rhoand ras andpromote breast carcinoma growth, migration, and invasion. CancerRes 2008;68:7779–87.

45. LofgrenKA,Ostrander JH,HousaD,HubbardGK, Locatelli A, Bliss RL,et al. Mammary gland specific expression of Brk/PTK6 promotesdelayed involution and tumor formation associated with activation ofp38 MAPK. Breast Cancer Res 2011;13:R89.

46. HuX, Su F, Qin L, JiaW,GongC, Yu F, et al. Stable RNA interference ofErbB-2 gene synergistic with epirubicin suppresses breast cancergrowth in vitro and in vivo. Biochem Biophys Res Commun2006;346:778–85.

47. Haegebarth A, Bie W, Yang R, Crawford SE, Vasioukhin V, Fuchs E,et al. Protein tyrosine kinase 6 negatively regulates growth and pro-motes enterocyte differentiation in the small intestine. Mol Cell Biol2006;26:4949–57.

48. Palka-Hamblin HL, Gierut JJ, Bie W, Brauer PM, Zheng Y, Asara JM,et al. Identification of beta-catenin as a target of the intracellulartyrosine kinase PTK6. J Cell Sci 2010;123:236–45.

Ludyga et al.





2013;11:381-392. Published OnlineFirst January 30, 2013.Mol Cancer Res Natalie Ludyga, Natasa Anastasov, Michael Rosemann, et al. Malignancy and Tumor Progression in Human Breast Cancer CellsEffects of Simultaneous Knockdown of HER2 and PTK6 on

Updated version

10.1158/1541-7786.MCR-12-0378doi:

Access the most recent version of this article at:

Cited articles

http://mcr.aacrjournals.org/content/11/4/381.full#ref-list-1

This article cites 48 articles, 12 of which you can access for free at:

Citing articles

http://mcr.aacrjournals.org/content/11/4/381.full#related-urls

This article has been cited by 2 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mcr.aacrjournals.org/content/11/4/381To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-12-0378

http://mcr.aacrjournals.org/content/11/4/381.full#ref-list-1

http://mcr.aacrjournals.org/content/11/4/381.full#related-urls

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mcr.aacrjournals.org/content/11/4/381


Effects of Simultaneous Knockdown of HER2 and …...and hormonal and chemo- or radiotherapy, an...

Documents

Transcript of Effects of Simultaneous Knockdown of HER2 and …...and hormonal and chemo- or radiotherapy, an...