J Food Biochem. 2020;44:e13231. wileyonlinelibrary.com/journal/jfbc  | 1 of 14https://doi.org/10.1111/jfbc.13231

© 2020 Wiley Periodicals, Inc.

1  | INTRODUC TION

The incidence of obesity and type 2 diabetes mellitus (T2DM) is a major worldwide health concern. Epidemics of obesity, T2DM and dyslipidemia are highly correlated with an increase in food intake and a prolonged energy imbalance (American Diabetes, 2009).

Moreover, modern lifestyle is represented by high calorie intake and low physical activity resulting in an increase in metabolic disorders. Hence, it is important to control insulin resistance and obesity by the modification of lifestyle factors such as diet.

Epidemiological studies suggest that cereal fibers and whole grain products can prevent obesity and weight gain, as well as

Received:20October2019  |  Revised:20February2020  |  Accepted:16March2020DOI: 10.1111/jfbc.13231

F U L L A R T I C L E

Effects of high-fiber rice Dodamssal (Oryza sativa L.) on glucose and lipid metabolism in mice fed a high-fat diet

Adriana Rivera-Piza1 | Lynkyung Choi1 | Jaeeun Seo1 | Hyeon Gyu Lee2  | Jiyoung Park3 | Sang-Ik Han4 | Sung-Joon Lee1

1Department of Biotechnology, Graduate School of Life Sciences & Biotechnology, College of Life Sciences & Biotechnology, Korea University, Seoul, Republic of Korea2DepartmentofFoodandNutrition,Hanyang University, Seoul, Republic of Korea3Department of Central Area Crop Science, NationalInstituteofCropScience,RuralDevelopment Administration, Suwon, Republic of Korea4DepartmentofFunctionalCrop,FunctionalCropResourceDevelopmentDivision,NICS,RDA, Miryang, Republic of Korea

CorrespondenceSung-Joon Lee, Department of Biotechnology, Graduate School of Life Sciences & Biotechnology, College of Life Sciences & Biotechnology, BK21-PLUS, KoreaUniversity,Seoul136-713,Republicof Korea.Email: junelee@korea.ac.kr

Funding informationRural Development Administration, Republic ofKorea.,Grant/AwardNumber:ProjectNo.PJ011253042018

AbstractWe investigated the effects of high amylose rice variety, Dodamssal (DO) (Oryza sativa L.), on glucose homeostasis and lipid metabolism in mice. Experiment 1: Oral administration of DO for 1 week significantly improved glucose and insulin tolerance (p < .001) and reduced plasma triglyceride and low-density lipoprotein cholesterol concentrations. Experiment 2: Administration of DO-containing diet for 5 weeks also significantly reduced fasting glucose concentrations and hepatic lipid accumulation. DO induced GLP-1, adiponectin, and PYY levels. In the liver, DO suppressed the gene expressionofG6pc,keygeneingluconeogenesisandinducedAKTphosphorylation.DO increased fecal bile acid excretion regulating the expression in key genes in bile acidmetabolism.DOsuppressedplasmaTrimethylamineN-oxideand intestinal li-popolysaccharide concentrations. DO may be achieved the hypolipidemic effects by direct activation of hepatic Pparα expression and its responsive genes regulating he-patic fatty acid uptake and β-oxidation, while downregulating the hepatic fatty acid synthesis Our results demonstrate that high-fiber rice, DO, might be a potential sup-plement for the amelioration of insulin resistance and hyperlipidemia.

Practical applicationsThe results from the present study suggest that newly developed DO (Oryza sativa L.) high amylose rice strain may improve insulin sensitivity and activates the Akt path-way. DO consumption tends to counteract the deleterious effects characterized dur-ing the intake of high-fat-diet related to plasma TG, ALT, and AST concentrations. Therefore, DO supplementation might be a potential adjuvant to ameliorate dyslipi-demia and adiposity.

K E Y W O R D S

dietary fibers, glucose metabolism, insulin resistance, lipid metabolism, obesity

2 of 14  |     RIVERA-PIZA Et Al.

contribute to the reduction of the risk for the development of T2DM (Cho,Qi,Fahey,&Klurfeld,2013).Dietaryfibercouldreducethein-testinal uptake of dietary fat and cholesterol, and the intake of high amylose, a type of dietary fibers, is known to decrease lipogenesis and steroidogenesis (Liu et al., 2003). The intake of dietary fibers is known to modulate intestinal microbiota, which can affect the inges-tion of food and the adiposity of the individual. Recent intervention studies have shown that T2DM can be prevented by modulating diet increasing fiber intake (Bruttomesso & Tessari, 2019).

Dietary fibers include several starch and non-starch polysac-charides including amylose, cellulose, hemicellulose, and β-glucans (Burton-Freeman,2000).Dietaryfiberscanbeclassifiedasprebiotic(Slavin, 2013) since these fibers are substrate for short-chain fatty acid (SCFA) production through bacterial fermentation by gutmi-crobiota (den Besten et al., 2013), which could in turn demonstrate several biological activities including reduction of plasma cholesterol and triglyceride concentrations.

Rice (Oryza sativa L.) is the most important cultured crop in Asia and has been used as a staple food for more than half of the popu-lation intheworld (Huang&Lai,2016).Severalricevarietieshavebeen developed for a specific nutritional purpose. Specially bred rice variety enriched with dietary fibers showed improved biological ef-fects. Oryza sativa L., Goami-3 is a rice variety with high levels of fibers, resulted in a significant reduction in body fat (–23%), total cholesterol (–20%), and triglyceride concentrations (–30%). Goami-3 rice also improved dyslipidemia and adiposity in diet-induced obese mice (Kim et al., 2013). Thus, different rice strains may have unique health effects.

Oryza sativa L. Dodamssal (DO) is a high amylose, high dietary fiber-containing variety developed by the Rural Development Administration (RDA) of Korea (Republic of Korea). DO contains more than 38% amylose, whereas normal rice contains only 18% of amylose content (Sim et al., 2015). High amylose rice has been shown to be more resistant to digestion than low amylose varieties (Panlasigui&Thompson,2006).ThedietaryfibercontentofDOis4.2%, which is more than twice that of normal rice (Sim et al., 2015). Following these reports, the present article aims to elucidate therole of a newly developed rice strain, DO, a high content of dietary fiber in relation to glucose and insulin metabolism and its link to the pathogenesis of obesity and T2DM as well as the metabolic disor-ders that usually precede their onset, including metabolic syndrome.

2  | MATERIAL S AND METHODS

2.1 | Preparation of DO rice samples

DO rice samples were obtained from the RDA, Suwon, Korea. DO was bred for food processing. Rice samples for the oral glucose toler-ance test (OGTT) and insulin tolerance test (ITT) were finely ground with a 100-mesh sieve and dissolved in sterilized double-distilled water.Ricepowder(1.6g/kgbodyweight)wasadministeredorallyfor the glucose tolerance test.

2.2 | Animal feeding studies and diet

We performed two independent animal feeding studies. The animals were housed with ad libitum access to rodent chow and water for a 1-week acclimation period before experimental manipulations began and maintained in a temperature-controlled (23°C ± 1°C) facility with a 12-hr light/dark cycle. db/dbandC57BL/6Jmicewerefeda45%high-fatdiet(HFD)basedonAIN-93adlibitum.Theprotocoloftwoanimalstudiesaredescribedbelow(FigureS1).

2.2.1 | Animal experiments #1

Six-week-old C57BL/6J male mice (20–23 g, Samtako Co.,Gyenggi-Do, Korea) were maintained in a temperature-controlled (21°C–25°C) environment on a 12-hr light/dark cycle. Mice were fed a45%HFDfor4weekstoinducehyperglycemia.Then,micewererandomly assigned into two groups. One group received orally with 1.6gday–1 kg–1ofbodyweightofeithercornstarch(HF)asnegativecontrolorDOwhitericefor1weekunderHFD(FigureS1a).

2.2.2 | Animal experiment #2

Six-week-old db/dbmalemice(25–27g,SamtakoCo.,Gyenggi-Do,Korea) were maintained in a temperature-controlled (21°C–25°C) environment on a 12-hr light/dark cycle. The db/db mice were feda45%HFDfor2weeksto inducehyperglycemia.Then,db/db (5weeks)werefedeitherwithHFDcontaining45%ofcaloriesfromfat (HFgroup)orHFDsupplementedwith30%(w/w)of isocaloricDO (DO group, Figure S1b). DO-containing isocaloric diets werecustom designed and manufactured in dry pellet form by Du-Yeol Biotech (Gyenggi-Do, Korea). The components and energy density of these isocaloric diets are listed in Table 1.

In both mouse feeding experiments; food intake and body weight were assessed weekly. At the end of the both animal experimen-tal, mice were sacrificed after 12-hr fasting and blood was collected from the heart puncture into BD Vacutainer blood collection EDTA tubes (Becton, Dickinson and Company, NJ, USA). Blood sampleswere centrifuged for 15 min at 12,000 rpm at 4°C to collect plasma samples. Then, stools and the organs containing the liver, ileum, mus-cle, and other tissues were removed and immediately frozen in liquid nitrogen.Thetissuesandplasmasampleswerestoredat−80°Cforfurther analysis. All animal experiments were performed according to a protocol approved by the Animal Experiment Committee of KoreaUniversity(protocolNo.KUIACUC-2016-97).

2.3 | Blood chemistry and hormone analysis

The plasma total cholesterol, high-density lipoprotein (HDL) choles-terol, low-density lipoprotein (LDL) cholesterol, triglyceride, aspartate aminotransferase (AST), alanine aminotransferase (ALT), and glucose

     |  3 of 14RIVERA-PIZA Et Al.

levels were measured by an automated clinical chemistry analyzer (Cobas111, Roche, Basel, Switzerland) according to the manufac-turer's instructions. The homeostatic model assessment-insulin re-sistance (HOMA-IR) index was calculated according to this formula: HOMA− IR=

Glucose× Insulin

405 (Glucose in mass unit of mg/dl). The plasma

insulin level was determined by an ultra-sensitive mouse/rat insulin enzyme-linked immunosorbent assay (ELISA) kit from Merck Inc (Cat # EZRMI-13K, Darmstadt, Germany). Plasma adiponectin was deter-minedusingamouseadiponectinELISAkit(Cat#ab108785,abcam,Cambridge, UK). Plasma PYY was determined by a mouse PYY (Peptide YY)ELISAkitfromElabscience(Cat#E-EL-M2375,Houston,TX,USA),plasma GLP-1 concentration was measured by GLP-1 (active) ELISA kit (Cat# EGLP-35k, Merck Inc, Darmstadt, Germany), and plasma free fattyacid(FFA)wasmeasuredusinganFFAquantificationcolorimetricandfluorometrickit(K612-100,BioVision,CA,USA)accordingtothemanufacturer's instructions.

2.4 | Histological analysis of liver

Livers from db/db mice were fixed in 4% paraformaldehyde and then stained with hematoxylin and eosin in the Histopathology

DepartmentofAnamKoreaUniversityHospital(Seoul,Korea).Formicroscopic analysis, images were obtained using an inverted micro-scope(EclipseTi-s;Nikon).

2.5 | Fecal total bile acids

Stool samples were collected weekly after hyperglycemia induction. Onemilliliterof75%ethanolwasaddedto50mgofdriedpulver-ized feces (two different time points; n = 3 or 4 per group), incu-bated at 50°C for 2 hr, and then centrifuged at 1,050g for 10 min. One hundred microliters of supernatant were added to 500 µl of phosphate-buffered saline, vortexed vigorously, and assayed using CrystalChem mouse total bile acids kit (Downers, Grove, IL) accord-ing to the manufacturer's instructions.

2.6 | Oral glucose tolerance test (OGTT)

After daily oral feeding of DO for 1 week, C57BL/6J mice werefasted overnight. Glucose levels were determined from the tail vein before the oral administration of glucose (1.6 g/kg bodyweight).Bloodsamplesweremeasuredat regular intervals (15,30,60,90,and 120 min), and glucose levels were quantified using a portable blood glucose monitoring system (Accu-Check Go, Roche).

2.7 | Insulin tolerance test (ITT)

After 1 week of daily oral administration. C57BL/6J mice werefasted(6hr)andinsulin(0.35U/kginsulin,Sigma)wasinjectedintra-peritoneally. Blood samples were measured at regular intervals (15, 30,60,90,and120min)andglucoselevelswerequantifiedusingaportable blood glucose monitoring system (Accu-Check Go, Roche).

2.8 | Quantitative polymerase chain reaction (qPCR)

TotalRNAof liverand ileumtissueswas isolatedusingRNAisoPlus(Takara Bio Inc., Shiga, Japan) according to the manufacturer's pro-tocol.First-strandcDNAwassynthesizedfrom1µgoftotalRNAofeach sample using ReverTra Ace qPCR-RTMasterMixwith g-DNAremover (Toyobo, Osaka, Japan). Extraction of total and synthesis of cDNAwereperformedasdescribedpreviously(Jiaetal.,2013)usingReverTra Ace qPCR-RT Master Mix with g-DNA remover (Toyobo,Osaka, Japan). The cDNAsampleswere thenusedas templates forPCR reactions. Specific primers were designed by the OligoPerfectTM Designer Program (Invitrogen, CA, USA). Primer sequences are shown in Table 2. Real-time qPCR was performed with the SYBR Green PCR system (Toyobo, Osaka, Japan) and with the Bio-Rad IQ5 cycler system (Bio-Rad, Hercules, CA, USA). The PCR reaction conditions were 95°C for3minfollowedby50cyclesof95°Cfor20s,60°Cfor20s,60°Cfor20s,and72°Cfor60s.Ameltingcurveof71cycles,startingat

TA B L E 1   Isocaloric composition of the group-specific diets and Dodamssal (DO) composition analysis

HFD (HF) DO

g Kcal g Kcal

Casein, lactic 245 980 210 840

L-cystine 3.5 14 3 12

Corn starch 85.1 340.4 35 140

Sucrose 200 800 84 336

Dextrose 115 460 50 200

α-Cellulose 58 0 36 0

Soybean oil 30 270 28 252

Lard 195 1,755 195 1,755

Calcium phosphate, dibasic

3.4 0 3 0

Mineral mixa  43 0 35 0

Vitamin mixa  19 76 18 72

Choline bitartrate 3 0 3 0

DO rice composition – – 300 1,088.4

Water 12.24

Fat 2.54

Ash 7.18

Carbohydrate 1.19

Calorie 76.85

Water soluble fibers 362.81

Water insoluble fibers 2.00

Total calories 1,000 4,695 1,000 4,695.4

aRecommendedforthestandarddiet(AIN-93).

4 of 14  |     RIVERA-PIZA Et Al.

55°C and increasing by 0.5° every 10 s, was performed to determined primer specificity. The ribosomal protein L32 (Rpl32) was used for nor-malizing data, and gene expression levels were calculated according to IQ5 Optical System Software (version 2; Bio-Rad, Hercules, CA, USA).

2.9 | Immunoblot analysis

Liver samples were homogenized in 200 µl of RIPA lysis buffer (10mMTris–HCL, pH7.5, 1%NP-40, 0.1% sodiumdeoxycholate,0.1%SDS,150mMNaCl,and1mMEDTA)containing1%proteaseand phosphatase inhibitor cocktail (Thermo Scientific, MA, USA) and centrifuged at 14,000 rpm for 10 min at 4°C to collect the super-natant as described previously (Jia et al., 2013). The concentration was determined with a Bio-Rad reagent (Bio-Rad, PA, USA). The protein was denatured by heating and then loaded on sodium do-decyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotted. Briefly, the protein samples (40 µg) were resolved on 10% SDS-PAGE gels and then transferred onto nitrocellulose membranes (Daeillab Service Co. Ltd., Seoul, Korea). Nonspecificbinding was blocked with 5% nonfat milk in Tris-buffered saline with 0.1%Tween-20(TBS-T,pH8.025mMTris,137mMNaCl,2.7mMKCl, and 0.1% Tween-20) at room temperature for 1 hr, followed by overnight incubation with primary antibodies at 4°C. Antibodies specific forPCK1,G6PCAKT, phosphorylatedAKT, andα-tubulin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The anti-microtubule-associated protein 1A/1B-light chain 3 (LC3)antibodywaspurchasedfromNovusBiologicals(Littleton,CO,

USA). After incubation, the membranes were washed with TBS-T for 40 min. Then, the blots were hybridized with secondary antibody in 5% nonfat milk dissolved in TBS-T at room temperature for 1 hr after they were washed with TBS-T 4 times. Immunoreactive protein bands were detected with an enhanced chemiluminescence system (Thermo Scientific, MA, USA), visualized using ChemiDoc (Bio-Rad, CA, USA), and quantified with Image Lab software (Bio-Rad, CA, USA).

2.10 | Statistical analysis

All experiments were conducted in triplicate; the results are expressed as mean ± standard error of the mean (SEM). Data analyses between the treated groups and the control group were performed using GraphPad 5 software. Unpaired t test and one-way analysis of variance were adopted for general data analysis. Significant differences between the two groups of data were determined with a t test (p < .05).

3  | RESULTS AND DISCUSSION

3.1 | Acute oral administration of DO improves glucose and insulin tolerance

After 1 week of DO administration, body weight and food intake were not different between control and DO mice (data not shown). In OGTT, glucose concentrations were reduced in the DO mice at

TA B L E 2  NamesandsequencesofPCRprimers

Gene name Forward 5 -́3ʹ Reverse 3 -́5ʹ Product size (bp)

Hmgcr GTCCAATTTGGCAGCTCAGCCATT TCCAGCGACTATGAGCGTGAACAA 132

Asbt/Slc10a2 TGATGTTTTCTATGGGGTGCAAT AGAGGCATGATTCCAAACTGAC 109

Ldlr CAACAATGGTGGCTGTTCCCACAT ACTCACACTTGTAGCTGCCTTCCA 176

Cyp7a1 ACACCATTCCTGCAACCTTC GCTGTCCGGATATTCAAGGA 232

Rpl32 GGCCTCTGGTGAAGCCCAAGATCG CCTCTGGGTTTCCGCCAGTTTCGC 106

Cyp27a1 TGAAACCCTCCATTCCTGAG AGGAAGTGCAGGTAGCCAGA 256

Fxr/Nr1h4 GGCCTCTGGGTACCACTACA ACATCCCCATCTCTTTGCAC 159

Fgf15 AGAGAACAGCTCCAGGACCA TTCTCCATCCTGTCGGAATC 209

Npc1l1 GGAGCTGTTGGAGCTACAGG CAGAGTCTGGTTGGCTGTGA 202

Fabp6 TCATCACAGAGGTCCAGCAG AACTTGTCACCCACGACCTC 217

G6pc CCTCCTCAGCCTATGTCTGC AACATCGGAGTGACCTTTGG 186

Pck1 GTCAACACCGACCTCCCTTA CCCTAGCCTGTTCTCTGTGC 237

Fasn CCCTTGATGAAGAGGGATCA ACTCCACAGGTGGGAACAAG 116

Srebp1 GTGAGCCTGACAAGCAATCA GGTGCCTACAGAGCAAGAGG 103

Cpt1α CATGTCAAGCCAGACGAAGA TGGTAGGAGAGCAGCACCTT 111

Pparα ATGCCAGTACTGCCGTTTTC GGCCTTGACCTTGTTCATGT 220

Acox1 CAGGAAGAGCAAGGAAGTGG CCTTTCTGGCTGATCCCATA 189

Pparαgc1 TGTGGAACTCTCTGGAACTGC GCCTTGAAAGGGTTATCTTGG 235

Scd1 GCGATACACTCTGGTGCTCA CCCAGGGAAACCAGGATATT 117

     |  5 of 14RIVERA-PIZA Et Al.

alltimepointscomparedwiththelevelsincontrols(Figure1a).Theglucose response area (area under the curve [AUC]) was reduced by 30.8% in the DO mice compared with those of the controls (Figure1b).InITT,theDOgroupshowedasignificantreductionininsulinresponsearea(AUC)comparedwiththoseintheHFDgroupby25.1%(Figure1c,d).Theseresultssuggestthatacuteoraladminis-tration of DO improves glucose and insulin tolerance. Consumption of foods rich in dietary fibers (or a mixture of whole grains and bran) is modestly associated with a reduced risk of obesity and T2DM (Cho et al., 2013). Furthermore, fiber can regulate blood glucose levelsand prevent lipid accumulation (Venn & Mann, 2004).

3.2 | DO decreased LDL cholesterol and triglyceride concentrations in mice

After 1 week of DO administration, mice showed a significant reduction in fasting plasma glucose (Figure2a).DOalso reduced total (−13.8%)and LDL cholesterol (−27.8%), plasma triglyceride levels (−46.4%) andFFAs(−54.3%)comparedwithcontrol(Figure2b,c,f,g).LDL-to-HDLratiowas significantly reduced, while HDL cholesterol levels were slightly in-creased,althoughnotsignificantly(Figure2d,e).ALTandASTlevelsweremarginallyalteredinDOmice(Figure2h,i).TheseresultsrevealthatDOamelioratesHFD-induceddyslipidemiainmice.DOfeedingsignificantly

reducedplasmaandLDLcholesterol,FFAs,andtriglycerideconcentra-tionsinC57BL/6JwhichisinlinewiththestatementthatDietaryfibercan regulate glucose and lipid metabolism (Lattimer & Haub, 2010; Zawistowski, Kopec, & Kitts, 2009). Therefore, increasing the intake of dietary fibers could prevent and improve obesity and T2DM.

3.3 | Effects of DO on insulin, adiponectin, GLP-1, and PYY levels

DO administration showed that fasting insulin levels were sig-nificantly suppressed by 79.1% (p < .01, Figure 3a), while plasmaadiponectin and GLP-1 were increased by 180.3% (p < .01) and 64.2%(p < .01), respectively, in DO mice compared to the controls (Figure3b,d).Likewise,circulatingconcentrationsoftheanorexigenicpeptide PYY were also significantly increased by 50.1% (p < .05) in theDOgroup(Figure3c).Theobservedeffectsmaybeduetoim-proved glucose and insulin tolerance which lead to improved plasma lipid and glucose metabolism by modulating adiponectin, GLP-1, and PYY secretion in mice. GLP-1, an incretin hormone, plays a pivotal role in glucose metabolism by binding the GLP-1 receptor on the surface of pancreatic β-cells to stimulate insulin secretion and block glucagon secretion for regulation of glucose homeostasis mainte-nance (Diez & Iglesias, 2003). Collectively, our results showed that

F I G U R E 1  DOadministrationimprovesglucoseandinsulintoleranceinC57BL/6Jmouse.MicewerefedHFDcontaining45%fatcaloriesandorallyadministered1.6g/kgbodyweightofDodamssal(DO)for1week.Micewereorallyadministratedwithhighamylose-rice,DOorcornstarchascontrol(HF).(a)Oralglucosetolerancetest.Bloodglucoselevelswerecheckedat0,15,30,60,90,120minaftertheoral administration of each rice sample. (b) Area under curve (AUC) was calculated for plasma glucose levels. (c) Insulin tolerance test (ITT). Bloodinsulinlevelwerecheckedat15,30,60,90,120minaftertheoraladministrationofeachricesample(D)Areaundercurve(AUC)wascalculated for plasma insulin levels. The values are expressed as mean ± SEM. Tukey's test was performed for multiple group comparisons. *, p < .05; **, p < .01; ***, p<.001;HF,High-fatdiet;DO,Dodamssal

6 of 14  |     RIVERA-PIZA Et Al.

GLP-1 concentrations were significantly increased in the DO group ofC57BL/6Janddb/db mice, suggesting that DO may have benefi-cial effects on glucose homeostasis. Equivalently, adiponectin is an adipokine that mediates several metabolic processes such as fatty acid oxidation and glucose regulation (Diez & Iglesias, 2003), and thus, the plasma concentrations of adipokines are tightly associated with both lipid and glucose metabolisms.

3.4 | DO induce AKT phosphorylation and suppressing gluconeogenesis gene expressions

To investigate the mechanism of DO in the regulation of glucose metabolism, we assessed the gene and protein expressions in-volved in gluconeogenesis and insulin signaling pathway. Two key genes in gluconeogenesis (G6pc and Pck1) were measured by qPCR.

F I G U R E 2   DO improved hyperlipidemia in wild-type mice. One-week administration of DO reduces plasma cholesterol and triglyceride levelsinC57BL/6Jmice.(a)Fastingglucose,(b)Plasmatotalcholesterol,(c)LDLcholesterol,(d)HDLcholesterol,(e)LDL-to-HDLratio,(f)Plasmatriglycerides,(g)Freefattyacids,(h)PlasmaALT,(i)PlasmaASTlevels.Thevaluesareexpressedasmean±SEM.One-wayANOVAwith Tukey's test was performed for multiple group comparisons. *, p < .05; ***, p<.001;HF,High-fatdiet;DO,Dodamssal

F I G U R E 3   Effects of DO administration on insulin, adiponectin, GLP-1, and PYY levels in wild-type mice. (a) Plasma insulin, (b) Adiponectin, (c) PYY, and (d) GLP-1 variation concentrations. The values are expressed as mean ± SEM. Tukey's test was performed for multiple group comparisons. **, p < .01; ***, p<.001;HF,High-fatdiet;DO,Dodamssal

     |  7 of 14RIVERA-PIZA Et Al.

HepaticmRNAandproteinlevelsofG6pc were reduced in DO group (Figure 4a,c), whereas Pck1 expression was not significantly dif-ferent inDOcompared to thecontrols (Figure4b,c).HepaticAKTactivity was assessed by immunoblotting analysis. Phosphorylated AKT was increased by 1-fold (p= .0457) inDOgroup (Figure4d),suggesting marginal improved insulin signaling pathways following DO administration. Autophagy is reported to protect against insulin resistance(Yang,Li,Fu,Calay,&Hotamisligil,2010).DOtendedtoincrease LC3-II levels, a marker for autolysosome formation, and the LC3-II-to-LC3-Iratio,butnotsignificantly(FigureS2).Theseresultssuggest that DO feeding may improve glucose and insulin tolerance by enhancing insulin signaling pathways that suppress hepatic gluco-neogenesis. Suppression of gluconeogenesis is a major mechanism toimproveinsulinsensitivityandhyperglycemia.PEPCKandG6Paseare two key enzymes in gluconeogenesis and inhibition of these en-zymes or the expression of these genes could suppress the rate of gluconeogenesis. In our results, the expression of G6pc, which en-codeG6Pase,wasconsistentlyreducedinbothC57BL/6Janddb/db mice. Thus, inhibition of hepatic gluconeogenesis may be the major mechanism to improve hyperglycemia and glucose/insulin toler-ance along with elevation of adiponectin and GLP-1 levels. AKT is a major effector of the IR-IRS-1-PI3K pathway and is activated by its phosphorylation (Hong et al., 2014), which is a hallmark for improved

insulin sensitivity. Our results showed that DO supplementation re-stored AKT activity in the insulin signaling pathway, especially in C57BL/6Jmice.

3.5 | DO regulates the expression of bile acid metabolism genes

Plasma cholesterol levels were reduced significantly in the DO group; thus, we investigated the expression of key genes involved in cholesterolandbileacidmetabolismintheliverandileum(Figure5).Bile acids are efficiently reabsorbed (>95%) from the intestine, mainly by active transport mediated by the ileal bile acid transporter (also known as Slc10a2 or Asbt; Li & Chiang, 2015). Bile acids are syn-thesized from cholesterol by a process that requires the concerted actions of at least 14 liver enzymes (Russell, 2003). Cyp7a1, which encodes hepatic cholesterol 7α-hydroxylase, is the first and rate-limiting enzyme in the classic pathway for bile acid synthesis in the liver, and Cyp27a1geneencodessterol27-hydroxylaseandinitiatesbile acid metabolism in the alternative pathway (Russell, 2009).

FarnesoidXreceptor(FXR;Fxr, also known as Nrh14) activation in the intestine, specifically the ileum, has a major role in bile acid homeostasis(Ferrebee&Dawson,2015).Ithasbeensuggestedthat

F I G U R E 4  EffectsofDOontheexpressionofgluconeogenicgenesandAKTactivity.(a)ThemRNAexpressionofG6pcand(b)Pck1.Immunoblotanalysisof(c)G6PCandPCK1.(d)ImmunoblotanalysisofAKT,p-AKTandp-AKT/AKTratio.Thevaluesareexpressedasmean ± SEM. Tukey's test was performed for multiple group comparisons. Different letters indicate p < .05. *, p<.05;HF,High-fatdiet;DO,Dodamssal;G6PC,glucose6-phosphatase;PCK1,phosphoenolpyruvatecarboxykinase-1

8 of 14  |     RIVERA-PIZA Et Al.

intestinalFXRregulateshepaticCyp7a1 by the inducing ileal fibro-blast growth factor-15 (Fgf-15) expression (Inagaki et al., 2005; Sayin et al., 2013; Zimmer et al., 2012) and regulates expression of the ilealbileacidtransporter. IntestinalFXRinducestheexpressionofcytosolic ileal bile acid-binding protein, Ibabp, (also known as Fabp6); Andthepolytopictransmembraneprotein,Niemann-PickC1-Like1(Npc1l1), a cholesterol transporter in the intestine, which facilitates

the transfer of secreted biliary cholesterol back into hepatocytes (Betters & Yu, 2010; Howles & Hui, 2012).

Results showed that the expression of Asbt/Slc10a2 in the in-testinewas not changed (Figure 5a). In contrast, ileal Fxr/Nrh14 (Figure5b)andFabp6 (Figure5c),weresignificantlyupregulatedin the DO group (0.45-fold and 1.2-fold), respectively, compared with the control group. Also, the expression of Fgf-15 in the

F I G U R E 5  EffectsofDOontheexpressionofhepaticandilealbileacidmetabolismgenesinC57BL/6Jmice.(a)Asbt/Slc10a2(b)Fxr/Nr1h4,(c)Fabp6,(d)Fgf-15(e)Npc1l1andintheliver(f)Npc1l1,(g)Cyp1a1,(h)Cyp27a1(i)Hmgcr,(j)Fxr/Nr1h4,(k)Ldlrand(l)Fecalbile acid excretion on day 0 and after 1 week of DO oral administration (m) Schematic model representing the mechanisms whereby DO regulates cholesterol and bile acid metabolism. (n) Hepatic lipid metabolism genes. TC, total cholesterol; LDL-C, LDL cholesterol; BA, bile acids;HMGCR,3-hydroxy-3-methylglutarylcoenzymeAreductase;FXR,farnesoidXreceptor;SHP.Smallheterodimerpartner;CYP7A1,cholesterol7-αhydroxylase;CYP27A1,sterol27-hydroxylasecholesterol7-Rhydroxylase;FGFR4,fibroblastgrowthfactorreceptor4;FABP6;liverfattyacid-bindingprotein,NPC1L1,Niemann-PickdiseasetypeC1gene-like1protein;ASBT,ilealapicalsodium-dependentbileacidtransporter;FGF15,fibroblastgrowthfactor15;PPARα, peroxisome proliferator-activated receptor alpha; PPARαGC1, peroxisome proliferator-activated receptor gamma coactivator 1-alpha; CPT1α,carnitinepalmitoyltransferase;ACOX1,peroxisomalacyl-coenzymeAoxidase;SREBP1,sterolregulatoryelement-bindingprotein1;FAS,fattyacidsynthase;SCD1,stearoyl-CoAdesaturase;SCFA,Short-chainfatty acids. The values are expressed as mean ± SEM. Tukey's test was performed for multiple group comparisons. *, p < .05; **, p<.01;HF,High-fat diet; DO, Dodamssal

     |  9 of 14RIVERA-PIZA Et Al.

intestinedidnotchange(Figure5d).DOsignificantlysuppressedthe expression of ileal Npc1l1 (−29.0%, p < .05) but not the he-patic Npc1l1(Figure5e,f).HFDintakeiscorrelatedwithimpairedinsulin action which increases delivery of FFA to the liver andconsequently increasing production of hepatic triglyceride (Seo etal.,2008;Shimadaetal.,1995).FXRnegatively regulatesbileacid synthesis directly in the liver leading to reduced transcription of Cyp7a1(Chiang,2009;Xu,2011).InDO,theexpressionofhe-patic Cyp7a1 was also significantly reduced but not the Cyp27a1 (Figure5g,h).HMG-CoAreductase(Hmgcr) is considered a major rate-limiting enzyme in cholesterol synthesis (Sato & Takano, 1995). Hepatic Hmgcrexpression (Figure5i)wassignificantly re-duced, however, the expression of Fxr/Nrh14 and Ldlr(Figure5j,krespectively) were not changed in DO group compared with con-trols possibly due to the existence of a cholesterol secretion path-way that is independent of this hepatobiliary tract (Theuwissen & Mensink, 2008; Vrins, 2010). However, this should be study more in detail in further research.

DO group showed a significant increase in fecal bile acids excre-tion (+39.2%, p< .05)comparedwiththecontrolgroup (Figure5l)after 1 week of oral DO administration. Suggesting that the hypo-cholesterolemic effects of DO rice may be through the induction of bile acid excretion and the suppression of hepatic cholesterol bio-synthesis. Dietary fibers have the ability to increase intraluminal vis-cosity thereby affecting the enterohepatic recirculation of bile acids (Kristensen et al., 2012) which could also be linked to the effects thatDOexerts.BycomparingexpressionofdirectFXRtargetgenesin the liver and ileum, it seems that the gut microbiota primarily af-fectsFXRtargetsintheileumandnottheliver.Aschematicrepre-sentationofDOregulatorymechanismwasproposed (Figure5m).Moreover, DO appears to induce Pparα gene expression and may regulates its responsive genes involved in hepatic lipid metabolism. Gene expression of Pparαgc1, Cpt1α Acox1, which drives fatty acid β-oxidation, were upregulated significant compared with those of HF-fedmice.ThegeneexpressionsofSrebp1 as well as its respon-sive genes Fas and Scd1, which regulate lipogenesis (fatty acid and triglyceride synthesis) in the liver were downregulated by DO oral administration(Figure5n).

Pparα mediates the gene transcription involved in fatty acid uptake and oxidation of fatty acids in hepatic lipid metabolism. In the liver, fatty acids are esterified to fatty acyl-CoAs in a Pparα-dependent manner and then transferred to the mitochondrial for β-oxidation catalyzed by Pparαgc1, Acox1, and Cpt1, which are directly activated by Pparα (Fanetal.,1998;Jiaetal.,2013).Furthermore, Pparα enhance the location of Srebp1 on ER pre-venting the following activation Fas and Scd1 which are involved in hepatic lipogenesis synthesis (Yecies et al., 2011). Collectively, our results suggest that DO may, at least in part, act throughout Fxr to suppress the expression of Asbt, this along with a reduced expression of Npc1l1 may contribute to a reduction in total plasma and LDL in mice via a significant increase in fecal bile acid excre-tion and the hypolipidemic effects of DO may be achieved by direct activation of hepatic Pparα expression and its responsive

genes regulating hepatic fatty acid uptake and β-oxidation, while downregulating the hepatic fatty acid synthesis gene expression to decrease triglyceride concentrations in circulatory system and liver lipid accumulation.

3.6 | Administration of DO for 5 weeks reduces fasting glucose concentrations in db/db mice

We next assessed the long-term administration effects of DO in db/db mice. In mice fed isocaloric, high-fat containing, DO diet (30%, w/w of DO, 45% calories from fat) for 5 weeks, fasting plasma glucose concentrations were modestly decreased at weeks 3 to 5, respec-tively, during supplemented rice-diet intake (Figure 6a) comparedtothecontrolgroup,althoughbodyweight (Figure6b),andtissueweights were not different between the DO and the control groups (datanotshown).Foodintakeremainedunchanged(datanotshown).Hematoxylin and eosin staining of mouse livers revealed that DO reduced the ballooning in hepatocytes, a marker of hepatic steatosis (Figure6c).DOfeedingsignificantly reduced,plasma total choles-terol,LDLcholesterol,triglyceride,andFFAlevelscomparedtothecontrolgroup(Figure6d–e,h–i).LDL-to-HDLratiotendedtobere-duced,whileHDLcholesterollevelswerenotchanged(Figure6f,g).ALT, and AST concentrations were marginally altered in DO mice (Figure6j,k).Inaddition,DOreducesplasmaglucoseandslightlyim-provesglucosetoleranceandinsulinsensitivity(Figure6l,m).Theseresults suggest that long-term administration of DO showed mar-ginally hypoglycemic and hypolipidemic effect with amelioration of hepatic steatosis in db/dbmice.Forexample,Wu,Yang,So,Lee,andKim(2016)showedthatmicefedwithIlpumbrownriceshowedsig-nificantly reduced plasma total cholesterol levels and did not result in obesity. In line with our short-term results, it is suggested that DO rice has similar biological effects comparable to the intake of dietary fibers thus, show regulation of key parameters in the lipid and glu-cosemetabolism(He&Shi,2017;Kovatcheva-Datcharyetal.,2015).

3.7 | Effects of 5-week administration of DO on hormone levels, AKT activity, and the expression of gluconeogenesis genes in db/db mice

We quantified plasma hormones in db/db mice. Insulin levels were suppressedby63.8% (p < .01;Figure7a),while adiponectin,PYY,and GLP-1 concentrations were significantly increased by 20.8% (p<.05),49.7%(p<.01),and104.7%(p < .05), respectively, in the DOgroupcompared to the controls (Figure7b–d).These findingsare in linewith the results from theC57BL/6Jmice after 1weekof DO administration. The gene and protein expression analysis re-vealed that themRNAexpressionofG6pc and Pck1 (Figure7e–g)was significantly suppressed in DO livers. In immunoblot analysis, phosphorylation of AKT and the p-AKT-to-AKT ratio tended to be increased, although not significantly (p=.6179;FigureS3a).Proteinexpression of LC3-II, a marker for autophagosome formation, tended

10 of 14  |     RIVERA-PIZA Et Al.

to be increased in DO livers (p= .1964;FigureS3b).Theseresultssuggest that long-term administration of DO in db/db mice has a hy-poglycemic effect, primarily because of the suppression of hepatic gluconeogenic gene expressions and induction of GLP-1, as well as PYY, and adiponectin concentrations. Based on these remarks, we suggest that DO intake might be beneficial in improving insulin resistance and glucose homeostasis in both mice strains, which ap-peared to be mediated through elevation of plasma insulin level that caused activation of glycolysis and inhibition of gluconeogenic and lipid metabolic enzymes in liver although further detailed mecha-nism seems to be elucidated.

3.8 | DO effects on diet-related diseases

High-fat diet induced inflammation and increased circulating plasma concentrations of lipopolysaccharide (LPS), which subsequently pro-motes inflammation, insulin resistance, obesity, and T2DM in humans androdents(Canietal.,2007;Lyuetal.,2017;Sánchez-Tapiaetal.,2017).High lipopolysaccharide (LPS)content is linkedtoexcessdi-etaryfat(Canietal.,2007).Studies(Canietal.,2007;Everardetal.,2011; Kobyliak et al., 2016; Koren et al., 2011; Savcheniuk et al.,2014) have indicated that modulation of the gut microbiota reduced metabolic endotoxemia and the fecal content of LPS as well as

F I G U R E 6   Hypoglycemic and hypolipidemic effects of DO in db/dbmice.Micewerefed45%HFDcontaining35%DOricefor5weeksprior to blood analysis. (a, l) Plasma glucose and (b) Body weight, (c) Hematoxylin & Eosin staining of mouse livers. Liver images were obtained and analyzed as described in the Methods section (magnification × 200). (d) Plasma total cholesterol, (e) HDL cholesterol, (f) LDL cholesterol,(g)HDL-to-LDLratio,(h)Plasmatriglycerides,(i)Freefattyacids,(j)ALT,and(k)ASTlevels,(m)insulinsensitivityindicesafter5-week DO feeding experiments. HOMA-IR, homeostatic model assessment-insulin sensitivity. The values are expressed as mean ± SEM. Tukey's test was performed for multiple group comparisons. *, p < .05; **, p < .01; ***, p<.001;HF,High-fatdiet;DO,Dodamssal

     |  11 of 14RIVERA-PIZA Et Al.

F I G U R E 7   Effects of DO on glucose metabolism in db/db mice. GI hormones and gene and protein expressions were measured in mice after 5 weeks of DO diet in db/dbmice.(a)Plasmainsulin,(b)Adiponectin,(c)PYY,and(d)GLP-1concentrations.(e)TheexpressionofmRNAexpressionof(e)G6pcand(f)Pck1inlivers.Immunoblotanalysisofhepatic(g)PCK1andG6PC.Thevaluesareexpressedasmean±SEM. Tukey's test was performed for multiple group comparisons. *, p < .05; **, p<.01;HF,High-fatdiet;DO,Dodamssal

F I G U R E 8  DOdietreducesLPSandTMAOlevelsinC57BL6/Janddb/db mice. Plasma LPS and TMAO concentrations in (a) db/db miceand(b)C57BL/6JmicefedHFD.Bloodsampleswerecollectedfromtheheartuponsacrificeafter5-weekand1-weektreatmentdiets,respectively.Cornstarch(CS)wasusedascontrolfortheoralfeedingcontrolgroupofC57BL/6Jmice.Plasmawasobtainedafter centrifugation at 3,000 rpm for 20 min. The values are expressed as mean ± SEM. Tukey's test was performed for multiple group comparisons. *, p < .05; **, p<.01;HF,High-fatdiet;DO,Dodamssal

12 of 14  |     RIVERA-PIZA Et Al.

improved low-grade inflammation, steatosis, glucose intolerance, and insulin sensitivity. Hence, to causally link changes in gut microbiota toHFD-inducedvascular inflammation and cardiovascular diseases(CVDs) disorders, we sought to analyze the levels of plasma LPS in vivo. We found that DO intake suppressed metabolic endotoxemia levelsofLPSinbothHFD-fedC57BL/6Janddb/dbmice(Figure8a,b,respectively).

Additionally, literature suggests a correlation on low-fiber intake andCVDs,sinceelevatedconcentrationsofTrimethylamineN-oxide(TMAO) and its precursor TMA were associated with increased risks of major adverse cardiovascular events (Heianza, Ma, Manson, Rexrode,&Qi,2017).SinceTMAOisaplasmabiomarkerinthedi-agnosisandpreventionofCVDs (Lyuetal.,2017)andacceleratedvascular inflammation (Chenet al., 2016),weassessed theTMAOconcentrationinC57BL6/Janddb/db mice plasma after short-term and long-term intake of DO, respectively. Results showed TMAO concentrations were markedly reduced by DO intake in both high-fat-fedC57BL/6Janddb/dbmice(Figure8a,bcorrespondingly).Thiswas correlated with improved glucose intolerance, lower plasma LPSconcentrations, lipidandbileacidmarkers (mRNAexpression)in hepatic and ileal tissues. These results suggest that DO slightly

counteracts theeffectofHFD intake related tometabolic inflam-mation and vascular inflammation. Thus, suggesting that DO mod-ulates microbiota to suppress inflammation and ameliorate the risk of CVDs due to a reduction in LPS endotoxin and plasma TMAO cir-culating levels.

4  | CONCLUSION

Obesity and T2DM are lifestyle metabolic diseases that can lead to many complications including CVDs and stroke. A balanced nutri-tion and energy intake are important to maintain health and meta-bolic homeostasis. Therefore, in the present study, we investigated a novel rice strain, Oryza sativa L. DO, with a high content of di-etary fiber-like amylose. Our results demonstrate that DO reduces fastingplasmaglucose in theshort-term (C57BL/6J)andconfirmlong-term experiments (db/db) in mice compared with the control diets. DO supplementation tends to counteract the deleterious ef-fects characterized during the intake of high-fat diet, related to plasma TG, ALT, and AST and elevate HDL-C. DO also significantly suppressedtheexpressionofPck1andG6pc,keygenesinhepatic

F I G U R E 9   Suggested mechanism of action of DO rice in mice. DO feeding improves glucose and insulin tolerance by enhancing insulin signaling pathways that suppress hepatic gluconeogenesis and DO shows hypocholesterolemic effects by counteracting the deleterious effects characterized during the intake of high-fat-diet, improving plasma lipid parameters. DO increased adiponectin, GLP-1, and PYY levelsinplasmaleadingtoadecreaseinbloodglucose,whileincreasingthetotalbileacidexcretioninstoolsviaFXRinhepatocytesandenterocytes. DO, suppress inflammation and ameliorate the risk of CVDs due to a reduction in LPS endotoxin and plasma TMAO circulating levels.TC,totalcholesterol;LDL-C,LDLcholesterol;glucagon-likepeptide-1,andpeptidetyrosinetyrosine;FXR,farnesoidXreceptor;NPC1L1,Niemann-PickdiseasetypeC1gene-like1protein;LPS,lipopolysaccharide;TMAO,TrimethylamineN-oxide;BA,bileacids;G6PC,glucose6-phosphatase;PCK1,phosphoenolpyruvatecarboxykinase-1

     |  13 of 14RIVERA-PIZA Et Al.

gluconeogenesis and induced phosphorylation activation of AKT, especially inC57BL/6Jmice.DOsupplementationmaystimulatethe secretion of the appetite control hormones such as GLP-1, PYY, insulin, and adiponectin leading to a decrease in blood glu-cose, while increasing the total bile acid excretion in stools and reducingplasmaTMAOandLPSplasmaconcentrations(Figure9).Collectively, the results from the present study suggest that newly developed DO high amylose rice strain showed hypolipidemic ef-fects and may improve glucose tolerance in mice. And therefore, may be a potential adjuvant-treatment agent to prevent disease de-velopment by improving glucose metabolism and lipid metabolism.

ACKNOWLEDG MENTSThis study was supported by Cooperative Research Program for Agriculture Science & Technology Development (Project No.PJ011253042018) of the Rural Development Administration, Republic of Korea.

CONFLIC T OF INTERE S TThe authors declared that they have no conflict of interest.

ORCIDHyeon Gyu Lee https://orcid.org/0000-0002-9141-9469 Sung-Joon Lee https://orcid.org/0000-0002-0661-5255

R E FE R E N C E SAmerican Diabetes. (2009). Diagnosis and classification of diabetes mel-

litus. Diabetes Care, 32(Suppl1),S62–S67.Betters,J.L.,&Yu,L. (2010).NPC1L1andcholesterol transport.FEBS

Letters, 584(13),2740–2747.Bruttomesso, D., & Tessari, P. (2019). A high-fiber diet decreases postab-

sorptive protein turnover but does not alter insulin sensitivity in men with type 1 diabetes mellitus. Journal of Nutrition, 149(4),596–604.

Burton-Freeman,B.(2000).Dietaryfiberandenergyregulation.Journal of Nutrition, 130(2SSuppl),272S–275S.

Cani, P. D., Amar, J., Iglesias, M. A., Poggi, M., Knauf, C., Bastelica, D., …Burcelin,R. (2007).Metabolicendotoxemia initiatesobesityandinsulin resistance. Diabetes, 56(7),1761–1772.

Chen,M.L.,Yi,L.,Zhang,Y.,Zhou,X.,Ran,L.,Yang,J.,…Mi,M.T.(2016).Resveratrol attenuates trimethylamine-n-oxide (TMAO)-induced atherosclerosis by regulating TMAO synthesis and bile acid metabo-lism via remodeling of the gut microbiota. mBio, 7(2), e02210–e2215.

Chiang, J. Y. (2009). Bile acids: Regulation of synthesis. Journal of Lipid Research, 50(10),1955–1966.

Cho,S.S.,Qi,L.,Fahey,G.C.Jr.,&Klurfeld,D.M.(2013).Consumptionofcereal fiber, mixtures of whole grains and bran, and whole grains and risk reduction in type 2 diabetes, obesity, and cardiovascular disease. American Journal of Clinical Nutrition, 98(2),594–619.

den Besten, G., van Eunen, K., Groen, A. K., Venema, K., Reijngoud, D. J., & Bakker, B. M. (2013). The role of short-chain fatty acids in the interplay between diet, gut microbiota, and host energy metabolism. Journal of Lipid Research, 54(9), 2325–2340.

Diez, J. J., & Iglesias, P. (2003). The role of the novel adipocyte-de-rived hormone adiponectin in human disease. European Journal of Endocrinology, 148(3), 293–300.

Everard, A., Lazarevic, V., Derrien, M., Girard, M., Muccioli, G. G., Neyrinck,A.M.,…Cani,P.D. (2011).Responsesofgutmicrobiotaand glucose and lipid metabolism to prebiotics in genetic obese and diet-induced leptin-resistant mice. Diabetes, 60(11),2775–2786.

Fan,C.Y.,Pan,J.,Usuda,N.,Yeldandi,A.V.,Rao,M.S.,&Reddy,J.K.(1998). Steatohepatitis, Spontaneous peroxisome proliferation and liver tumors in mice lacking peroxisomal fatty acyl-coa oxi-dase implications for peroxisome proliferator-activated receptor α natural ligand metabolism. Journal of Biological Chemistry, 273(25), 15639–15645.

Ferrebee,C.B.,&Dawson,P.A.(2015).Metaboliceffectsofintestinalab-sorption and enterohepatic cycling of bile acids. Acta Pharmaceutica Sinica B, 5(2), 129–134.

He,M.,&Shi,B.(2017).Gutmicrobiotaasapotentialtargetofmetabolicsyndrome: The role of probiotics and prebiotics. Cell and Bioscience, 7, 54–54.

Heianza,Y.,Ma,W.,Manson,J.E.,Rexrode,K.M.,&Qi,L.(2017).Gutmicrobiota metabolites and risk of major adverse cardiovascular dis-ease events and death: A systematic review and meta-analysis of prospective studies. Journal of the American Heart Association, 6(7),e004947.

Hong, H. J., Kang, W., Kim, D. G., Lee, D. H., Lee, Y., & Han, C. H. (2014). Effects of resveratrol on the insulin signaling pathway of obese mice. Journal of Veterinary Science, 15(2),179–185.

Howles,P.N.,&Hui,D.Y.E.(2012).PhysiologicalroleofhepaticNPC1L1inhumancholesterolandlipoproteinmetabolism:Newperspectivesand open questions. Journal of Lipid Research, 53(11), 2253–2255.

Huang,Y.P.,&Lai,H.M.(2016).Bioactivecompoundsandantioxidativeactivity of colored rice bran. Journal of Food and Drug Analysis, 24(3), 564–574.

Inagaki, T., Choi, M., Moschetta, A., Peng, L. I., Cummins, C. L., McDonald, J.G.,…Kliewer,S.A.(2005).Fibroblastgrowthfactor15functionsas an enterohepatic signal to regulate bile acid homeostasis. Cell Metabolism, 2(4),217–225.

Jia, Y., Kim, J.-Y., Jun, H.-J., Kim, S.-J., Lee, J.-H., Hoang, M. H., … Lee, S.-J. (2013). Cyanidin is an agonistic ligand for peroxisome proliferator-ac-tivated receptor-alpha reducing hepatic lipid. Biochimica et Biophysica Acta, 1831(4),698–708.

Kim, H.-W., Lee, A.-Y., Yeo, S. K., Chung, H., Lee, J. H., Hoang, M.-H., … Kim, Y.-S. (2013). Metabolic profiling and biological mechanisms of body fat reduction in mice fed the ethanolic extract of black-colored rice. Food Research International, 53(1),373–390.

Kobyliak,N.,Falalyeyeva,T.,Virchenko,O.,Mykhalchyshyn,G.,Bodnar,P.,Spivak,M.,…Ostapchenko,L.(2016).Comparativeexperimentalinvestigation on the efficacy of mono-and multiprobiotic strains in non-alcoholic fatty liver disease prevention. BMC Gastroenterology, 16(1), 34.

Koren, O., Spor, A., Felin, J., Fåk, F., Stombaugh, J., Tremaroli, V., …Bäckhed, F. (2011).Humanoral, gut, andplaquemicrobiota in pa-tients with atherosclerosis. Proceedings of the National Academy of Sciences, 108(Supplement 1), 4592–4598.

Kovatcheva-Datchary,P.,Nilsson,A.,Akrami,R.,Lee,Y.S.,DeVadder,F., Arora, T.,…Bäckhed, F. (2015).Dietary fiber-induced improve-ment in glucose metabolism is associated with increased abundance of Prevotella. Cell Metabolism, 22(6),971–982.

Kristensen, M., Jensen, M. G., Aarestrup, J., Petersen, K. E., Søndergaard, L., Mikkelsen, M. S., & Astrup, A. (2012). Flaxseed dietary fiberslower cholesterol and increase fecal fat excretion, but magnitude of effect depend on food type. Nutrition & Metabolism, 9(1), 8.

Lattimer, J. M., & Haub, M. D. (2010). Effects of dietary fiber and its com-ponents on metabolic health. Nutrients, 2(12),1266–1289.

Li, T., & Chiang, J. Y. (2015). Bile acids as metabolic regulators. Current Opinion in Gastroenterology, 31(2), 159.

Liu,S.,Willett,W.C.,Manson,J.A.E.,Hu,F.B.,Rosner,B.,&Colditz,G.(2003). Relation between changes in intakes of dietary fiber and grain products and changes in weight and development of obesity among mid-dle-aged women. American Journal of Clinical Nutrition, 78(5),920–927.

Lyu,M.,Wang,Y.,Fan,G.,Wang,X.,Xu,S.,&Zhu,Y.(2017).Balancingherbal medicine and functional food for prevention and treatment

14 of 14  |     RIVERA-PIZA Et Al.

of cardiometabolic diseases through modulating gut microbiota. Frontiers Microbiology, 8(2146),1–21.

Panlasigui,L.N.,&Thompson,L.U.(2006).Bloodglucoseloweringef-fects of brown rice in normal and diabetic subjects. International Journal of Food Sciences and Nutrition, 57(3–4), 151–158.

Russell, D. W. (2003). The enzymes, regulation, and genetics of bile acid synthesis. Annual Review of Biochemistry, 72,137–174.

Russell,D.W.(2009).Fiftyyearsofadvancesinbileacidsynthesisandmetabolism. Journal of Lipid Research, 50(Suppl), S120–S125.

Sánchez-Tapia, M., Aguilar-López, M., Pérez-Cruz, C., Pichardo-Ontiveros,E.,Wang,M.,Donovan,S.M.,…Torres,N.(2017).Nopal(Opuntia ficus indica) protects from metabolic endotoxemia by modi-fying gut microbiota in obese rats fed high fat/sucrose diet. Scientific Reports, 7(1),4716.

Sato, R., & Takano, T. (1995). Regulation of intracellular cholesterol me-tabolism. Cell Structure and Function, 20(6),421–427.

Savcheniuk,O.,Kobyliak,N.,Kondro,M.,Virchenko,O.,Falalyeyeva,T.,& Beregova, T. (2014). Short-term periodic consumption of multipro-biotic from childhood improves insulin sensitivity, prevents develop-ment of non-alcoholic fatty liver disease and adiposity in adult rats with glutamate-induced obesity. BMC Complementary and Alternative Medicine, 14(1),247.

Sayin,S.I.,Wahlström,A.,Felin,J.,Jäntti,S.,Marschall,H.-U.,Bamberg,K.,…Bäckhed,F.(2013).Gutmicrobiotaregulatesbileacidmetabo-lism by reducing the levels of tauro-beta-muricholic acid, a naturally occurringFXRantagonist.Cell Metabolism, 17(2), 225–235.

Seo, K. I., Choi, M. S., Jung, U. J., Kim, H. J., Yeo, J., Jeon, S. M., & Lee, M. K. (2008). Effect of curcumin supplementation on blood glucose, plasma insulin, and glucose homeostasis related enzyme activities in diabetic db/db mice. Molecular Nutrition & Food Research, 52(9), 995–1004.

Shimada, M., Ishibashi, S., Gotoda, T., Kawamura, M., Yamamoto, K., Inaba, T.,…Yamada,N. (1995).Overexpression of human lipopro-tein lipase protects diabetic transgenic mice from diabetic hypertri-glyceridemia and hypercholesterolemia. Arteriosclerosis, Thrombosis, and Vascular Biology, 15(10),1688–1694.

Sim, E.-Y., Chung, S.-K., Cho, J.-H., Woo, K. S., Park, H. Y., Kim, H.-J., … Kim, W.-H. (2015). Physicochemical properties of high amylose rice varieties. Food Engineering Progress, 19(4), 392–398.

Slavin,J.(2013).Fiberandprebiotics:Mechanismsandhealthbenefits.Nutrients, 5(4),1417–1435.

Theuwissen, E., & Mensink, R. P. (2008). Water-soluble dietary fibers and cardiovascular disease. Physiology & Behavior, 94(2), 285–292.

Venn, B. J., & Mann, J. I. (2004). Cereal grains, legumes and diabetes. European Journal of Clinical Nutrition, 58(11),1443–1461.

Vrins,C.L.(2010).Frombloodtogut:Directsecretionofcholesterolviatransintestinal cholesterol efflux. World Journal of Gastroenterology, 16(47),5953–5957.

Wu,C.,Yang,S.O.,So,M.Y.,Lee,S.J.,&Kim,Y.S. (2016).Effectsofbrown rice on cellular growth and metabolic changes in mice. Food Research International, 84, 33–40.

Xu, Y. (2011). Bile acid receptor modulators in metabolic diseases. InAnnual reports in medicinal chemistry (Vol. 46,pp.69–87).AcademicPress.

Yang,L.,Li,P.,Fu,S.,Calay,E.S.,&Hotamisligil,G.S.(2010).Defectivehepatic autophagy in obesity promotes ER stress and causes insulin resistance. Cell Metabolism, 11(6),467–478.

Yecies, J. L., Zhang, H. H., Menon, S., Liu, S., Yecies, D., Lipovsky, A. I., … Manning, B. D. (2011). Akt stimulates hepatic SREBP1c and lipogene-sis through parallel mTORC1-dependent and independent pathways. Cell Metabolism, 14(1), 21–32.

Zawistowski, J., Kopec, A., & Kitts, D. D. (2009). Effects of a black rice extract (Oryza sativa L. indica) on cholesterol levels and plasma lipid parameters in Wistar Kyoto rats. Journal of Functional Foods, 1(1), 50–56.

Zimmer,J.,Lange,B.,Frick,J.-S.,Sauer,H.,Zimmermann,K.,Schwiertz,A., … Enck, P. (2012). A vegan or vegetarian diet substantially alters the human colonic faecal microbiota. European Journal of Clinical Nutrition, 66(1), 53.

SUPPORTING INFORMATIONAdditional Supporting Information may be found online in the Supporting Information section.

How to cite this article: Rivera-Piza A, Choi L, Seo J, et al. Effects of high-fiber rice Dodamssal (Oryza sativa L.) on glucose and lipid metabolism in mice fed a high-fat diet. J Food Biochem. 2020;44:e13231. https://doi.org/10.1111/jfbc.13231