Effect of Vitamin D Supplementation and/or Physical...

Med. J. Cairo Univ., Vol. 81, No. 1, December: 1053-1065, 2013

www.medicaljournalofcairouniversity.net

Effect of Vitamin D Supplementation and/or Physical Training on

Cigarette Smoke Induced COPD in Rats

NASHWA ELTABLAWY, M.D.; SAMAH ELATTAR, M.D. and ZIENAB ABDEL WAHAB, M.D.

The Department of Physiology, Faculty of Medicine, Cairo University

Abstract

Background: Chronic obstructive pulmonary disease (COPD) is a major health problem with increasing morbidity

and mortality. Vitamin D deficiency has been established as exceedingly prevalent in many of chronic lung disease popu-lations and exercise training in COPD patients results in

positive effects in dyspnea and exercise tolerance.

Aim of Work: The purpose of the present study was to investigate the effect of vitamin D supplementation and/or physical training on pulmonary functions, lung inflammation,

antimicrobial production and matrix degradation in a rat model of COPD.

Methodology: Forty male Albino rats were used in this study and divided into 5 groups, 8 rats each: Group1: Control

group, Group 2: (COPD group): COPD rats maintained un-treated for the experimental period, Group 3: (Vit. D+COPD):

COPD rats were treated with vitamin D injection 1, 25 (OH)

D3 was administered intraperitoneally (i.p.) at dose 0.5 µg/kg of body weight (BW), 3 times a week for 8 weeks, Group 4:

(COPD+ Exercise): COPD rats performed daily exercise

program and group 5: (COPD+Vit D+exercise) COPD rats

treated with vitamin D injection (i.p.) at a dose of 0.5 µ g/kg, 3 times a week for 8 weeks and performed daily exercise

program. After 8 weeks of treatment, pulmonary functions were tested and blood samples were withdrawn for measuring vitamin D and Ca2+ levels and the lung tissues were excised to measure interleukin 12 (IL12), tumor necrosis factor alpha

(TNF alpha), metalloproteinase-9 (MMP-9) and cathelicidin.

Results: Peak expiratory flow (PEF), forced vital capacity (FVC), vitamin D and Ca2+ were significantly reduced in COPD rats after 12 weeks of exposure to cigarette smoke.

Vitamin D supplementation and swimming training for 8 weeks improved PEF, FVC, vitamin D and Ca2+ significantly as compared to untreated COPD. Combined vitamin D treat-ment and physical training significantly improved FVC level as compared with each treatment separately. The improvement

was associated with significant reduction in inflammatory markers and MMP-9 as compared to COPD untreated rats.

The antimicrobial cathelicidin was significantly increased in

COPD rats and was further increased on vitamin D treatment

but not with exercise training.

Correspondence to: Dr. Nashwa Eltablawy, The Department of Physiology, Faculty of Medicine, Cairo University E-mail: [email protected]

Conclusion: Our results showed that COPD is an inflam-matory disease and it is associated with vitamin D deficiency. Vitamin D supplement or rehabilitation by physical training

each separately improved the pulmonary functions, reduced

inflammation, and attenuate lung parenchymal degradation.

Vitamin D in addition induced an antimicrobial protection,

however vitamin D supplement had a slightly better effects

as compared with exercise training. Combination of both vitamin D supplementation and exercise training had a syner-gistic effect and produced a significant improvement as

compared to each therapy separately. We can conclude that

vitamin D supplement has a beneficial effects as a therapy in cases of COPD and it is better added to rehabilitation training

programs for better results.

Key Words: COPD – Vitamin D – Physical training – Cathe-licidin.

Introduction

CHRONIC obstructive pulmonary disease (COPD) is a major health problem with increasing morbidity

and mortality; in 2020, COPD will be the 3 rd

leading cause of mortality worldwide and the 5 th

leading source in terms of burden of disease [1] . COPD is characterized by persistent airflow limi-tation that is usually progressive and associated

with an enhanced chronic inflammatory response in the airways and the lung to noxious particles or

gases. Exacerbations and comorbidities contribute to the overall severity in individual patients [2-4] .

Exposure to cigarette smoke is known to sig-nificantly increase the risk for the development of COPD [5,6] . The exact pathogenesis has yet to be discovered; however, numerous cellular elements

have demonstrated involvement in the pathophys-iology of COPD. These include macrophages, neutrophils and cytokines such as interleukin (IL)- 4, IL-5 and IL-13, along with interferon-gamma

[6-8] .

The alveolar wall destruction and loss of elastic

recoil that occur in COPD are believed to be the

1053

http://www.medicaljournalofcairouniversity.net

mailto:[email protected]

1054 Effect of Vitamin D Supplementation and/or Physical Training

result of chronic inflammation and imbalance of

antioxidants [7,9] . This oxidative stress causes a protease/antiprotease imbalance and is believed to be a contributing factor toward the pathogenesis

of COPD [9] .

Vitamin D is a steroid hormone that is synthe-sized in the epidermal keratinocytes under influence

of UV-B light (290-315nm) or acquired in the diet. Dietary sources include supplemented dairy prod-ucts, fish oil, fish liver and eggs. It is estimated

that approximately 3 percent of the human genome

is regulated directly or indirectly by the vitamin D endocrine system [10,11] .

Recent research has revealed new sites of action

that may force the re-examination of vitamin D and its role in human physiology. Vitamin D recep-tors (VDRs) have been found in organs not typically

believed to be involved with bone metabolism, including the pancreas, gonads, liver, heart, brain

and breast, as well as the hematopoietic and im-mune systems [10] .

Vitamin D deficiency has been established as exceedingly prevalent in many of chronic lung

disease populations [12] . COPD patients without any glucocorticoid use had significantly decreased

25-hydroxyvitamin D levels when compared with age-matched controls [13] . Children with a diagnosis of wheezy bronchitis had more than two-and-a-half times the incidence of rickets than the age-matched controls. Also it was noted a 10 times

higher incidence of wheezy bronchitis when severe rickets was present [14] . Limited studies [15,16] in patients with chronic lung disease suggest that

bone mineral density is correlated with lung func-tion, whereas another study [17] was unable to confirm this.

Recent studies have shown that vitamin D has

pleiotropic protective effects [18,19] . 1,25 (OH)2D3 (1,25-dihydroxyvitamin D 3), an active metabolite of vitamin D is also a potent regulator of the

immune response in Th1 cell-directed diseases

[20,21] . Sunder and colleagues [22] have recently shown that VDR deficiency invokes lung inflam-mation and alterations in lung function. Hence,

understanding the molecular mechanisms of dietary vitamin D for the treatment of lung disease and

their exacerbations are an emerging area of research

[23] .

Skeletal muscle dysfunction is common in patients with advanced COPD and it contributes

importantly to limiting their functional capacity

and quality of life [24] . The role of exercise training in pulmonary rehabilitation of patients with severe

COPD has been studied [25] . Exercise training in

COPD patients results in positive effects in dyspnea

and exercise tolerance [25,26] , however, the mech-anisms by which exercise affect the pulmonary

functions in COPD have not been determined.

Aim of work: Accordingly, the purpose of the present study was to investigate the effect of vita-min D supplementation and/or physical training on pulmonary functions (peak expiratory flow rates

(PEF) and forced vital capacity (FVC) in a rat

model of COPD induced by 3 months exposure to

cigarette smoke. The effect of vitamin D supple-mentation and physical training on vitamin D level

and calcaemic state, lung inflammation as deter-mined by lung expression of TNF-α and IL-12 was measured. The effect of vitamin D and physical

training on the antimicrobial protein cathelicidin

and tissue breakdown as indicated by measuring lung metalloproteinase 9 (MMP-9) was also inves-tigated.

Material and Methods

Experimental animals and groups: Forty male Albino rats, weighing 100-120g,

were used in this study. This work was conducted in the Physiology department, Cairo University from May 2013 – October 2013. The rats were

kept under standard conditions. Placed in cages,

at 20±5° C, average humidity, and normal light/dark

cycles. Standard chow and water were available

ad libitum.

Rats were divided into 5 groups: Group 1: Control group (8 rats): These are

normal rats serving as control rats for the different

values measured in the other groups.

Remaining rats were exposed to passive ciga-rette smoke for 3 months in order to develop COPD

and then tested by pulmonary function tests to

examine the development of COPD.

32 male rats were daily exposed to the smoke

resulted from burning of 12-15 cigarettes. COPD

was induced by cigarette smoking exposure tech-nique: Cigarette smoke (CS) exposure was achieved by same procedure which had been used in a pre-vious study [27] with some modification in periods of exposure and number of cigarettes. Popular

Egyptian filter-tipped cigarette were used contain-ing (25mg) tar and (1.8mg) nicotine.

The exposure to the CS was initial progressive concerning the burned material mass and the ex-posure time in order to permit the biological adap-tation of the animals and to avoid accidents such

as smoke intoxication that could determine death

of rats.

Nashwa Eltablawy, et al. 1055

The cigarette smoke exposure lasts for 3 months.

The rats were randomly divided into 4 groups after

developing COPD:

Group 2: (COPD group): Eight rats were in-cluded in this group and maintained untreated for

the experiment period.

Group 3: (Vit.D+COPD): Eight COPD rats were treated with vitamin D injection1, 25(OH)

D3 was administered intraperitoneally (i.p.) at dose

0.5µg/kg BW, 3 times a week for 8 weeks [28] .

Group 4: (COPD+Exercise): Eight COPD rats performed daily exercise program.

The exercise protocol consisted of swimming exercise (1hr/day, 5 days/week) [29] for 8 weeks in a swimming tank filled with water at a temper-ature of 36ºc. Daily swimming period was divided into 2 sessions each formed of 30 minutes separated

by 1 hour rest. At the completion of each period

of swimming exercise, the rats were removed from

the water, carefully dried and returned to their cages. The exercised rats underwent a swimming

programme consisting of gradually increasing

periods of swimming in the first 4 days the duration of exercise was gradual increased from an initial

period of 15min to the maximum permissible per-iod of 30min.

Group 5: (COPD+Vit.D+Exercise) eight COPD

rats treated with vitamin D injection (i.p.) at dose

0.5µgm/kg, 3 times a week for 8 weeks and per-formed daily exercise program similar to the pro-tocol tried by group 4.

After 8 weeks, the animals were transferred to

National Research Centre, Cairo, Egypt where

pulmonary functions were assessed and blood samples were withdrawn by capillary tubes and

left to clot to get the serum for measurement of vitamin D and Ca2+. The animals were then sacri-ficed and their chests were opened and the lungs

were excised for measurement of IL12, TNF alpha,

cathelicidin and MMP-9.

Measurement of pulmonary function:

Rats were placed in a specific body plethysmo-graph made of plexi glass. Rats head protruded

through a neck collar made of a dental latex dam into a head exposure chamber that ends with a

flow head connected to spirometer (AD Instruments spirometer, ML 140) which is a precision differential pressure transducer for measuring respiratory vari-ables. It measures differential pressure across fine

gauze mounted in a flow head [30] .

Estimation of vitamin D and calcium:

Blood samples were withdrawn and left to clot for 20min then centrifuged at 12,000rpm for 1o

min then the separated serum was kept frozen at

-80c till analysis. Serum samples were examined for 25(OH) D levels by Enzyme-linked immun-osorbent assay (ELISA) by kit supplied by (Im-mundiagnostic USA) briefly, monoclonal antibody identify 25, OH vitamin D was used in the assay. The samples were incubated with the detection antibody after the extraction step. Then Peroxidase-conjugated antibody was then added into microplate well, forming a complex of 25-hydroxy vitamin D-detection antibody-peroxidase conjugate. Tet-ramethylbenzidine (TMB) was used as a substrate, the colour density developed is proportional to

vitamin d concentration. Finally, to terminate the

reaction stop solution was added and the microplate

were read by elisa reader at 520nm [31] . Serum calcium concentrations were measured by standard

laboratory methods.

Measurement of TNF- α and IL-12: TNF-α and IL-12 in lung tissues were measured

by using ELISA (quantikine R&D system USA) according to the manufacturer`s instructions [32,33] .

Detection of MMP-9 & cathelcidin gene ex-pression using real time:

PCR (RT-PCR):

RNA extraction:

Total RNA was isolated from lung tissue homo-genates using RNeasy Purification Reagent (Qiagen, Valencia, CA) according to manufacturer's instruction. The purity (A260/A280 ratio) and the concentration of RNA were obtained using spec-trophotometry (GeneQuant 1300, Uppsala, Swe-den). RNA quality was confirmed by gel electro-phoresis.

cDNA synthesis:

First-strand cDNA was synthesized from 4µg of total RNA using an Oligo (dT) 12-18 primer

and SuperscriptTM II RNase Reverse Transcriptase,

This mixture was incubated at 42 ° C for 1h, the kit was supplied by Super Script Choice System (Life

Technologies, Breda, the Netherlands).

Real-time quantitative polymerase chain reac-tion (PCR):

Real-time PCR (RT-PCR) amplification was

carried out using 10µL amplification mixtures containing Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA USA), equiv-


Abstract

Background: Chronic obstructive pulmonary disease (COPD) is a major health problem with increasing morbidity

and mortality. Vitamin D deficiency has been established as exceedingly prevalent in many of chronic lung disease popu-lations and exercise training in COPD patients results in

positive effects in dyspnea and exercise tolerance.

Aim of Work: The purpose of the present study was to investigate the effect of vitamin D supplementation and/or

physical training on pulmonary functions, lung inflammation,

antimicrobial production and matrix degradation in a rat model

of COPD.

Methodology: Forty male Albino rats were used in this study and divided into 5 groups, 8 rats each: Group 1: Control

Primer sequences used for RT-PCR.

Primer Sequence

MMP-9

Cathelicidin

GAPDH

Forward:5’- CATTCGCGTGGATAAGGAGT -3´ Reverse:5´- ACCTGGTTCACCTCATGGTC -3´ according to gene bank

accession number NM-013599

Forward:5´AGGATTGTGACTTCAAGAAGGACG-3´ Reverse:5´GTTTATTTCTCAGAGCCCAGAAGC-3´. according to gene bank

accession number XM_005253678.1

Forward 5´ TGCTGGTGCTGAGTATGTCG 3´ Reverse 5´ TTGAGAGCAATGCCAGCC 3´ gene bank accession NM_017008

group, Group 2: (COPD group): COPD rats maintained un-treated for the experimental period, Group 3: (Vit. D+COPD):

COPD rats were treated with vitamin D injection 1, 25 (OH)

D3 was administered intraperitoneally (i.p.) at dose 0.5µg/kg of body weight (BW), 3 times a week for 8 weeks, Group 4:

(COPD+ Exercise): COPD rats performed daily exercise

program and group 5: (COPD+Vit D+exercise) COPD rats

treated with vitamin D injection (i.p.) at a dose of 0.5µg/kg, 3 times a week for 8 weeks and performed daily exercise

program. After 8 weeks of treatment, pulmonary functions were tested and blood samples were withdrawn for measuring vitamin D and Ca2+ levels and the lung tissues were excised to measure interleukin 12 (IL12), tumor necrosis factor alpha

(TNF alpha), metalloproteinase-9 (MMP-9) and cathelicidin.

Results: Peak expiratory flow (PEF), forced vital capacity (FVC), vitamin D and Ca2+ were significantly reduced in COPD rats after 12 weeks of exposure to cigarette smoke.

Vitamin D supplementation and swimming training for 8 weeks improved PEF, FVC, vitamin D and Ca2+ significantly

as compared to untreated COPD. Combined vitamin D treat-ment and physical training significantly improved FVC level as compared with each treatment separately. The improvement

was associated with significant reduction in inflammatory

markers and MMP-9 as compared to COPD untreated rats.

The antimicrobial cathelicidin was significantly increased in

COPD rats and was further increased on vitamin D treatment

but not with exercise training.

Conclusion: Our results showed that COPD is an inflam-matory disease and it is associated with vitamin D deficiency. Vitamin D supplement or rehabilitation by physical training

each separately improved the pulmonary functions, reduced

inflammation, and attenuate lung parenchymal degradation.

Vitamin D in addition induced an antimicrobial protection,

however vitamin D supplement had a slightly better effects

as compared with exercise training. Combination of both vitamin D supplementation and exercise training had a syner-gistic effect and produced a significant improvement as

compared to each therapy separately. We can conclude that

Table (1): Changes in pulmonary functions (PEF and FVC) in untreated COPD rats and in

COPD rats after 8 weeks of either vitamin D supplementation, exercise training

or both.

Control COPD COPD+ Vit D

COPD+ exercise

COPD+ vit D+exercise

PEF (mL/min) Mean±S.D. 13.65± 1.04a

6.78± 1.15b 10.36±0.87c

8.80±0.89d 10.45± 1.02c

FVC (mL) Mean±S.D. 9.24±0.78a

4.81±0.85b 7.90±0.54 c

6.21 ±0.56c 8.43±0.63 a

- (n=8). - Values are Mean±SD. - Values with different letters in the same row are significantly different from each other ( p<0.05). - Values with the same letters in the same row are insignificantly different from each other ( p>0.05).

c d

Copd+ vit d exercise

c

Copd+ vit d+

exercise

a

b

Control Copd Copd+

PE

F m

L/m

in

16.00

14.00

12.00

10.00

8.00

6.00

4.00

2.00

0.00 Control Copd Copd+

vit d Copd+

exercise Copd+ vit d+

exercise

a

b

c

c

a

FV

C =

mL

12.00

10.00

8.00

6.00

4.00

2.00

0.00

a

b

a a a

Control Copd Copd+ vit d

Copd+ exercise

Copd+ vit d+

exercise

0

70

60

50

40

30

20

10

Vit

D (

ng/m

l)

Control Copd Copd+

Copd+

Copd+ vit d

exercise vit d+ exercise

Ca2

+ (

mg/

di)

12

10

8

6

4

2

0

a

b

a ab a


Fig. (1): Effects of vitamin D supplement and physical training

for 8 weeks on pulmonary function (PEF) in COPD rats (Mean±SD).

Effect of COPD, vitamin D supplementation,

and exercise training on vitamin D levels and serum Ca2+ level in rats:

As expected from previous researches the present results showed deficiency of vitamin D

and a hypocalcaemic state in rats with COPD and


for 8 weeks on pulmonary function (FVC) in COPD rats (Mean±SD).

the levels of vitamin D and Ca2+ were significantly reduced in COPD rats as compared to control rats.

It can be seen from Table (2) and Figs. (3,4) that

vitamin D supplementation and/or exercise correct-ed the deficiency and the values of these two parameters were back to normal control values.

Table (2): Effects of vitamin D supplement and physical training for 8 weeks on serum

levels of vitamin D and Ca2+ in COPD rats.


COPD+ exercise


Vit D (ng/ml) Mean±S.D. 52.25±8.65a

29.00±5.41 b 51.41±3.06a

53.95±5.92a 52.46±9.48a

Ca (mg/dl) Mean±S.D. 10.18±0.32a

7.40±0.57b 9.25±0.48a

8.48±0.82ab

9.75±0.43 a

- (n=8). - Values are mean±SD. - Values with different letters in the same row are significantly different from each other ( p<0.05). - Values with the same letters in the same row are insignificantly different from each other ( p>0.05).


for 8 weeks on serum level of vitamin D in COPD rats (Mean±SD).

Changes in inflammatory markers TNF alpha and IL12 in lung tissues in untreated COPD rats and in COPD rats after 8 weeks of either vitamin D supplementation, exercise training or both:

The results of the present work confirmed that

COPD is an inflammatory disease. As shown in


for 8 weeks on serum Ca2+ levels in COPD rats (Mean±SD).

Table (3) and Figs. (5,6), lung TNF alpha and IL12 were significantly increased in COPD rats as com-pared to control rats. Treatment with i.p. injection

of vitamin D, for 8 weeks reduced the inflammation

and the levels of the inflammatory markers were

significantly decreased as compared to the untreated

COPD rats. Physical training induced also an anti-

Control Copd Copd+

Copd+

Copd+ vit d


IL-1

2 (p

g/m

l)

160

140

120

100

80

60

40

20

0

a

b

c

d

e

Control Copd Copd+

Copd+

Copd+ vit d


TN

F-al

pha

(pg/

ml)

350

300

250

200

150

100

50

0

a

b

c d

e


inflammatory effect and significantly reduced the

level of TNF alpha and IL 12 as compared to the untreated COPD rats but the reduction was signif-icantly less than that produced by vitamin D treat-

ment. Combined treatment with vitamin D and

physical training induced a further significant

decline in the levels of inflammatory markers as compared to each treatment alone.

Table (3): Effects of vitamin D supplement and physical training for 8weeks on lung inflammatory markers

(TNF alpha and IL10), matrix degradation (MMP-9) and antimicrobial (cathelidicine) in COPD

rats.


COPD+ exercise


IL-12 (pg/ml) Mean±S.D. 30.56±4.05a

113.66± 19.75b 56.93±7.03 c

86.86±5.09d 44.99±4.60e

TNF-alpha (pg/ml) Mean±S.D. 46.60±9.53 a

266.56±59.59b 133.24±8.96c

152.63 ± 17.78d 102.46±9.18 e

MMP-9 Mean±S.D. 1.35±0.32a 9.51± 1.85b 5.42±0.70c

6.62±0.35d 4.68±0.56e

Cathelicidin Mean±S.D. 0.14±0.03 a

0.3 8±0.06b 0.86±0.12c

0.39±0.13 b 0.84±0.10c

- (n=8). - Values are Mean±SD. - Values with different letters in the same row are significantly different from each other ( p<0.05). - Values with the same letters in the same row are insignificantly different from each other ( p>0.05).


for 8 weeks on lung inflammatory marker (IL12) in

COPD rats (Mean±SD).


and exercise training on mRNA of lung matrix

(MMP-9): Table (3) and Fig. (7) show that in rats devel-

oped COPD there is enhanced degradation of lung

parenchyma as indicated by elevated level of MMP-9 in lung tissues. Treatment of COPD rats with vitamin D for 8 weeks or exercise significantly reduced destruction of lung tissue by attenuation

of MMP-9 production as compared to the untreated

rats. It can be observed that vitamin D supplemen-tation caused a more significant reduction in MMP-9 production than did exercise training. Combining both therapy together induced a better improvement


for 8 weeks on lung inflammatory marker (TNFalpha)

in COPD rats (Mean ±SD).

and a significant reduction in MMP-9 in lung tissues as compared to each therapy alone.


and exercise training on mRNA of antimicrobial cathelicidin in lung tissue:

Table (2) and Fig. (8) showed that COPD was

associated with a significant increase in the level

of antimicrobial cathelicidin. Vitamin D supple-mentation for eight weeks alone or in combination

with exercise training induced a further significant

increase in its value. Exercise alone had no effect

on the lung level of cathelicidin as compared to

COPD untreated group.

a

b

c d

e


Copd+ exercise

Copd+ vit d+

exercise

0

12

10

8

6

4

2

MM

P-9

a

b

c c

b


Copd+ exercise

Copd+ vit d+

exercise

0

Cat

helic

idin

e

1.2

1

0.8

0.6

0.4

0.2



for 8 weeks on M RNA of lung matrix degradation (MMP-9) in COPD rats (Mean ±SD.


for 8 weeks on mRNA of antimicrobial (cathelicidin) in COPD rats (Mean ±SD.).

Discussion

Chronic obstructive pulmonary disease (COPD) has been defined as a preventable and treatable

pathologic condition characterized by partially reversible airflow limitation [35] . It is well known that cigarette smoke is one of the most important

risk factors for COPD, and it can accelerate the

development of COPD in humans [36] . In this study, we found that exposure to cigarette smoke caused

COPD after 12 weeks in male albino rats; it pro-duced a significant reduction in pulmonary function

as detected by a significant decrease in mean values

of PEF and FVC as compared to control group.

Short term exposure to noxious gases as ciga-rette smoke (days) [37] resulted in a pulmonary inflammatory infiltrate, increased mucus produc-tion, and pulmonary edema. Long term induction protocols (weeks or months) [38] produced, in addition to the inflammatory infiltrate, emphysema

and pulmonary remodeling characterized by fibro-sis, and thickened bronchiole and arterial walls.

In the present study, we found that vitamin D was deficient in rats with COPD and that the dose

of vitamin D supplemented in our study was enough to raise the blood vitamin D level to be comparable with the control value. Exercise protocol performed in COPD rats also was able to significantly increase

vitamin D level as compared to COPD untreated

rats. In rats with COPD treated with both vitamin

D and exercise, there was a significant increase in

vitamin D levels as compared with the COPD untreated rats but the increase was insignificant

when compared with vitamin D or exercise treated rats.

There are several factors that could account for vitamin D deficiency in COPD patients: Poor diet,

a reduced capacity of aging skin for vitamin D synthesis, reduced outdoor activity and therefore

sun exposure, an increased catabolism by gluco-corticoids, impaired activation because of renal dysfunction, and a lower storage capacity in mus-cles or fat due to wasting [38] . Many steps of the vitamin D pathway (intake, synthesis, storage,

metabolism) can potentially be disturbed in COPD patients.

In agreement with our results, Forli et al., [12] found vitamin D deficiency (in their study defined

as below 20ng/ml) in more than 50% of a cohort

waiting for lung transplantation. In an outpatient

study on patients with COPD in Denmark, 68% of the participants had osteoporosis or osteopenia

[40] . A recent study showed that vitamin D defi-ciency is highly prevalent in COPD and correlates with variants in the vitamin D binding gene [41] .

Moderate endurance exercise increases serum 1,25(OH)2D3 level [42,43] . Also, Sato et al., [44] , reported that immobilization, in contrast to endur-ance exercise, 1,25-(OH) 2D3 are suppressed. How-ever, Maimoun et al., [45] , reported that in exercise trained rats, serum 1,25-(OH) 2D3 concentration was not affected.

In this study vitamin D supplementation, exer-cise training or both significantly improved pul-monary functions compared with COPD untreated

group.

In agreement with our results, a strong relation-ship between serum levels of vitamin D and lung

function (FEV1 and FVC) was found [46,47] . In another study, 25(OH)D was correlated with FEV1

[48] . Ferrari et al., [49] also demonstrated that the maximal exercise capacity and carbon monoxide transfer in the single breath method were both

positively correlated with serum 25(OH)D concen-trations.


A cross-sectional study found that higher plasma

levels of vitamin D are associated with increased

bone mineral density and exercise capacity in

people with COPD [50] . Evidence also showed that high dose vitamin D supplementation improved

respiratory muscle strength and exercise capacity in people with COPD [51] . Epidemiological studies revealed a dose-dependent association between

serum 25(OH)D levels and pulmonary function so

that adequate vitamin D supplementation may extend beyond its protection against osteoporotic fractures [52] .

However Shaheen et al., [53] reported that total vitamin D intake was positively associated with forced expiratory volume in 1 s (FEV1); they did not confirm a positive association between blood

25(OH)D concentrations and adult lung function.

They suggested that the apparent relationships with

dietary vitamin D are likely to be explained by

other highly correlated nutrients in the diet.

Also, Bjerk et al., [54] , reported that short-term vitamin D supplementation in patients with COPD

had no discernible effect on a simple measure of

physical performance [55] .

As regard the effects of physical exercise on

pulmonary functions, there was a controversy.

Maltais et al., [56] reported improvement of pulmo-nary functions FEV 1 and demonstrated physiologic gain following 12 weeks of exercise in persons with severe COPD. Similar improvement in phys-iologic parameters have been confirmed by several

additional studies [57,58] .

On the other hand, Flo et al., [59] , reported worsening of pulmonary emphysema induced by exercise training. Their hypothesis is that the increase in mechanical forces on the connective tissue may contribute to the worsening of pulmo-nary function. One alternative explanation for the

worsening of emphysema induced by exercise was the presence of exercise-induced oxidative stress.

It has been demonstrated that strenuous aerobic

exercise is associated with oxidative stress and

tissue damage [60,61] . However, moderate exercise training is associated with adaptive responses in

at least some antioxidant capacities [62] .

The beneficial effect of vitamin D supplemen-tation and or exercise on pulmonary functions

could depend on the calcemic effects of vitamin

D.

In the present study it was observed that the

calcium levels in the blood of COPD rats were

significantly lower than normal control. Treatment of the COPD rats for 8 weeks with vitamin D

improved the calcemic state of the rats to the normal control values. Also in the exercise trained

group or combined vitamin D and exercise group calcium levels were increased to be insignificantly

changed as compared to the control rats.

The vital capacity and total lung capacity were found to decline with an increasing number of

thoracic vertebral fractures as a direct consequence

of vitamin D deficiency and hypocalcemia [63] . Nuti et al., observed 3030 ambulatory COPD pa-tients and found a strong association between

COPD severity and fractures [64] . Kyphosis related to osteoporosis caused limitation in rib mobility and inspiratory muscle function and correlated

with a reduction in FEV 1 and FVC [65] . The altered properties of the thoracic skeleton could result in

failure of the respiratory muscles contributing to

the pathophysiology of COPD.

It was seen from the results of this study that

exercise also improved pulmonary functions in COPD rats and we can find that also exercise improved the calcemic state in COPD rats. Blood

Ca2+ levels were increased but not significantly in exercise trained groups as compared with un-treated COPD rats.

In agreement with our results, Yeh et al., report-ed that in exercise trained rats plasma ionized calcium slightly increased [42] . Previous studies suggest that moderate endurance exercise increases

serum 1,25(OH)2D3 level, decreases urinary calci-um excretion [43] . By using a flat-bed treadmill exercise, Yeh and co-workers found that the endur-ance exercise trained female Sprague-Dawley rats had higher duodenal active, but not passive, calcium absorption than the control [42] . Although exercise-enhanced intestinal calcium absorption is likely

mediated by an increase in serum 1,25-(OH) 2D3 level, exercise may also stimulate calcium absorp-tion by changing intestinal motility and epithelial permeability [66,67] .

Acute exacerbations of COPD are an important

cause of hospitalization and lead to a faster decline

in FEV 1 [68] . Exacerbations are triggered by virus-es, bacteria, atypical strains, or a combination of these [69,70] .

In the present study it was found that vitamin D treatment enhances the innate immune system

by inducing the production of antimicrobial cathe-licidin and was associated with a significant in-crease in its lung production.

The occurrence of exacerbations, which are very often caused by bacterial or viral infections,

increases the severity of COPD and causes a higher


death rate in humans [71] . 1,25(OH)2D3 is a direct regulator of antimicrobial peptides, such as cathe-licidin (camp) and defensin ß2 (defß2) genes that are driven by vitamin D response elements

(VDRE)-containing promoters, revealing the po-tential therapeutic role of vitamin D3 analogs

against opportunistic infections, including the infections in the respiratory tracts which occurs in patients with COPD susceptible to exacerbations [72] .

In agreement with our results, Vazirnia ei al., [73] reported a beneficial effect of 1,25(OH) 2D on the innate immunity and they also found an eleva-tion of the antimicrobial cathelicidin in cases treated

with vitamin D.

Several interventional studies examining the effect of vitamin D supplementation on the risk of

influenza [74,75] and in patients with active tuber-culosis showed a significantly reduced risk for influence an improved immunity against mycobac-teria [76,77] . There was also a higher rate of tuber-culosis symptom improvement in children [78] .

Several mechanisms could explain vitamin D’s potentially beneficial effects on infectious diseases.

In addition to its antimicrobial effect, vitamin D

can affect the inflammatory response. In the present

study, the increase of lung production of inflam-matory mediators in untreated COPD rats relative to healthy controls are in agreement with those

previously reported in patients with stable COPD of similar severity and body mass index [79] . Studies have also reported increased levels of circulating

cytokines (interleukin (IL)-6 and -8 and tumour

necrosis factor-a (TNF-(x) and acute phase reactant

protein (C-reactive protein (CRP), both of which reflect systemic inflammation, in the peripheral

circulation of stable COPD patients [80,81] .

In agreement with our results, it was reported

that 1,25D (1,25-dihydroxyvitamin D) decreases

TNF-alpha [82] . Other studies showed that vitamin D can modulate the activity of various immune

cells and inhibit inflammatory responses [83,84] . It was reported that vitamin D-induced inhibition of

IL-12 release by dendritic cells has a profound

effect on T lymphocyte differentiation [85] . Vitamin D-binding protein has immunomodulatory functions pertinent to the lung, and is associated with acti-vation of macrophages and neutrophil chemotaxis

[19] .

In agreement with our results, regular exercise

was noted to protect against diseases associated

with chronic inflammation [86] . On the other hand, American Thoracic Society reported that exercise

induced oxidative stress and could, inversely,

induce abnormal exercise-induced inflammation

in COPD. Plasma inflammatory mediators TNF alpha and IL-6 were not significantly modified by

training. Pulmonary rehabilitation can induce pe-ripheral muscle adaptations without decreasing the levels of systemic or local muscle inflammation [87] .

In our study it can be observed that matrix

metalloproteinasis-9 (MMP-9) is significantly elevated in lung tissues of COPD rats and a caus-ative role has been suggested in the development

of COPD [88] . The effect of vitamin D on extracel-lular matrix homeostasis not only in bone tissue,

but also within the lung may have a role in COPD

development. In the present study, vitamin D sup-plementation significantly reduced MMP-9 pro-duction in lung tissues of treated COPD rats as compared with untreated controls.

In agreement with our results, Boyan and Schwartz [89] found vitamin D to be an autocrine regulator of extracellular matrix turnover and

growth factor release via matrix metalloproteinases.

Also Bahar-Shany et al., [90] reported that vitamin D attenuates MMP-9 production in keratinocytes

and they suggested that vitamin D deficiency may

lead to a reduced attenuation of MMP-9 activity

resulting in enhanced degradation of lung paren-chyma.

Our results showed that exercise training re-duced lung production of MMP-9, suggesting that

exercise training may be important not only in

pulmonary rehabilitation in COPD but also as an adjuvant in the prevention and progression of lung

destruction due to cigarette smoking.

Few studies investigated the effect of physical training on lung production of MMP-9 in COPD. Toledo et al., [91] found a decrease in TIMP 1 in mice exposed to cigarette smoke that was reversed by aerobic exercise.

Conclusion: We can see from the results of this work that,

COPD is an inflammatory disease and it is associ-ated with vitamin D deficiency. Vitamin D supple-ment or rehabilitation by physical training each separately improved the pulmonary functions, reduced inflammation, and attenuate lung paren-chymal degradation. Vitamin D in addition induced an antimicrobial protection, however vitamin D

supplement had a slightly better effects as compared

with exercise training. Combination of both vitamin

D supplementation and exercise training had a


synergistic effect and produced a significant im-provement as compared to each therapy separately.

We can conclude that vitamin D supplement has

a beneficial effects as a therapy in cases of COPD

and it is better added to rehabilitation training

programs for better results.

References

1- ANTO J.M., VERMEIRE P., VESTBO J. and SUNYER J.: Epidemiology of chronic obstructive pulmonary disease.

Eur. Respir. J., 17: 982-994, 2001.

2- MANNINO D.M., DOHERTY D.E. and BUIST A.S.: Global Initiative on Obstructive Lung Disease (GOLD) classification of lung disease and mortality: Findings from the Atherosclerosis Risk in Communities (ARIC) study. Respir. Med., 100: 115-122, 2006.

3- VESTBO J. and RODRIGUEZ-ROISIN R.: GOLD and the fixed ratio. Eur. Respir. J., 38: 481-482, 2011.

4- HOESEIN F.A.A.M., ZANEN P. and LAMMERS J.W.J.: Lower limit of normal or FEV1/FVC <0.70 in diagnosing COPD: An evidence-based review. Respir. Med., 105:

907-915, 2011.

5- CHURG A., COSIO M. and WRIGHT J.L.: Mechanisms of cigarette smoke-induced COPD: insights from animal models. Am. J. Physiol. Lung. Cell. Mol. Physiol., 294: L612-L631, 2008.

6- SPURZEM J.R. and RENNARD S.I.: Pathogenesis of COPD. Semin. Respir. Crit. Care Med., 26: 142-53, 2005.

7- FABBRI L.M. and HURD S.S.: Global strategy for the diagnosis, management and prevention of COPD: Update. Eur. Respir. J., 22: 1-2, 2003.

8- ELIAS J.: The relationship between asthma and COPD:

Lessons from transgenic mice. Chest, 126 (Suppl 1):

111 S-6S, 2004.

9- MACNEE W.: Pulmonary and systemic oxidant/antioxidant

imbalance in chronic obstructive pulmonary disease. Proc.

Am. Thorac. Soc., 2: 50-60, 2005.

10- GREESNPAN F. and GARDNER D.G.: Basic and Clinical Endocrinology. 6 th edn. New York: Lange Medical books/McGraw Hill Publishing, pp. 281-8, 2001.

11-BOUILLON R., CARMELIET G., VERLINDEN L., VAN ETTEN E., VERSTUYF A., LUDERER H.F., LIEBEN L., MATHIEU C. and DEMAY M.: Vitamin D and human health: Lessons from vitamin D receptor null mice. Endocr.

Rev., 29: 726-76, 2008.

12- FORLI L., HALSE J., HAUG E., et al.: Vitamin D defi-ciency, bone mineral density and weight in patients with advanced pulmonary disease. J. Intern. Med., 256: 56- 62, 2004.

13- RIANCHO J.A., GONZALEZ MACIAS J., DEL ARCO C., AMADO J.A., FREIJANES J. and ANTON M.A.: Vertebral compression fractures and mineral metabolism

in chronic obstructive lung disease. Thorax., 42: 962-6, 1987.

14- EL-RADHI A.S., MAJEED M., MANSOR N. and IBRA-HIM M.: High incidence of rickets in children with wheezy bronchitis in a developing country. J. R. Soc. Med., 75: 884-7, 1982.

15- IQBAL F., MICHAELSON J., THALER L., RUBIN J., ROMAN J. and NANES M.S.: Declining bone mass in men with chronic pulmonary disease: Contribution of

glucocorticoid treatment, body mass index, and gonadal function. Chest, 116: 1616-24, 1999.

16- TAVEIRA-DASILVA A.M., STYLIANOU M.P., HEDIN C.J., HATHAWAY O. and MOSS J.: Bone mineral density in lymphangioleiomyomatosis. Am. J. Respir. Crit. Care Med., 171: 61-7. (PubMed.), 2005.

17- CAPLAN-SHAW C.E., ARCASOY S.M., SHANE E., et al.: Osteoporosis in diffuse parenchymal lung disease.

Chest, 129: 140-6, 2006.

18- LIN R. and WHITE J.H.: The pleiotropic actions of vitamin D. Bioessays, 26: 21-28, 2004.

19- CHISHIMBA L., THICKETT D.R., STOCKLEY R.A. and WOOD A.M.: The vitamin D axis in the lung: A key role for vitamin D-binding protein. Thorax., 65: 456-462,

2010.

20- CANTORNA M.T.: Vitamin D and autoimmunity: Is vitamin D status an environmental factor affecting au-toimmune disease prevalence? Proc. Soc. Exp. Biol. Med.,

223: 230-233, 2000.

21- WHITE J.H.: Vitamin D signaling, infectious diseases, and regulation of innate immunity. Infect. Immun., 76: 3837-3843, 2008.

22- SUNDAR I.K., HWANG J.W., WU S., SUN J. and RAH-MAN I.: Deletion of vitamin D receptor leads to premature

emphysema/COPD by increased matrix metalloproteinases

and lymphoid aggregates formation. Biochem. Biophys.

Res. Commun., 406: 127-133, 2011.

23- LEHOUCK A., MATHIEU C., BOUILLON R., VERHAE-GEN J., VAN ELDERE J., DECALLONNE B., CAR-REMANS C., BAEKE F., DECRAMER M. and JANS-SENS W.: High doses of vitamin D for the treatment of COPD exacerbations: an intervention trial. Am. J. Respir.

Crit. Care Med., 183: A5372, 2011.

24- DEBIGARE R., COTE C.H. and MALTAIS F.: Peripheral muscle wasting in Chronic Obstructive Pulmonary Disease.

Am. J. Respir. Crit. Care Med., 164: 1712-1717, 2001.

25- American Thoracic Society. Pulmonary rehabilitation. Am. J. Respir. Crit. Care Med., 159: 1666-1682, 1999.

26- CASABURI R., PORSZASZ J., BURNS M.R., CHANG R.S.Y. and COOPER C.B.: Physiologic benefits of exercise

training in rehabilitation of patients with severe chronic

obstructive pulmonary disease. Am. J. Respir. Crit. Care Med., 155: 1541-1551, 1997.

27- LI Y., LI S.Y., LI J.S., DENG L., TIAN Y.G., JIANG S.L.,

WANG Y. and WANG Y.Y.: A rat model for stable chronic

obstructive pulmonary disease induced by cigarette smoke

inhalation and repetitive bacterial infection. Biol. Pharm. Bull., 35 (10): 1752-60, 2012.

28- LOKESHWAR B.L., SCHWARTZ G.G., SELZER M.G., BURNSTEIN K.L., ZHUANG S.H., BLOCK N.L. and BINDERUP L.: Inhibition of Prostate Cancer Metastasis

in Vivo: A Comparison of 1,25-Dihydroxyvitamin D (Calcitriol) and EB10891. Cancer Epidemiol Biomarkers Prev., 8: 241, 1999.

29- YOUNGJEON LEE, JOO-HEON KIM, YUNKYUNG HONG, SANG-RAE LEE, KYU-TAE CHANG and YONGGEUN HONG: Prophylactic effects of swimming


exercise on autophagy-induced muscle atrophy in diabetic rats. Lab. Anim. Res., 28 (3): 171-179, 2012.

30- ABEER A.A. SALAMA, HALA F. ZAKI, SIHAM M. EL-SHENAWY, EL-DENSHARY E.S.M. and ISMAIEL EL KASSABY ISMAIEL NERMEEN M.: Shaffie. Effects

of Fish oil and Dexamethasone in Experimentally-Induced

Bronchial Asthma. Australian Journal of Basic and Applied

Sciences, 6 (13): 497-506, 2012.

31- WIELDERS J.P. and WIJNBERG F.A.: Preanalytical stability of 25(OH)-vitamin D3 in human blood or serum at room temperature: Solid as a rock. Clin. Chem., 55

(8): 1584-5, 2009.

32- MASKOS K., FERNANDEZ-CATALAN C., HUBER R., BOURENKOV G.P., BARTUNIK H., ELLESTAD G.A., REDDY P., WOLFSON M.F., RAUCH C.T., CAST-NER B.J., DAVIS R., CLARKE H.R., PETERSEN M., FITZNER J.N., CERRETTI D.P., MARCH C.J., PAXTON R.J., BLACK R.A. and BODE W.: Crystal structure of

the catalytic domain of human tumor necrosis factor-alpha-converting enzyme. Proc. Natl. Acad. Sci. USA,

95 (7): 3408-12, 1998.

33- HAYES M.P., WANG J., NORCROSS M.A.: Regulation of interleukin-12 expression in human monocytes: Selec-tive priming by interferon-gamma of lipopolysaccharide-inducible p35 and p40 genes. Blood, 86 (2): 646-50, 1995.

34- KENNETH J. LIVAK and THOMAS D.: Schmittgen: Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 22DDCT. Methods, 25: 402-408, 2001.

35- LI Y., LI S.Y., LI J.S., DENG L., TIAN Y.G., JIANG S.L.,

WANG Y. and WANGA Y.Y.: A rat model for stable chronic obstructive pulmonary disease induced by cigarette

smoke inhalation and repetitive bacterial infection The

Pharmaceutical Society of Japan Biol. Pharm. Bull., 35

(10): 1752-1760, 2012.

36- TANTUCCI C. and MODINA D.: Lung function decline

in COPD. Int. J. Chron. Obstruct. Pulmon. Dis., 7: 95- 99, 2012.

37- HARDAKER E.L., FREEMAN M.S., DALE N., BAHRA P., RAZA F., BANNER K.H. and POLL C.: Exposing rodents to a combination of tobacco smoke and li-popolysaccharide results in an exaggerated inflammatory response in the lung. Br. J. Pharmacol., 160: 1985-1996,

2010.

38- MUR˘ARESCU E.D., ELOAE-ZUGUN F. and MIHAIL-

OVICI M.S.: Experimental COPD induced by solid com-bustible burn smoke in rats: A study of the emphysematous

changes of the pulmonary parenchyma. Rom. J. Morphol. Embryol., 49: 495-505, 2008.

39- HOLICK M.F.: Vitamin D deficiency. N. Engl. J. Med., 357: 266-281, 2007.

40- JORGENSEN N.R., SCHWARZ P., HOLME I., HEN-RIKSEN B.M., PETERSEN L.J. and BACKER V.: The prevalence of osteoporosis in patients with chronic ob-structive pulmonary disease: A cross sectional study.

Respir. Med., 101: 177-185, 2007.

41- JANSSENS W., BOUILLON R., CLAES B., CAR-REMANS C., LEHOUCK A., BUYS SCHAERT I., et al.: Vitamin D Deficiency is Highly Prevalent in COPD and Correlates with Variants in the Vitamin D binding gene.

Thorax., 65: 215-20, 2010.

42- YEH J.K. and ALOIA J.F.: Effect of physical activity on calciotropic hormones and calcium balance in rats. Am. J. Physiol., 258: E263-E268, 1990.

43- YEH J.K., ALOIA J.F. and YASUMURA S.: Effect of physical activity on calcium and phosphorus metabolism in the rat. Am. J. Physiol., 256: E1-E6, 1989.

44- SATO T., YAMAMOTO H., SAWADA N., NASHIKI K., TSUJI M., NIKAWA T., ARAI H., MORITA K., TAKETANI Y. and TAKEDA E.: Immobilization decreas-es duodenal calcium absorption through a 1,25-dihyd-roxyvitamin D-dependent pathway. J. Bone. Miner. Metab.,

24: 291-299, 2006.

45- MAIMOUN L., SIMAR D., MALATESTA D., CAIL-LAUD C., PERUCHON E., COURET I., ROSSI M. and MARIANO-GOULART D.: Response of bone metabolism related hormones to a single session of strenuous exercise in active elderly subjects. Br. J. Sports. Med., 39: 497- 502, 2005.

46- BLACK P.N. and SCRAGG R.: Relationship between se-rum 25-hydroxyvitamin d and pulmonary function in the third national health and nutrition examination survey.

Chest, 128: 3792-3798, 2005.

47- BERG I., HANSON C., SAYLES H., ROMBERGER D., NELSON A., MEZA J., MILLER B., WOUTERS E.F., MACNEE W., RUTTEN E.P., ROMME E.A., VESTBO J., EDWARDS L. and RENNARD S.: Vitamin D, vitamin D binding protein, lung function and structure in COPD. Respir. Med., 107 (10): 1578-88, 2013.

48- BOUILLON R.W., CLAES B., CARREMANS C., LE-HOUCK A., BUYSSCHAERT I., COOLEN J., MATHIEU C., DECRAMER M., et al.: Vitamin D defi-ciency is highly prevalent in COPD and correlates with

variants in the vitamin D-binding gene. Thorax., 65: 215- 20, 2010.

49- FERRARI M., SCHENK K., PAPADOPOULOU C., FER-RARI P., CARBONARE L.D. and BERTOLDO F.: Serum 25-hydroxy vitamin D and exercise capacity in COPD. Thorax. Epub., 2010.

50- WRIGHT R.J.: Make no bones about it: increasing epide-miologic evidence links vitamin D to pulmonary function

and COPD. Chest, 128: 3781-3783, 2005.

51- ROMME E.A., RUTTEN E.P., SMEENK F.W., SPRUIT M.A., MENHEERE P.P. and WOUTERS E.F.: Vitamin D status is associated with bone mineral density and func-tional exercise capacity in patients with chronic obstructive

pulmonary disease. Ann. Med., 45 (1): 91-6, 2013.

52- HORNIKX M., REMOORTE H.V., LEHOUCK A., MATHIEU C., MAES K., RAMIREZ G.G., DECRAMER M., TROOSTERS T. and JANSSENS W.: Vitamin D supplementation during rehabilitation in COPD: a second-ary analysis of a randomized trial. Respiratory Research,

13: 84, 2012.

53- SHAHEEN S.O., JAMESON K.A., ROBINSON S.M., BOUCHER B.J., SYDDALL H.E., SAYER A.A., COO-PER C., HOLLOWAY J.W. and DENNISON E.M.: Re-lationship of vitamin D status to adult lung function and COPD. Thorax., 66 (8): 692-8, 2011.

54- BJERK S.M., BRADLEY D. EDGINGTON and KEN M. KUNISAKI: Supplemental vitamin D and physical per-formance in COPD: A pilot randomized trial. Int. J. Chron.

Obstruct. Pulmon. Dis., 8: 97-104, 2013.


55- GILBERT C.R., ARUM S.M. and SMITH C.M.: Vitamin D deficiency and chronic lung disease. Can. Respir. J.,

16 (3): 75-80, 2009.

56- MALTAIS F., LEBLANC P., SIMARD C., JOBIN J., BERUBE C., BRUNEAU J., et al.: Skeletal muscle adap-tation to endurance training in patients with chronic

obstructive pulmonary disease. Am. J. Respir. Crit. Care Med., 154: 442-47, 1996.

57- ROCHESTER C.L.: Exercise training in chronic obstruc-tive pulmonary disease. Journal of Rehabilitation Research and Development, 40: 59-80, 2003.

58- JANSSENS W., LEHOUCK A., CARREMANS C., BOUILLON R., MATHIEU C. and DECRAMER M.: Vitamin D beyond bones in chronic obstructive pulmonary disease: Time to act. Am. J. Respir. Crit. Care Med., 179

(8): 630-6, 2009.

59- FLÓ E.C., FERNANDA D.T.Q.S. LOPES, DAVID I. KASAHARA, ANNA CECÍLIA D. SILVA, RITA C.C. JESUS, DOLORES H.R.F. RIVERO, PAULO H.N. SALDIVA, MILTON A. MARTINS and WILSON JA-COB-FILHO.: Effects of exercise training on papain-induced pulmonary emphysema in Wistar rats. Journal of Applied Physiology, 101 Volume 1, 2006.

60- KUMAR T.C., REDDY K.V., ANURADHA D. and RED-DANNA P.: Enhanced production of LTB4 and free rad-icals in rat lung by exhaustive physical exercise. Biochem. Mol. Biol. Int., 741: 641-646, 1995.

61- REDDY V.K., KUMAR C.T., PRASAD M. and RED-DANNA P.: Exercise-induced oxidant stress in the lung tissue: role of dietary supplementation of vitamin E and

selenium. Biochem. Int., 26: 863-871, 1992.

62- TERBLANCHE S.E.: The effects of exhaustive exercise on activity levels of catalase in various tissues of male and female rats. Cell. Biol. Int., 23: 749-753, 1999.

63- ASAMI S., HIRANO T., YAMAGUCHI R., TSURUDOME Y., ITOH H. and KASAI H.: Effects of forced and spon-taneous exercise on 8-hydroxydeoxyguanosine levels in

rat organs. Biochem Biophys Res. Commun., 243: 678- 682, 1998.

64- NUTI R., SIVIERO P., MAGGI S., GUGLIELMI G., CAFFARELLI C., CREPALDI G., et al.: Vertebral frac-tures in patients with chronic obstructive pulmonary

disease: The EOLO Study. Osteoporos Int., 20: 989-998,

2009.

65- SCHLAICH C., MINNE H.W., BRUCKNER T., WAGNER G., GEBEST H.J., GRUNZE M., et al.: Reduced pulmo-nary function in patients with spinal osteoporotic fractures.

Osteoporos Int., 8: 261-267, 1998.

66- SMETANKA R.D., LAMBERT G.P., MURRAY R., EDDY D., HORN M. and GISOLFI C.V.: Intestinal per-meability in runners in the. Chicago marathon. Int. J. Sport. Nutr., 9: 426-433, 1999.

67- CHAROENPHANDHU N.: Physical activity and exercise

affect intestinal calcium absorption: A perspective review.

Journal of Sports Science and Technology, Volume 7, No. 1,2, 2007.

68- NIEWOEHNER D.E.: The impact of severe exacerbations on quality of life and the clinical course of chronic obstructive pulmonary disease. Am. J. Med., 119: 38-45,

2006.

69- CAMARGO C.A.Jr., GINDE A.A., CLARK S., CART-WRIGHT C.P., FALSEY A.R. and NIEWOEHNER D.E.: Viral pathogens in acute exacerbations of chronic obstruc-tive pulmonary disease. Intern. Emerg. Med., 3: 355-359,

2008.

70- PAPI A., LUPPI F., FRANCO F. and FABBRI L.M.: Pathophysiology of exacerbations of chronic obstructive

pulmonary disease. Proc. Am. Thorac. Soc., 3: 245-251,

2006.

71- SEEMUNGAL T.A.R., HURST J.R. and WEDZICHA J.A.: Exacerbation rate, health status and mortality in

COPD-a reiew of potential interventions. Int. J. Chron.

Obstruct. Pulmon. Dis., 4: 203-223, 2009.

72- WANG T.T., NESTEL F.P., BOURDEAU V., NAGAI Y., WANG Q., LIAO J., TAVERA-MENDOZA L., LIN R., HANRAHAN J.W., MADER S. and WHITE J.H.: Cutting

edge: 1,25-dihydroxyvitamin D3 is a direct inducer of

antimicrobial peptide gene expression. J. Immunol., 173,

2909-2912, 2004.

73- LIU P.T., STENGER S., LI H., WENZEL L., TAN B.H., KRUTZIK S.R., et al.: Toll-like receptor triggering of a

vitamin D-mediated human antimicrobial response. Sci-ence, 311: 1770-1773, 2006.

74- JORDE R., WITHAM M., JANSSENS W., ROLIGHED L., BORCHHARDT K., de BOER I.H., GRIMNES G. and HUTCHINSON M.S.: Vitamin D supplementation did not prevent influenza-like illness as; diagnosed retro-spectively by questionnaires in subjects participating in randomized clinical trials. Scand. J. Infect. Dis., 44: 126- 132, 2012.

75- URASHIMA M., SEGAWA T., OKAZAKI M., KURIHA-RA M., WADA Y. and IDA H.: Randomized trial of vitamin D supplementation to prevent seasonal influenza A in

schoolchildren. Am. J. Clin. Nutr., 91: 1255-1260, 2010.

76- MARTINEAU A.R., WILKINSON R.J., WILKINSON K.A., NEWTON S.M., KAMPMANN B., HALL B.M., PACKE G.E., DAVIDSON R.N., ELDRIDGE S.M., MAUNSELL Z.J., et al.: A single dose of vitamin D enhances immunity to mycobacteria. Am. J. Respir. Crit. Care Med., 176: 208-213, 2007.

77- MARTINEAU A.R., TIMMS P.M., BOTHAMLEY G.H., HANIFA Y., ISLAM K., CLAXTON A.P., PACKE G.E., MOORE-GILLON J.C., DARMALINGAM M., DAVID-SON R.N., et al.: High-dose vitamin D3 during intensive-phase antimicrobial treatment of pulmonary tuberculosis:

A double-blind randomised controlled trial. Lancet, 377:

242-250, 2011.

78- MORCOS M.M., GABR A.A., SAMUEL S., KAMEL M., EL BAZ M., EL BESHRY M. and MICHAIL R.R.: Vitamin D administration to tuberculous children and its value. Boll. Chim. Farm., 137: 157-164, 1998.

79- KOECHLIN C., COUILLARD A., CRISTOL J.P., et al.: Does systemic inflammation trigger local exercise_induced

oxidative stress in COPD? Eur. Respir. J., 23538-544.544,

2004.

80- WAYSE V., YOUSAFZAI A., MOGALE K. and FILTEAU S.: Association of subclinical vitamin D deficiency with severe acute lower respiratory infection in Indian children

under 5y. Eur. J. Clin. Nutr., 58: 563-567, 2004.

81- WOOD A.M., BASSFORD C., WEBSTER D., NEWBY

P., RAJESH P., STOCKLEY R.A. and THICKETT D.R.:


Vitamin D-binding protein contributes to COPD by acti-vation of alveolar macrophages. Thorax., 66 (3): 205-10,

2011.

82- KUO Y.T., KUO C.H., LAM K.P., CHU Y.T., WANG W.L., HUANG C.H. and HUNG C.H.: Effects of vitamin

D3 on expression of tumor necrosis factor-alpha and chemokines by monocytes. J. Food Sci., 75 (6): H200-4, 2010.

83- HUGHES D. A. and NORTON R.: Vitamin D and respi-ratory health. Clin. Exp. Immunol., 158 (1): 20-25, 2009.

84- MORA J.R., IWATA M. and ULRICH H.: von Andrian. Vitamin effects on the immune system: Vitamins A and

D take centre stage. Nat. Rev. Immunol., 8 (9): 685-698, 2008.

85- D'AMBROXIO D.C.M., COCCIOLO M.G., MAZZEO D., et al.: Inhibition of IL-12 production by 1,25- dihydroxyvitamin D3. Involvement of NF-kappaB down-regulation in transcriptional repression of the p40 gene. J. Clin. Invest., 101: 252-62, 1998.

86- PETERSEN A.M. and PEDERSEN B.K.: The anti-inflammatory effect of exercise. J. Appl. Physiol., 98: 1154-1162, 2005.

87- VOGIATZIS I., STRATAKOS G., SIMOES D.C., TERZIS G., GEORGIADOU O., ROUSSOS C. and ZAKYNTHI-NOS S.: Effects of rehabilitative exercise on peripheral

muscle TNFalpha, IL-6, IGF-I and MyoD expression in patients with COPD. Thorax., 62 (11): 950-6, 2007.

88- HERR C., GREULICH T., KOCZULLA R.A., MEYER S., ZAKHARKINA T., BRANSCHEIDT M. and ES-CHMANN R.: Robert the role of vitamin D in pulmonary disease: COPD, asthma, infection, and cancer. Respir.

Res., 12 (1): 31, 2011.

89- BOYAN B.D. and SCHWARTZ Z.: 1,25-Dihydroxy Vitamin D3 Is an Autocrine Regulator of Extracellular Matrix Turnover and Growth Factor Release via ERp60

Activated Matrix Vesicle Matrix Metalloproteinases. Cells. Tissues. Organs, 189 (1-4): 70-74, 2008.

90- BAHAR-SHANY K., RAVID A. and KOREN R.: Upreg-ulation of MMP-9 production by TNFalpha in kerati-nocytes and its attenuation by vitamin D. J. Cell. Physiol.,

222 (3): 729-37, 2010.

91- TOLEDO A.C., MAGALHAES R.M., HIZUME D.C., et al.: Aerobic exercise attenuates pulmonary injury induced

by exposure to cigarette smoke. European Respiratory

Journal, 39: 254-264, 2012.

Effect of Vitamin D Supplementation and/or Physical...

Documents

Transcript of Effect of Vitamin D Supplementation and/or Physical...