Effect of gene polymorphisms on pharmacokinetics of calcineurin inhibitors : Indian scenario
-
Upload
himanshu-raje -
Category
Documents
-
view
199 -
download
3
description
Transcript of Effect of gene polymorphisms on pharmacokinetics of calcineurin inhibitors : Indian scenario
STUDY OF GENE POLYMORPHISMS RELATED TO DRUG LEVEL AND CLINICAL BEHAVIOR IN KIDNEY TRANSPLANT PATIENTS: AN INDIAN
SCENARIO
A Thesis submitted to the
University of Mumbai for the
M.Sc. (by research) Degree In Applied Biology
Submitted By
Himanshu S. Raje
Under The Guidance Of
Dr. T. F. Ashavaid. Ph. D., FACB Consultant Biochemist
Head Dept. of Lab Medicine Jt. Director Research
RESEARCH LABORATORIES P.D. HINDUJA NATIONAL HOSPITAL AND MEDICAL RESEARCH CENTRE
MUMBAI - 400 016
SEPTEMBER 2008
STATEMENT BY THE CANDIDATE As required by the University Regulation No. R.2190, I wish to state that the work embodied in this thesis titled “Study of gene polymorphisms related to drug level and clinical behavior in kidney transplant patients: an Indian scenario” forms my own contribution to the research work carried out under the guidance of “Dr. T. F. Ashavaid” at the “P.D. Hinduja National Hospital And Medical Research Center.” This work has not been submitted for any other degree of this or any other university. Whenever references have been made to previous works of others, it has been clearly indicated as such and included in the Bibliography. Certified By Dr. T.F. Ashavaid. Ph.D., FACB Himanshu S. Raje Consultant Biochemist, Research Student Head Laboratory Medicine, Joint Director, Research. P.D. Hinduja National Hospital And Medical Research Centre.
CONTENTS No. CHAPTERS PAGE No. 1. INTRODUCTION 1 2. REVIEW OF LITERATURE 5 3. AIMS AND OBJECTIVES 39 4. MATERIALS AND METHODS 40 5. RESULTS AND DISCUSSION 52 6. CONCLUSION 67 7. BIBLIOGRAPHY 70 8. APPENDIX 9. SYNOPSIS
CHAPTER 1
INTRODUCTION
1
Chapter 1 - Introduction
The transplantation of organs to replace those lost or damaged through injury,
disease or deliberate mutilation has been practiced longer than most people realize,
but not successfully achieved until the later half of the twentieth century. Legend
has it that saints Cosmas and Damian, in the third century, replaced an entire
gangrenous leg removed from Justinian, a church elder in Constantinople, with one
taken from a corpse. While it is highly unlikely that this actually happened, records
dating back many centuries show that physicians on the Indian subcontinent
developed techniques for moving flaps of skin from an individual’s forehead
downward onto their face to reconstruct noses lost through injury, infection or legal
penalties involving mutilation. The first scientifically documented successful case in
western medical literature was described in 1596 by Gaspari Toggliacozzi at the
University of Bologna who, knowing that transplants between individuals had little or
no hope of success and deciding against using a wooden or metal substitute,
transferred a piece of skin from a man’s arm onto his face to reconstruct the
patient’s nose. The paramount importance of the genetic relationship between the
host and the donor to the success of a transplant was not definitively recognized
until the late 1920s when Little and Tyzzer noted a pattern in the rejection of
transplanted tumours in mice. Grafts exchanged between closely related donors
and hosts had a far greater chance of success than those done between unrelated
individuals (Auchimloss et al 1998, Charlton B et al 1994).
Because of tremendous development in the field of medicine, it is now possible to
transplant several organs like heart, liver, pancreas etc. However, the procedure to
transplant failed kidneys has significantly developed. The number of patients
undergoing kidney transplantation as well as the survival rate of organ and hence
the success rate of the procedure exceeds that of any other organ transplantation.
2
Since 1950s, renal transplantation has been increasingly used and the total number
of transplants performed on a worldwide basis, now exceeds half a million. The
increased reliance on transplantation has been possible because of constant
improvements in optimizing the matching of donors and recipients, and in the ability
to manage the host immune system to permit graft survival.
Now a days the concept of renal transplantation has become relatively
straightforward and sufficient technical skills have become available for the transfer
of grafts. However the attempts have been defeated by the recipient’s own immune
system. The immune system is unable to distinguish between the presence of “good
foreign” and “bad foreign” cells. Essentially the immune system of the recipient
views the transfer of even beneficial foreign cells as threats and attempt to destroy
the transplant. The increase in the success of renal transplantation outcome is
mainly attributed to two general discoveries 1) the role of genetics in determining
what the immune system views as foreign, leading to an ability to optimally match
donors and recipients, and 2) the development of techniques to inhibit the ability of
the immune response to damage or destroy transplanted grafts.
Most available grafts are allografts (grafts obtained from genetically non-identical
person) because of genetic diversity among humans, therefore; the alternative
solution to an attack by the immune system upon the graft is to employ some
method of minimizing the capacity of the immune system to do so, that is
immunosuppression. It is defined as the generalized inhibition of the immune
system without reference to the specificity of the rejection response.
Generalized immunosuppression is usually achieved by the application of chemical
agents or antibodies directed against cells of the immune system, particularly
lymphocytes. Drugs such as cyclosporine (CsA) and tacrolimus (FK506) (commonly
called as calcineurin inhibitors or CNIs) suppress the transcription of Interleukin-2
(IL-2) gene and target their effect on those T lymphocytes that are most actively
proliferating and responding at the time of application (presumably those that are
3
attacking the graft) leaving the remaining quiescent T and B lymphocytes relatively
unaffected and available for use in the future if needed (Humar A et al 2001).
The worldwide use of immunosuppressive drugs especially the calcineurin inhibitors
(CNIs) eg. CsA and tacrolimus have enabled this strategy to obtain its current place.
However it is well recognized that responses to calcineurin inhibitors have
significant inter- and intra-individual variation in transplant patients, which have
considerable influence on the drug effects and human bodies. Over-dose of these
drugs has been proved to influence the lifespan of the allograft, they also have their
side effects; most serious of which is nephrotoxicity. The narrow therapeutic indices
for the currently used immunosuppressive drugs owing to their poor bioavailability
and large individual variability in drug administration make the posttransplant drug
therapeutic strategy difficult. Therefore empirical dose has lost its value in the
posttransplant therapy and an individualized dosage regimen must be established
to achieve the optimal immunosuppressive effect (Wu J et al 2004, Bradley J et al
2003).
Many genetic and nongenetic factors such as organ function, drug interactions and
the nature of the disease may influence the effects of these drugs. Genetic factors
are estimated to contribute much to the interindividual variations in drug
administration; it is estimated that genetics can account for 20 to 95 percent of
variability in drug disposition and effects (Kalow W et al 1998, Evans W et al 2003).
Although many nongenetic factors influence the effects of medications, including
age, organ function, concomitant therapy, drug interactions and the nature of the
disease, there are now numerous examples of cases in which interindividual
differences in drug response are due to sequence variants in the genes encoding
drug-metabolizing enzymes, drug transporters or drug-targets. Unlike other factors
influencing drug response, inherited determinants generally remain stable
throughout a person’s lifetime. Pharmacogenetics is such a subject to determine the
genetic factors describing the inherited nature of individual variations, thereby
providing a strong scientific basis for optimizing drug therapy on the basis of each
4
patient’s genetic constitution. In recent years, extensive studies on
pharmacogenetics of immunosuppressive drugs have been focused on the
contribution of drug-metabolizing enzyme cytochrome P450 (CYP)3A and the drug
transporter P-glycoprotein (P-gp). Their contribution has been studied with respect
to the individual administration of CNIs in organ transplantation for they are thought
to be the main determinant of the pharmacokinetics of calcineurin inhibitors (Kalow
W et al 1998, Evans W et al 1999).
Thus, there are two factors responsible for accumulation of drug metabolites in the
body, first is defective metabolism and the other is decreased efflux of the formed
drug metabolites. The cause of this defective metabolism as well as decreased
efflux is mainly attributed to the gene polymorphisms in the responsible genes
respectively.
The study of single nucleotide polymorphisms in the genes involved in CNI
metabolism and CNI-drug target genes is therefore essential to develop an
individualized postoperative therapy so as to avoid the incidences of nephrotoxicity.
CHAPTER 2
REVIEW OF LITERATURE
5
Chapter 2 – Review Of Literature
Structure of kidney
The kidneys are two bean shaped organs lying in the retroperitoneal space, each
weighing 150g. The kidney is an anatomically complex organ, consisting of many
different types of highly specialized cells, arranged in a highly organized three-
dimensional pattern. The functional unit of the kidney is called a nephron (there are
approximately 1 million nephrons in one human kidney); each consists of a
glomerulus and a long tubule, which is composed of a single layer of epithelial cells.
The nephron is segmented into distinct parts e.g. proximal tubule, loop of Henle,
distal tubule, collecting duct- each with a typical cellular appearance and special
functional characteristics.
The nephrons are packed together tightly to make up the kidney parenchyma, which
can be divided into regions. The outer layer of kidney is called as cortex. It consists
of glomeruli, much of the proximal tubule, and some of the more distal portions as
well. The inner section called the medulla, consists largely of the parallel arrays of
the loops of Henle and collecting ducts. The medulla is formed into cone-shaped
regions, called pyramids (the human kidney typically has seven to nine), which
extend into the renal pelvis. The tips of the medullary pyramids are called papillae.
The medulla is important for concentration of the urine; the extracellular fluid in this
region of the kidney has much higher solute concentration than plasma- as much as
four times higher- with highest solute concentration reached at the papillary tips.
6
The renal artery, which enters the kidney at the renal hilum, carries about one fifth
of the cardiac output; this represents the highest tissue-specific blood flow of all
larger organs in the body (about 350ml/min per 100g of tissue). As a consequence
of this generous perfusion, the renal arteriovenous O2 difference is much lower than
that of most other tissues (and blood in the renal vein is noticeably redder in colour
than that in the other veins). The renal artery bifurcates several times after it enters
the kidney and then breaks into arcuate arteries, which run in an archlike fashion,
along the border between the cortex and the outer medulla. Kidney is the organ,
which purifies blood and maintains the body fluid volume (Figure 1 and 2).
Functions of kidney:
The main functions of the kidneys are:1) maintenance of body composition 2)
Excretion of metabolic end products and foreign substances 3) Production and
secretion of enzymes and hormones like rennin, erythropoetin etc. Thus the
principal job of the kidneys is the correction of perturbations in the composition and
volume of body fluids that occur as a consequence of food intake, metabolism,
environmental factors, and exercise. Typically, in healthy people, such perturbations
are corrected within a matter of hours so that in the long term, body fluid volume
and the concentration of most ions do not deviate much from normal set points. In
many disease states, however, these regulatory processes are disturbed, resulting
in persistent deviations in body fluid volumes or ionic concentrations. In case of
severe disease state like ESRD (End Stage Renal Disease) however there is
absolute dysfunction of kidney and hence the permanent solution is kidney
transplantation (Giebisch G et al 2003, Guyton A et al 1991, Koeppen B et al 1992).
7
Renal transplantation
The process of transplantation is the most effective and economical form of renal
replacement treatment. In this process the foreign kidney grafts are obtained from
cadaveric organ donors, living related donors (usually siblings or parents), living
unrelated altruistic donors etc. once the potential recipient has been shown to be fit
for surgery the operation can proceed.
The donor renal vessels are anastomosed to the iliac vessels in the recipient’s
pelvis and the ureter, joined directly to the bladder. Allograft survival is dependant
on the degree of HLA (Human Leukocyte Antigen) matching between the donor and
recipient (the greater the better) and the condition of the kidney at the time of
transplantation. Immunosuppression with combination of agents is started
immediately before operation and continued for as long as the transplant is
functioning, or has the potential to do so and the risks are acceptable. The
commonly used immunosuppressants, CNIs (cyclosporine A and tacrolimus) block
T cell proliferation by affecting cytokine production (mainly IL-2). These agents help
in maintaining allograft and preventing rejection. The causes of early allograft
failures are irreversible acute rejection, vascular thrombosis, and patient death from
infection or co-morbid conditions such as ischemic heart disease. Late transplant
failure results from chronic rejection (a poorly understood process which is in part
immunologically mediated), stopping or inconsistent taking of immunosuppressive
drugs and occasionally recurrence of the original cause of the renal failure, in the
graft. The recipients have an increased risk of death from complications of
immunosuppression such as infection and malignant disease such as lymphoma
and from cardiovascular disease.
Episodes of acute rejection are diagnosed by reduction in allograft function, and
usually confirmed by a biopsy revealing injury and invasion of tubules and vascular
endothelium by lymphocytes. These are usually treated with higher doses of
immunosuppressants. The side effects of these immunosuppressive agents are
8
largely the consequence of reduced immunity but cyclosporine and tacrolimus are
themselves nephrotoxic and may cause hirsutism, gum hypertrophy and tremor.
CsA and tacrolimus are chemically distinct molecules that bind to the intracellular
immunophillins, cyclophillin and FKBP (FK506 Binding Protein) respectively. When
bound, both the molecules inhibit the phosphatase; calcineurin, which is required for
the movement of nuclear factors from cytoplasm to nucleus. Decreased secretion of
IL-2 prevents proliferation of inflammatory responses via B cells and T cells. The
attenuated inflammatory response greatly reduces overall function of the immune
system (Kasiske B 2006).
The bioavailability and metabolism of cyclosporine and tacrolimus are primarily
controlled by the members of the cytochrome P450 isoenzyme system found in the
liver and gastro-intestinal tract. The main efflux pump involved in transporting them
is p-glycoprotein encoded by MDR-1 gene. PGP is a transmembrane transporter
capable of transporting numerous endogenous substances from the cytoplasm to
the exterior of the cell. In the intestines, PGP limits oral bioavailability of drugs by
expelling them from the interior of enterocytes into the gut lumen. After tacrolimus
and cyclosporine reach the blood stream, they are subject to metabolism and
systemic clearance by CYP enzymes, specifically CYP3A4 and CYP3A5. Many
clinical drugs are substrates of the CYP3A4 and CYP3A5 enzyme found in high
concentrations in the cells of the intestine and along with PGP, may reduce the
bioavailability of many drugs. CYP3A4 and CYP3A5 are also concentrated in the
liver and account for much of the first pass clearance from the hepatic portal vein
and systemic clearance of tacrolimus and cyclosporine (Hesselink D et al 2003,
Zheng H et al 2004, Yates C et al 2003, Haufroid V et al 2004, Anglicheu D et al
2003, Macphee I et al 2005, Uesugi M et al 2006, Formea C et al 2004).
9
Cyclosporine A (CsA)
Cyclosporine A (CSA), the first calcineurin inhibitor available for clinical use, was
launched in 1980s and radically changed the field of organ transplantation. The
incidence of acute rejection in solid organ transplantation decreased significantly,
making this event an unusual cause of graft failure nowadays. Early (1-2 years)
graft and patient survival has increased to unparalleled levels. CSA inhibits
interleukin-2 gene transcription and the transition of T lymphocytes from the G0 to
G1 phase of the cell cycle. It binds to a cytoplasmic immunophillin cyclophillin. The
complex CSA-cyclophillin decreases calcium signaling and blocks calcineurin, a
calcium dependant enzyme responsible for the nuclear translocation and
dephosphorylation of the cytosolic activating nuclear factor of T cells which initiates
the transcription of several cytokines mainly interleukin-2 (Allen R et al 1985).
Discovery of cyclosporine in 1971 began a new era in immunopharmacology. It was
the first immunosuppressive drug that allowed selective immunoregulation of T cells
without excessive toxicity. Cyclosporine was isolated from the fungus
Tolypocladium inflatum. It was first investigated as an anti-fungal antibiotic but it’s
spectrum was too narrow to be of any clinical use. J. F. Borel (Figure 3a)
discovered it’s immunosuppressive activity in 1976. This led to further investigations
into it’s properties involving further immunological tests and investigations into it’s
structure and synthesis (Borel J 1976, 1982). Cyclosporine has unwanted side
effects, notably nephrotoxicity. Animal testing showed cyclosporine to be sufficiently
non-toxic to begin clinical trials. These studies initially failed due to poor absorption
of the drug. Once this had been overcome, results were encouraging enough for
cyclosporine to be licensed for use in clinical practice. Cyclosporine changed the
face of renal transplantation. It decreased morbidity and enabled the routine
transplantation of organs that until then had only been done experimentally (Borel J
1981, 1982).
10
CsA is a cyclic polypeptide consisting of 11 amino acids and possess potent
immunosuppressive properties (Figure 3b). The introduction of CsA in the early
1980s dramatically altered the outcomes of renal transplantation. With CsA, five
year patient survival rate after cadaveric transplant is about 90% and five-year graft
survival rate is 75-80%. Thus CsA continued to play a central role in most
immunosuppressive protocols in spite of the introduction of the other newer
immunosuppressants.
The chemical structure of cyclosporine A is shown in the adjoining figure. It belongs
to a family of cyclic polypeptides and includes a unique 9-carbon acid in position 1.
All amide nitrogens are either hydrogen bonded or methylated. It contains a single
D- amino acid residue in position 8 and the methyl amide between residues 9 and
10 in cis configuration; all other methyl amides are in the trans form. Cyclosporine A
is lipophilic and very hydrophobic therefore for clinical administration it must be
solubilized (Cockburn I 1986).
After CsA has been internalized by lymphocytes, it binds to cyclophillin and inhibits
IL-2 by the mechanism described later in this chapter. It is cleared from the body
largely in the form of monohydroxylated (M1 and M17) and N-demethylated (M21)
metabolites. The major site of CsA metabolism is the endoplasmic reticulum of
hepatocytes where the number of cytochrome P450 3A proteins is more. Although
there is considerable interindividual variation in it’s metabolism, the cyclic peptide
structure of cyclosporine is relatively resistant to metabolism, but the side chains
are extensively metabolized. While metabolism is thought to result in the
inactivation of the immunosuppressive properties of the drug, some of the
metabolites are found to contribute to immunosuppression or toxicity (M1 and M9).
CsA and it’s metabolites are excreted mainly through the bile into the feces,
approximately 6% is excreted through the urine. In the presence of hepatic
dysfunction, adjustment in the dose may be necessary (Aoyama T et al 1989, Dai Y
et al 2004).
11
Adverse effects of CsA can be grouped into renal and non-renal side effects. It has
a vasoconstrictor effect on renal vasculature. This (probably a transient, reversible
and dose dependant phenomenon) may cause early post transplant graft
dysfunction.
CsA has been monitored by using 12-hour trough level (C0) with relative success in
the past 2 decades. However data have shown that this technique does not always
correlate with area under the curve or drug exposure, particularly in poor absorbers
of CsA. As stated earlier the microemulsion formulation of cyclosporine, Neoral,
offers more complete and reliable absorption from the gastrointestinal tract than
sandimmune. Recent studies showed that measuring the CsA blood level at 2 hours
(C2) correlated better with the area under the curve (Total drug exposure to the
body from first dose to the next dose) compared with C0. Data suggests that C2
level upto 1500 ng/ml for the first month is a therapeutic range. A C2 level of
approximately 800ng/ml at 1 year may be associated with improved long-term
outcome and less nephrotoxicity (Burdmann E et al 2003).
12
Tacrolimus (FK506)
Tacrolimus (Figure 4a) was discovered in 1987 by a Japanese team headed by T.
Goto, T. Kino and H. Hatanaka; it is among the first macrolide immunosuppressants
discovered, preceded by the discovery of rapamycin (sirolimus) in 1975. It is a
metabolite of an actinomycete Streptomyces tsukubaensis, was first demonstrated
to be immunologically effective in vivo in rat heart allograft recipients in 1987. It was
soon found to be a potent alternative to CsA in several experimental models. The
name ‘tacrolimus’ is reportedly derived from “Tsukuba macrol ide
immunosuppressant (Kino T et al 1987, Pritchard D et al 2005).
Pharmacokinetics: Because tacrolimus is minimally soluble in aqueous solvents, it
is formulated in alcohol and a surfactant for continuous intravenous administration.
The oral formulation is composed of capsules of a solid dispersion of tacrolimus in
hydroxypropyl methylcellulose. Absorption of tacrolimus is incomplete after oral
administration. Its bioavailability ranges from 10-60%, with peak blood level after 1
to 2 hours and half-life of 8 to 24 hours. The oral dose of tacrolimus needs to be
higher than intravenous doses. Administration of tacrolimus by the intravenous
route leads to a rapid distribution of the drug reflected as a rapid decline of the initial
peak concentration, followed by a slower decline over next 24 hours. Tacrolimus is
highly bound to plasma proteins eg. Albumin, and to red blood cells and
lymphocytes. Most of the solid organs exhibit a high concentration of tacrolimus
particularly in the lungs, heart, kidney, pancreas, spleen, and liver. The major part of
metabolism takes place in the intestinal wall and in the liver by the cytochrome
P450 system. At least 15 metabolites have been detected, and some of them show
pharmacological activity. Drug level monitoring is required, because tacrolimus has
high inter and intra- individual variability and a narrow therapeutic index. Drug levels
can be monitored by an enzyme linked immunosorbent assay (ELISA), RIA or by
FPIA from whole blood.
13
Pharmacodynamics: The mechanism of action is similar for tacrolimus and CsA.
The process is initiated by binding of the tacrolimus molecule to cytoplasmic
immunophillins, FKBP (FK506 binding protein), of which the isoform FKBP12 seems
to be involved in the immunosuppressive effect caused by tacrolimus. The
tacrolimus-FKBP complex inhibits the activity of calcineurin, a serine-threonine
phosphatase that regulates IL-2 promoter induction after T cell activation. Inhibition
of calcineurin impedes calcium dependant signal transduction, and inactivates
transcription factors (NFAT) that promote cytokine gene activation, because they
are direct or indirect substrates of calcineurin’s serine-threonine phosphatase
activity. As a consequence, the transcription of cytokines IL-2, IL-3, IL-4, IL-5,
interferon-γ, tumor necrosis factor-α, granulocyte-macrophage colony stimulating
factor, IL-2 and IL-7 receptors, is suppressed by tacrolimus (Liu J 1993, Rao A
1994).
Metabolism: Tacrolimus is metabolized to oxidized metabolites in liver by CYP3A
enzymes. Three mono-demethylated metabolites (M-I, M-II and M-III), three di-
demethylated metabolites (M-V, M-VI and M-VII), one mono-hydroxylated
metabolite (M-IV) and one metabolite modified by multiple reactions (M-VIII) are the
products of metabolism (Figure 4b, c) (Iwasaki K et al 1995).
14
Tacrolimus inhibits lymphocyte activation in vitro 10 to 100 times more potently that
CsA. One explanation might be the higher binding affinity of tacrolimus to FKBP
compared to the binding of cyclosporine to it’s immunophillin called cyclophillin.
Other immunosuppressive effects of tacrolimus include the inhibition of T cell
proliferation and the inhibition of primary or secondary T cytotoxic cell proliferation
in vitro, whereas direct cytotoxicity and calcium dependant T cell stimulation are not
affected. Tacrolimus also suppresses B cell activation in vitro: both induced Ig
production by B cells and the proliferation of stimulated B cells. In vivo, tacrolimus
inhibits proliferative and cytotoxic responses to alloantigens and suppresses
primary antibody responses to T cell dependant antigens, whereas secondary
antibody responses, IL-2 stimulated cell proliferation and natural killer or antibody
dependant cytotoxic cell function are not inhibited (Luke R et al 1994, Manez R et al
1995).
Tacrolimus has been investigated in clinical transplantation of all solid organs, and it
has been approved as an immunosuppressant agent for primary therapy in patients
with liver and kidney transplants. In renal transplantation, tacrolimus was used first
in 1989 in Pittsburgh. Many clinical trials and reports in renal allograft recipients
have been published. Tacrolimus has been proved effective in the patients with
steroid- resistant rejection episodes. In the most recent randomized, comparative
multicenter trial including 412 patients, tacrolimus was equivalent to CsA in 1-year
graft and patient survival. The number and severity of biopsy-proven acute rejection
episodes were significantly lower in the tacrolimus group. After 3 years, patient and
graft survival was still equivalent for both groups, but the number of graft failures
defined, as loss of graft excluding death was significantly lower in the tacrolimus
group. A higher overall incidence of post-transplant diabetes mellitus was observed
in the same group.
Significant nephro and neuro-toxicity have been reported in patients receiving
tacrolimus treatment. One possible mechanism for the neurotoxicity is the inhibition
of calcineurin phosphatase, but the etiology of it’s renal vasculopathic effects is
15
unclear. Reduced renal glomerular and cortical blood flow and increased renal
vascular resistance are generally associated with increased thromboxane A2,
endothelin production or stimulated intra-renal rennin production. Cardiomyopathy,
anemia, chronic diarrhea, onset of diabetes and allergies have been reported in the
patients receiving tacrolimus. Lymphoproliferative diseases and infections are
associated with tacrolimus based immunosuppressive protocols.
In the cytoplasm, cyclosporine A (CsA) binds to it’s immunophillin, cyclophillin
(CpN), forming a complex between cyclosporine and CpN. The cyclosporine-CpN
complex binds and blocks the function of the nuclear factor of activated T cells
(NFATc), and thereby the transport of NFATc to the nucleus and the binding of
NFATc to the nuclear component of the nuclear factor of activated T cells (NFATn).
The NFATc-NFATn complex binds to the promoter of the interleukin 2 (IL-2) gene
and initiates IL-2 production. Consequently, T cells do not produce IL-2, which is
necessary for full T-cell activation. Tacrolimus (FK506) binds to FK506-binding
protein (FKBP), forming a FK506-FKBP complex, which binds to and blocks CaN.
The FK506-FKBP-CaN complex inhibits the activation of NFATc, thus preventing it’s
entrance into the nucleus. Although the pre-drugs cyclosporine and FK506 bind to
different target molecules, both drugs inhibit T-cell activation in the same fashion
(Figure 5) (Rao A 1994, Andrus L et al 1981).
16
Target of CNIs : IL-2 gene
Cytokines are potent immunomodulatory molecules that act as mediators of
inflammation and the immune response. Primarily secreted by T cells and
macrophages, they influence cellular activation, differentiation and function.
Cytokine production is under genetic control. This is evidenced by the identification
of polymorphisms in cytokine gene regulatory regions that correlate with intra-
individual variations in actual cytokine production. As these polymorphisms
segregate independently, each person is a mosaic of high-, intermediate- and low
producing phenotypes. Cytokine polymorphisms have been implicated in a number
of diseases, disorders and toxicities (Cox E et al 2001).
The activation of cytokine genes is dependant on the binding of proteins, so called
transcription factors, to the DNA flanking the genes. In particular, the portion of DNA
immediately upstream of the cytokine gene, known as the promoter region,
influences the expression of cytokine genes. The promoter region of IL-2 gene is
now very well characterized and contains binding sites for many different
transcription factors. Some of these protein factors exist in the cytoplasm and, after
they are modified by phosphorylation or dephosphorylation, translocate to the
nucleus where they bind to the DNA. Alternatively, they are already present in the
nucleus where they are activated, again by the addition or removal of phosphate
groups. The binding of protein factors influences the conformation of DNA and
allows the access and assembly of the complex of RNA polymerase enzymes
required to make an RNA copy of the gene, the process of transcription (Grunfeld J
et al 1998).
DNA binding sites for certain factors appear quite frequently in cytokine gene
promoters. For example, the factor NFAT (nuclear factor of activated T cells) is
important for the regulation of IL-2, TNF, Interferon gamma, IL-4 and others.
Cyclosporine and Tacrolimus act to prevent the translocation of the cytoplasmic
NFAT molecule to the nucleus, thereby suppressing the activation of cytokine gene
17
expression. Other factors include NF-kB, CERB (cyclic adenosine monophosphate
(cAMP) response element binding and AP-1 (activation protein 1). The transcription
factor binding sites present in IL-2 gene are shown in the adjoining figure. One
notable point is that coordinately regulated cytokines (eg. The proinflammatory or
inflammatory cytokines) share the same pattern of transcription factor binding sites
(Figure 6).
The transcription factors are activated as a final event in the different second
messenger pathways that exist in T cells. Flux of calcium leads to NFAT activation,
whereas protein kinase C (PKC) is responsible for the translocation of NFkB.
Elevation of cAMP levels activates protein kinase A (PKA), which phosphorylates
and activates CERB, whereas many cell surface cytokine receptors activate factor
AP-1. Therefore T cell responds differentially to stimuli that selectively activate
second messenger pathways.
This concept is extremely important because we now realize that
immunosuppressive agents can be used to modify second messenger pathways
and cause the T cell to behave differently. Thus, certain drugs or combinations of
drugs can selectively inhibit the production of targeted cytokines.
It is now clear that there are polymorphisms in cytokine genes that predispose to
higher or lower production of cytokines. The DNA sequence in the promoter region
of cytokine genes in different individuals can vary so that although the cytokine itself
is the same, the amount produced can differ 4- to 50-fold. It is because of this
reason the study of promoter or regulatory region gene polymorphisms of cytokine
genes assumes significance (Turner D et al 1997, Grunfeld J et al 1998).
Morgun et al (2003) have recently shown that T-330G regulatory region
polymorphism of IL-2 gene affects allograft outcome after renal transplantation.
They have observed that this polymorphism is related to in vitro IL-2 levels with the
T/T and T/G genotypes being associated with low production and the G/G genotype
18
associated with high production, however a higher frequency of T/T genotype was
observed in renal transplant patients who experienced at least one acute rejection
in the first 3 months after transplantation than in those without rejection. Whereas
Cox et al have observed G/G genotype to be associated with high in vitro IL-2
production in peripheral blood lymphocytes. Effects of this polymorphism on the
incidences of CNI induced nephrotoxicity as well as on IL-2 levels need to be further
studied. Cox et al have also observed that the carriers of G/G genotype have shown
high in vitro IL-2 production. It is also observed that an increase in IL-2 production
has been associated with acute rejection events in renal transplant recipients
(Morgun et al 2003).
As stated earlier, nephrotoxicity is the most worrying side effect of CsA and
Tacrolimus. It is of particular concern in the case of renal transplantation, in which it
has to be distinguished from rejection as a cause of deteriorating renal function. In
the early rat and dog models of transplantation, nephrotoxicity was not noted. It
became evident soon after the initial clinical use of CsA. It was then subsequently
shown in the animal models using higher doses and more sophisticated evaluation
of renal function and some of the morphological changes attributed to nephrotoxicity
were observed in humans (Burdmann E et al 2003).
Nephrotoxicity
Drug induced nephrotoxicity may be caused due to patient related or medication
related risk factors. While patient related factors include age, sex, weight, height
etc. medication related factors are Their inherent nephrotoxic potential, Increased
dose, Their duration, frequency and form of administration, Repeated exposure,
Impairment in the metabolism of these drugs, leading to accumulation of their
metabolites in the body.
19
Because decreased renal function is often unsuspected in elderly or asymptomatic
patients, overdosing with nephrotoxic agents may occur resulting renal injury. When
the frequency of nephrotoxicity is assessed, it has become clear that most renal
injuries tend to cluster around certain patients and specific clinical situations that
represent risk factors. Because nephrotoxicity may limit the clinical usefulness of
many diagnostic and therapeutic agents, recognition of factors associated with
higher risk for renal injury becomes important.
To evaluate nephrotoxicity, it is necessary to define exactly the increase in serum
creatinine concentration that will be used clinically to signal it’s presence. The
common wisdom is to accept increases of 0.5 mg/dL if the baseline level is normal,
or increases of 1 mg/dL or more if the baseline concentration is already elevated.
However, serum creatinine levels should always be evaluated (Thatte L et al 1996).
Three clinical types of nephrotoxicity were observed with CsA and tacrolimus. The
first occurs immediately after transplantation, usually in the kidney already damaged
by ischemia and perhaps associated with the use of intravenous CsA. In humans,
the incidence of delayed function after renal transplantation has tended to be higher
in the patients treated with CsA than in those treated with azathioprine and steroids
(Burdmann E et al 2003)
The second type of nephrotoxicity is seen after the first two or three weeks and is
associated with deteriorating renal function, usually but not always associated with
high blood levels of CNIs, and responds to a reduction in CNI dosage. This type of
nephrotoxicity has to be differentiated from the episodes of acute rejection.
The mechanism of CNI induced nephrotoxicity has not been clarified, but it would
seem that a direct toxic action on proximal tubular cells is not a significant factor. A
decrease in renal blood flow with an increased renal vascular resistance at the level
of the afferent arteriole of the glomerulus and a decreased glomerular filtration rate
20
is the primary cause of nephrotoxicity. The metabolites of CNIs also have a similar
effect (Campistol J et al 2000).
The third type of CNI induced nephrotoxicity is a chronic condition in which there is
a slow and steady deterioration in the renal function and the histology of the kidney
may reveal several interstitial fibrosis. This type of nephrotoxicity shows some
improvement in renal function with a decrease in CNI dosage but this improvement
tends to be relatively short lived. It is likely that many of the changes observed
result from chronic immunological damage on which is superimposed some element
of nephrotoxicity.
Acute nephrotoxicity is the predominant kidney abnormality, seen within the first 6 to
12 months after initiating the treatment and is characterized by an acute or
subacute reduction in kidney function that is often dose-dependant. It is a functional
and reversible abnormality related to a renal imbalance of vasoconstrictor and
vasodilators mediators. The main feature of this form of nephrotoxicity is an intense
internal vasoconstriction reflected by increased renal vascular resistance and
reciprocal renal blood flow decrease, followed by variable degrees of glomerular
filtration rate (GFR) impairment. This vasoconstriction occurs preferentially in the
afferent arterioles but also in the adjacent small arteries, including the glomerular
tuft.
The clinical manifestations of nephrotoxicity are similar for CsA and tacrolimus,
consisting of acute reversible kidney dysfunction and chronic interstitial
nephropathy. Generally kidney dysfunction is nonprogressive and remits when the
dose is lowered or the drug is discontinued. Virtually every patient who receives
therapeutic doses of a CNI will experience a component of persistent, reversible
reduction in glomerular filtration rate (GFR) and renal blood flow. The mechanism of
this acute nephrotoxicity is homodynamic and results from the ability of CNIs to
induce intense renal vasoconstriction. CNIs do not cause vasoconstriction directly
but may act by stimulating production of other vasoconstrictor compound such as
21
thromboxane A2, endothelin and leukotrienes (English J et al 1987, Rosen S et al
1990).
In kidney transplant recipients, within the first year after transplant, it is often difficult
to distinguish acute nephrotoxicity from acute rejection. A stable or slowly
progressive increase in serum creatinine that reverses when the CsA or tacrolimus
dose is reduced suggests nephrotoxicity. Kidney biopsy can be helpful in this
setting, since aggressive inflammatory cell infiltrates are usually absent in acute
nephrotoxicity and their presence in a biopsy specimen would suggest ongoing
rejection. Isometric tubular vacuolization may be observed with calcineurin inhibitor
induced toxicity. Although serum drug levels are frequently used to monitor
therapeutic efficacy and to prevent toxicity, there is only a rough correlation
between serum levels and clinical events.
Chronic nephrotoxicity is defined by the development of interstitial fibrosis with
reduced levels of GFR in the patients receiving long-term treatment with CNIs. The
clinical features of chronic CsA nephrotoxicity are better characterized. Although
chronic nephrotoxicity also occurs with tacrolimus, generally 6 to 12 months of
treatment are required before signs of chronic nephrotoxicity become apparent.
Because of the irreversible nature of the morphologic abnormalities, this form of
toxicity is more ominous than the acute form. Histologically, chronic nephrotoxicity is
characterized by focal or striped medullary interstitial fibrosis. Often, these changes
are accompanied by tubular atrophy and obliterative arteriolar changes. In more
advanced cases, diffuse interstitial fibrosis with focal and segmental glomerular
sclerosis can be seen.. Although the mechanism of chronic nephrotoxicity is not
known, it is likely that cumulative dose, arterial hypertension and immunologic injury
contribute to the development of the lesion (Rosen S et al 1990).
Nephrotoxicity is an example of adverse drug reaction (ADR) caused because of
inappropriate dose of CNIs. There exist interindividual differences in the metabolism
of CNIs and therefore it is well recognized that different patients respond in different
22
ways to the same medication. Individual genetic status has been shown to
contribute much to these variations.
Interpatient variability in response to drug therapy is the rule and not the exception,
for almost all medications. It is well recognized that individuals may respond quite
differently to the same dose or even the same plasma concentration of a drug.
Potential causes for such variability in drug effects include the pathogenesis and
severity of the disease being treated, drug interactions and the individual’s age,
nutritional status, organ function and concomitant diseases. In many cases,
however, genetic factors may have an even greater influence on drug efficacy and
toxicity.
With the completion of Human Genome Project (HGP) and the ongoing annotation
of it’s data, the time is rapidly approaching when the sequences of virtually all genes
encoding enzymes that catalyze phase I and phase II drug metabolism will be
known. The same will be true for genes that encode drug transporters, drug
receptors and other drug targets. As a result, the traditional phenotype-genotype
pharmacogenetic and pharmacogenomic research paradigm is reversing the
direction to create a complementary genotype to phenotype flow of information.
The convergence of advances in pharmacogenetics and human genetics means
that physicians can now individualize the therapy for few drugs. As our knowledge
of genetic variations in the genes involved in the uptake, distribution and
metabolism, and action of various drugs improves, our ability to test for that
variation and, as a result to select the best drug and their optimal dose for each
patient should also increase.
23
Drug metabolism
Human body continuously remains in homeostasis; everything that comes in, must
go out. If the balance is disturbed, the organism accumulates the compound and the
concentration will rise, eventually reaching toxic levels (eg. nephrotoxicity in case of
the accumulation of CsA or tacrolimus). If not eliminated, these compounds would
stay in the body forever and with each repeated dose their concentration would rise
(Meyer U et al 2004).
Once the drug is administered, the drug is absorbed and distributed to it’s site of
action, where it’s interaction with targets (such as receptors and enzymes),
undergoes metabolism, and is then excreted. Each of these processes could
potentially involve clinically significant genetic variations in drug metabolism and
drug transporter genes (Meyer U et al 2004, Cascorbi I et al 2006).
There are more than 30 families of drug-metabolizing enzymes in humans, and
essentially all have genetic variants, many of which translate into functional
changes in the proteins encoded. There are monogenic as well as multigenic effects
on the metabolism due to these variations. There is an example of multigenic effect
involving the CYP3A family of P450 enzymes. About three quarters of whites and
half of blacks have a genetic inability to express functional CYP3A5. The lack of
functional CYP3A5 may not be readily evident, because many medications
metabolized by CYP3A5 are also metabolized by the universally expressed
CYP3A4. For medications that are equally metabolized by both the enzymes, the
net rate of metabolism is the sum of that due to CYP3A4 and CYP3A5; the
existence of this dual pathway partially obscures the clinical effects of genetic
polymorphism of CYP3A5 but contributes to the large range of total CYP3A activity
in humans. The CYP3A pathway of drug elimination is further confounded by the
presence of SNPs in the CYP3A4 gene that alter the activity of this enzyme for
some substrates but not for others. The genetic basis of CYP3A5 deficiency is
predominantly a SNP in intron 3 that creates a cryptic splice site causing 131
24
nucleotides of the intronic sequence to be inserted into the RNA, introducing a
termination codon that prematurely truncates the CYP3A5 protein. Although it is
now possible to determine which patients express both functional enzymes (ie.
CYP3A4 and CYP3A5), the clinical importance of these variants remains unclear
(Evans W et al 1999, Morisseau C et al 2005).
R. T. Wiiliams first defined the field of biotransformation in 1947. He proposed that
drugs or compounds could be biotransformed in two phases: functionalization,
which uses oxygen to form a reactive site and conjugation, which results in addition
of a water-soluble group to the reactive site. These two steps, functionalization and
conjugation, are termed phase I and phase II detoxification, respectively. The result
is the biotransformation of a lipophilic compound, not able to be excreted in urine, to
a water-soluble compound able to be removed in urine. Therefore detoxification is
not one reaction, but rather a process that involves multiple reactions and multiple
players (Estabrook R et al 1996, Liska D et al 1998, Satoh T et al 2002).
Currently over 10 families of phase I enzymes have been described, which include
at least 35 different genes. Phase II reactions are equally complex, and involve
multiple gene families as well (Meyer U et al 2004, Zanger U et al 2004).
The phase I system
The phase I detoxification system, composed mainly of the cytochrome P450
supergene family of enzymes, is generally the first enzymatic defense against
foreign compounds. Most pharmaceuticals are metabolized through phase I
biotransformation. In a typical phase I reaction, a cytochrome P450 enzyme
(Cyp450) uses oxygen and, as a cofactor, NADH, to add a reactive group, such as
hydroxyl radical. As a consequence of this step in detoxification, reactive molecules,
which may be more toxic than the parent molecule, are produced. If these reactive
molecules are not further metabolized by phase II conjugation, they may cause
damage to proteins, RNA and DNA within the cell. Several studies have shown the
25
evidence of association between induced phase I and/or decreased phase II
activities and an increased risk of disease, such as cancer, systemic lupus
erythromatosus and Parkinson’s disease. Compromised phase I and/or phase II
activity has also been implicated in adverse drug responses.
There are at least 10 families of phase I activities described in humans. The major
P450 enzymes involved in metabolism of drugs or endogenous toxins are the
Cyp3A4, Cyp1A1, Cyp1A2, Cyp2D6 and the Cyp2C enzymes. The amount of each
of these enzymes present in the liver reflects their importance in drug metabolism.
Most information on the phase I activities has been derived from studies with drug
metabolism; however, phase I activities are also involved in detoxifying endogenous
molecules, such as steroids.
CYP catalytic cycle is shown in the adjoining figure. In this cycle, CYP molecule
converts a substrate to it’s oxidized product. Several molecules are required for this
reaction. These include the addition of two hydrogen ions, oxygen and transfer of
two electrons, the accessory proteins NADPH and cytochrome b5 allow the electron
transfer (Meyer U et al 1990, Ingelman S et al 2004, Guengerich F et al 1999).
The phase II system
Phase II conjugation reactions generally follow phase I activation, resulting in a
compound that has been transformed into a water-soluble compound which can
then be excreted through urine or bile. Several types of conjugation reactions are
present in the body, including glucuronidation, sulfation and glutathione and amino
acid conjugation. These reactions require cofactors, which must be replenished
through dietary sources (Liska D 1998).
26
The phase III system
Drug transporters
Transport proteins have an important role in regulating the absorption, distribution
and excretion of many medications. Members of the adenosine triphosphate (ATP)-
binding cassette family of membrane transporters are among the most extensively
studied transporters involved in drug-disposition and effects. A member of the ATP
binding cassette family (ABC family), p-glycoprotein (pgp) is the energy dependant
cellular efflux of substrates, including bilirubin, several anticancer drugs, cardiac
glycosides, immunosuppressive agents, glucocorticoids and many other
medications. The expression of p-glycoprotein in many normal tissues suggests that
it has a role in the excretion of drug metabolites into urine, bile and the intestinal
lumen. At the blood-brain barrier, p-glycoprotein in the choroid plexus limits the
accumulation of many drugs in the brain including cyclosporine and tacrolimus.
Structure: All ABC transporters are transmembrane proteins having their core
functional unit as two polytropic membrane spanning domains (MSDs) typically
consisting 6 transmembrane (TM) helices (in some proteins may range from 5 to
10) and two nucleotide binding domains (NBDs). All these domains are encoded in
a single polypeptide in the order NH2 – MSD – NBD – MSD – NBD – COOH. The
NBDs of all ABC proteins contain walker A and walker B motifs that are essential for
ATP binding and hydrolysis. In addition they also contain a motif known as “C
signature” that is characteristic of ABC ATPases. C signature motif has a core
sequence LSGGQ. It appears in general that the role of this motif is not essential as
far as the transport of substrate is concerned (Figure 9) (Higgins C et al 1992, Doyle
L et al 1998).
Mechanism: The mechanism of substrate transport by ABC protein (eg. pgp) is
called as it’s transport cycle. The cyclic events that occur in the mechanism of
transport are as follows (Figure 10)
27
Step 1) When substrate binds to high affinity site of ABC protein it induces
conformational changes that enhance the ATP binding to NBD1.
Step 2) The initial binding of ATP to NBD1 stabilizes the interaction between NBDs
by establishing contact with the C signature motif of NBD2, facilitating the binding of
second molecule of ATP.
Step 3) Binding of the second ATP molecule completes the formation of closed
NBD dimmer and also causes conformational changes in NBD2. The combined
positional and conformational changes resulting from ATP binding are transmitted to
MSDs resulting in a decrease in the affinity for the substrate.
Step 4) The protein maintains a low affinity state following hydrolysis of ATP at
NBD2, as long as NBD1 is occupied by ATP and ADP has not been released by
NBD2. The mechanism by which the protein returns to it’s original conformation
remains unclear, however the proposed mechanism depending on the available
experimental data is described below (Chang X et al 1997, Gao M et al 1996,
Payen L et al 2003, Zhao Q et al 2004).
Step 5) If NBD1 lacks ATPase activity, resetting of protein might occur after the
release of only ADP from NBD2 or may require the release of ADP from NBD2 and
ATP from NBD1.
Step 6) It is also proposed that hydrolysis of ATP by NBD1 is required to reset the
protein (Jones P et al 2002, Koike K et al 2004, Loo T et al 2002, Situ D et al 2004,
Zhang D et al 2004).
Recently, antiporter activity (p-glycoprotein or multi-drug resistance) has been
defined as the phase III detoxification system. Antiporter activity is an important
factor in the first pass metabolism of pharmaceuticals and other xenobiotics. The SUB
28
antiporter is an energy dependant efflux pump, which pumps toxic material out of a
cell, thereby decreasing their intracellular concentration.
Antiporter activity in the intestine appears to be co-regulated with intestinal phase I
Cyp3A4 enzyme. This observation suggests the antiporter may support and
promote detoxification. Possibly, it’s function of pumping non-metabolized toxic
compounds out of the cell and back into intestinal lumen may allow more
opportunities for phase I activity to metabolize the toxic compound before it is taken
into circulation (Figure 11).
The two genes encoding antiporter activity have been described: the multi-drug
resistance gene 1 (MDR-1) and multi-drug resistance gene 2 (MDR-2). The MDR-1
gene product is responsible for drug resistance of many cells and is normally found
in epithelial cells in the liver, kidney, pancreas, small and large intestine, brain and
testes. MDR-2 activity is expressed primarily in liver, and may play a role similar to
that of intestinal MDR-1 for liver detoxification enzymes; however, it’s function is
currently undefined.
Genetic variation in drug-metabolizing enzymes and drug transporters is an
important contributor to interindividual differences in drug disposition and is
associated with significant clinical consequences. Many commonly used drugs are
dependant on cytochrome P450 monooxygenase enzymes (CYP450s) for their
metabolism and for elimination on ATP binding cassette family protein (p-gp) coded
by MDR-1 gene. More than 80% of all phase I-dependent metabolism of clinically
used drugs is carried out by the CYP450s, and these enzymes also metabolize a
large number of chemicals. The polymorphic forms of CYP450s are responsible for
the development of a significant number of adverse drug reactions and may also
contribute to nonresponsiveness to drug therapy (Chin K et al1993, Wacher V et al
1995, Deeley R et al 2006).
29
Adverse reaction to medication is a major cause of death and is partly ascribed to
inconsistent drug response displayed by different patients. Polymorphisms in
cytochrome P450 and multidrug resistance genes have the capacity to change the
expression of genes, leading to altered drug metabolism and disposition, which in
due course may result in adverse drug reactions.
The construction of single nucleotide polymorphism (SNP) profiles constitutes an
approach to differentiate between patients who respond favorably to medication and
those who experience undesirable side effects. The field pharmacogenomics aims
to permit the physician to improve medication response by way of individualized
prescriptions. This procedure will result in safer, more effective and cost-effective
medicine.
As mentioned above, increased dose for a particular individual leading to increased
levels of CNIs in the body may lead to nephrotoxicity; it is also true that their faster
metabolism causing their decreased levels leads to inadequate
immunosuppression. Because of this there are chances of strong host immune
response against graft causing nephrotoxicity or graft versus host disease (GVHD)
and in severe cases graft rejection. Hence monitoring levels of CNIs and correlating
them with the polymorphisms present in the above-mentioned genes assumes
significance.
In recent years, research has focused on the possible causes of inter and intra-
individual differences in the pharmacokinetics of CNIs. Genetic polymorphisms have
been identified in these genes that are associated with the expression of the CYP3A
enzymes and P-gp. It has become clear that the genetic variations of CYP3A and P-
gp may play an important role in the individual administration of immunosuppressive
drugs.
30
CYP3A4
In 1985 Watkins et.al. identified a glucocorticoid inducible cytochrome P450 in
human liver. Molowa et.al (1986) reported the complete cDNA sequence of this
P450. Wrighton and Vandenbranden isolated a CYP3-type cytochrome P450 from
human fetal liver. By somatic cell hybridization and in situ hybridization, Riddell et.al
(1987) assigned it to chromosome 7 and identified it as a cytochrome P450 enzyme
family member that encodes the enzyme nifedipine oxidase (CYP3). Brooks B et.al
(1988) concluded that the most likely location of CYP3 is 7q21-q22.1. Inoue et.al
(1992) mapped CYP3A4 to chromosome 7q22.1 by fluorescence in situ
hybridization.
CYP3A4 is one of the most abundant P450s in human liver. It is inducible by a
variety of agents including glucocorticoids and Phenobarbital and plays a central
role in the metabolism of immunosuppressive cyclic polypeptides i.e. CsA and
tacrolimus. It is responsible for oxidative metabolism of wide variety of xenobiotics,
including an estimated 60% of all clinically used drugs. Although the expression of
CYP3A4 gene is known to be induced in response of variety of compounds the
mechanism underlying this induction which represents a basis of drug interactions
in the patients was not clear (Ando Y et al 1999). Lehman et.al (1998) identified a
human orphan nuclear receptor that binds to a response element in CYP3A4
promoter and is activated by a range of drugs known to induce CYP3A4 expression.
Rebbeck et al (1998) have observed a single nucleotide polymorphism (SNP) in the
nifedipine specific response element (NFSE) of CYP3A4 promoter. They termed the
SNP as CYP3A4-V. It is an A to G transition at -290bp that alters 10bp.
(AGGGCAAGAG) to (AGGGCAGGAG) located -287 to -296bp from the
transcription start site of CYP3A4 gene. Unlike other human P450s there is no
evidence of null allele in case of CYP3A4. Genetic variations found in the flanking,
intronic and exonic regions of the gene may influence the level or function of
CYP3A4 protein, but full-length m-RNA has been detected in all adults studied so
31
far. Five different SNPs have been observed in the 5’-flanking region of the human
CYP3A4 gene. By far the most common is the one described above (A-290G or
CYP3A4-V or CYP3A4*1B). It’s mutant allele frequency varies among different
ethnic groups: 0% in Taiwanese, Chinese, Chinese Americans and Japanese
Americans; 2 – 9.6% in Caucasians; 9.3 – 11% in Hispanic Americans and 35 –
67% in African Americans. The other allelic variants in the 5’-flanking region appear
to be of much lower frequencies.
Of the five promoter SNPs identified, only CYP3A4-V has been studied to ascertain
the effect of the mutation on transcriptional activity and in vivo catalytic activity.
Amiramani et al (1999) examined the effect of this polymorphism on leuciferase
reporter transcription in HepG2 hepatoma and MCF7 breast cancer cell lines. They
observed that luciferase expression from the mutant (G) promoter construct
occurred at a rate that was 1.4 to 1.9 fold higher than that observed for wild type (A)
construct. This finding was supported by an observation of 1.6- and 2.1 fold higher
level of nifedipine oxidation and CYP3A4 protein in human livers carrying at least
one G-290 allele, although the difference was not statistically significant. However,
results from studies with a larger sample size demonstrate no clear association
between this polymorphism and CYP3A4 specific content or catalytic activity among
tissue banks from predominantly Caucasian donors.
The functional significance of this polymorphism has also been evaluated in vivo,
but with populations of limited size. Ball S et al (1999) studied the metabolic fate of
CYP3A probe substrates in healthy African American volunteers. They found no
difference in mean demethylation rate or mean oral clearance measured in
individuals with a homozygous A-290 (n=8) or homozygous G-290 (n=23) CYP3A4
genotype. Wandel et al (2000) have observed no no relationship between genotype
and oral midazolam clearance for this polymorphism however they found 30% lower
systemic midazolam clearance for subjects homozygous for the variant G allele
compared to that observed in subjects with A allele.
32
CYP3A5
The CYP3A5 cDNA sequence was first described independently by Aoyama et al
(1989) and Schuetz et al (1996). The allele corresponding to this cDNA and the
respective expressed protein was designated wild type, CYP3A5*1A. Subsequent
work described 5’-flanking sequence of two distinctly different genomic clones from
a human liver containing CYP3A5 protein. The clones contain identical sequences
for exon 1 but differed slightly in the 5’-flanking sequence. The flanking sequence
corresponding to CYP3A5*1A was notable for minor differences compared to the
CYP3A4 gene. More recent work revealed that the putative CYP3A5*1A promoter
sequence described by Jaunaidi et al (1994) actually corresponds to that of a
closely related CYP3A pseudogene, CYP3API.
In 2000, Paulussen et al (2000) described two linked mutations in the proximal 5’-
flanking region of CYP3A5 gene that were in complete concordance with
polymorphic hepatic CYP3A5 protein content. The first report of a potentially
important CYP3A5 coding SNP came from Jaunaidi et al (1994) in their study of
livers obtained from Caucasian donors. These investigators described a
transversion in exon 11 of CYP3A5 gene. The most frequent and functionally
important SNP in the CYP3A5 gene consists of an A6986G transition within intron 3
(CYP3A5*3) this polymorphism creates an alternative splice site within the pre-
mRNA and production of aberrant mRNA (SV1-mRNA) that contains 131 bp. Of
intron 3 sequence (exon 3B) inserted between exon 3 and exon 4. The exon 3B
insertion results in a frameshift and predicted truncation of the translated protein at
amino acid 102. Among Caucasians, a CYP3A5*3/*3 genotype was perfectly
concordant with very low or undetectable hepatic CYP3A5 protein content, a finding
that has been confirmed by other investigators. In addition, homozygosity for the
CYP3A5*3 allele was also strongly associated with low CYP3A5 protein content in
African-American livers and Caucasian intestinal mucosa (Kuehl et al 2001).
33
Focusing on the functional wild type allele (A6986), the frequency is reported as 5-
15% for Caucasians and 45-73% for African Americans. Hustert et al (2001) also
reported an A6986 allele frequency of 27% in Chinese and 30% in Koreans.
Sequence information from more limited data sets suggested a A6986 allele
frequency of 35% in Chinese, 15% in Japanese, 25% in Mexicans and 60% in
Southwestern American Indians (Kuehl et al 2001, Hustert et al 2001, Lamba J et al
2002).
There are mutations within intron 4 and intron 5 of the CYP3A5 gene which also
create cryptic splice sites that can affect the production of functional mRNA (SV2
and SV3). However, these rarer mutations have, to date always been seen in
combination with the intron 3 SNP and thus, represent CYP3A5*3 haplotypes (*3A,
*3B and *3C). Additional rare mutations that also give rise to splicing defects have
been reported. Several other intronic and flanking CYP3A5 SNPs have also been
described, although the haplotype for these mutations has not yet been determined.
In their publication Kuehl et al reported on the close association between high
hepatic CYP3A5-specific content and the presence of the CYP3A5*1A allele.
Moreover, they also demonstrated that Caucasians and African American livers with
at least one copy of the CYP3A5*1A allele exhibited a mean midazolam
hydroxylation activity that was approximately 2-fold higher than that observed for
the corresponding CYP3A5*3/*3 livers. While there was considerable phenotypic
variability within different CYP3A5 genotype groups, presumably as a result of
variable CYP3A4 expression, livers carrying a functional CYP3A5 allele were more
likely to exhibit more catalytic activity than those that did not. Hustert et al, reported
a similar concordance between hepatic CYP3A5 protein content and the
CYP3A5*1A genotype, however, the presence of CYP3A5 protein was less
prevalent than that seen in other Caucasian liver banks.
The impact of CYP3A5 splice variants on the production of mRNA is quite
interesting. Although livers with a homozygous CYP3A5*1 genotype produce only
34
properly spliced, wild type (wt) mRNA, those homozygous for the CYP3A5*3 variant
allele produce both wt and variant (SV1) mRNA. Utilizing a quantitative Taqman
assay, Lin et al (2002) found that the mean wt-CYP3A5 mRNA level was 4-fold
higher in CYP3A5*1/*3 livers compared to CYP3A5*3/*3 livers. SV1-CYP3A5
mRNA was absent from CYP3A5*1/*1 tissue, and present in heterozygous livers at
levels that were approximately 10-fold lower than wt-CYP3A5 mRNA. Moreover,
inter-individual differences in wt-CYP3A5 mRNA content could explain 53% of the
variability in CYP3A5 protein content. A similar correlation was seen between
hepatic CYP3A4 mRNA and protein content, demonstrating the variable
transcriptional control is the dominant source of inter-individual differences in
hepatic CYP3A levels. Interestingly, the relative amount of wt- and SV1-CYP3A5
mRNA were highly correlated with each other, for both CYP3A5*1/*3 and
CYP3A5*3/*3 sub-populations, suggesting that the probability of proper and
improper splicing at the exon 3/exon 4 boundry is pre-determined by the interaction
of the pre-mRNA with the spliceosome.
Because the substrate specificity and product regioselectivity of CYP3A5 can differ
from that of CYP3A4, it is expected that the impact of CYP3A5 genetic
polymorphism on drug disposition will be drug dependent. There are substrates,
which are common for CYP3A4 and CYP3A5 however for which the catalytic
activity of CYP3A5 is comparatively much lower than that of CYP3A4, whereas for
few substrates the catalytic activity is comparable.
Even when CYP3A5 is shown to be as efficient a catalyst of drug metabolism as
CYP3A4, one can still identify significant differences in product regioselectivity.
CYP3A5 catalyzes the formation of the M1 metabolite of cyclosporine, but it does
not make AM9 and AM4N. CYP3A4 produces all the three metabolites. There is
little information in the literature pertaining to the in vivo significance of newly
identified CYP3A5 polymorphisms with respect to metabolic drug clearance
(Aoyama T et al 1989). Undoubtfully, many pharmacogenetic studies are currently
underway and results can be expected to appear in the literature.
35
Aoyama et al (1989) screened a liver cDNA library with CYP3A4 as probe and
isolated a cDNA encoding CYP3A5, which they termed PCN3. Immunoblot analysis
of liver microsomes showed that CYP3A5 is expressed as a 52.5KD protein. The
deduced 502 amino acid CYP3A5 protein shares 85% sequence similarity with
CYP3A4. Analysis of enzymatic activity established that CYP3A4 and CYP3A5
have overlapping substrate specificity with minor differences in the metabolism of
steroids and cyclosporine, suggesting that CYP3A4 may bind these drugs at more
than 1 site.
Jaunaidi et al (1994) isolated the 5-prime flanking region of CYP3A5 from a
genomic clone on chromosome 7. Promoter analysis determined that CYP3A5 uses
a CATAA, rather than a TATA box at positions -23 to -28 and has a basic
transcription element from -35 to -50.
Yamakoshi et al (1999) isolated a cDNA clone for CYP3A5 from a prostate library
and determined that it has a unique 5-prime untranslated sequence, suggesting that
CYP3A5 is differentially regulated in liver and prostate. Enzymatic analysis showed
that the prostate form of the enzyme could metabolize sex hormones.
Variation in CYP3A enzymes, which act in drug metabolism, influences circulating
steroid levels and responses to half of all oxidatively metabolized drugs. CYP3A
activity is the sum activity of the family CYP3A genes, including CYP3A5, which is
polymorphically expressed at high levels in a minority of Caucasians. Previous
studies on CYP3A5 showed that a greater degree of heterogeneity seems to be
conferred by differences in the expression of CYP3A5. Genetic polymorphisms of
CYP3A5 have been found to be associated with more significant pharmacokinetic
effects on immunosuppressive drugs than those of CYP3A4.
36
MDR-1
In 1976, a 170KD glycosylated membrane protein was isolated from colchicine-
resistant Chinese hamster ovary cells. Since this glycoprotein appeared unique to
sublines displaying altered drug permeability, it was named para-glycoprotein.
About 10 years later, the human MDR1 gene was isolated from multidrug-resistant
KB carcinoma cells and was demonstrated to encode human p-glycoprotein. To
date, several isoforms of p-glycoprotein have been identified from humans, mice,
hamsters and rats and these are encoded by a family of closely related genes.
Based on their 3’-untranslated regions they are classified into 3 subclasses: class 1
containing human MDR1, mouse MDR1a or (mdr-3), hamster Pgp1 and rat Pgp1,
class 2 containing of mouse MDR-1b or (mdr-1), hamster Pgp-2 and rat pgp-2 or
(mdr-1b) and class 3 containing of human MDR3 or (MDR2), mouse mdr2, hamster
Pgp3 and rat pgp3.
It has been elucidated that human para-glycoprotein is a phosphorylated and
glycosylated protein with 1280 amino acid residues and consists of 2 homologous
halves containing 6 putative hydrophobic Transmembrane segments and an
intracellular binding site for ATP. The halves are separated by a flexible linker
polypeptide. Structural analysis by electron microscopy and image analysis using
Chinese hamster ovary cells suggested that P-glycoprotein approximates a cylinder
of about 10nm in diameter and a maximum height of 8nm, thus about one half of the
molecule is in the membrane. A large aqueous chamber within the membrane is
open at the cytoplasmic face. Extensive mutational analysis revealed that the two
halves of human para-glycoprotein interact to form a single transporter and the
major drug binding domains reside in or near transmembrane domains 5, 6 and 11,
12. P- glycoprotein is understood to act as a pump which detects and removes it’s
substrates into and out of cells, however another model which has been proposed
states that P-glycoprotein acts as a flippase carrying it’s substrate from the inner
leaflet of lipid bilayer to outer leaflet. P-gp belongs to a large group of functional
proteins that share common functional and structural properties. This superfamily is
37
known as ATP-binding cassette superfamily. To date more than 40 human ABC
transporter genes have been identified and sequenced. Pgp is defined as ABCB1.
Recently the term MDR1 has come to be used instead of Pgp.
Multidrug resistance-1 gene codes for para glycoprotein (pgp) a 170kDa
transmembrane glycoprotein. It is a member of the adenosine triphosphate (ATP)
binding cassette family of membrane transporters and thus contributes to phase III
metabolism of drugs. It functions as an energy dependant transmembrane efflux
pump that exports a number of substrates from inside to outside of cells to reduce
the accumulation of toxic substances and metabolites within the cells. Pgp is
reportedly expressed in various human tissues, including the intestine, adrenal,
kidney, liver and capillary endothelial cells of brain and testes. The disposition of
pgp expression suggests that pgp may play a role in the absorption and excretion of
it’s substrates and protect organism from toxic xenobiotics.
Great interindividual variations in the expression and function of pgp are due to
genetic factors. About 15 mutations and 28 SNPs have been identified so far in the
MDR-1 gene. Out of these SNPs the one in exon 21 (G2677T) and the other in
exon 26 (C3435T) are of particular interest because they have significant
pharmacological effects and are associated with alteration of pgp expression and/or
function. The SNP in exon 26 (C3435T) has been studied extensively. Hoffmeyer et
al (2000) first showed that SNP was associated with variation in intestinal
expression and function of pgp. The 3435C/C allele was more strongly associated
with pgp expression than the 3435T/T allele in enterocytes, and the circulating
concentrations of orally administered digoxin were higher for the 3435T/T allele than
for the 3435C/C allele. Several other groups also reported that SNP is associated
with pgp expression in CD56+ NK cells and placental tissues. SNP in exon 26 is a
silent one that does not result in any amino acid changes, while the heterozygosity
for the 3435T allele in exon 26 results in a 2-fold reduction in intestinal pgp
expression (Ameyaw et al 2001). This may be interpreted by the tight linkage with
the recently reported exon 21 G2677T SNP which alters the protein sequence
38
resulting in an A893S amino acid change. A noncoding SNP located in the promoter
of MDR-1 (T-129C) is also associated with weaker expression of pgp in human
placenta.
Investigation of the frequency of polymorphisms of MDR-1 found that there is
significant variability among various ethnic groups. In the African-American group
there is a 68% to 83% frequency of the MDR-1 3435CC genotype in contrast to
21% to 25% in Caucasian subjects, and 29% to 38% in Asians.
Relationship between CYP3A and MDR-1
It is known that there is a close relationship between CYP3A and PGP, which
overlap in substrates, and both contribute significantly to absorption and phase I
metabolism and share localization in small intestinal enterocytes. In the gut, PGP is
present on the apical membrane of the cells of the brush border, whereas the
CYP3A enzyme is located deeper in the cell, within the endoplasmic reticulum. This
arrangement limits or regulates access of drugs to CYP enzymes and prevents CYP
enzymes from being overwhelmed by the high drug concentration in the intestine.
Functional interactions between PGP and CYP3A have been suggested, though not
yet completely understood, at 3 levels 1) co-regulation of gene expression; 2)
functional interaction and 3) active transport of drug metabolites. One study showed
that the C3435T polymorphism in the MDR1 gene affects the enterocyte expression
level of CYP3A4 rather than PGP. Moreover, Anglicheu et al (2003) found in
Caucasians that CYP3A5*3 allele carriers were more likely to possess the MDR1
3435T allele.
CHAPTER 3
AIMS AND OBJECTIVES
39
Chapter 3 – Aims and Objectives
Drug induced nephrotoxicity is the most common phenomenon occurring in the
case of renal transplant recipients. It is the major factor affecting the outcome of
renal transplantation. As described earlier, gene polymorphisms in drug
metabolizing genes, drug transporter genes and drug targets has been shown to be
a contributing factor in influencing the activities of these enzymes. Therefore, SNP
profiling of patients undergoing kidney transplant may help to decide how each
patient will behave clinically to a given drug dose. Depending on the genetic status
of the individual, his/her metabolic status could be decided.
Depending on the metabolic status of individual, clinicians would be able to decide
the individualized dosage regimen, which in turn would help in reducing the chance
of occurrence of drug induced nephrotoxicity.
Keeping this hypothesis, we decided to study,
A-290G polymorphism of CYP3A4 gene,
A6986G polymorphism of CYP3A5 gene,
C3435T polymorphism of MDR-1 gene and
T-330G polymorphism of IL-2 gene
in 100 healthy controls and 100 renal transplant recipients so as to obtain a
comparative data between diseased and general population. We further aimed at
correlating the occurrence of these SNPs with the blood levels of CNIs and
subsequent incidences of nephrotoxicity. IL-2 SNP data as well as the incidences of
nephrotoxicity and rejection will be correlated with IL-2 plasma levels to observe the
role of IL-2 gene SNP in influencing it’s levels. As per the hypothesis, this could
guide clinicians to establish individualized dosage regimen for CNIs in order to
minimize the incidences of drug induced nephrotoxicity.
CHAPTER 4
MATERIALS AND METHODS
40
Chapter 4 – Materials and Methods
Subjects
Consecutive 100 renal transplant recipients receiving either CsA or tacrolimus were
included in patient group. Their clinical details like renal profile, liver profile, past
history of diseases or disorders were noted down as per the proforma. Patient
samples were collected from P. D. Hinduja National Hospital (N=12) as well as from
Muljibhai Patel Urological Hospital (MPUH), Nadiad, Gujrat (N=88). Plasma
separation and sample storage was done by laboratory staff of MPUH and samples
were collected from them in periodic visits to the hospital (by the gap of 1 to 11/2
month). Transportation of samples was done in a sealed container having ice pack.
Control group comprised of consecutive 100 subjects having normal renal profile.
Controls were selected in order to compare the genotype and allele frequencies of
the polymorphisms included in the study for the patients with general healthy
population. This group was chosen from the subjects attending regular health check
program at our hospital. After sample collection blood samples of patients as well as
controls were stored at 4°C and separated plasma samples of patients were stored
at -70°C.
Sample collection
Blood sample collection was done in EDTA tube.
For patients –
One 5cc EDTA pretransplant before starting CNIs and
One 5cc EDTA on 6th day after transplant
For controls –
One 5cc EDTA
Pre- as well as posttransplant blood sample collection was done for patients to use
the separated plasma for IL-2 ELISA.
Collected blood samples were used for genomic DNA extraction.
41
Genomic DNA extraction
Mammalian DNA is usually isolated by treatment of cells with proteinase K in the
presence of EDTA and SDS followed by extractions with phenol and isoamyl
chloroform. However this method is cumbersome especially when large number of
samples are involved. This method also involves risk to perform because of
involvement of hazardous solvents. Therefore simple salting out procedure
described by Miller et al was preferred for all the extractions done. The procedure
used is as follows.
1. 5 ml of anticoagulated blood (heparinized) was overlaid on equal amount of
'Histopaque' (Sigma) in 15 ml polypropylene tubes and centrifuged at 2,500 rpm
x 30 mins. Buffy coats of nucleated cells were obtained.
2. The cells were washed thrice with phosphate buffered saline (PBS) [See
appendix].
3. After washing, 3 ml of nuclei lysis buffer (See appendix) was added to the cells.
4. The cell lysate was digested overnight at 37°C with 0.2 ml of 10% SDS (See
appendix) and 0.5 ml of Proteinase K Solution (1 mg/ml Proteinase K in 1% SDS
and 2mM Na2EDTA).
5. After digestion the solution obtained was clear and very viscous. It was treated
with 6M sodium chloride solution [See appendix] (such that the final molarity of
sodium chloride is around 1.5 M (1 ml 6M NaCl per 3.5 ml lysis solution). Most of
the proteins precipitate out at this concentration.
6. The suspension was mixed vigorously and centrifuged at 2500 rpm x 20 mins.
The precipitated protein settled at the bottom of the tube and formed a pellet.
The viscous supernatant containing the DNA was transferred to another 15 ml
polypropylene tube.
7. Exactly 2 volumes of RT absolute ethanol (Hayman Ltd.) were added and the
tubes inverted several times until the DNA precipitated.
8. The precipitated DNA strands were removed with a plastic spatula or pipette and
transferred to a fresh 1.5 ml micro-centrifuge tube, washed with 70% ethanol
42
and allowed to dry. (Total drying is avoided, as it becomes difficult to redissolve
the DNA). After partial drying, DNA was redissolved in 100 µl of TE buffer (See
appendix).
9. The DNA was allowed to dissolve for 2 hrs at 37°C or overnight at 4°C before
quantitating.
10. The absorbance of the DNA was measured at 260 nm and 280 nm and the yield
obtained from this technique was 0.5-1.0 µg/µl. The ratio of A260 to A280 was
consistently between 1.7-2.0, demonstrating good deproteinization.
11. The DNA samples were electrophoresed on 0.8% agarose gel (See appendix) in
1X TAE buffer (See Appendix) as described later. Lambda DNA/Hind III digest
was used as a marker. The DNA was found to be of high molecular weight. DNA
samples extracted from the whole blood of all the subjects were preserved at -
20°C until use for PCR.
Genomic DNA amplification
In 1983, Dr. Kary Mullis from Cetus conceived a novel concept, which ultimately
earned Dr. Mullis the Nobel prize for Chemistry in 1993. This concept involves
utilizing an enzyme that normally is responsible for DNA synthesis (a DNA
polymerase), specific sequences (DNA primers) and other reagents such as
magnesium which is a co-factor for the activity of DNA polymerase, dNTPs etc. He
invented a test tube process of repetitive DNA synthesis. The process is termed as
Polymerase Chain Reaction (PCR) amplification. Application of this powerful
technology has touched every aspect of medical science and the practice of
medicine, from the study of gene regulation to the diagnosis of infectious, neoplastic
and hereditary diseases. The invention of PCR has upgraded recombinant DNA
technology, to a new level: it allows the scientist and the clinician to directly amplify
a defined stretch of DNA sequence in an exponential fashion, in short span of
several hours. The simplicity and sensitivity of this process makes it possible to
utilize this technology for the analysis of a minute amount of a specific genetic
material.
43
Principle –
DNA is made from four nucleotides adenine, guanine, thymine and cytosine. The
DNA molecule normally is present inside the cell as a complex of two polynucleotide
strands which, at the molecular level, complement each other so that adenine (a
purine) on one strand always corresponds to thymidine (a pyrimidine) on the other
strand, and a guanine (a purine) on one strand always corresponds to cytosine (a
pyrimidine) on the opposite strand. This complementation allows maximum
hydrogen bond formation between the purine and pyrimidine bases and at the same
time provides for the same spacing for each of the three base pairs [always a
purine, a fused 5- and 6- member ring, with a pyrimidine, a 6- member ring]. The
two DNA strands are oriented in an antiparallel direction (5’ to 3’) orientation
according to the linkage of phosphodiester backbone and twist around each other,
creating a double helix.
DNA polymerase is capable of synthesizing a second strand of DNA always in a
5’to 3’orientation, using the four nucleotide triphosphates as substrates, one DNA
strand as a template and a short piece of complementary DNA as primer. To initiate
DNA synthesis in vitro, the double stranded DNA is first heated to separate the two
strands, (denaturation), It is then cooled, thus allowing the annealing of primers
(which are provided in an excess amount) to the complementary DNA fragments. If
two specific DNA primers are provided that are complementary to the DNA
sequences on the opposite strand of parental DNA molecule, DNA synthesis
mediated by the DNA polymerase (extension) will yield two double stranded
molecules from the parental DNA duplex. If this process is repeated a second time,
the result would be four DNA molecules. In other words, the DNA multiplies
exponentially (doubling each time) as the same cycle of reaction is repeated. This is
the basis of PCR. PCR amplification
44
theoretically can amplify a short stretch of DNA fragment (upto several thousand
base-pair long), from a single molecule to 1,000 copies (210 = 1,000), if the process
is repeated 10 times, to one million copies (220 = 1,000,000) if the process is
repeated twenty times, and to one billion copies (230 = 1,000,000,000) if the process
is repeated 30 times. This process can be carried out automatically in a machine
called as thermal cycler that repeats this cycle of denaturation (94 to 96°C)
annealing of primers (40 to 60°C) and DNA synthesis (65 to 75°C), using a
thermostable DNA polymerase. A billion fold amplification, can be accomplished in
a span of 3 to 4 hours, yielding microgram quantity of DNA for direct analysis or
further procedures.
Amplification of CYP3A4 gene
Genomic DNA was amplified by PCR for the desired region of CYP3A4 gene by
using the primers mentioned in the table. PCR reactions were carried out in 0.5ml
microcentrifuge tubes with following conditions
Initial denaturation for 5min at 94°C followed by denaturation at 94°C for 1min,
primer annealing temperature at 60°C for 1min and amplification at 72°C for 1min.
These steps were repeated for 38 cycles.
A 50µl reaction contained following reagents
1X PCR buffer (see appendix for details)
2mM MgCl2
200µM dNTP
5pmol of both forward and reverse primers and
1 unit of the enzyme Taq polymerase (Fermentas)
500 ng DNA
45
Amplification of CYP3A5 gene
Genomic DNA was amplified by PCR for the desired region of CYP3A5 gene by
using the primers mentioned in the table. PCR reaction was carried out in 0.5ml
microcentrifuge tube with following conditions
Initial denaturation of 94°C for 5min followed by the denaturation step of 1min,
annealing of the primers at 55°C for 1min and extension of 72°C for 1min. These
steps were repeated for 35 cycles with final extension of 10min at 72°C.
A 25µl reaction contained following reagents
1X PCR buffer (see appendix for details)
1.5mM MgCl2
200µM dNTP
50pmol of both forward and reverse primers and
1.5 units of the enzyme Taq polymerase (Fermentas)
500 ng DNA
Amplification of MDR-1 gene
Genomic DNA was amplified by PCR for the desired region of MDR-1 gene by
using the primers mentioned in the table. PCR reaction was carried out in 0.5ml
microcentrifuge tube with following conditions
Initial denaturation of 94°C for 5min followed by the denaturation step of 1min,
annealing of primers at 55°C for 1min and extension of 72°C for 1min. These steps
were repeated for 35 cycles followed by final extension of 10min at 72°C.
46
A 25µl reaction contained following reagents
1X PCR buffer (see appendix for details)
1.5mM MgCl2
200µM dNTP
25 pmol of both forward and reverse primers and
1 unit of the enzyme Taq polymerase (Fermentas)
500 ng DNA
Amplification of IL-2 gene
Genomic DNA was amplified by PCR for the desired region of IL-2 gene by using
the primers mentioned in the table. PCR reaction was carried out in 0.5ml
microcentrifuge tube with following conditions
Initial denaturation of 94°C for 5mni followed by a denaturation step of 1min,
annealing of primers at 59°C for 30 seconds and extension of 72°C for 1min. These
steps were repeated for 30 cycles followed by final extension of 72°C for 10min.
A 25µl reaction contained following reagents
1X PCR buffer (see appendix for details)
1.0mM MgCl2
200µM dNTP
5 pmol of both forward and reverse primers and
1 unit of the enzyme Taq polymerase (Fermentas)
500 ng DNA
47
Detection of the amplified product
Principle
Detection of the amplified products was done using agarose gel electrophoresis.
Agarose gels are cast by melting the agarose in the desired buffer until a clear,
transparent solution is obtained. The melted solution is then poured into a mould
and allowed to harden. Upon hardening of the agarose it forms a matrix, the density
of which is determined by the concentration of agarose. When an electric field is
applied across the gel, DNA, which is negatively charged at neutral pH, migrates
towards anode. The rate of migration depends on
1) Molecular size of DNA – linear or double stranded DNA migrate through gel
matrices at rates that are inversely proportional to log10 of number of base
pairs.
2) Agarose concentration – There is a linear relationship between log of
electrophoretic mobility of DNA and gel concentration.
3) Conformation of DNA – Superhelical circular, nicked circular and linear DNAs
migrate at different rates through agarose gels.
4) Applied voltage – To obtain maximum resolution of DNA fragments greater
than 2kb in size, gel should be run at no more than 5V/cm.
5) Direction of electric field.
6) Base composition and temperature.
7) Presence of intercalating dyes – EtBr reduces electrophoretic mobility of
DNA by 15%. The dye intercalates between the stacked base pairs and
increases length of linear and nicked DNA making them more rigid.
48
Method
1) Edges of clean dry glass tray were sealed with tapes. Mould was set on
horizontal section of bench.
2) Sufficient electrophoresis buffer was prepared 1X TAE (see appendix for
details) and appropriate quantity of powdered agarose was weighed and
added to buffer in a conical flask. Care was taken that the buffer did not
occupy more than 50% of the conical flask.
3) The slurry was heated in microwave oven till all the grains of agarose are
dissolved.
4) The solution was cooled to 60°C and EtBr was added from a stock solution of
10mg/ml in water to final concentration of 0.5µg/ml and mixed thoroughly.
5) Remaining agarose was poured into the mould
6) After the gel is completely set the combs were removed.
7) Enough electrophoresis buffer was added in the running tank so as to cover
the gel properly to a depth of about 1mm.
8) DNA samples or amplified products were mixed with gel loading dye (see
appendix for details) and loaded into the wells formed in the gel.
9) Tank was closed with lid and connected with wires to electrode so that DNA
can migrate towards anode.
10) After the desired separation of the tracking dye Bromophenol blue, the gel
was observed under UV light in the gel documentation system.
49
Genotyping of samples
1) CYP3A4 A-290G polymorphism – The samples were genotyped for this SNP
by using 10 units of restriction enzyme MboII per reaction with 1X buffer (see
appendix) and 10µl of amplified product. The digested products were
separated on 3.5% high resolution agarose gel (Sigma).
2) CYP3A5 A6986G polymorphism – The samples were genotyped for this SNP
by using 1 unit of restriction enzyme SspI per reaction with 1X buffer (see
appendix) and 10µl of amplified product. The digested products were
separated on 3% agarose gel (Himedia).
3) MDR-1 C3435T polymorphism – The samples were genotyped for this SNP by
using 5 units of restriction enzyme DpnII per reaction with 1X buffer (see
appendix) and 10µl of amplified product. The digested products were
separated on 3% agarose gel (Himedia).
4) IL-2 T-330G polymorphism – The samples were genotyped for this SNP by
using 10 units of restriction enzyme FspBI per reaction with 1X buffer (see
appendix) and 5µl of amplified product. The digested products were separated
on 3.5% high resolution agarose gel (Sigma).
Quality control and confirmation of results
In order to check the handling of reagents and method of work, a negative control
involving sterile distilled water instead of DNA sample was incorporated in each
batch of genomic DNA amplification reaction.
For confirmation of results obtained by restriction enzyme digestion method,
representative samples for all the four polymorphisms (12 bidirectional reactions)
were sent for automated sequencing (by ABI Prism) to MWG Biotech, Banglore
Genei and GenOm Bio.
50
Estimation of human plasma Interleukin-2 levels by ELISA
Principle
The ELISA of IL-2 plasma levels was performed by the method provided in the kit
(Immunotech, Beckman Coulter). It is a two immunological step sandwich type
assay. The first step leads to the capture of IL-2 by a monoclonal antibody bound to
the wells of a microtiter plate and the binding of the second monoclonal antibody,
which is biotinylated, to the solid phase antigen complex. In the second step, the
streptavidine peroxidase binds to the biotinylated antibody. After incubation, the
wells are washed and the antigen complex bound to the well detected by addition of
a chromogenic substrate. The intensity of the coloration is proportional to the IL-2
concentration in the sample.
Method
1) All the components of the kit were equilibrated at room temperature for
30min. before starting the assay.
2) Serial dilutions of the standards were made as per the instructions given in
the kit insert (see appendix for details).
3) Wash buffer was diluted 1X from 20X.
4) 50µl of standard or sample and 50µl of biotinylated antibody was added into
wells
5) Plate was incubated for 2hrs at room temperature on microplate shaker at
350RPM
6) After incubation wells were washed by the wash buffer 5 times. Washing was
done by adding 300µl of wash buffer per well and inverting the plate over
discard. The plate was tapped several times on absorbent paper so as to
remove the wash buffer completely.
7) 100µl of streptavidin-HRP conjugate was added to the wells.
51
8) Plate was incubated for 30min at room temperature on microplate shaker at
350RPM.
9) Wells were washed with wash buffer 5 times
10) 100µl of substrate was added to all the wells.
11) Plate was incubated for 20min at room temperature on microplate shaker.
at 350RPM
12) 50µl of stop solution (see appendix) was added to all the wells in order to
stop the reaction.
13) Absorbance was taken at 450nm on a microplate reader capable of
plotting graph and determining the unknown concentrations as per the
curve fit equation in quadratic mode given in the kit insert.
Statistical analysis
Pearson’s chi-square test is applied to test the relationship of categorized
dependant and independent variables. If expected number in a table is below 5 in
any 2xn table then Fisher’s exact test (one sided) was used as the test of
significance. To study the effect on value, when classifying variable had greater
than 2 subgroups then Kruskal-Wallis ANOVA (Analysis of Variance) was used as
the test of significance. For all the tests p value < 0.05 was considered to be
statistically significant. SPSS 15.0, STATA 10.0 and XLSTATS packages were used
to perform all the statistical analysis.
CHAPTER 5
RESULTS AND DISCUSSION
52
Chapter 5 – Results and Discussion
Calcineurin inhibitors have significantly improved the outcome of renal
transplantation. However their inherent nephrotoxic potential limits the survival of
the graft. This CNI induced nephrotoxicity is the result of longer retention of
unmetabolized drug in the circulation. Single nucleotide polymorphisms in the genes
responsible for drug metabolism, drug efflux and drug targets have been shown to
be a major contributing factor towards drug retention in the body and hence
nephrotoxicity. Therefore we hypothesized that the study of these SNPs could
generate data, which would be helpful to clinicians in order to establish
individualized dosage regimen depending on patient’s SNP profile.
In the present study we decided to include 100 consecutive renal transplant
recipients who received either CsA or tacrolimus and 100 healthy controls in order
to compare the genotype as well as allele frequencies in diseased and general
population.
Total 200 subjects including 100 patients and 100 controls were analyzed for the
mentioned SNPs of CYP3A4, CYP3A5, MDR-1 and IL-2 genes. Patient samples
were collected from P. D. Hinduja National Hospital (n=12) and Muljubhai Patel
Urological Hospital (MPUH), Nadiad, Gujrat (n=88). 100 control samples were
collected from the subjects attending regular health check-up program at our
hospital. As the control group included in this study is not related to or a subgroup of
the patient population, the subjects comprising control group were not receiving
CNIs.
Among the consecutive 100 renal transplant patients included in the study, the
incidence of kidney failure was observed more in the age group of 30-50 years.
Gender wise distribution of patients shows that the prevalence of kidney failure was
found more in males (80%) than in females (20%).
53
In order to segregate the patients who achieved higher 6th day CNI levels, both the
categories of patients (ie. Those on CsA and those on tacrolimus) were divided as
per the therapeutic range of the respective drug levels.
In case of the patients receiving CsA (n=56), the division was made as those who
achieved <1500 ng/ml 6th day C2 level and those who achieved >1500 ng/ml 6th day
C2 level likewise in the case of tacrolimus receiving patients, the division was made
as those who achieved <10 ng/ml 6th day trough level and those who achieved >10
ng/ml 6th day trough level.
Out of the 44 patients receiving tacrolimus, 27 were receiving Azathiopurine along
with tacrolimus and 17 were receiving Mycophenolate mofetil along with it.
From the 56 patients receiving CsA 5 patients developed nephrotoxicity (mean 6th
day C2 level 1699 ng/ml) within one month of transplantation which was confirmed
by tissue biopsy. Out of the 44 patients receiving tacrolimus, 3 patients developed
biopsy proven nephrotoxicity (mean 6th day trough level 17.43 ng/ml) within the
same period of time.
54
CYP3A4 A-290G polymorphism
The A-290G SNP of CYP3A4 gene also called CYP3A4-V is the most common SNP
found in it’s 5’-flanking domain. The change lies in the putative nifedipine response
element (NFSE). Despite the expanding knowledge about CYP3A4 gene mutations,
the impact of variant alleles on enzyme activity is still under-recognized because the
frequency reported for many CYP3A4 variant alleles including G-290 is extremely
low (Ball S et al 1999, Felix C et al 1998. Rebbeck T et al 1998, Rivory L et al
2000).
G-290 allele frequency varies among different ethnic groups, 0% in Taiwanese,
Chinese, Chinese Americans and Japanese Americans, 2 to 9.6% in Caucasians,
9.3 to 11% in Hispanic Americans and 35 to 67% in African Americans (Gonzalez F
et al 1988, Rebbeck T et al 1998, Walker A et al, Hsich K et al 2001, Ball S et al
1999, Garcia-Martin E et al 2002, Paris P et al 1999).
As CYP3A4 substantially contributes to the metabolism of many clinically important
drugs including CNIs, it may be speculated that the observed interindividual
difference in their metabolism is likely attributed to the polymorphic expression of
this enzyme. However the attempts to link SNPs in CYP3A4 gene with functional
effects on drug pharmacokinetics have mostly shown negative results. Results from
many studies have showed no significant pharmacological impact of this
polymorphism on CsA pharmacokinetics. Von Ahsen et al (2001) have reported that
this SNP had no significant effect on trough blood concentrations of CsA in 124
stable Caucasian renal transplant recipients. They also found no significant
difference in the CsA doses needed to maintain similar trough concentrations in the
patients with or without G-290 allele. Similar conclusions have been drawn in many
other studies. It was thought that CYP3A4-V genotype in the transplant population
lacked an association with CsA clearance. Though some results showed a positive
correlation with tacrolimus and or sirolimus, it was associated with drug exposure
and functional influence of CYP3A5. the study of Hesselink et al (2003) showed that
G-290 allele carriers have lower tacrolimus dose-adjusted trough levels than
55
patients with the wild-type genotype. This may be explained by an unlikely
mechanism. The polymorphism is located in the 5’- transcriptional regulatory
element of the CYP3A4 coding region, more likely causing changes in protein
expression rather than activity. Pregnane X receptor and retinoid X receptor are
shown to be transcription initiation factors of CYP3A genes. Thus this polymorphism
may affect the binding of these factors to the regulatory element of CYP3A4 thereby
affecting the gene expression rather than affecting protein per se. On the other
hand, the variability in the pharmacokinetics of orally administered CNIs is largely
determined by interindividual differences in phase I elimination, whereas the C0 of
tacrolimus correlates better with total drug exposure than the results were
essentially influenced by CYP3A5 SNP. The exact contribution still needs to be
elucidated (Ball S et al 1999, Felix C et al 1998, Rebbeck T et al 1998, Von Ahsen
et al 2001, Rivory L et al 2000, Anglicheu D et al 2005, Hesselink D et al 2003,
Kuehl P et al 2001).
Table 2 compares the genotype frequencies of CYP3A4 A-290G SNP in 100
healthy controls and 100 patients. The distribution indicates that there is no
significant difference between genotype frequencies and number of alleles in both
the groups.
Table 3 shows number of genotypes in two subgroups of cyclosporine receiving
patients. It can be observed that these subgroups showed the prevalence of AA
(wild type) genotype and consequently A allele. The five patients who developed
nephrotoxicity were homozygous wild type for this polymorphism.
Table 4 shows number of genotypes in the two subgroups of tacrolimus receiving
patients. In this case also it can be observed that both these subgroups showed the
prevalence of AA (wild type) genotype and consequently A allele. The three patients
who developed nephrotoxicity were homozygous wild type for this polymorphism.
56
Table 5 shows the distribution of genotypes of CYP3A4 A-290G SNP in case of the
patients receiving tacrolimus and azathiopurine. All the patients in this case also
were found A allele carriers and most of them are homozygous wild type (AA n =
26).
Table 6 shows the distribution of genotypes of CYP3A4 A-290G SNP in case of the
patients receiving tacrolimus and Mycophenolate mofetil. All the patients in this
case also were found homozygous wild type (AA, n = 17).
57
CYP3A5 A6986G polymorphism
The 6986 A/G variation within intron 3 seems to be the most important functional
polymorphism in the CYP3A5 gene. CYP3A5*3 (G at position 6986) creates an
aberrantly spliced site in the pre- mRNA with a stop codon and leads to a truncated
CYP3A5 protein. Among CYP3A5*3/*3 subjects, CYP3A5 expression comprises
only 4.2% of total CYP3A in the jejunum. Among heterozygous CYP3A5*1/*3
subjects, however, CYP3A5 expression is appreciable, with 50% of total CYP3A in
the liver and 61% of CYP3A in the jejunum (Lin Y et al 2002). It has been reported
that CYP3A5*1 (A at position 6986) allele is related to the increased expression of
CYP3A5 enzyme and only people with at least one CYP3A5*1 allele actually
express CYP3A5 protein (Kuehl P et al 2001). In some patients, the coexistence of
the other variant alleles CYP3A5*2, CYP3A5*6 and CYP3A5*7 with CYP3A5*1
allele may prevent the expression of CYP3A5 (Hustert E et al 2001). As a result of
racial differences in the frequency of the most prevalent CYP3A5 alleles, about one
quarter of Caucasians and half of African Americans generally have the ability to
express functional CYP3A5. Japanese and Chinese people express CYP3A5
approximately three times as frequently as Caucasian subjects (Kuehl et al 2001,
Chou F et al 2001, Hiratsuka M et al 2002).
Several studies have shown that the dose of tacrolimus is associated with CYP3A5
SNPs. Patients with CYP3A5*1 allele require a larger dose of tacrolimus (kg/day) to
achieve the same blood concentration than the homozygous patients with
CYP3A5*3 in pediatric heart and adult lung transplantation (Zheng H et al 2003,
Zheng H et al 2004). The result was also shown in renal transplant recipients
(Thevert E et al 2003, Zhang X et al 2005). Moreover, others studied SNPs in a
pseudogene CYP3AP1 (-44A�G) and CYP3A5*3 and found that determination of
the CYP3A5*3 genotype could be used to predict the dose of tacrolimus (Macphee I
et al 2005, Macphee I et al 2002) . A study shows that polymorphisms of the donor
CYP3A5 gene seemd to contribute more to the individual variation of the dose of
tacrolimus. In case of CsA, however few studies have shown the role of this SNP on
CsA pharmacokinetic characteristics. Hesselink et al (2003) found no association
58
between CYP3A5 genetic polymorphism and dose adjusted predose concentration.
Interestingly unexpected result was reported in a recent study demonstrating that
CsA oral clearance was significantly lower in CYP3A5 expressers than in the
nonexpressers (Yates C et al 2003). They suggested that this observation was
artefact attributed to a linkage in their study population between CYP3A5
nonexpressers and MDR-1 3435T allele carriers. They failed to independently
assess whether CYP3A5 correlated with any CsA pharmacokinetic parameter since
all CYP3A5 nonexpressers were also MDR-1 3435T allele carriers. Another report
demonstrated that an effect of CYP3A5 intron 3 polymorphism was associated with
CsA dosage to a lesser extent other than tacrolimus in stable renal transplant
recipients (Haufroid V et al 2004). Dose adjusted trough concentrations were 3 fold
and 1.6 fold higher in CYP3A5*3/*3 patients than in CYP3A5*1/*3 patients for
tacrolimus and CsA, respectively (Hesselink D et al 2003, Evans W et al 1999,
Kamdem et al 2005). Although the polymorphism of CYP3A5 is thought to be
associated with the tacrolimus requirement but not associated with CsA
pharmacokinetics (von Ahsen et al 2001), the exact mechanism of CYP3A5 on CsA
pharmacokinetics is still controversial and needs to be further clarified.
Table 7 compares the genotype frequencies of CYP3A5 A6986G SNP in 100
healthy controls and 100 patients. The distribution indicates that there is no
significant difference between genotype frequencies and number of alleles in both
the groups.
Table 8 shows number of genotypes in the two subgroups of cyclosporine receiving
patients. It can be observed that both these subgroups showed the prevalence of G
allele. On comparing the A allele carriers (AA+AG) and homozygous mutants (GG)
from <1500ng/ml group with those of >1500ng/ml group we did not find significant
difference. All the five patients who developed nephrotoxicity were heterozygous for
this polymorphism.
59
Table 9 shows number of genotypes in the two subgroups of tacrolimus receiving
patients. It can be observed that all the 8 patients who achieved greater than
10ng/ml 6th day trough level of tacrolimus were homozygous mutants (GG). As per
the observations of Hesselink et al (2003), the patients having GG genotype for this
SNP require lower tacrolimus dose to achieve target drug level, which means they
show higher trough levels if dose adjustments are not done. Consequently, the
observations from above table suggest that a significant difference (p<0.05) exists
between A allele carriers and homozygous mutants (GG) in <10ng/ml and >10ng/ml
groups and the group achieving higher levels is prevalent in GG genotype. This
indicates the risk of nephrotoxicity. The three patients who developed biopsy proven
nephrotoxicity were all mutants for this polymorphism.
In order to observe the effect of CYP3A5 A6986G polymorphism on the
pharmacokinetics of tacrolimus we tabulated the median of level/dose (L/D) ratio
against the three genotypes. Observation from the following table shows that the
median L/D ratio was found to be significantly higher in the patients having GG
genotype (n = 24) by Kruskal-Wallis test (table 10).
Table 11 shows the genotype distribution of CYP3A5 A6986G SNP in the patients
receiving tacrolimus and azathiopurine. All the patients who achieved >10ng/ml 6th
day trough level of tacrolimus showed homozygosity for mutant G allele.
Table 12 shows the genotype distribution of CYP3A5 A6986G SNP in the patients
receiving tacrolimus and mycophenolate mofetil. In this case also all the patients
who achieved >10ng/ml 6th day trough level of tacrolimus showed homozygosity for
mutant G allele.
60
MDR-1 C3435T polymorphism
Both CsA and tacrolimus are the substrates for P-gp. Numerous studies have
associated SNPs in the MDR-1 gene with dosage of CsA and tacrolimus in organ
transplant recipients. Yates et al (2003) investigated 10 renal transplant recipients
and concluded that MDR-1 3435T allele carriers had enhanced CsA oral clearance
compared with individuals with the CC genotype. A recent study also shows that the
donor’s MDR-1 C3435T genotype was associated with the development of CsA
nephrotoxicity in renal transplant patients (Anglicheau D et al 2003). P-gp is also an
important factor in CNI induced nephrotoxicity. Recently the donor's MDR1 C3435T
genotype was associated with the development of CsA nephrotoxicity (Hauser I et
al 2005).
However, conflicting results have been reported. Von Ahsen et al (2001) found no
significant difference in CsA doses needed to maintain similar CsA trough
concentrations in 124 stable Caucasian renal transplant recipients. Goto et al
(2002) found no association between 10 SNPs including C3435T of exon 26 and
the tacrolimus concentration/dose ratio during the first postoperative days after liver
transplantation. Others found no evidence supporting a role of MDR-1 C3435T in
tacrolimus dose or CsA dose adjusted predose concentrations (Hesselink D et al
2003). Further Macphee I et al (2002) reported only a weak association of MDR-1
C3435T with tacrolimus concentrations and hence dose. These conflicting results
might be explained by the delay after transplantation. Several months after
transplantation, side effects of immunosuppressive treatment frequently require the
addition of concomitant medications (antihypertensive, antilipemic and uricosuric)
that might interact with CNI absorption and excretion (Bonhomme-Faivre L et al
2004).
Haplotype analysis of MDR-1 gene exon 12, 21 and 26 SNPs have attracted more
attention from researchers. Anglicheau et al performed a haplotype analysis on
exon 12, 26 and 21 in 81 renal transplant recipients. They showed a 61% increase
in tacrolimus dose regimen for patients who were homozygous for the wild type
61
allele in SNP of all three exons. Bernal M et al (2003) have reported the frequency
of C3435T polymorphism to be 26% (C/C), 22% (T/T), 52% (C/T) in a Spanish
population. In 461 White subjects Cascorbi I et al (2004) have reported the
frequency of mutants to be 28.6% and that of heterozygots to be 53.9%.
A study by Li-Yan-Miao et al (2007) on comparing allele frequencies of MDR-1
C3435T SNP in 105 healthy Chinese volunteers and 50 renal transplant recipients
shows that the frequencies do not differ in both these groups (p>0.05). Zheng H et
al (2003) have concluded in their study on pediatric heart transplant recipients that
the T allele of C3435T SNP of MDR-1 has been associated with increased blood
concentration of tacrolimus and homozygous mutants of this polymorphism require
larger tacrolimus dose to maintain their tacrolimus blood concentration. However a
study done by the same authors Zheng et al (2004) on adult lung transplant
recipients from USA shows no association between the homozygocity for the
mutant allele of this polymorphism and tacrolimus blood concentration. Whereas
Wang J et al (2006) state in their study on adult lung transplant recipients that
haplotypes are predictive of tacrolimus dose requirements. Research by Zhang X et
al (2005) on 118 renal transplant recipients from China does not show any
association between MDR-1 C3435T genotypes and tacrolimus trough levels at 1
week, 1 month or 3 months. Hu YF et al (2006) have studied 106 Chinese renal
transplant recipients receiving cyclosporine and concluded that MDR-1 C3435T
SNP is not a determinant of CsA trough levels and the median C0 level of all the
recipients did not differ in the wild type, heterozygous and mutant genotypes
(p>0.05). Whereas a study on 88 Iranian renal transplant recipients receiving CsA
by Azarpira N et al (2006) has demonstrated that level/dose (L/D) ratio was
significantly higher in the subjects homozygous mutant for MDR-1 C3435T SNP i.e.
(TT). These authors have also stated that pharmacogenetics methods could be
used to help select the initial dosage within few days after transplantation and
individualize the immunosuppressive therapy. A small study on 19 Caucasian renal
transplant recipients by Yates et al shows that MDR-1 3435T allele carriers have
enhanced oral clearance of CsA, however they fail to assess it’s independent role
62
because MDR-1 3435T allele carriers were also CYP3A5 nonexpressors. A study
by Hesselink et al (2003) on renal transplant recipients from Netherlands (on CsA n
= 110, on tacrolimus n = 64) however shows no correlation between MDR-1
C3435T genotypes and tacrolimus dose requirements. Roy JN et al (2006), in their
study on 44 renal transplant recipients from Canada concludes that the complete
absence of CYP3A5*3 allele and the accumulation of less than 3 copies of MDR-1
T-129C, C3435T and G2677T SNPs are associated with lower tacrolimus blood
levels. However Tsuchiya N et al (2004) state in their study on 30 consecutive renal
transplant recipients from Japan that MDR-1 C3435T SNP is not associated with
tacrolimus pharmacokinetics. Study by Haufroid et al (2004) on 50 renal transplant
recipients receiving tacrolimus showed no association between trough blood
concentration of tacrolimus dose requirement and MDR-1 C3435T genotypes. Wei-
Lin W et al (2006) have shown that MDR-1 C3435T genotypes influence tacrolimus
trough levels and hence dose requirements in 50 Chinese liver transplant recipients.
Foote CJ (2006) et al have shown that MDR-1 C3435T polymorphism is an
independent predictor of CsA dose within few days after renal transplant. Kotrych K
et al (2007) have studied 116 renal transplant recipients from Poland receiving CsA
and concluded that this SNP is not a CsA dose predictor. Utecht KN et al (2006)
state that the influences of CYP3A5 and MDR-1 alleles on CsA metabolism and
MDR-1 alleles on tacrolimus metabolism remain controversial. However Akbas SH
et al (2006) in their study on 92 Turkish renal transplant recipients state that
tacrolimus daily doses were significantly lower in the patients with 3435TT genotype
at 1 and 6 month after transplant. Therefore knowledge of MDR-1 genotypes may
be useful to adjust the optimal dose of tacrolimus in transplant patients thereby
rapidly achieving target blood concentrations.
Table 13 compares the genotype frequencies of MDR-1 C3435T SNP in 100
healthy controls and 100 patients. The distribution indicates that there is no
significant difference between genotype frequencies and number of alleles in both
the groups.
63
Table 14 shows number of genotypes in the two subgroups of cyclosporine
receiving patients. It can be observed that both these subgroups showed the
prevalence of T allele hence the difference was insignificant. Of the five patients
who developed nephrotoxicity one patient with the level 1830 ng/ml was
homozygous mutant whereas rest all were heterozygous.
Table 15 shows number of genotypes and alleles in the two subgroups of tacrolimus
receiving patients. It can be observed that all the 8 patients who showed >10ng/ml
6th day trough level of tacrolimus showed the prevalence of mutant (TT) genotype (n
= 7), which suggests the risk for developing nephrotoxicity. All the three patients
who developed nephrotoxicity were homozygous mutants for this polymorphism.
In order to observe the effect of genotypes of MDR-1 C3435T polymorphism on the
pharmacokinetics of tacrolimus, we tabulated the median L/D ratios of tacrolimus
against the genotypes. The observation from the following table shows that the
median L/D ratio was significantly higher in the subjects having TT genotype (n =
18) by Kruskal-Wallis test (table 16).
Table 17 shows the genotype distribution of MDR-1 C3435T SNP in the patients
receiving tacrolimus and azathiopurine. All the patients who achieved >10ng/ml 6th
day trough level of tacrolimus showed homozygosity for mutant T allele.
Table 18 shows the genotype distribution of MDR-1 C3435T SNP in the patients
receiving tacrolimus and mycophenolate mofetil. No significant difference was
observed in the patients with respect to the prevalence of the homozygous mutant
genotype.
64
IL-2 T-330G polymorphism
Cyclosporine and tacrolimus exhibit their immunosuppressive action by inhibiting
the transcription of interleukin-2. Though the molecular mechanisms of
immunosuppression for both these drugs are different, they have a common target.
T-330G polymorphism in the promoter region of IL-2 gene is relatively recent SNP
and hence not much literature is available about it's association studies (Morgun A
et al 2003).
Polymorphisms in the promoter region of cytokine genes have been shown to
influence their levels as well as some of them have been associated with toxicity or
rejection episodes in case of solid organ transplant patients. Therefore the study of
this SNP with respect to CNI blood levels and the incidences of nephrotoxicity with
IL-2 plasma level assumes significance.
Morgun et al (2003) have studied 67 heart and 63 renal transplant recipients for this
SNP and found that wild type genotype (TT) is associated with kidney rejection.
However in the same study, no association was observed for heart transplant
recipients. Holweg et al (2003) have also found no association of this SNP with
rejection episodes in 301 heart transplant recipients.
A study by Satoh S et al (2007) on 50 recipients with stable renal graft function
shows that the frequencies of the IL-2 T-330G TT genotype were higher in the
patients with progressive CAN (Chronic/sclerosing Allograft Nephropathy)
(p=0.046). The study also concludes that the presence of IL-2 T-330G TT genotype
may be a risk factor for CAN, however further studies with a large number of
subjects would contribute to the ability to make progressive determinations or tailor
immunomodulatory regimens after renal transplantation. Cox ED et al (2001) from
Washington, U.S.A. Have studied 160 (102 whites, 43 African-Americans) renal
transplant recipients and concluded that renal transplant recipients differ from the
general population with regard to IL-2, IL-6 and Interferon gamma gene
65
polymorphisms. These findings again suggest the relevance in making prognostic
determinations or tailoring immunomodulatory regimens after renal transplantation.
Jordan S et al (1993) have shown that IL-2 plasma levels were not predictive of
allograft rejection in the case of Caucasian cardiac transplant recipients. Studies by
Chang DM et al (1996) and Grant SC et al (1996) also concludes the same in
cardiac transplant patients from Taiwan and United Kingdom respectively.
MacMillan M et al (2003) have stated in their study on 95 consecutive donor and
recipient that the high producer G allele of IL-2 T-330G increases risk for acute graft
versus host disease in case of unrelated donor bone marrow transplantation.
A study by Kutukcular et al (1995) on 16 renal transplant recipients from England
shows that out of the 16 patients 7 showed clinical evidence of acute allograft
rejection and 5 showed good allograft function with no signs of rejection. Primary
nonfunction was observed in 4 patients and the IL-2 plasma levels whenever
detectable were found to be predictive of allograft rejection.
The observation from our study shows that out of the 100 patients studied, 8
patients showed detectable plasma posttransplant IL-2 levels (pg/ml) (13.656 on
tac, 3.930 on CsA, 5.779 on CsA, 9.706 on tac, 0.748 on CsA, 11.786 on tac,
30.077 on tac and 2.521 pg/ml on tac) withe their respective IL-2 T-330G genotypes
as (TT, TT, GG, TT, TG, TG, TG, TT). As shown in the bracket above, 5 patients
out of them were on tacrolimus and remaining 3 were on cyclosporine. Out of the 5
patients on tacrolimus, 3 developed nephrotoxicity within one month of
transplantation. Their IL-2 levels were 13.656 pg/ml (TT for IL-2 T-330G), 11.786
pg/ml (TG for IL-2 T-330G) and 30.077 pg/ml (TG for IL-2 T-330G).
Table 19 compares the genotype and allele frequencies of IL-2 T-330G SNP in 100
healthy controls and 100 patients. The distribution indicates that there is no
significant difference between genotype frequencies and number of alleles in both
the groups.
66
Table 20 shows number of genotypes in the two subgroups of cyclosporine
receiving patients. It can be observed that both these subgroups showed the
prevalence of wild type T allele. Of the five patients who developed nephrotoxicity 3
were heterozygous and 2 were wild type for this polymorphism.
Table 21 shows number of genotypes in the two subgroups of tacrolimus receiving
patients. In this case also it can be observed that both these subgroups showed the
prevalence of wild type T allele. Of the three patients who developed nephrotoxicity
2 were heterozygous and 1 was wild type for this polymorphism.
Table 22 shows the distribution of genotypes of IL-2 T-330G SNP in the patients
who were receiving tacrolimus and azathiopurine. No significant difference was
observed in the patients having <10 and >10ng/ml tacrolimus drug levels with
respect to homozygous mutant genotype.
The genotype distribution of the patients receiving tacrolimus and mycophenolate
mofetil shows a significant difference between the two groups with respect to the
number of homozygous mutants (table 23).
CHAPTER 6
CONCLUSION
67
Chapter 6 – Conclusion The success of kidney transplantation gets affected by drug induced nephrotoxicity.
Calcineurin inhibitors are the commonly used immunosuppressants worldwide.
These drugs have shown significant improvement in the outcome of kidney
transplantation; however limiting it’s success by their side effect i.e. nephrotoxicity.
This condition occurs because of improper metabolism of these drugs.
Pharmacogenomics emphasizes that every individual metabolizes drugs
differentially. This difference, in case of CNIs has been attributed to polymorphisms
in the genes involved in their metabolism (CYP3A4, CYP3A5), efflux (MDR1) and
those genes which are their targets (IL-2). Therefore we aimed at studying A-290G
(CYP3A4), A6986G (CYP3A5), C3435T (MDR1) and T-330G (IL-2) polymorphisms
in Indian de novo renal transplant recipients. This data was then correlated with the
blood levels of cyclosporine and tacrolimus. The hypothesis in this study was that if
either of these polymorphisms was found to be associated with higher levels of
either CsA or tacrolimus then it could guide physicians to predict the likelihood of
development of nephrotoxicity early and thereby to adjust the dose.
Upon studying 100 consecutive de novo renal transplant recipients receiving either
CsA or tacrolimus and 100 controls showing normal renal profile, we found that the
genotype frequencies of all the polymorphisms studied did not differ significantly
between controls and patients (p>0.05). In the case of CYP3A4 (A-290G) SNP the
mutant allele frequencies in our healthy subjects (0.050; n=100) lies between that in
the Australians (0.031, Amanda S et al 2002) and Caucasians (0.09, Von-Ahsen et
al 2001). The mutant G allele frequency of CYP3A5 A6986G polymorphism from
our study (0.705; n=100) is at par with that in Chinese (0.76, Nie-xin-min et al 2005)
and higher than that found in Indian immigrants in Singapore (0.59, Balram C et al
2003). In case of the mutant allele frequency of the MDR-1 C3435T polymorphism
we found that the frequency from our study (0.610; n=100) is at par with that found
in Indian immigrants in Singapore (0.63, Balram C et al 2003). However the mutant
68
G allele frequency of IL-2 T-330G polymorphism in our study (0.495; n=100) is
higher than that found in Whites (0.26) and in African- Americans (0.06).
In the patient group, 56 patients who received cyclosporinedid not show significant
difference for genotype frequencies of the polymorphisms studied in the patients
who developed <1500ng/ml and >1500ng/ml 6th day C2 levels. 44 patients who
were receiving tacrolimus also did not show significant difference with respect to
their genotype frequencies of CYP3A4 and IL-2 gene polymorphisms in those who
achieved <10ng/ml and >10ng/ml 6th day trough levels.
However for tacrolimus treated patients CYP3A5 6986G and MDR1 3435T
polymorphism frequencies were significantly different in those who achieved
<10ng/ml and >10ng/ml 6th day trough levels (p=0.010, CYP3A5 and p=0.015,
MDR1 by Fisher’s exact test). Significantly higher tacrolimus levels were observed
in the homozygous mutant cases of CYP3A5 and MDR1 gene polymorphisms
(p=0.011, CYP3A5 and p=0.0122, MDR-1 by Kruskal- Wallis test).
IL-2 ELISA data shows that detectable levels were obtained in the 5 patients who
received tacrolimus. Out of the 5 patients on tacrolimus who developed detectable
IL-2 levels 3 were wild type and 2 were heterozygous. Out of the three patients who
developed nephrotoxicity 1 was wild type and 2 were heterozygous for IL-2 T-330G
SNP.
Thus in the present study on 100 patients we have observed significant association
of CYP3A5 A6986G and MDR1 C3435T polymorphisms with increased levels of
tacrolimus. Larger sample size can only strengthen this association. This data
would be helpful to physicians so that by knowing the genotype of the patient before
undergoing transplantation they would be able to decide upon the starting dose of
tacrolimus so as to avoid high trough levels and consequently nephrotoxicity.
69
Future directions of work
Pharmacogenomics is an upcoming field. Individualized medicine concept is
gradually gaining place in regular clinical practice. Genetic polymorphisms as well
as mutations have now been identified in all the main genes in cytochrome P450
family, however their effect on translation, respective protein levels or on the protein
conformation is not known for all. Therefore proteomic studies could develop
simultaneously with genomics. There is lack of large, conclusive, prospective
studies showing improvement of drug efficacy following genotyping; this is the major
reason why the incorporation of the knowledge gained from pharmacogenetics into
routine medical practice is lacking. The cost of genotyping is decreasing rapidly,
cost effective high throughput genotyping techniques are becoming available and
hence our knowledge about the benefits of predictive genotyping is increasing, this
could be used in designing large association studies. In December 2004 the FDA
(Food and Drug Administration) has approved a microarray chip designed to
routinely identify polymorphisms of drug transporters and cytochrome P450s. This
technique along with the findings from proteomic studies could provide physicians
with valuable information to individualize drug treatment.
70
Figure 1 – Structure of kidney
Source - http://www.sci.sdsu.edu/classes/bio100/Lectures/Lec t16/Image271.gif Figure 2 - Functions of kidney
Source - http://www.engin.umich.edu/~CRE/web_mod/viper/pics/ nephron.gif
71
Figure 3 – a) Dr. J. F. Borel, inventor of cyclospo rine, b) Chemical structure of
cyclosporine
a)
Source –
www.worldoffungi.org/Mostly_Medical/Harriet_Upton/H arriet_Upton.htm
b)
Source- http://dailymed.nlm.nih.gov/dailymed/image.cfm?id=2 988&name=gengraf-capsules-
structure.jpg&CFID=426818&CFTOKEN=98e97d54d4965467- ABA54B97-CA47-C63D-
03D3681BAC969B62&jsessionid=ca305bfcd7d516306626
Cyclic peptide
Side chain
72
Figure 4 – a) Chemical structure of tacrolimus b) M etabolites of tacrolimus c)
Metabolism of tacrolimus
c)
a)
b)
Source - Iwasaki K (2007). Metabolism of tacrolimus (FK506) and recent topics
in clinical pharmacokinetics. Drug Metab. Pharmacok inet., 22 (5), 328-355.
73
Figure 5 - Mechanism of action of cyclosporine or t acrolimus (FK506)
Source – Expert reviews in Molecular Medicine, Camb ridge university press,
2000.
74
Figure 6 – Promoter region of IL-2 gene and the fac tors binding at various
positions.
Source - Grunfeld J, Bach J, Kreis H et al (1998). Advances in nephrology. St.
Lois: Mosby.
75
Figure 7 – ADME process (Absorption Distribution Me tabolism Excretion)
Source - Waterbeemd H, Gifford E (2003). ADMET in silico m odelling: towards
prediction paradise?. Nature Reviews Drug Discovery , 2, 192-204.
Figure 8 – The phase I system, mechanism of action of cytochrome p450
Source - http://www.reactome.org/figures/p450_cat_c ycle.JPG
76
Figure 9 – Topology of p-glycoprotein
Figure 10 – Mechanism of substrate efflux by p-glyc oprotein
Source (Fig. 9 & 10) - Deeley R, Westlake C, Cole S (2006). Transmembrane
transport of endo- and xenobiotics by mammalian ATP -binding cassette
multidrug resistance proteins. Physiol. Rev., 80, 849-899.
SUB SUB
SUB
SUB
77
Figure 11 – The phase III system
Source - Liska D (1998). The detoxification enzyme systems. Altern. Med.
Rev., 3(3), 187-198.
78
Figure 12 – Structure of promoter region of CYP3A4 gene
Figure 13 – Relative position of CYP3A4 and CYP3A5 genes on chromosome
Figure 14 – Phenotypic effect of CYP3A5 A6986G poly morphism
Source (Fig 12, 13, 14) - Lamba JK, Lin YS, Schuetz EG et al (2002). Genetic
contribution to variable human CYP3A-mediated metab olism. Advanced Drug
Delivery Reviews, 54, 1271-1294.
79
Figure 15 – Positions of various SNPs in MDR-1 gene with their positions in
protein
Source - Anglicheu D, Verstuyft C, Laurent-Pung P e t al (2003). Association of
the multidrug resistance-1 gene single-nucleotide p olymorphisms with the
tacrolimus dose requirements in renal transplant re cipients. J. Am. Soc.
Nephrol., 14, 1889-1896.
80
Figure 16 – Steps in Polymerase Chain Reaction
Source - http://employees.csbsju.edu/hjakubowski/cl asses/ch331/dna/pcr.gif
Figure 17 – Approximate temperatures used in DNA am plification
Source - http://www.mun.ca/biology/scarr/PCR_sketch _3.gif
81
Table 1 – Details of the genotyping of the polymorp hisms included in the
study
Gene
Primers
Adapted
from
Amplified
product
length
Restriction
enzyme
used
Fragment
lengths
after
digestion
CYP3A4
Forward
5’gaatgaggacagccatagagacaagggga3’
Reverse
5’cctttcagctctgtgttgctctttgctg3’
Cavalli et
al (2001)
385 bp.
Mbo II
Wt - 175, 169
Ht - 210, 175,169
Mt - 210, 175
CYP3A5
Forward
5’catcagttagtagacagatga3’
Reverse
5’ggtccaaacagggaagaaata3’
Ron HN et
al
(2002)
293 bp.
SspI
Wt - 148, 125
Ht - 168, 148,125
Mt - 168, 125
MDR-1
Forward
5’gatctgtgaactcttgttttca3’
Reverse
5’gaagagagacttacattaggc3’
Calado RT
et al
(2002)
244 bp.
Dpn II
Wt - 172, 72
Ht - 244, 172,72
Mt - 244
IL-2
Forward
5’tattcacatgttcagtgtagttct3’
Reverse
5’agactgactgaatggatgtaggtg3’
Cox ED et
al (2001)
188 bp.
Fsp BI
Wt - 188
Ht - 188, 164,24
Mt - 164, 24
82
Figure 18 – Photograph of IL-2 ELISA plate Figure 19 – OD versus concentration graph of the st andards
Standards
83
Figure 20 – Genotyping of CYP3A4 A-290G polymorphis m
W W H W W Ma
Wild type - 175, 169 Heterozygous - 210, 175, 169 Mutant - 210, 175 Ma – pBR322 MspI digest
84
Figure 21 – Genotyping of CYP3A5 A6986G polymorphis m
Wild type - 148 and 125 Heterozygous - 168, 148, 125 Mutant - 168, 125
Ma – pBR322 MspI digest
M H M H H Ma M H H H M
85
Figure 22 – Genotyping of MDR1 C3435T polymorphism
Wild type - 172, 72 Heterozygous - 244, 172, 72 Mutant – 244 Ma – 50bp DNA ladder
M W W H Ma M H H
86
Figure 23 – Genotyping of IL-2 T-330G polymorphism
H M M H H W H H H W W Ma
Wild type - 188 Heterozygous - 188, 164, 22 Mutant – 164, 22 Ma – 50bp DNA ladder
CYP3A4 A-290G SNP
Table 2 – Comparison of genotype frequencies between controls and patients
Table 3 – Comparison of the genotype frequencies between the two groups of cyclosporine treated patients
Table 4 – Comparison of the genotype frequencies between the two groups of tacrolimus treated patients
CYP3A4Level AA AG GG Total
Controls 92 6 2 100Patients 96 3 1 100
Total 188 9 3 200Fisher's exact = 1.000, NS
CYP3A4Level AA AG GG Total
40 2 1 4313 0 0 13
Total 53 2 1 56Fisher's exact = 1.000, NS
<1500 ng/ml CsA> 1500 ng/ml CsA
CYP3A4Level AA AG GG Total
35 1 0 368 0 0 8
Total 43 1 0 44Fisher's exact = 0.818, NS
<10 ng/ml tac> 10 ng/ml tac
Table 5
Tac, AZA AA AG GG A allele carriers
Homozygous mutants
<10 ng/ml 22 1 0 23 0
>10 ng/ml 4 0 0 4 0
Table 6
Tac, MMF AA AG GG A allele carriers
Homozygous mutants
<10 ng/ml 13 0 0 13 0
>10 ng/ml 4 0 0 4 0
CYP3A5 A6986G SNP
Table 7 – Comparison of genotype frequencies between controls and patients
Table 8 – Comparison of the genotype frequencies between the two groups of cyclosporine treated patients
Table 9 – Comparison of the genotype frequencies between the two groups of tacrolimus treated patients
CYP3A5Level AA AG GG Total
Controls 6 47 47 100Patients 3 62 35 100
Total 9 109 82 200Fisher's exact = 0.0989, NS
CYP3A5Level AA AG GG Total
2 31 10 430 12 1 13
Total 2 43 11 56Fisher's exact = 0.357, NS
<1500 ng/ml CsA> 1500 ng/ml CsA
CYP3A5Level AA AG GG Total
<10 ng/ml tac 1 19 16 360 0 8 8
Total 1 19 24 44> 10 ng/ml tac
Fisher's exact = 0.010
Table 10
Table 11
Tac, AZA AA AG GG A allele carriers
Homozygous mutants
<10 ng/ml 1 11 11 12 11
>10 ng/ml 0 0 4 0 4
Table 12
Tac, MMF AA AG GG A allele carriers
Homozygous mutants
<10 ng/ml 0 8 5 8 5
>10 ng/ml 0 0 4 0 4
CYP3A5L/D ratio AA AG GG
2.66 6.44 8.11Median (ng/ml/mg/kg/day)K-W ANOVA = 0.011
MDR1 C3435T SNP
Table 13 – Comparison of genotype frequencies between controls and patients
Table 14 – Comparison of the genotype frequencies between the two groups of cyclosporine treated patients
Table 15 – Comparison of the genotype frequencies between the two groups of tacrolimus treated patients
MDR-1Level CC CT TT Total
Controls 12 54 34 100Patients 14 54 32 100
Total 26 108 66 200Chi square = 0.8462, NS
MDR-1Level CC CT TT Total
12 20 11 430 10 3 13
Total 12 30 14 56Fisher's exact = 0.107, NS
<1500 ng/ml CsA> 1500 ng/ml CsA
MDR-1Level CC CT TT Total
<10 ng/ml tac 2 23 11 360 1 7 8
Total 2 24 18 44> 10 ng/ml tac
Fisher's exact = 0.015
Table 16
Table 17
Tac, AZA CC CT TT C allele carriers
Homozygous mutants
<10 ng/ml 1 16 6 17 6
>10 ng/ml 0 0 4 0 4
Table 18
Tac, MMF CC CT TT C allele carriers
Homozygous mutants
<10 ng/ml 1 7 5 8 5
>10 ng/ml 0 1 3 1 3
MDR-1L/D ratio CC CT TT
6.22 6.22 8.83Median (ng/ml/mg/kg/day)K-W ANOVA = 0.0122
IL2 T-330G SNP
Table 19 – Comparison of genotype frequencies between controls and patients
Table 20 – Comparison of the genotype frequencies between the two groups of cyclosporine treated patients
Table 21 – Comparison of the genotype frequencies between the two groups of tacrolimus treated patients
IL-2Level TT TG GG Total
Controls 24 53 23 100Patients 33 54 13 100
Total 57 107 56 200Chi square = 0.1354, NS
IL-2Level TT TG GG Total
12 25 6 435 7 1 13
Total 17 32 7 56Fisher's exact = 1.000, NS
<1500 ng/ml CsA> 1500 ng/ml CsA
IL-2Level TT TG GG Total
13 19 4 363 3 2 8
Total 16 22 6 44
<10 ng/ml tac> 10 ng/ml tac
Fisher's exact = 0.427, NS
Table 22
Tac, AZA TT TG GG T allele carriers
Homozygous mutants
<10 ng/ml 6 13 4 19 4
>10 ng/ml 2 2 0 4 0
Table 23
Tac, MMF TT TG GG T allele carriers
Homozygous mutants
<10 ng/ml 7 6 0 13 0
>10 ng/ml 1 1 2 2 2
87
Chapter 7 – Bibliography
Akbas S, Bilgen T, Keser I et al (2006) .
The effect of MDR1 (ABCB1) polymorphisms on the pharmacokinetic of tacrolimus
in Turkish renal transplant recipients.
Transplant. Proc., 38(5), 1290-1292.
Allen R, Hunnisett A, Morris P (1985) .
Cyclosporin and rifampicin in renal transplantation.
Lancet, 1, 1283
Amanda S, Bryan G, Ecushla H et al (2002) .
The CYP3A4*1B polymorphism has no functional significance and is not associated
with risk of breast or ovarian cancer.
Pharmacogenetics, 12(5), 355-366.
Ameyaw M, Regaterio E, Li T et al (2001) .
MDR1 pharmacogenetics: frequency of the C3435T mutation in exon 26 is
significantly influenced by ethnicity..
Pharmacogenetics, 11(3), 217-221.
Amiramani B, Walker AH, Weber BL et al (1999) .
Modification of clinical presentation of prostate tumors by novel genetic variant in
CYP3A4.
J of Nat. Cancer Inst., 91, 1588-1590.
Ando Y, Tateishi T, Sekido Y et al (1999) .
Modification of clinical presentation of prostate tumors by novel genetic variation in
CYP3A4.
J of Nat. Cancer Inst., 95, 1587-1590.
88
Andrus L, Lafferty K (1981) .
Inhibition of T-cell activity by cyclosporine A.
Scand. J. Immunol., 15, 449
Anglicheu D, Verstuyft C, Laurent-Pung P et al (200 3).
Association of the multidrug resistance-1 gene single-nucleotide polymorphisms
with the tacrolimus dose requirements in renal transplant recipients.
J. Am. Soc. Nephrol., 14, 1889-1896.
Aoyama T, Yamano S, Waxman D et al (1989) .
Cytochrome P450IIIA gene product that is differentially expressed in adult human
liver, cDNA and deduced amino acid sequence and distinct specificities of cDNA
expressed hPCN1 and hPCN3 for the metabolism of steroid hormones and
cyclosporine.
J. Biol. Chem., 264, 10388-10395.
Auchimloss H, Sachs D (1998) .
Xenogenic transplantation.
Annual Review of Immunology, 16, 433-470.
Azarpira N, Aghdaie M, Behzad-Behbahanie A et al (2 006).
Association between cyclosporine concentration and genetic polymorphisms of
CYP3A5 and MDR1 during the early stage after renal transplantation.
Exp. Clin. Transplant., 4(1), 416-419.
Ball S, Scatina J, Kao J et al (1999) .
Population distribution and effects on drug metabolism of a genetic variant in the
5'promoter region of CYP3A4.
Clin. Pharmacol. Ther., 66, 288-294.
89
Balram C, Sharma A, Sivathasan C et al (2003) .
Frequency of C3435T single nucleotide MDR-1 genetic polymorphism in an Asian
population: phenotypic genotypic correlates.
British J. of Clin. Pharmacol., 96(1), 78-80.
Balram C, Zhou Q, Cheung YB et al (2003) .
CYP3A5*3 and *6 single nucleotide polymorphisms in three distinct Asian
populations.
Eur. J. Clin. Pharmacol., 59(2), 123-126.
Bernal M, Sinues B, Fanlo A et al (2003) .
Frequency distribution of C3435T mutation in exon 26 of the MDR1 gene in a
spanish population.
Ther. Drug Monit., 25(1), 107-111.
Bonhomme-Faivre L, Devocelle L et al (2004) .
MDR-1 C3435T polymorphism influences cyclosporine A dose requirement in liver
transplant recipients.
Transplantation, 78(1), 21-25.
Borel J, Feurer C, Gubler H et al (1976) .
Biological effects of cyclosporine A: a new antilymphocytic agent.
Agenis Actions, 6, 468
Borel J (1981) .
Cyclosporine A presents experimental status.
Transplant. Proc., 13, 334
Borel J (1982) .
The history of cyclosporine A and it's significance.
Cyclosporine A, D. J. White edition, 5,
90
Bradley J, Gibbs P, Watson C (2003) .
Update in transplantation- 2003.
Clin. Transpl., , 307-336.
Brooks B, McBride O, Dolphin C et al (1988) .
The gene CYP3 encoding P450CN1 (nifedipine oxidase) is tightly linked to the gene
COL1A2 encoding collagen type 1 alpha on 7q21-q22.1.
Am. J. Hum. Genet., 43, 280-284.
Burdmann E, Andoh T, Yu L et al (2003) .
Cyclosporine nephrotoxicity.
Seminars in Nephrology, 23(5), 465-476.
Calado R, Falcao R, Garcia A et al (2002).
Influence of functional MDR1 gene polymorphisms on p-glycoprotein activity in
CD34+ hematopoetic stem cells.
Haematologica, 87(6), 564-568.
Campistol J, Sacks S (2000).
Mechanisms of nephrotoxicity.
Transplantation, 69, 5-10.
Cascorbi I, Gerloff T, Johne A et al (2004) .
Frequency of single nucleotide polymorphisms in the P-glucoprotein drug
transporter MDR1 gene in white subjects.
Clin. Pharmacol. Ther., 75(1), 124-124.
Cascorbi I (2006) .
Genetic basis of toxic reactions to drugs and chemicals.
Toxicol. Lett., 162, 16-28.
91
Cavalli S, Hirata M, Hirata R (2001).
Detection of MboII polymorphism at the 5' promoter region of CYP3A4.
Clin. Chem., 47, 348-351.
Chang D, Ding Y, Kuo S et al (1996) .
Cytokines and cell surface markers in prediction of cardiac allograft rejection.
Immunol. Invest., 25(1-2), 13-21.
Chang X, Hou Y, Riordan J (1997) .
ATPase activity of purified multidrug resistance associated protein.
J. Biol. Chem., 272, 30962-30968.
Charlton B, Auchinloss H, Fathman C (1994) .
Mechanisms of transplant tolerance.
Annual Review of Immunology, 12, 707-734.
Chin K, Pastan I Gottesman M (1993) .
Function and regulation of the multidrug resistance gene.
Adv. Cancer Res., 60, 157-180.
Chou F, Tzeng S, Huang J et al (1996) .
Genetic polymorphism of cytochrome P450 3A5 in Chinese.
Drug. Metab. Dispos., 29, 1205-1209.
Cockburn I (1986) .
Cyclosporine A: clinical evaluation of drug interactions.
Transplant. Proc., 18, 50
Cox ED, Hoffman SC, Dimercurion BS et al (2001) .
Cytokine polymorphic analysis indicate ethnic differences in the allelic distribution of
interleukin-2 and interleukin-6.
Transplantation, 72, 720-726.
92
Dai Y, Iwanaga K, Lin Y et al (2004) .
In vitro metabolism of cyclosporine A by human kidney CYP3A5.
Biochemical Pharmacol., 68, 1889-1902.
Deeley R, Westlake C, Cole S (2006) .
Transmembrane transport of endo- and xenobiotics by mammalian ATP-binding
cassette multidrug resistance proteins.
Physiol. Rev., 80, 849-899.
Doyle L, Yang W, Abruzzo L et al (1998) .
A multidrug resistant transporter from human MCF-7 breast cancer cells.
Proc. Natl. Acad. Sci., 95, 15665-15670.
English J, Evan A, Houghton D et al (1987).
Cyclosporine-induced acute renal dysfunction in rat. Evidence of arteriolar
vasoconstriction with preservation of tubular function.
Transplantation, 44, 135-141.
Estabrook R (1996) .
Cytochrome P450: from a single protein to a family of proteins - with some personal
reflections.
Cytochromes P450: Metabolic and Toxicological Aspects, , 3-28.
Evans W, Relling M (1999) .
Pharmacogenomics: translating functional genomics into rational therapeutics.
Science, 286, 487-491.
Evans W, McLeod H et al (2003) .
Pharmacogenetics- drug disposition, drug targets and side effects.
NEJM, 348(6), 538-549.
93
Felix C, Walker A, Lange B et al (1998) .
Association of CYP3A4 genotype with treatment related leukemia.
Proc. Natl. Acad. Sci., 95, 13176-13181.
Foote C, Greer W, Kiberd B et al (2006) .
MDR1 C3435T polymorphisms correlate with cyclosporine levels in de novo renal
recipients.
Transplant. Proc., 38(9), 2847-2849.
Formea C et al (2004) .
Cytochrome P-450 3A4, 3A5 and MDR-1 as pharmacogenomic predictors of
tacrolimus pharmacokinetics and clinical outcomes in liver transplant recipients.
Clinical Pharmacology & Therapeutics, 75, 114-119.
Gao M, Cui H, Loe D et al (2000) .
Comparison of the functional charactoristics of the nucleotide binding domains of
multidrug resistance protein 1.
J. Biol. Chem., 275, 13098-13108.
Garcia-Martin E, Martinez C, Pizarro R et al (2002) .
CYP3A4 variant alleles in white individuals with low CYP3A4 enzyme activity. Clin.
Pharmacol. Ther., 71, 196-204.
Giebisch G, Windhager E (2003) .
The urinary system.
Medical Physiology, A cellular and Molecular Approach, Section VI, 735-875.
Goto M, Masuda S, Saito H et al (2002) .
C3435T polymorphism in the MDR1 gene affects the enterocyte expression level of
CYP3A4 rather than Pgp in recipients of living-donor liver transplantation.
Pharmacogenetics, 12, 451-457.
94
Grant S, Lamb W, Brooks N et al (1996) .
Serum cytokines in human heart transplant recipients. Is there a relationship to
rejection?.
Transplantation, 62(4), 480-491.
Grunfeld J, Bach J, Kreis H et al (1998).
Advances in nephrology. St. Lois: Mosby.
Guengerich F (1999) .
Cytochrome P-450 3A4 regulation and role in drug metabolism.
Annu. Rev. Pharmacol. Toxicol., 39, 1-17.
Guyton A (1991) .
Textbook of Medical Physiology 25-31.: WB Saunders.
Haufroid V, Maurad M, Van Kerckhove V et al (2004) .
The effect of CYP3A5 and MDR-1 (ABCB1) polymorphisms on cyclosporine and
tacrolimus dose requirements and trough blood levels in stable renal transplant
patients.
Pharmacogenetics, 14, 147-154.
Hauser I, Schaeffeler E, Gauer S et al (2005) .
ABCB1 genotype of the donor but not recipient is a major risk factor for
cyclosporine-related nephrotoxicity after renal transplantation.
J. Am Soc. Nephrol., 16, 1501-1511.
Hesselink DA, Van Schaik RH, Van der heiden IP et a l (2003).
Genetic polymorphisms of the CYP3A4, CYP3A5 and MDR-1 genes and
pharmacokinetics of the calcineurin inhibitors cyclosporine and tacrolimus.
Pharmacogenetics and Genomics, 9, 245-254.
95
Higgins C (1992) .
ABC transporters: from microorganisms to man.
Annu. Rev. Cell Biol., 8, 67-113.
Hoffmeyer S, Burk O, Richter OV et al (2000) .
Functional polymorphisms of the human multidrug-resistance gene: multiple
sequence variations and correlation of one allele with P-glycoprotein expression
and activity in vivo.
PNAS, 97(7), 3473-3478.
Holweg C, Peeters A, Balk A et al (2003) .
Recipient gene polymorphisms in the Th-1 cytokines IL-2 and IFN-gamma in
relation to acute rejection and graft vascular disease after clinical heart
transplantation.
Transpl. Immunol., 11(1), 121-127.
Hu Y, Qiu W, Liu Z et al (2006) .
Effects of genetic polymorphisms of CYP3A4, CYP3A5 and MDR1 on cyclosporine
pharmacokinetics after renal transplantation.
Clin. Exp. Pharmacol. Physiol., 33(11), 1093-1098.
Humar A, Matas A (2001) .
Immunosuppression: Use in Transplantation.
Encyclopedia of Life Sci.,1-9.
Hustert E, Habri M, Burk O et al. (2001) .
The genetic determinants of the CYP3A5 polymorphism.
Pharmacogenetics, 11, 773-779.
96
Ingelman M, Oscarson M, McLellan R et al (1999) .
Polymorphic human cytochrome P450 enzymes: an opportunity for individualized
drug treatment.
Trends Pharmacol. Sci., 20, 342-349.
Ingelman M (2004) .
Pharmacogenetics of cytochrome P450 and it's applications in drug therapy: the
past, present and future.
Trends Pharmacol. Sci., 25, 193-200.
Inoue K, Inazawa J, Nakagawa H et al (1992) .
Assignment of the human cytochrome P-450 nifedipine oxidase gene (CYP3A4) to
chromosome 7 at band q22.1 by fluorescence in situ hybridization.
Jpn. J. Hum. Genet., 37, 133-138.
Iwasaki K (2007) .
Metabolism of tacrolimus (FK506) and recent topics in clinical pharmacokinetics.
Drug Metab. Pharmacokinet., 22(5), 328-355.
Jaunaidi Y, Guzelian P, Maurel P et al (1994) .
Sequence of the 5-prime - flanking region of CYP3A5: comparative analysis with
CYP3A4 and CYP3A7.
Biochem. Biophys. Res. Commun., 205, 1741-1747.
John S, Turner D, Donn R et al (1998) .
Two novel biallelic polymorphisms in the IL-2 gene.
European Journal of Immunogenetics, 25, 419-420.
97
Jones P, George M (2002) .
Mechanism of ABC transporters: a molecular dynamics simulation of a well
characterized nucleotide binding subunit.
Pract. Natl. Acad. Sci., 99, 12639-12644.
Jordan S, Czer L, Toyoda M et al (1993) .
Serum cytokine levels in heart allograft recipients: correlation with findings on
endomyocardial biopsy.
J. Heart Lung Transplant, 12(2), 333-337.
Kalow W, Tang B, Endrenyi L et al (1998) .
Hypothesis: comparisons of inter- and intra-individual variations can substitute for
twin studies in drug research.
Pharmacogenetics, 8, 283-289.
Kamdem L, Streit F, Zanger U et al (2005) .
Contribution of CYP3A5 to the in vitro hepatic clearance of tacrolimus.
Clin. Chem., 51(8), 1374-1381.
Kasiske B (2006) . Chapter 68, Evaluation of patients for kidney transplantation.
537-544.: ELSEVIER.
Kino T, Hatanaka H, Hashimoto M et al (1987) .
FK-506, a novel immunosuppressant isolated from a streptomyces; fermentation,
isolation and physico-chemical and biological characteristics.
J. Antibiot., 40(9), 1249-1255.
Koeppen B, Stanton B (1992) .
Renal Physiology.: St. Louis, Mosby-Year Book.
98
Koike K, Conseil G, Leslie E et al (2004) .
Identification of proline residues in the core cytoplasmic and transmembrane
regions of multidrug resistance protein 1 (MRP1/ABCC1) important for transport
function, substrate specificity and nucleotide interactions.
J. Biol. Chem., 279, 12325-12336.
Kotrych K, Sulikowski T, Domanski L et al (2007) .
Polymorphism in the p-glycoprotein drug transporter MDR1 gene in renal transplant
patients treated with cyclosporine A in a Polish population.
Pharmacol. Rep., 59(2), 199-205.
Kuehl P, ZaDg J, LiD Y et al. (2001) .
Sequence diversity in CYP3A promoters and characterization of the genetic basis of
polymorphic CYP3A5 expression.
Nat. Genetics., 27, 383-391.
Kutukular N, Clark K, Rigg KM et al (1995) .
The value of posttransplant monitoring of interleukin (IL)-2, IL-3, IL-4 +/- IL-6, IL-8
and soluble CD23 in plasma of renal allograft recipients.
Transplantation, 59, 333-340.
Lamba JK, Lin YS, Schuetz EG et al (2002) .
Genetic contribution to variable human CYP3A-mediated metabolism. Advanced
Drug Delivery Reviews, 54, 1271-1294.
Lehman J, McKee D, Watson M et al (1998) .
The human orphan nuclear receptor PXR is activated by compounds that regulate
CYP3A4 gene expression and cause drug interactions.
J. Clin. Invest., 102, 1016-1023.
99
Li-Yan M, Chen-Rong H, Jian-Quan H et al (2007) .
Association study of ABCB1 and CYP3A5 gene polymorphisms with sirolimus
trough concentration and dose requirements in Chinese renal transplant recipients.
Biopharmaceutics and Drug Disposition, 29(1), 1-5.
Lin Y, Dowling A, Quigley S (2002) .
Co-regulation of CYP3A5 and contribution to hepatic and intestinal midazolam
metabolism.
Mol. Pharmacol., 62, 162-172.
Liska D (1998) .
The detoxification enzyme systems.
Altern. Med. Rev., 3(3), 187-198.
Liu J (1993) .
FK-506 and cyclosporine, molecular probes for studying intracellular signal
transduction.
Immunol. Today, 14, 290-295.
Loo T, Bartlett M, Clarke D (2003) .
Drug binding in human p-glycoprotein causes conformational changes in both
nucleotide binding domains.
J. Biol. Chem., 278, 1575-1578.
Luke R (1994) .
New issues in therapy after renal transplantation.
N.E.J.M., 331, 393-394.
MacMillan M, Radloff G, Kiffmeyer W et al (2003) .
High-producer interleukin-2 genotype increases risk for acute graft-versus host
disease after unrelated donor bone marrow transplantation.
Transplantation, 76(12), 1758-1762.
100
Macphee I, Iain AM, Fredricks, Salim T et al (2002) .
Tacrolimus pharmacogenetics: polymorphisms associated with expression of
cytochrome p4503A5 and p-glycoprotein correlate with dose requirement.
Transplantation Proceedings, 74(11), 1486-1489.
Macphee I, Fredericks S, Mohamed M et al (2005) .
Tacrolimus pharmacogenetics: the CYP3A5*1 allele predicts low dose-normalized
tacrolimus blood concentrations in whites and South Asians.
Transplantation, 79, 499-502.
Manez R, Jain A, Marino I et al (1995) .
Comparitive evaluation of tacrolimus (FK506) and cyclosporine A as
immunosuppressive agents.
Transplantation Reviews, 9, 63-76.
Meyer U (2004).
Pharmacogenetics - five decades of therapeutic lessons from genetic diversity. Nat.
Rev. Genet., 5, 669-676.
Miller S, Dykes D, Polesky H (1998) .
A simple salting out procxedure for extracting DNA from human nucleated cells.
Nucl. Acid Res., 16, 1215.
Molowa D, Schuetz E, Wrighten S et al (1986) .
Complete cDNA sequence of a cytochrome P-450 inducible by glucocorticoids in
human liver.
Proc. Nat. Acad. Sci., 83, 5311-5315.
101
Morgun A, Shulzenco N et al (2003) .
Interleukin-2 gene polymorphism is associated with renal but not cardiac transplant
outcome.
Transplantation Proceedings, 35(4), 1344-1345.
Morisseau C, Hammock B (2005).
Epoxide hydrolases: mechanisms, inhibitor designs and biological roles.
Annu. Rev. Pharmacol. Toxicol., 45, 311-333.
Nie Xin-min, Gui Rong, Zhao Hong Shan et al (2005) .
Influence of CYP3A5 polymorphism on tacrolimus blood concentrations in renal
transplant patients.
J.of Cent. South university of Tech., 12(1), 310-312.
Paris P, Kupelian J, Hall T et al (1999) .
Association between a CYP3A4 genetic variant and clinical presentation in African
American prostate cancer patients.
Cancer Epidemiol. Bio-markers Prev., 8, 901-905.
Paulussen A, Lavrijsen K, Bohets H et al (2000) .
Two linked mutations in transcriptional regulatory elements of the CYP3A5 gene
constitutes the major genetic determinant of polymorphic activity in humans.
Pharmacogenetics, 10, 415-424.
Pawlik A, Domanski L, Rozanski J et al (2005) .
IL-2 and TNF-alpha promoter polymorphisms in patients with acute kidney graft
rejection.
Transplant. Proc., 37(5), 2041-2043.
102
Payen L, Gao M, Westlake C et al (2003) .
Role of carboxylate residues adjacent to the conserved core walker B motifs in the
catalytic cycle of multidrug resistance protein 1 (ABCC1).
J. Biol. Chem., 278, 38537-38547.
Pritchard D (2005) .
Sourcing a chemical succession for cyclosporine from parasites and human
pathogens.
Drug Discov. Today, 10(10), 688-691.
Rao A (1994) .
NF-ATp: a transcription factor required for the co-ordinate induction of several
cytokine genes.
Immunol. Today, 15, 274-281.
Rebbeck TR, Jaffe JM, Walker AH et al (1998) .
Modification of clinical presentation of prostate tumors by a novel genetic variant in
CYP3A4.
J of Nat. Cancer Inst., 90(16), 1225-1229.
Riddell D, Wang H, Umbenhauer D et al (1987) .
Regional assignment for the genes encoding human P450IIIA3 (CYP3) and
P450IIC9 (CYP2C).
Cytogenet. Cell Genet., 46, 682
Rivory L, Qin H, Clark S et al (2000) .
Frequency of cytochrome P450 3A4 variant genotype in transplant population and
lack of association with cyclosporine clearence.
Eur. J. Clin. Pharmacol., 56, 395-398.
103
Ron H, Heiden I, van der Anker J et al (2002).
CYP3A5 variant allele frequencies in Dutch Caucasians.
Clin. Chem., 48, 1668-1671.
Rosen S, Greenfeld Z, Brezis M (1990).
Chronic cyclosporin induced nephropathy in the rat. A medullary ray and inner stripe
injury.
Transplantation, 49, 431-438.
Roy JN, Barma A, Poirier C et al (2006) .
Cyp3A4, Cyp3A5 and MDR-1 genetic influences on tacrolimus pharmacokinetics in
renal transplant recipients.
Pharmacogenetics and Genomics, 16(9), 659-665.
Saeki T, Ueda K, Tanigawara Y et al (1993) .
Human p-glycoprotein transports cyclosporine A and FK506.
J. Biol. Chem., 268, 6077-6080.
Satoh T, Taylor P, Bosron W et al (2002).
Current progress on esterases: from molecular structure to function.
Drug Metab. Dispos., 30, 488-493.
Scarel-Caminaga R, Trevilatto P, Souza A et al (200 2).
Frequencies of the -330 (T-->G) IL-2 and -590 (T-->C) IL-4 gene polymorphisms in
a population from south-eastern Brazil.
European J. of Immunogenetics, 29, 293-296.
Schaefeller E, Eichelbaum M, Brinkmann U et al (200 1).
Frequency of C3435T polymorphism of MDR1 gene in African people.
Lancet, 358, 383-384.
104
Schuetz J, Schuetz E, Thottassery J et al (1996) .
Identification of a novel dexamethasone responsive enhancer in the human
CYP3A5 gene and it's activation in human and rat liver cells.
Mol. Pharmacol., 49(1), 63-72.
Schwab M, Eichelbaum M, Fromm M (2003) .
Genetic polymorphisms of the human MDR1 drug transporter.
Annu. Rev. Pharmacol. Toxicol., 43, 285-307.
Situ D, Haimeur A, Conseil G et al (2004) .
Mutational analysis of ionizable residues proximal to the cytoplasmic interface of
membrane spanning domain 3 of the multidrug resistance protein (MRP1/ABCC1).
Glutamate 1204 is important for both the expression and catalytic activity of the
transpor.
J. Biol. Chem., 279, 38871-38880.
Thatte L, Carlos A, Vaamonde M (1996) .
Drug-induced nephrotoxicity The crucial role of risk factors.
Postgraduate Medicine, 100(6), 31-41.
Tsuchiya N, Satoh S, Tada H et al (2004) .
Influence of CYP3A5 and MDR-1 (ABCB1) polymorphisms on the pharmacokinetics
of tacrolimus in renal transplant recipients.
Transplantation, 78(8), 1182-1187.
Turgut S, Turgut G, Atalay E (2006) .
Genotype and allele frequency of human multidrug resistance (MDR1) gene
C3435T polymorphism in Denizli province of Turkey.
Mol. Biol. Rep., 33(4), 295-300.
105
Turner D, Grant S, Yonan N et al (1997) .
Cytokine gene polymorphism and heart transplant rejection.
Transplantation, 64, 776
Uesugi M, Masuda S, Katsura T et al (2006) .
Effect of intestinal CYP3A5 on postoperative tacrolimus trough levels in living-donor
liver transplant recipients.
Pharmacogenet. Genomics, 16, 119-127.
Utecht K, Hiles J, Kolesar J (2006) .
Effects of genetic polymorphisms on the pharmacokinetics of calcineurin inhibitors.
Am. J. Health Syst. Pharm., 63(23), 2340-2348.
Von Ahsen N, Richter M, Grupp C et al (2001) .
No influence of the MDR-1 C3435T polymorphism or a CYP3A4 promoter
polymorphism (CYP3A4-V allele) on dose-adjusted cyclosporine A trough
concentrations or rejection incidence in stable renal transplant recipients.
Clin. Chem., 47, 1048-1052.
Wacher V, Wu C, Benet L (1995) .
Overlapping substrate specificities and tissue distribution of cytochrome P4503A
and p-glycoprotein: Implications for drug delivery and activity in cancer
chemotherapy.
Mol. Carcinog., 13, 129-134.
Wandel C, Witte J, Hall J et al (2000) .
CYP3A activity in African American and European American men: population
differences and functional effect of the CYP3A4*1B 5'-promoter region
polymorphism.
Clin. Pharmacol. Ther., 68, 82-91.
106
Wang J, Zeevi A, McCurry K et al (2006) .
Impact of ABCB1 (MDR1) haplotypes on tacrolimus dosing in adult lung transplant
patients who are CYP3A5*3/*3 non-expressors.
Transplant. Immunol., 15(3), 235-240.
Watkins P, Wrighton S, Maurel P et al (1985) .
Identification of an inducible form of cytochrome P-450 in human liver.
Proc. Nat. Acad. Sci., 82, 6310-6314.
Wei-lin W, Jing J, Shu-sen Z et al (2006) .
Tacrolimus dose requirement in relation to donor and recipient ABCB1 and CYP3A5
gene polymorphisms in Chinese liver transplant patients.
Liver Transpl., 12(5), 775-780.
Wrighton S, Vandenbranden M (1989) .
Isolation and characterization of human fetal liver cytochrome P450HLp2: a third
number of the P450III gene family.
Arch. Biochem. Biophys., 268, 144-151.
Wu J, Zheng S (2004) .
Liver transplantation in China: problems and their solutions.
Hepatobiliary Pancreat. Dis. Int., 3, 170-174.
Yamakoshi Y, Kishimoto T, Sugimura K et al (1999) .
Human prostate CYP3A5: identification of a unique 5-prime untranslated sequence
and characterization of purified recombinant protein.
Biochem. Biophys. Res. Commun., 260, 676-681.
107
Yates C, Zhang W, Song P et al (2003) .
The effect of CYP3A5 and MDR-1 polymorphic expression on cyclosporine oral
disposition in renal transplant patients.
J. Clin. Pharmacol., 43, 555-564.
Zang X, Liu ZH, Zeng JM et al (2005) .
Influence of CYP3A5 and MDR-1 polymorphisms on tacrolimus concentration in the
early stage of renal transplantation.
Clin. Transplant., 19(5), 638-643.
Zanger U, Raimundo S, Eichelbaum M (2004) .
Cytochrome P450 2D6: overview and update on pharmacology, genetics,
biochemistry.
Naunyn Sch. Arch. Pharmacol., 369, 23-37.
Zhang D, Nunoya K, Vasa M et al (2004) .
Transmembrane helix 11 of multidrug resistance protein 1 (MRP1/ABCC1):
identification of polar amino acids important for substrate specificity and binding of
ATP at nucleotide binding domain 1.
Biochemistry, 43, 9413-9425.
Zhang X, Liu Z, Zheng J et al (2005) .
Influence of CYP3A5 and MDR1 polymorphisms on tacrolimus concentration in the
early stage after renal transplantation.
Clin. Transplant., 19(5), 638-643.
Zhao Q, Chang X (2004) .
Mutation of the aromatic amino acid interacting with adenine moiety of ATP to a
polar residue alters the properties of multidrug resistant protein.
J. Biol. Chem., 279, 48505-48512.
108
Zheng H, Webber S, Zeevi A et al (2003) .
Tacrolimus dosing in pediatric heart transplant patients is related to CYP3A5 and
MDR1 gene polymorphisms.
Am. J. Transplant., 3, 477-483.
Zheng H, Zeevi A, Schuetz E et al (2004) .
Tacrolimus dosing in adult lung transplant patients is related to cytochrome
P4503A5 gene polymorphism.
J. Clin. Pharmacol., 44(2), 135-140.
109