Indian Journal of Experimental Biology Vol.52, March 2014, pp. 267-280

Effect of Dactylogyrus catlaius (Jain 1961) infection in Labeo rohita (Hamilton 1822): Innate immune responses and expression profile

of some immune related genes

Pujarini Dash, Banya Kar, Arpita Mishra & P K Sahoo*

Fish Health Management Division, Central Institute of Freshwater Aquaculture, Kausalyaganga, Bhubaneswar 751 002, India

Received 21 March 2013; revised 12 September 2013

The monogenean ectoparasite, Dactylogyrus sp. is a major pathogen in freshwater aquaculture. The immune responses in parasitized fish were analyzed by quantitation of innate immune factors (natural agglutinin level, haemolysin titre, antiprotease, lysozyme and myeloperoxidase activities) in serum and immune-relevant gene expression in gill and anterior kidney. The antiprotease activity and natural agglutinin level were found to be significantly higher and lysozyme activity was significantly lower in parasitized fish. Most of the genes viz., β2-microglobulin (β2M), major histocompatibility complex I (MHCI), MHCII, tumor necrosis factor α (TNFα) and toll-like receptor 22 (TLR22) in gill samples were significantly down-regulated in the experimental group. In the anterior kidney, the expression of superoxide dismutase and interleukin 1β (IL1β) were significantly up-regulated whereas a significant down regulation of MHCII and TNFα was also observed. The down-regulation of most of the genes viz, MHCI, β2M, MHCII, TLR22 and TNFα in infected gills indicated a well evolved mechanism in this parasite to escape the host immune response. The modulation of innate and adaptive immunity by this parasite can be further explored to understand host susceptibility.

Keywords: Dactylogyrus catlaius, Gene expression, Immune response, Labeo rohita

Aquaculture has emerged as one of the most promising food producing sectors due to its role in improving food security and meeting the nutritional needs of the world population. Since the initiation of intensive aquaculture, infectious diseases have emerged as a limiting factor for further expansion of the sector. There is now an increasing economic importance of fish parasitic diseases in aquaculture and fisheries. Heavy parasitic infections damage the integument of the fish which may develop into wounds facilitating entry of secondary infectious agents1. Parasites interfere with the nutrition, metabolism and secretary function of alimentary canal, damage nervous system and also upset the normal reproduction of the host2. Moreover, parasitic diseases also affect the general perception of people towards aquaculture. Thus, parasitic diseases play a crucial role in aquaculture by causing mortality or retarding growth rate of fish and decreasing

marketability of the product and thereby cause significant economic losses.

In recent years monogenean parasites have emerged as serious pathogens of commercially important fishes. Among these parasites, the genus Dactylogyrus is the largest helminth genus consisting of more than 900 species, parasitizing many fish species3. Members of this genus are ectoparasites commonly known as gill flukes generally infecting the gill of freshwater cyprinids. Gill flukes have high host specificity and do not cause pathogenic problem in nature due to their narrow host range4. However, under favourable aquaculture conditions monogeneans may become pathogenic to the host. Heavily infected fish of Cyprinidae show swollen and pale gills, accelerated respiration rate, excessive mucous secretion, loss of appetite and less tolerance in low oxygen environment which often leads to high mortality5. In severe cases gill hemorrhages and metaplasia occur which become portals for secondary bacterial and fungal infections5. Among all ectoparasitic infections dactylogyral infections alone constitute a major portion of about 37% in three districts of West Bengal, India6. Thus, dactylogyral

—————— *Correspondent author Telephone: +91-674-2465446 Mob: 09437015120 Fax: +91-674-2465407 E-mail: pksahoo1@hotmail.com

INDIAN J EXP BIOL, MARCH 2014

268

infections contribute to fish loss in many ways and the control of this parasite has now become an urgent need in fish farming. The development of economically viable and environmentally sound methods of controlling these parasites would not be possible without adequate knowledge of fish immunology and a complete understanding of host-parasite interaction.

With advancement in fish immunology, researchers now have general agreement as to presence of the main immune mechanisms in teleosts that have been described for mammals. Teleosts have elements of both innate and adaptive immune system. Studies on identification and molecular characterization of fish immune genes have facilitated their expression profiling during different infections. It is very much essential to understand which molecules or which pathways get activated during a particular infection that would assist in the development of therapeutic strategy against the pathogen. Over the past, immune relevant genes for both adaptive and innate immunity have been identified in various fish species which encode different molecules like cytokines, complements, immunoglobulins, lectins and cell surface receptors7. Molecular identifications have been the focus of fish immunology. Functional characterization of various immune relevant genes with respect to various infections has just gained momentum in the recent past8. However, information on immune relevant gene expression during monogenean parasitic infections is very scarce. Oncorhynchus mykiss parasitized by Gyrodactylus

derjavini showed a clear induction of IL1β expression in the skin, during the initial phases of primary infections whereas the type II IL1β receptor was expressed later9. In addition, there was up-regulation of TNFα, iNOS and COX-2 expression, whereas no clear parasite related changes in transcript levels of TCR-β and MHCIIβ could be observed10. Similarly, in Salmo salar infected by Gyrodactylus salaris, Mc1-1 (related to IL1β) was up-regulated11. Further studies also indicated increased expression of immune relevant genes like MHCI, Mx, IFN-γ and CD8a in susceptible responding Baltic S. salar, and slight changes in highly susceptible non-responding Danish salmon12. An upregulation in the expression levels of several immune-related genes [(matrix metalloproteinases)-9 and 13, leukotrine-B4 receptor, CD20 receptor, MHC class I and class II b chain, Ig H and L chains] in peripheral blood leucocytes of

Paralichthys olivaceus was observed during the infection by another monogenean, Neoheterobothrium

hirame13. In another study, cytokines IL-1β

(spleen and gills) and TGF-β (gills) were up-regulated in Dicentrarchus labrax infected with Diplectanum

aequans14. Very little information is available on

antibody responses and acquired protection in the host during monogenean attacks. Specific antibodies against D. aequans were detected in sera of sea bass infected by the monogenean using Western blot analysis15. Antibodies also seem to be involved in the partial immunity observed in Oncorhynchus

mykiss immunized with Discocotyle sagittata extracts16.

However, in particular not much is known about the immune response of fishes in relation to Dactylogyrus infection. Moreover, the successful use of immune prophylactic measures in piscine parasitic infections without doubt requires the basic studies on immune responses of host. In absence of any information regarding the immune response of the Indian major carp, Labeo rohita against Dactylogyrus sp., this study has been conducted to reveal the immune response in rohu against D. catlaius with respect to the differential expression of some important immune genes. Toll like receptor molecules are pattern recognition receptors that induce expression of regulatory cytokines like IL 8 and TNFα through MyD88 pathway thereby assisting in initiation of inflammatory response and induction of adaptive response. To understand, whether the host immune response against Dactylogyrus is CTL/Th mediated and what role the inflammatory cytokines play, few of the genes viz., MHCI, MHCII and β-2 microglobulin and some cytokines were considered for the study. Role of various non-specific immune parameters during infection cannot be ignored as they form the first line of defence. In the present study, some of the indicators of innate immunity were also evaluated during Dactylogyrus

catlaius infection. Materials and Methods

Animals—Rohu (L. rohita) juveniles (weighing 70.62±3.05 g) showing no signs of disease (under gross and microscopic examination of skin, gill and kidney tissues of representative samples) and no previous history of parasitic infections were obtained from the farm of CIFA, Bhubaneswar. Fishes were acclimatized in plastic tanks of 500 L capacity

DASH et al.: IMMUNE RESPONSE OF LABEO ROHITA TO DACTYLOGYRUS CATALAIUS INFECTION

269

for 15 days before conducting the experiment. They were fed with commercial pellet diet at 1.5% of their body weight. About 10% of water was removed daily along with the left-over feed and fecal matter. The basic physico-chemical water parameters were measured systematically at seven-day intervals to maintain its optimal level throughout the experiment. The water temperature in the tanks varied from 25 to 28 °C during the experiment.

Experimental design and co-habitational

challenge—The fish were randomly divided into six tanks with eight fish in each tank. In another tank rohu juveniles infected with Dactylogyrus sp. (examined through light microscopic study of infected gill samples), which were collected from an infected pond of the host institute, were maintained. One fin-clipped heavily infected rohu (based on observation of gill fluke load in gill samples taken from the infected fish stock) was introduced into three of the tanks for co-habitational challenge. The other three tanks served as uninfected control. The fish were observed daily for development of infection. Within 11 days post-challenge, the fish revealed development of infection as observed from gross and microscopic examination of gill mucus of randomly collected samples. The heavily infected fish started dying in the infected group during second week post-challenge.

Sampling procedure—The fish from infected and control groups (12 numbers from each group) on day 15 post-challenge were anaesthetized with MS222 (Argent Chemical, Redmond, WA, USA) and bled non-lethally through the caudal vein using a plastic 2 mL syringe (24 gauge needle). Blood samples of both groups were allowed to clot at room temperature for 30 min and then kept at 4 °C for 3 h. The clotted samples were centrifuged at 5,000 g for 5 min at 4 °C to collect sera, which were stored immediately at -70 °C until further analysis for various innate immune parameters. The serum samples from each experimental fish were processed separately for various immune parameters.

Gill and anterior kidney tissue samples were collected from the infected and control group (three fish each) aseptically after anaesthetizing the fish with MS222 (Argent Chemical, Redmond, USA) and a portion of it was stored in RNAlater (Sigma, USA) at –20 °C for extraction of total RNA. Throughout the procedure, care was taken to use RNAse free tubes and dissection tools. Also the workbench was wiped

with RNASE AWAY (Molecular Bio Products, USA) to avoid contamination.

Infected gill samples were also collected in 10% neutral buffered formalin (Fisher, India) for light microscopic (squash preparations) examinations to detect the parasite species and parasite load following standard protocol5.

For further confirmation and early detection of Dactylogyrus infection, genomic DNA was extracted from gill tissue collected from three infected individuals. Before extraction of DNA, tissue samples (50-100 mg) were rinsed with 1 mL of PBS, cut into as fine pieces with sterile scissors and incubated in 1 mL of TENS buffer (10 mM Tris Cl, 1 mM EDTA, 0.5% SDS, 0.1 M NaOH) and 25 µL of proteinase K (10 mg mL-1) for 3 h at 50 °C followed by general phenol-chloroform extraction. Prior to extraction all the samples were treated with 4 µL of RNase A (10 mg mL-1) and incubated at 37 °C for 30 min. The extracted gDNA was dissolved in TE buffer (10 mM Tris Cl, 1 mM EDTA) and stored at -20 °C until subsequent PCR analysis. The concentration of the nucleic acid in the sample was quantified by measuring absorbance at 260 nm using NanoDrop ND-1000 spectrophotometer (Thermo Scientific, USA). The purity of the samples was also checked by measuring the ratio of OD260 nm: OD280 nm.

A region comprising partial 28S rDNA was amplified using the forward primer, 5′ ACCCGCTGAATTTAAGCAT 3′ and reverse primer, 5′ CTCTTCAGAGTACTTTTCAAC 3′. The reaction consisted of 1 µL of genomic DNA, 19.85 µL of nuclease free water, 2.5 µL of Taq buffer, 0.5 µL of dNTP, 0.5 µL of forward and reverse primers each and 0.15 µL (1.5 units) of Taq DNA polymerase (Bangalore Genei, Merck Specialities Pvt. Ltd., India). The amplification reaction was carried out initially at 94 °C for 3 min, followed by denaturing temperature of 94 °C for 45 sec for 32 cycles, annealing at 56 °C for 45 sec and extension at 72 °C for 1 min 30 sec and final extension of 10 min at 72 °C. The PCR product was visualized in 1% agarose gel with ethidium bromide staining. The amplified product was purified from agarose gel by using GeneiPureTM Gel Extraction Kit (GeneiTM, Merck Specialities Pvt. Ltd., India) according to manufacturer’s instructions and sequenced commercially. The sequence homology was determined by using NCBI BLAST online application. DNA sequences of the closely related

INDIAN J EXP BIOL, MARCH 2014

270

species were downloaded and multiple sequence alignments were done using Clustal W programme on Bioedit version 7.0.9.017. The phylogenetic tree was constructed using MEGA version 5 using neighbor joining method18.

Innate immune parameters—Total serum myeloperoxidase (MPO) activity: Total serum myeloperoxidase (MPO) activity was measured according to method of Quade and Roth19 with a partial modification. Serum (10 µL) was mixed with 90 µL of Hank’s balanced salt solution without Ca2+ or Mg2+ in transparent U-bottom 96-well microtitre plates (Axygen, USA). Then, 35 µL of freshly prepared 20 mM 3,3′-5,5′-tetra methyl benzidine hydrochloride (Genei, Bangalore, India) and 5 mM H2O2 were added. The colour change reaction was terminated after 2 min by adding 35 µL of 4 M H2SO4. The OD was taken at 450 nm in a microplate reader (iMARKTM, Microplate reader, BIO-RAD, India).

Total serum anti-protease level: Total serum antiprotease in fish serum was determined according to Zuo and Woo20 with minor modification. Serum (10 µL) was mixed with 100 µL of trypsin (bovine pancreas type I, Sigma; 200 µg/mL of PBS). One positive control was taken containing only trypsin and PBS but no serum. All tubes were incubated at 25 °C for 30 min. After incubation, 1 mL of casein dissolved in PBS (2.5 mg/mL) was added to all tubes and incubated for 15 min at 25 °C. The reaction was stopped by adding 500 µL of 10% tricholoroacetic acid (TCA). The sample was centrifuged at 10, 000 g for 5 min. The OD of the supernatant was measured at 280 nm and the percentage of trypsin inhibition was calculated.

Serum lysozyme activity: Turbidometric assay was carried out to study the serum lysozyme activity according to method of Sankaran and Gurnani21 with partial modification. A suspension of 150 µL of Micrococcus lysodeikticus (0.2 mg/mL) in 0.02 M sodium acetate buffer (pH 5.5) was added to 15 µL of serum previously taken in 96 well U-bottom microtitre plates (Axygen, USA). Initial OD was read at 450 nm immediately after adding the bacteria and final OD was read after 1 h incubation at 24 °C. Serum lysozyme values were expressed as µg/mL equivalent to hen egg white lysozyme activity.

Serum haemolytic activity: To study the haemolytic activity of serum, rabbit blood (2 mL) was collected in Alsever’s solution and separated RBC was further

diluted with PBS to make 1% v/v. Two-fold serial dilution (up to 8 dilutions) of the unheated sera was made in PBS, and then 50 µL of 1% rabbit RBC was added to each well of the microtitre plate. The plate was incubated at 37 °C for 1 h. Haemolysin titer was defined as the last dilution of serum showing complete lysis of RBC22.

Natural agglutinin level: To study the serum natural agglutinin level, the serum samples were heat inactivated at 56 °C for 20 min to inhibit the complement activity. The heat inactivated sera were diluted two-fold serially in PBS (with Ca2+ and Mg2+) in a 96 well microtitre plate. Then 50 µL of formalin-killed Aeromonas hydrophila (adjusted to OD 2) was added to each well. The plate was incubated overnight at 25 °C. The bacterial agglutination titre was defined as the last dilution of serum showing maximal positive agglutinin23.

Expression analysis of immune related genes—RNA isolation and cDNA synthesis: Skin and anterior kidney tissues (100 mg each) stored in RNAlater of each fish were utilized for extraction of total RNA using TRI reagent (Sigma) following the manufacturer’s instructions. The resulting RNA was treated with DNase I, RNase-free (Fermentas, USA) followed by inactivation of DNase I according to the manufacturer’s instructions. The absence of DNA contamination was further confirmed by PCR using β-actin primers as described later (Table 1). Total RNA (1 µg) was reverse-transcribed for preparation of complementary DNA (cDNA). In the first step, RNA was incubated with random hexamer primer (Fermentas, USA, 100 µM) for 5 min at 70 °C and cooled at 25 °C for 10 min for the annealing of the primer and RNA. To this reaction mixture, MMLV-RT buffer (Sigma), dNTP, RNAse inhibitor (40 U/µL, Bangalore Genei, Merck Specialities Pvt. Ltd., India), and MMLV-RT enzyme (200 U/µL, Sigma) were added and incubated for 5 min at 25 °C, 1 h at 42 °C and 2 min at 95 °C subsequently in a thermal cycler (Master Gradient Eppendorf, USA). cDNAs thus synthesized were stored at 0 °C till further use.

PCR conditions: For semi-quantitative expression analysis of few immune-related genes, β-actin, which expresses constitutively, was taken for sample normalization as well as positive control. All the PCR conditions and number of cycles were optimized prior to the final expression analysis. Certain immune genes such as tumor necrosis factor α (TNFα), major histocompatibility complex I (MHCI), major

DASH et al.: IMMUNE RESPONSE OF LABEO ROHITA TO DACTYLOGYRUS CATALAIUS INFECTION

271

histocompatibility complex II (MHCII), β2 microglobulin (β2M), toll-like receptor 22 (TLR22), interleukin 8 (IL8), interleukin 1β (IL1β), manganese superoxide dismutase (MnSOD), natural killer cell enhancement factor B (NKEF-B), tumor necrosis factor receptor (TNFR2a) and TNF receptor associated factor (TRAF6a) that hold important place in parasitic infections were amplified using either self-designed or previously published primer sequences. The sequence and optimum annealing temperature for primers used are given in Table 1. Each PCR reaction consisted of 0.5 µL of cDNA, 20.35 µL of nuclease free water, 2.5 µL of Taq buffer, 0.5 µL of dNTPs, 0.5 µL of forward and reverse primers each and 0.15 µL (1.5 units) of Taq DNA polymerase (Bangalore Genei, Merck Specialities Pvt. Ltd., India). All amplification reactions were carried out initially at 94 °C for 3 min, followed by denaturing temperature of 94 °C for 45 sec for 28-32 cycles, annealing temperature of respective target genes for 45 sec and extension at 72 °C for 1 min

30 sec and final extension of 10 min at 72 °C . The details of primer sequences used for all genes are given in Table 1. The PCR product of each amplified gene was visualized in 1% agarose gel with ethidium bromide staining.

Expression analysis: The relative level of expression was analyzed through densitometric analysis using Alpha Ease_FC Imaging software (Alpha Innotech Corp., USA). To assess the differences in expression of different genes between control and gill fluke infected fish, the ratios of immune related genes to β-actin expression product for each gene of interest was calculated.

Statistical analysis—All experimental serum parameters were carried out taking each serum sample in duplicate and the mean ± SE for each parameter was calculated. The mean values were compared by Student’s t-test to determine significant difference at 5% (P ≤ 0.05) level.

Mean values (±SE) of the target gene expression, relative to β-actin, were derived from triplicates.

Table 1—Primers used with their optimum annealing temperatures and sizes of PCR amplicons

Target gene Primer sequence (5’ to 3’) Optimum annealing temperature (°C)

Size of PCR amplic-on (bp)

Accession number

Natural killer cell enhancing factor-B65

F-ACCGAGATCATCGCGTTC

R-CCGGCAGGTCATTGATG

49 285 n.s.

Superoxide dismutase F-ACGAGACCTGTAGTGCCCTGC

R-CGGAAGCCATCAAGCGTG

57.4 178 n.s., s.d.

Interleukin 1β (IL1β)66 F-ATCTTGGAGAATGTGATCGAAGAG

R-GATACGTTTTTGATCCTCAAGTGTGAAG

57.4 561 AM932525

Interleukin8 (IL 8) F-GGGTGTAGATCCACGCTGTC R-AGGGTGCAGTAGGGTCCAG

53.5 167 n.s., s.d.

MHCI F-CAGTATGGGTATGATGGA R-TCTGCCAGGAGATTGTT

44.2 291 n.s., s.d.

MHCII F-AGGAGATGCCGAATGGAG R-GATGATTCCCAGCACCAG

55.3 200 n.s.,s.d.

TRAF 6a F-AGATCCGGGAGCTGTGCATCC

R-GCCTCTGGAATGCCTGCAAGTC

59.4 441 n.s., s.d.

Tumor necrosis factor-α43

F-CCAGGCTTTCACTTCAGG

R-GCCATAGGAATCGGAGTAG

51.6 181 FN543477

Toll like receptor 228 F-TCACCCCATTTCGAGGCTAACAT

R-GAAGGCGTCGTACTGGAATGTC

56.0 520 FN548000

β2-microglobulin43 F-TCCAGTCCCAAGATTCAGGTG

R-TGGTGAGGTGAAACTGCCAG

59.7 175 AM774150

TNFR 2a F-TGGAGGAACATAGTGAAGCC

R-AGTTTGAGAACCATCAGACCC

55.3 227 n.s., s.d.

β-actin43 F-GACTTCGAGCAGGAGATGG

R-CAAGAAGGATGGCTGGAACA

55.3 138 n.s.

s.d=self-designed; n.s.=not submitted

INDIAN J EXP BIOL, MARCH 2014

272

Statistical differences in gene expression between gill fluke infected and uninfected control samples were assessed using Mann-Whitney U test (P-value of less than or equal to 0.05 was considered statistically significant).

Results All the healthy fish exposed to infected fish during

co-habitation got infected within 4-5 days of challenge (as observed from gill samples collected from experimental group and their microscopic examination) showing the first pathological signs of swollen and pale gills. The number of parasites attached and feeding on each individual fish varied during experimental period. However, in general the level of infection was too high (Fig.1) after co-habitational challenge on the day of sample collection. Due to heavy infection, hemorrhages appeared after infection on gills and mortality was also started in the experimental group during the study period. The infection was regarded as acute with high degree of severity. At this stage, the samples from infected fish were collected. The control fish did not show any infection either in gill or kidney squash examination.

The parasite was identified as Dactylogyrus

catlaius through morphological characterization. The

partial 28S rDNA generated in this study was 366 bp size (GenBank Accession no. KC687091). The phylogenetic analysis by neighbor joining method revealed this species to be most closely related to members of the genus Dactylogyrus, while the reference sequence of genus Dactylogyroides formed a different clade (Fig. 2).

In the present study, total serum antiprotease was found to be significantly higher in gill fluke infested fish in comparison to control (Fig. 3a). Parasite infected fish showed a higher agglutination titre (Fig. 3b) and a lower natural haemolysin titre was observed in the parasitized fish (Fig. 3c). No significant difference was found in serum myeloperoxidase level between control and fluke infected group (Fig. 3d). The lysozyme activity of serum was found to be significantly lower in parasitized fish in comparison to control (Fig. 3e). The results of the immune parameters studied are illustrated in Fig. 3.

In the present study, the expression of some immune relevant genes was investigated in the gill and anterior kidney tissues of D. catlaius infected fish relative to the control group. Densitometric quantification analysis of in-vivo expression of the immune-related genes is shown in Figs 4 (gill) and 5 (anterior kidney).

Most of the genes were found to be significantly down-regulated (P≤0.05) in infected fish as compared to control fish in gill samples except antioxidant genes viz., NKEF-B and MnSOD, and receptors like tumor necrosis factor receptor 2a (TNFR2a) and TNF receptor associated factor 6a (TRAF6a) (Fig. 4a, b, c and d). The expression of MHCI, MHCII, TNFα, TLR 22 along with β2M was significantly down-regulated (P≤0.05) in the infected fish gills relative to control fish gills (Fig. 4e, f, g, h and j). There was no significant change in the expression of IL8 in the infected fish relative to the control ( Fig. 4 i) while expression of IL1β was not detected in gill samples (Fig. 4).

On the other hand, the expression of MnSOD and IL1β were significantly up-regulated (P≤0.05) in infected fish anterior kidney samples as compared to control anterior kidney tissue (Fig. 5 b and k). At the same time significant down regulation (P≤0.05) of MHCII and TNFα was observed in infected anterior kidney samples (Fig. 5 f and g). There was no significant change in expression level for other genes studied in anterior kidney samples of infected fish (Fig. 5).

Fig. 1—Light microscopy (magnification 10X) of gill lamellae of L. rohita showing the parasite D. catlaius (arrow) attachment.

DASH et al.: IMMUNE RESPONSE OF LABEO ROHITA TO DACTYLOGYRUS CATALAIUS INFECTION

273

Discussion

This study was carried out with the objective of examining the effect of Dactylogyrus infection on the immune system of L. rohita, which is still unexplored. Any type of pathogen attack triggers the innate immunity of the host which bears the responsibility of activating the whole immune system by producing an array of immune molecules to combat the infection. In the present study an attempt was made to analyze the modulation of the immune system of L. rohita, with reference to innate immune responses and differential expression of few immune-related genes during experimental challenge with D. catlaius as a reflection of changes in both innate and specific immunity.

Various indicators of disease and stress response that are used for general immunological defense mechanism are cells of immune system (leucocytes, non-specific cytotoxic cells, eosinophilic granular cells, macrophages and other cells) and their products [myeloperoxidases (MPO), superoxides, acute-phase proteins, lysozyme, interferon, complement, properdin, lysins and agglutinins, etc.]24-26. The superoxide production was estimated by myeloperoxidase activity which is produced by neutrophils and acts against pathogens by forming

Fig. 2—A phylogenetic tree constructed by neighbor-joining method (1000 bootstraps) for the 28S region of different species of Dactylogyrus including the isolate used (D. catlaius) in the present study.

Fig. 3—Effect of Dactylogyrus catlaius infection on various non-specific immune parameters (a-antiprotease activity, b-natural agglutination titre, c-haemolysin titre, d-myeloperoxidase activity and e-lysozyme activity) in Labeo rohita. Data are presented as mean values (±SE). Significant difference between control and infected group is indicated by *, (P ≤ 0.05).

INDIAN J EXP BIOL, MARCH 2014

274

reactive oxygen molecules27. It acts upon hydrogen peroxide during respiratory burst and produce hypochlorous acid which is fatal to foreign invaders28. In the present study, no significant difference was found in the myeloperoxidase activity between control and gill fluke infested fish. The result falls in parallel with the study on Sparus aurata where no difference in myeloperoxidase level was observed during Enteromyxum leei (Myxozoa) infection between parasitized and non-parasitized fish29. Also a study on L. rohita infected with Argulus showed no difference in myeloperoxidase content between uninfested control and parasite infested fish30. These observations suggested that myeloperoxidase activity may not be playing major role in the control of parasites especially ectoparasites of fish; even they do cause severe tissue damage.

Host antiproteases are considered as an important branch of host defense system as proteases are known to play major role in pathogenesis of parasitic diseases. In the present study, the total antiprotease activity was found to be significantly higher in gill fluke infested fish in comparison to control that resulted as a reflex to counter parasitic release of proteases. In other parasitic infections like E. scophthalmi exposed turbot31 and E. leei exposed Diplodus puntazzo, total antiproteases levels were reported to be generally higher than control levels32. Similarly, serum antiprotease level in L. rohita

infested with an ectoparasite A. siamensis also showed a significant increase30

. This higher level of antiproteases in serum can be attributed to the fact that most of the antiproteases like α2 macroglobulin are responsible for clearance of the active proteases from body fluids which might be secretions of the parasites.

Lectins are important innate immune molecules which agglutinate foreign cells by adhering to their surface carbohydrate and promote phagocytosis by leucocytes. Lectins are well studied in mammals and vertebrates33,34. In fish, a number of lectins have been discovered35 and most of the experiments have been carried out on their agglutination activity and carbohydrate specificity36. These molecules not only initiate the immune response but also get involved in downstream effector functions like complement activation and initiation of adaptive immune response37. In the present study, a significantly higher level of serum agglutinating activity was found in parasitized fish signifying the stimulation of the host

immune system to react positively. C type lectin receptors, which are considered as the sensitive receptors of innate immune system are found to act as binding ligands for some glycan moieties of parasites. Carbohydrates expressed on the surface of parasitic helminthes are reported to be potential targets for these lectin molecules38. An increase in lectin acitivity in D. catlaius infected fish serum suggests that this parasite might possess some carbohydrate receptors

Fig. 4—Expression of immune relevant genes relative to β-actin gene in gill samples of Dactylogyus catlaius infected and control rohu. Bars represent mean values (±SE) of three samples. Statistically important down-regulation (P≤0.05) are denoted by * mark. (a-NKEF-B, natural killer-cell enhancing factor B; b-MnSOD, manganese superoxide dismutase; c-TNFR2a, tumor necrosis factor receptor 2a; d-TRAF6a, TNF receptor associated factor 6a; e and f-MHC-I and II, major histocompatibility complex I and II; g-TNFα, tumor necrosis factor α; h-TLR22, toll-like receptor 22; i-IL-8, interleukin 8; j-β2-M, β2- microglobulin).

DASH et al.: IMMUNE RESPONSE OF LABEO ROHITA TO DACTYLOGYRUS CATALAIUS INFECTION

275

Fig. 5—Expression of immune relevant genes relative to β-actin gene in anterior kidney tissues of Dactylogyus catlaius infected and control rohu. Bars represent mean values (±SE) of three samples. Statistically important up-regulation /down-regulation (P≤0.05) are denoted by * marks. ( a-NKEF-B, natural killer-cell enhancing factor B; b-MnSOD, manganese superoxide dismutase; c-TNFR2a, tumor necrosis factor receptor 2a; d-TRAF6a, TNF receptor associated factor 6a; e and f- MHC-I and II, major histocompatibility complex I and II; g-TNFα, tumor necrosis factor α; TLR22, h-toll-like receptor 22; i-IL-8, interleukin 8; j- β2-M, β2- microglobulin and k- IL-1β, interleukin 1β )

which are being recognized by the lectin molecules boosting the host immune system to neutralize the infection. The increased lectin activity may be a result of the host – parasite recognition as well as the host response to the parasite as lectins are reported to play dual role in both the cases39.

Lysozyme is an active molecule of fish defense system produced by neutrophils/phagocytes which restricts pathogen attack by disrupting the glycosidic bond of the peptidoglycan layer. In the present study, the lysozyme level showed a decrease in parasite infested fish. Reduction in levels of lysozyme was also earlier observed in gilthead sea bream parasitized by Polysporoplasma spari

40 and in D. puntazzo infected by E. leei

32. Lysozyme activity is dependent on level of stress and it is well recorded that serum as well plasma lysozyme activity is significantly depleted in stressed fish41 and that may be a reason for reduced lysozyme levels in infected fish.

Complement is one of the main mechanisms to ward off any infection as it is involved in initiation of innate immune response as well as mounting of an adaptive response. The haemolytic activity of fish serum is attributed to the alternate complement pathway. Monogenean parasites like Gyrodactylus

derjavini and G. salaris can be killed by alternate complement pathway32. However, in the present study a lower haemolysin titer was observed in parasitized fish, suggesting their increase in susceptibility to this infection as found here. In dactylogyral infections, considerable hemorrhaging with bleeding in gill lamellae occurs and it is suggested that the bleeding is promoted by secretions of the parasite42. The decrease in the heamolysin titre may be attributed to this loss of blood and tissue damage.

During tissue injury or exposure to pathogens there are changes in the levels of many plasma proteins. In the present study the levels of antiprotease and lectin, both of which are acute phase proteins (APP) significantly increased during infection. This increase of APPs during inflammation probably aids the host in regaining homeostasis43.

The expression study of immune-related genes at transcription level gives a real picture of the immune status of the organism and it helps in analyzing differential expression of target genes up to a very convenient level. Due to scarcity of genomic information on Indian carps, expression studies of immune relevant genes have been initiated recently8,43,44. Two organs, gill, the primary site of

INDIAN J EXP BIOL, MARCH 2014

276

attachment of gill fluke and anterior kidney, the major immunocompetent organ in fish were taken in the present study for the transcriptional analysis of various immune related genes to study the changes during D. catlaius infection. The gill assumes greater importance as an organ of study in case of gill fluke infections, as it is the organ first damaged by attachment of the fluke and later shows extensive tissue damage due to feeding. Hyperplasia of the epithelial cells and subsequent lamellar fusion, goblet cell proliferation as well as the migration of eosinophilic granular cells (EGCs) to gills of fishes infected with these parasites have been recorded45.

TNFα is an inflammation associated gene, which is produced by macrophages, monocytes, natural killer cells and T cells46. It stimulates the migration of dendritic cells into lymph node and thereby encourages its interaction with CD4+ T cells. TNFα induces adhesion molecules on endothelial cells and helps in bringing the leucocytes closer. In the present experiment, a down regulation was observed in the expression of TNFα and its receptors like TNFR2a and TRAF6a in both anterior kidney and gill of parasitized fish. Expression level of TNFα was found to be down regulated in the head kidney of E. leei infected gilthead sea bream at different time points post-exposure47. There is a little information available on down regulation of cytokine expression during fish-parasite interaction but is well reported in some other models48. Several mechanisms could be suggested for this down regulation of cytokines during parasite infection. At some level of infection, the host might adopt a mechanism to reduce the inflammation in order to prevent unnecessary tissue injury. A decreased level of TNFα was also observed in the intestine of Sparus aurata upon infection with E. leei

49. Toll-like receptors (TLRs) are the best

characterized class of pathogen recognizing receptors (PRRs) which are capable of inducing production of cytokines, reactive nitrogen and oxidative radicals and differentiation of cells of immune system50. They also trigger maturation of dendritic cells and inflammatory gene expression. Some TLR molecules like TLR 9 and TLR 21 have shown to play a role during parasitic infection by changing their expression pattern at different levels of infection51. TLR 22 is unique to teleost and is known to be modulated by ligands such as peptidoglycans and poly I: C50. However, the role of this molecule in parasitic

infection is not explored. The expression of TLR 22 was found to be significantly down-regulated in gills of parasitized fish but did not differ significantly in anterior kidney. There is a possibility of migration of receptor bearing cells from the site of infection after a certain period post-infection which could be the reason for the down regulation of TLR 22 in gill. The up-regulation of TLR 22 has been reported in skin of A. siamensis infested rohu8. However, changes in the expression pattern of a single TLR may not state the status of the whole TLR pathway. The cause and the mechanism of down-regulation of TLR 22 need to be explored further.

IL1β is a pro-inflammatory cytokine that stimulates T and B cells production, helps in phagocytosis and induces expression of several genes like COX2, MHC and IL1β itself52. In the skin of Oncorynchus mykiss

parasitized by Gyrodactylus derjavini, a clear induction of IL1β expression was observed during the initial phases of primary infection4. It was also reported to be up-regulated in spleen and gills of Diplectanum aequans-infected Dicentrarchus

labrax53. In the present study, IL1β expression was

found to be up-regulated in anterior kidney tissue of parasite infected fish, whereas it was not detected in gill. The very purpose of this cytokine to remain unchanged at the site of infection suggests that host inflammatory response is silent or slow to render protection to this infection, particularly through induction of specific immunity. The present work also showed no significant difference in IL8 expression level in both anterior kidney and gill tissues of parasitized and non-parasitized fish. Hence, the down-regulation or no major change of the cytokines (TNFα, IL8 and IL1β) in infected fish clearly revealed that the parasite suppresses the action of few inflammatory cells (particularly phagocytes or leucocytes) at the site of attachment to establish its pathogenicity.

Major histocompatibility complex (MHC) plays a key role in the recognition of self and non-self, thereby regulating T cell activation. Properly processed antigens are expressed in the membrane bound to either class I or class II MHC proteins and then recognized by lymphocytes through the cell-surface T-lymphocyte receptors (TCR). However, contact with the CD8 (in cytotoxic T lymphocytes) or CD4 (in helper T lymphocytes) co-receptors are necessary for triggering the adaptive immune response leading to pathogen elimination54. In the

DASH et al.: IMMUNE RESPONSE OF LABEO ROHITA TO DACTYLOGYRUS CATALAIUS INFECTION

277

present study, a clear down-regulation of both MHCI and MHCII was seen in gill tissues of infected fish. Also in the anterior kidney, MHCII was significantly down-regulated. This suggested that the parasite probably inhibits the development of adaptive immunity through some mechanism which needs to be further explored. In fact, a down-regulation of MHCII was reported in Atlantic salmon in response to Neoparamoeba perurans which explained high susceptibility of Atlantic salmon to amoebic gill disease (AGD)55. In addition to MHCI and MHCII, β2M was also significantly down-regulated in gill of infected fish suggesting the inability of infected fishes to mount a specific response against gill fluke. These might be one of the probable reasons of making this fish more susceptible to this parasite infection repeatedly in a culture environment.

Natural killer cell enhancing factor (NKEF) belongs to peroxiredoxin (Prx) family. Natural killer-like cells in fish are involved in both kinds of immune responses, acting as important effectors of innate immune response and also priming the adaptive response against pathogens56,57. NKEF is also known to act as an antioxidant preventing DNA and protein from being damaged by oxidative stress, chemotherapy agents and inflammation induced monocyte adhesion58. This factor enhances the cytotoxic effect of natural killer cells and strengthens the immune response. In the present study there was no major change in NKEF in both gill and anterior kidney tissues of infected fish in comparison to the control. This indicates that this parasite infection does not influence the host defense to stimulate NK-like cell activity to get rid of this infection.

Manganese superoxide dismutase is another antioxidant enzyme which comes to use when a cell is under oxidative stress. Mn-SODs are involved in the innate immune responses of animals and its transcription is modulated in response to challenges with endotoxins59,60, bacteria61,62 or viruses63,64. However, role of Mn-SOD in defense against parasitic infestations is not explored much yet. In the present study a significant up-regulation of transcription was noticed in anterior kidney tissues of infected fish. Also its transcription was up-regulated though not significantly in gill tissues of experimental group in comparison to control. The up-regulation of Mn-SOD in anterior kidney and gill tissues of infected rohu suggests the production of ROS by the host to protect its own damaged tissue at the site of

attachment in response to the parasites and their subsequent elimination by antioxidant molecules like superoxide dismutase.

It is evident from the present study that gill fluke infection modulates the innate as well as adaptive immune system of rohu in different aspects, resulting in up-regulation of few antioxidants and pro-inflammatory cytokines on one hand in tissue located far away from the site of infection (i.e. anterior kidney) and down-regulation of few of the genes like TLR 22 and other genes associated with adaptive immunity on the other hand in both gills and anterior kidney. The down-regulation of genes associated with antigen presentation i.e. MHCI and β2M along with MHCII and TLR22 in infected gills clearly indicated that this parasite evolves strong mechanism of escaping out of host defense machinery to establish them. This may be the possible reason for no/poor production of antibody in the host in a natural environment to protect the fish from subsequent infections that needs to be confirmed. Similarly, the parasite could also down-regulate one of the most important cytokine i.e. TNFα in both anterior kidney and gill tissues, thus indicating the insignificant role of inflammatory cells in rendering protection. As a whole it indicated a weak immunity of the host to the parasite infection and this may be one of the major causes how the parasite was able to progress very fast to produce acute infection and heavy tolls of mortality in carp culture. The present study also showed that the host innate immunity, which is considered as the first line of defense is not that much effective to combat this parasite. No such protective mechanisms of innate immunity were observed, by the measurement of certain innate immune parameters during gill fluke infection which might be due to the strong pathogenicity of this parasite. As a result of which, Dactylogyrus succeeds in infecting fishes so severely worldwide leading to high mortality.

In conclusion, the infection of D. catlaius induces or modulates the expression of several inflammatory and other immune relevant genes in different tissues of rohu. The data available for monogenean parasitoses is scarce. Most of the work in this group of parasites is related to Gyrodactylus sp., Diplectanum aequans, Neoheterobothrium hirame etc., and gill flukes being ignored though they are capable of causing heavy economic losses. This appears to be the first report that looks into the changes in immune system of a fish in case of D. catlaius infection.

INDIAN J EXP BIOL, MARCH 2014

278

Acknowledgement Authors are thankful to Dr P. Jayasankar, Director,

CIFA, Bhubaneswar, India for facilities and to Prof. U. Shameem, Andhra University, Visakhapatnam, India for help in identification of the species of parasite. References 1 Hoffman G L, Lesions due to internal helminths of

freshwater fishes, in The pathology of fishes, edited by W E Ribelin and G Higaki (The University of Wisconsin Press, Madison, Wisconsin, USA) 1967, 151.

2 Rahman M R, Prvez M, Jahan M S & Sarker M M, Histopathology of Beffamya bengalensis (Lamarck) by larval helminth, Univ J Zool Rajshahi Univ , 17 (1998) 19.

3 Dove D M A & Ernst I, Concurrent invades-four exotic species of monogenea now established on exotic freshwater fishes in Australia, Int J Parasitol, 28 (1998) 1755.

4 Neary E T, Develi N, Özgül G, Occurrence of Dactylogyrus species (Platyhelminths, Monogenean) on Cyprinids in Almus Dam Lake, Turkey, Turk J Fish Aquat Sci, 12 (2012) 15.

5 Shameem U, Monogenoidean parasites of fish:

Dactylogyrosis and Gyrodactylosis infection in fish culture

ponds, in Hands-on training programme on techniques for identification, pathology and control of fish parasites (Department of Zoology, Andhra University, Vishakhapatnam, India) 2013, 63.

6 Chanda M, Paul M, Maity J, Dash G, Gupta S S & Patra B C, Ornamental fish goldfish, Carassius auratus and related parasites in three districts of West Bengal, India, Chron

Young Sci, 2 (2011) 51. 7 Zhu L, Nie L, Zhu G, Xiang L, Shao J, Advances in research

of fish immune-relevant genes: A comparative overview of innate and adaptive immunity in teleosts, Dev Comp

Immunol, 39 (2013) 39. 8 Saurabh S, Mohanty B R & Sahoo P K, Expression of

immune–related genes in rohu Labeo rohita (Hamilton) by experimental freshwater lice Argulus siamensis (Wilson) infection, Vet Parasitol, 175 (2011) 119.

9 Lindenstrom T, Buchmann K & Secombes C J, Gyrodactylus

derjavini infection elicits IL-1b expression in rainbow trout skin, Fish Shellfish Immunol, 15 (2003) 107.

10 Lindenstrom T, Secombes C J & Buchmann K, Expression of immune response genes in rainbow trout skin induced by Gyrodactylus derjavini infections, Vet Immunol

Immunopathol, 97 (2004) 137. 11 Matejusova I, Felix B, Sorsa-Leslie T, Gilbey J, Noble L R,

Jones C S & Cunningham C O, Gene expression profiles of some immune relevant genes from skin of susceptible and responding Atlantic salmon (Salmo salar L.) infected with Gyrodactylus salaris (Monogenea) revealed by suppressive subtractive hybridization, Int J Parasitol, 36 (2006) 1175.

12 Kania P W, Larsen T B, Ingerslev H C & Buchmann K, Baltic salmon activates immune relevant genes in fin tissue when responding to Gyrodactylus salaris infection, Dis Aquat Org, 76 ( 2007) 81.

13 Matsuyama T, Fujiwara A, Nakayasu C, Kamaishi T, Oseko N, Tsutsumi N, Hirono I & Aoki T, Microarray analyses of gene expression in Japanese flounder Paralichthys olivaceus

leucocytes during monogenean parasite Neoheterobothrium

hirame infection, Dis Aquat Org, 75 (2007) 79. 14 Faliex E, Da Silva C, Simon G & Sasal P, Dynamic

expression of immune response genes in the sea bass, Dicentrarchus labrax, experimentally infected with the monogenean Diplectanum aequans, Fish Shellfish Immunol, 24 ( 2008) 759.

15 Monni G & Cognetti-Varriale A M, Antigenic activity of Diplectanum aequans (Monogenea) in sea bass (Dicentrarchus labrax L.) held under different oxygenation conditions, Bull Eur Assoc Fish Pathol, 21 ( 2001) 241.

16 Rubio-Godoy M, Sigh J, Buchmann K & Tinsley R C, Immunization of rainbow trout Oncorhynchus mykiss against Discocotyle sagittata (Monogenea), Dis Aquat Org, 55 (2003) 23.

17 Hall T A, BioEdit: A user friendly biological sequence alignment editor and analysis program for Windows 95/98/NT, Nucleic Acids Symp Ser, 1999 (41) 95.

18 Tamura K, Peterson D, Peterson N, Stecher G, Nei M & Kumar S, MEGA5: Molecular evolutionary genetics analysis using likelihood, distance and parsimony methods, Mol Biol

Evol, 28 ( 2011) 2731. 19 Quade M J & Roth J A, A rapid, direct assay to measure

degranulation of bovine neutrophil primary granules, Vet Immunol Immunopathol, 58 (1997) 239.

20 Zuo X & Woo P T K, Natural anti-proteases in rainbow trout, Oncorhynchus mykiss and brook charr, Salvelinus fontinalis and the in vitro neutralization of fish α2-macroglobulin by the metalloprotease from the pathogenic haemoflagellate, Cryptobia salmositica, Parasitology, 114 (1997) 375.

21 Sankaran K & Gurnani S, On the variation in the catalytic activity of lysozyme in fishes, Indian J Biochem Biophy, 9 (1972) 162.

22 Kumari J & Sahoo P K, Effects of cyclophosphamide on the immune system and disease resistance of Asian catfish, Clarias batrachus, Fish Shellfish Immunol, 19 (2005) 307.

23 Sahoo P K & Mukherjee S C, Effect of dietary β-1,3 glucan on immune responses and disease resistance of healthy and aflatoxin B1 induced immunocompromised rohu (Labeo

rohita Hamilton), Fish Shellfish Immunol, 11 (2001) 683. 24 Anderson D P & Siwicki A K, Basic haematology and

serology for fish health programs, in Diseases in Asian

aquaculture II, edited by M Shariff, J R Arthur & R P Subasinghe (Fish Health Section, Asian Fisheries Society, Manila) 1995, 185.

25 Marsden M J, Freeman L C, Cox D & Secombes C J, Non-specific immune responses in families of Atlantic salmon, Salmo salar, exhibiting differential resistance to furunculosis, Aquaculture, 146 (1996) 1.

26 Sahoo P K & Mukherjee S C, The effect of dietary immunomodulation upon Edwardsiella tarda vaccination in healthy and immunocompromised Indian major carp (Labeo

rohita), Fish Shellfish Immunol, 12 (2002) 1. 27 Ellis A E, Immunity to bacteria in fish, Fish Shellfish

Immunol, 9 (1999) 291. 28 Dalmo R A, Ingebrightsen K & Bogwald J, Nonspecific

defense mechanisms in fish with particular reference to the reticuloendothelial system (RES), J Fish Dis, 20 (1997) 214.

29 Cuesta A, Munoz P, Rodriguez A, Salinas I, Sitja-Bobadilla A, Alvarez-Pellitero P, Esteban M A & Meseguer J, Gilthead seabream (Sparus aurata L.) innate defence against the

DASH et al.: IMMUNE RESPONSE OF LABEO ROHITA TO DACTYLOGYRUS CATALAIUS INFECTION

279

parasite Enteromyxum leei (Myxozoa), Parasitology, 132 (2006) 95.

30 Saurabh S & Sahoo P K, Non-specific immune responses of Indian major carp Labeo rohita Hamilton to infestation by the freshwater louse Argulus siamensis (Wilson), Indian

J Fish, 57 ( 2010) 45. 31 Sitja-Bobadilla A, Redondo M J, Bermudez R, Palenzuela O,

Ferreiro I, Riaza A, Quiroga I, Nieto J M & Alvarez-Pellitero P, Innate and adaptive immune responses of turbot, Scophthalmus maximus (L.), following experimental infection with Enteromyxum scophthalmi (Myxosporea: Myxozoa), Fish Shellfish Immunol, 21 ( 2006) 485.

32 Alvarez-Pellitero P, Fish immunity and parasite infections: from innate immunity to immunoprophylactic prospects, Vet Immunol Immunopathol, 126 (2008) 171.

33 Epstein J, Eichbaum Q, Sheriff S & Ezekowitz-R A B, The collectins in innate immunity, Curr Biol, 8 (1996) 29.

34 Sumyia M & Summerfield J A, The role of collectins in host defence, Semin Liver Dis, 17 (1997) 311.

35 Yano T, The non-specific immune system, in The fish

immune system: Organism, pathogen and environment, edited by G Iwama, T Nakanishi (Academic Press, San Diego, USA) 1996, 105.

36 Ewart K V, Johnson S C & Ross N W, Lectins of the innate immune system and their relevance to fish health, ICES J

Mar Sci, 58 (2001) 380. 37 Vasta G R, Nita-Lazar M, Giomarelli B, Ahmed H, Du S,

Cammarata M, Parrinello N, Bianchet M A & Amzel L M, Structural and functional diversity of the lectin repertoire in teleost fish: Relevance to innate and adaptive immunity, Dev Comp Immunol, 35 (2011) 1388.

38 Vázquez-Mendoza A, Carrero J C & Rodriguez-Sosa M, Parasitic Infections: A Role for C-Type Lectins Receptors, BioMed Res Int, 2013 (2013) (in press).

39 Buchmann K, Lectins in fish skin: do they play a role in host-monogenean interactions, J Helminthol, 75 (2001) 227.

40 Karagouni E, Athanassopoulou F, Tsagozis P, Ralli E, Moustakareas T, Lytra K & Dostika E, The impact of a successful anti-myxosporean treatment on the phagocyte functions of juvenile and adult Sparus aurata L., Int

J Immunopathol Pharmacol, 18 (2005) 121. 41 Saurabh S & Sahoo P K, Lysozyme: an important defense

molecule of fish innate immune system, Aqua Res, 39 (2008) 223.

42 Schaperclaus W, Helminthiases, in Fish Diseases Volume II, edited by W Schaperclaus, H Kulow, K Schreckenbach) 1992, 750.

43 Mohanty B R & Sahoo P K, Immune responses and expression profile of some immune-related genes in Indian major carp Labeo rohita to Edwardsiella tarda infection, Fish Shellfish Immunol, 28 (2010) 613.

44 Mishra J, Sahoo P K, Mohanty B R & Das A, Sequence information, ontogeny and tissue-specific expression of complement C3 in Indian major carp, Labeo rohita (Hamilton), Indian J Exp Biol, 47 ( 2009) 672.

45 Raissy M & Ansari M, Histopathological changes in the gills of naturally infected Capoeta aculeata (Cuvier and Valenciennes, 1884) with parasites, Afr J Biotechnol, 68 (2011) 15422.

46 Whyte S K, The innate immune response of finfish, Fish

Shellfish Immunol, 23 (2007) 1127.

47 Cuesta A, Munoz P, Rodriguez A, Salinas I, Sitja-Bobadilla A, Alvarez-pellitero P, Estaben M A & Mesequer J, Gilthead sea bream (Sparus aurata L.) innate defence against the parasite Enteromyxum leei (Myxozoa), Parasitology, 132 (2006) 1.

48 Evering T &Weiss L M, The immunology of parasite infections in immunocompromised hosts, Parasite Immunol, 28 (2006) 549.

49 Sitja-Bobadilla A, Caiduch-Giner J, Saera-Vila A, Palenzuela O, Alvarez-Pellitero P & Perez-Sanchez J, Chronic exposure to the parasite Enteromyxum leei (Myxozoa: Myxosporea) modulates the immune response and the expression of growth, redox and immune relevant genes in gilthead sea bream, Sparus aurata L., Fish Shellfish

Immunol, 24 (2008) 610.

50 Aoki T & Hirono I, Immune relevant genes of Japanese flounder Paralichthys olivaceus, Comp Biochem Physiol, Part D 1 (2006) 115.

51 Li Y, Luo X, Dan X, Qiao W, Huang X & Li A, Molecular cloning of orange-spotted grouper (Epinephelus coioides) TLR21 and expression analysis post Cryptocaryon irritans infection, Fish Shellfish Immunol, 32 (2012) 476.

52 Li Y, Luo X, Dan X, Huang X, Qiao W, Zhong Z & Li A, Orange-spotted grouper (Epinephelus coipides) TLR2, MyD88 and IL-1β involved in anti-Cryptocaryon irritans response, Fish Shellfish Immunol, 30 (2011) 1230.

53 Faliex E, Da Silva C, Simon G & Sasal P, Dynamic expression of immune response genes in the sea bass, Dicentrarchus labrax experimentally infected with the monogenean Diplectanum aequans, Fish Shellfish Immunol, 24 ( 2008) 759.

54 Klein J & Figueroa F, Evolution of the major histocompatibility complex, Crit Rev Immunol, 6 (1986) 295.

55 Young N D, Crosbie-P B B, Adams M B, Nowak B F & Morrison R N, Neoparamoeba perurans n. sp., an agent of amoebic gill disease of Atlantic salmon (Salmo salar), Int J Parasitol, 37 (2007) 1469.

56 Kuznetsov A V, Clark J F, Winkler K & Kunz W S, Increase of flux control of cytochrome C oxidase in copper-deficient mottled brindled mice, J Bio Chem, 271 (1996) 283.

57 Li R W & Waldbieser G C, Genomic organisation and expression of the natural killer cell enhancing factor (NKEF) gene in channel catfish Ictalurus punctatus (Rafinesque), Fish Shellfish Immunol, 20 (2006) 72.

58 Chen Y M, Su Y L, Lin J H, Yang H L & Chen T Y, Cloning of an orange-spotted grouper (Epinephelus coioides) Mx DNA and characterization of its expression in response to nodavirus, Fish Shellfish Immunol, 20 (2006) 58.

59 Abe R, Shimosegawa T, Moriizumi S, Kikuchi Y, Kimura K, Satoh A, Koizumi M & Toyota T, Lipopolysaccharide induces manganese superoxide dismutase in the rat pancreas: its role in caerulein pancreatitis, Biochem Biophys Res

Commun, 217 (1995) 1216. 60 Li Q, Kumar A, Gui J F & Yu S X, Staphylococcus aureus

lipoproteins trigger human corneal epithelial innate response through toll-like receptor-2, Microb Pathog, 44 (2008) 426.

61 Bao Y, Li L & Zhang G, The manganese superoxide dismutase gene in bay scallop Argopecten irradians: cloning, 3D modeling and mRNA expression, Fish Shellfish Immunol, 25 (2008) 425.

INDIAN J EXP BIOL, MARCH 2014

280

62 Wang G X, Zhou Z, Cheng C, Yao J Y & Yang Z W, Osthol and isopimpinellin from Fructus cnidii for the control of Dactylogyrus intermedius in Carassius auratus, Vet

Parasitol, 158 (2008) 144. 63 Anduro G A, Barillas-Mury C V, Peregrino-Uriarte A B,

Gupta L, Gollas- Galva´n T, Hernandez-Lo´pez J & Yepiz-Plascencia G, The cytosolic manganese superoxide dismutase from the shrimp Litopenaeus vannamei: Molecular cloning and expression, Dev Comp Immunol, 30 (2006) 893-900.

64 Zhang Q, Li F, Wang B, Zhang J, Liu Y, Zhou Q & xiang J, The mitochondrial manganese superoxide dismutase gene in

Chinese shrimp Fenneropenaeus chinensis: cloning, distribution and expression, Dev Comp Immunol, 31 (2007) 429.

65 Chen J, Wu H Q, Niu H, Shi Y H & Li M Y, Increased liver protein and mRNA expression of natural killer cell-enhancing factor B (NKEFB) in ayu (Plecoglossus altivelis) after Aeromonas hydrophila infection, Fish Shellfish

Immunol, 6 (2009) 567. 66 Engelsma M Y, Stet R J, Saeij J P & Verburg-van Kemenade

B M, Differential expression and haplotypic variation of two interleukin- 1beta genes in the common carp (Cyprinus carpio L.), Cytokine, 22 (2003) 21.