Effect of a mycotoxin binder on gut health and performance ...
Transcript of Effect of a mycotoxin binder on gut health and performance ...
![Page 1: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/1.jpg)
Faculty of Bioscience Engineering
Academic year 2015 – 2016
Effect of a mycotoxin binder on gut health and performance in pigs
Linghong Jin
Promotor: Prof. dr. ir. Stefaan De Smet
Dr. ir. Joris Michiels
Master’s dissertation submitted in partial fulfillment of the requirements
for the degree of
Master of Science in Nutrition and Rural Development
Main subject Tropical Agriculture
![Page 2: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/2.jpg)
i
Copyright
“All rights reserved. The author and the promoters permit the use of this Master’s Dissertation for consulting purposes and copying of parts for personal use. However, any other use shall under the limitations of copyright regulations, particularly the stringent obligation to explicitly mention the source when citing parts out of this Master’s dissertation.”
Ghent University, June, 2016
Promotor Promotor
Prof. dr. ir. Stefaan De Smet Dr. ir. Joris Michiels
........................................ .............................................
The Author
Linghong Jin
........................................
![Page 3: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/3.jpg)
ii
Acknowledgments
First, I would like to express my deepest appreciation and special thanks to my academic
promotors Prof. dr. ir. Stefaan De Smet and Dr. ir. Joris Michiels for their continuous guidance
and persistent support during my thesis.
I am truly grateful to Nutrex NV for giving me this opportunity to study in Belgium. Without
your financial support, everything would not be possible.
I also would like to express my sincere thanks to Ir. Kurt Van de Mierop and Ir. Anne Goderis
from Nutrex NV for believing in me and motivating me throughout my Master program.
My sincere gratitude also goes to Ir. Wei Wang for her careful guidance throughout the thesis. I
choose this moment to acknowledge her contribution gratefully.
I would like to use this opportunity to express my deepest gratitude to Tessa Van Der Eecken
and Dr. ir. Mario Van Poucke for their technical support.
I also would like to express my sincere thanks to my course coordinators Ir. Anne-Marie
Remaut-De Winter and Marian Mareen for their support during my Master program.
I owe my deepest gratitude to Dr. ir. Marta Lourenco for her help throughout my thesis.
Without her support, it would not be possible for me to study in Belgium.
I would like to express my best regards, deepest sense of gratitude to my colleagues and
classmates for their support and for all the fun we have had throughout the thesis.
A big thank you goes to my friends Ana, Channy, Linjuan, Yanming and Ziyu for their
encouragement all the time.
Finally, I am indebted to my parents for supporting me spiritually throughout my thesis.
![Page 4: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/4.jpg)
iii
Dedication
I dedicate this Master dissertation to my father and mother for their continuous support and
inspiration.
![Page 5: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/5.jpg)
iv
Abstract
Contamination of animal feeds with mycotoxins is a worldwide problem. Dietary exposure to
mycotoxins can result in worse zootechnical performance such as reduced feed intake and also
irritation of the gastrointestinal tract (GIT). Deoxynivalenol (DON) is a major mycotoxin
produced by Fusarium species in the field, and is commonly found in cereal grains. After
ingesting feed contaminated with DON, the intestines are first exposed to high concentrations
of the toxin. The normal homeostasis may be affected by reducing the self-renewing capacities
of the intestinal epithelium. Mycotoxin binders as mycotoxin detoxifying agents are supposed
to reduce the negative impacts on gut health and performance of these toxins.
This study was conducted to investigate the effect of 37 days dietary exposure to DON and/or
mycotoxin binder on growth performance and gut health in weaning piglets. We hypothesized
that the mycotoxin binder can reduce the negative effects induced by DON.
To test the hypothesis, we performed an animal feeding experiment in a 2 × 2 factorial design
with either or not addition of DON, and either or not addition of binder to the feed. A total of
120 weaning piglets weaned at 3.5 weeks of age with an average weight of 7.3 kg were used in
the feeding trial for 37 days. Piglets were allocated randomly to 4 different dietary treatments.
Each treatment contained 5 pens with 6 piglets per pen. The 4 different dietary treatments were
as follows: T1, Negative control diet; T2, Negative control diet with 1 kg/ton mycotoxin binder;
T3, Negative control diet with DON and T4, Negative control diet with DON and 1 kg/ton
mycotoxin binder. From day 0 until day 14 (sampling on day 14) of the experiment, the diet of
T3 and T4 was artificially contaminated with 3 mg/kg of a mixture of DON (2.6 mg/kg),
3A-DON (0.1 mg/kg) and 15A-DON (0.3 mg/kg), after which the DON contamination level
was reduced to 1 mg/kg from day 14 until day 37.
The small intestinal mucosa was obtained from weaning piglets at d14. RT-qPCR analysis was
performed to test if transcription of inflammatory cytokines, tight junction proteins and brush
border enzymes are influenced at 75% of small intestine length. The gut barrier function was
also assessed ex vivo by measuring the permeability for FITC-dextran 4 (FD4) across sheets of
the mucosa in Ussing chambers at 75% of small intestine length.
After 37 days dietary exposure to DON, there were no significant differences on growth
performance and gut health between DON-control and DON-challenged groups. On binder
level, we found that groups that received diets with binder had a significant better Average
Daily Gain (ADG) and Average Daily Feed Intake (ADFI) for the period d0-d14 as well as the
whole period d0-d37 compared to groups that received diets without binder. Meanwhile, there
was a tendency that piglets supplemented with binder had a better feed conversion rate
compared to piglets received diets without binder from day 1 until day 14 of the experiment
![Page 6: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/6.jpg)
v
(p<0.10). As to gene expression of pro-inflammatory cytokines, supplementation of the diets
with mycotoxin binder significantly reduced the expression of TLR-4 compared to diets with
no binder. At the same time, there was a tendency that groups that received diets with binder
up-regulated the expression of occludin (OCLN) compared to groups that received diets
without binder (p<0.10).
There were interesting interactions on the growth performance between mycotoxin and binder.
For the first 14 days of the experiment, the group that received the diet contaminated with
DON in combination with mycotoxin binder (T4) had significant higher ADFI compared to the
group that received a diet only contaminated with DON (T3). This again resulted in a better
growth rate for T4 compared to T3 for period d0-d14. From the growth performance level, we
can see that binder could help improve the production when challenged with DON. As to the
immune response, the group fed the diet contaminated with DON in combination with
mycotoxin binder (T4) significantly down-regulated the expression of TLR-4 compared to the
group fed the diet only contaminated with DON (T3). At the same time, there was a tendency
that T4 up-regulated the expression of ZO-1 compared to T3 (p<0.10).
From our result, we can conclude that the mycotoxin binder, in combination with DON or not,
could improve growth performance especially in the first 14 days and also the whole period. It
also improves gut health by increasing the expression of tight junction proteins (TJPs) and
reducing the expression of TLR-4. So, the mycotoxin binder could be a good feed additive
regardless of mycotoxin contamination or not.
In further study, pure mycotoxin and different models, perhaps challenged with
lipopolysaccharide (LPS) could be applied.
![Page 7: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/7.jpg)
vi
Table of Contents
Copyright ................................................................................................................................ i
Acknowledgments .................................................................................................................. ii
Dedication............................................................................................................................. iii
Abstract .................................................................................................................................iv
Table of Contents ...................................................................................................................vi
List of abbreviations ............................................................................................................ viii
Chapter 1 Introduction............................................................................................................. 1
1.1 Background information .................................................................................................... 1
1.1.1 Swine production ............................................................................................................ 1
1.1.2 Gastrointestinal tract (GIT) of weaning pigs.................................................................... 1
1.2 Problem statement ............................................................................................................. 1
1.3 Motivation of the study ...................................................................................................... 2
1.4 Study objectives and research questions ............................................................................. 2
1.4.1 Broad objective .............................................................................................................. 2
1.4.2 Specific objectives .......................................................................................................... 2
1.4.3 Research questions ......................................................................................................... 2
1.4.4 Hypothesis of the study................................................................................................... 2
1.5 Limitations of the study ..................................................................................................... 2
1.6 Description of the study area ............................................................................................. 3
Chapter 2 Literature study ....................................................................................................... 4
2.1 Mycotoxins in pig feed ...................................................................................................... 4
2.1.1 The trichothecenes and deoxynivalenol (DON) ............................................................... 5
2.1.1.1The trichothecenes ........................................................................................................ 5
2.1.1.2 The occurrence of DON ............................................................................................... 6
2.1.1.3 Toxicokinetics of DON ................................................................................................ 7
2.1.1.4 Toxicodynamics of DON ............................................................................................. 8
2.1.1.5 Effect of DON on growth performance in pigs ........................................................... 10
2.1.1.6 Effect of DON on gut health in pigs ........................................................................... 11
2.1.1.6.1 Effect on intestinal cell viability and proliferation ................................................... 11
2.1.1.6.2 Effect on intestinal histology and morphology ......................................................... 12
2.1.1.6.3 Effect on intestinal immune response ...................................................................... 12
![Page 8: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/8.jpg)
vii
2.1.1.6.4 Effect on intestinal barrier function ......................................................................... 13
2.1.1.6.5 Effect on secretion of intestinal defense components ............................................... 13
2.1.1.7 EU regulation of DON in animal feed ........................................................................ 13
2.2 Mycotoxin binders ........................................................................................................... 14
2.2.1 Definition ..................................................................................................................... 14
2.2.2 Types ............................................................................................................................ 14
2.2.2.1 Aluminosilicates ........................................................................................................ 15
2.2.2.2 Activated carbon ........................................................................................................ 15
2.2.2.3 Yeast Cell Wall .......................................................................................................... 15
2.3 Effect of mycotoxin binders ............................................................................................. 15
Chapter 3 Materials and methods ........................................................................................... 18
3.1 Animals and experiment treatments ................................................................................. 18
3.2 Feed and diet ................................................................................................................... 18
3.4 Sampling ......................................................................................................................... 20
3.5 Growth performance ........................................................................................................ 20
3.6 Ex vivo measurement of intestinal permeability................................................................ 20
3.7 RNA isolation and reverse-transcription quantitative real-time PCR ................................. 20
3.8 Statistical analysis ........................................................................................................... 22
Chapter 4 Results and discussion ........................................................................................... 24
4.1 Growth performance ........................................................................................................ 24
4.2 Permeability measurements in distal small intestine ......................................................... 24
4.3 mRNA expression of tight junction proteins, inflammatory cytokines and brush border
enzyme in distal small intestine ............................................................................................. 25
4.4 Principal component analysis ........................................................................................... 28
4.5 Discussion ....................................................................................................................... 29
4.5.1 Effect of DON addition to feed on gut health and performance...................................... 29
4.5.2 Effect of binder addition to feed on gut health and performance .................................... 31
4.5.3 Interaction between mycotoxin and mycotoxin binder ................................................... 33
Chapter 5 Conclusions and recommendations ........................................................................ 35
5.1 General conclusions ........................................................................................................ 35
5.2 Recommendations for further research ............................................................................. 35
Chapter 6 Reference list ........................................................................................................ 36
![Page 9: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/9.jpg)
viii
List of abbreviations
3A-DON 3-acetyl- deoxynivalenol
15A-DON 15-acetyl- deoxynivalenol
AC Activated carbon
ADFI Average Daily Feed Intake
ADG Average Daily Gain
ADONs Acetylated-deoxynivalenols
AFB1 Aflatoxin B1
CLDN-1 Claudin 1
CLDN-2 Claudin 2
CLDN-5 Claudin 5
CLDN-7 Claudin 7
DON Deoxynivalenol
FB1 Fumonisin B1
FC Feed conversion
FD4 FITC-dextran 4
GIT Gastrointestinal tract
HCK Hematopoietic cell kinase
HPRT-1 Hypoxanthine Phosphoribosyltransferase 1
HSCAS Hydrated sodium calcium aluminosilicate
IAP Intestinal alkaline phosphatase
IFN-γ: Interferon, gamma
Ig Immunoglobulins
IL-1β Interleukin 1, beta
IL-8 Interleukin 8
LPS Lipopolysaccharide
MAPK Mitogen-activated protein kinase
NIV Nivalenon
OCLN Occludin
OTA Ochratoxin A
PCA Principal component analysis
![Page 10: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/10.jpg)
ix
PPIA Peptidylprolyl isomerase A
SAPK/JNK Stress-activated protein kinases/cJun N-terminal kinases
TBP TATA-binding protein
TJP Tight junction protein
TLR-4 Toll like receptor 4
TNF-α Tumor necrosis factor, alpha
ZEA Zearalenone
ZO-1 Zona occluden 1
ZO-2 Zona occluden 2
![Page 11: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/11.jpg)
1
Chapter 1 Introduction
This chapter briefly introduces the background information for this study. Problem statement,
motivation, study objectives, research questions and limitations of the study as well as the
description of the study area are included in this chapter.
1.1 Background information
1.1.1 Swine production
Swine production plays an important role in agriculture and occupies a large proportion of
Gross National Product in many countries worldwide. The EU produces 150 million pigs every
year, being the world's second largest pork producer. Pork occupies 9.0% of the agricultural
output of EU. There has been a 1.0% decrease in pig numbers over the past 10 years; however,
pork production has remained stable. This requires production efficiency in swine industry
despite constraints. Feed hygiene remains one of the important challenges in modern swine
production.
1.1.2 Gastrointestinal tract (GIT) of weaning pigs
Weaning is the period when piglets undergo the greatest challenge in their life in modern swine
production. Piglets after weaning may suffer from reduced feed intake as well as decreased
weight gain as the porcine gastrointestinal tract (GIT) is still underdeveloped. The gut is more
susceptible to toxins and the gut barrier may be affected easily. The mucosal epithelium of the
intestine plays an important role in resistance against gastrointestinal diseases. The intestinal
mucosa has to face important chemical and biological challenges and its health is an important
issue to maintain the homeostasis (Otte et al., 2009, Hecht, 1999, Podolsky, 2000). Defects in
barrier integrity will lead to histomorphological alterations, modulation of the expression of the
genes coding for inflammatory cytokines and impaired expression of tight junction proteins
(TJPs).
1.2 Problem statement
The contamination of feedstuffs with mycotoxins is a big issue worldwide. Mycotoxins involve
hundreds of chemically toxic compounds that are produced by fungi. The Biomin Mycotoxin
Survey showed that deoxynivalenol (DON) produced by Fusarium was the most prevalent
single mycotoxin found in all feedstuffs all over the world in 2015. The DON concentrations of
71% of finished feed samples and 88% of corn samples from all DON-contaminated samples
were above a value known to influence on pig health and performance. DON is physically
stable and easily enters the food chain (Turner et al., 2008). Humans and all animal species can
![Page 12: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/12.jpg)
2
exhibit toxic effects by DON ingestion (Pestka and Smolinski, 2005), with pigs being the most
susceptible one (Eriksen and Pettersson, 2004). Dietary exposure to mycotoxins can result in
worse zootechnical performances such as reduced feed intake and also as an irritation of the
GIT. Hence, feed contaminated with DON is really a severe problem posing threat to swine
production.
1.3 Motivation of the study
Many studies about the effects of DON on intestinal health and growth performance in farm
animals have already been investigated. Mycotoxin binders as mycotoxin detoxifying agents
are supposed to reduce the negative impacts on gut health and performance of these toxins.
However, there are few publications on the effects of toxin binders on gut health and growth
performance in piglets.
1.4 Study objectives and research questions
1.4.1 Broad objective
The broad objective of this research was to assess the effect of 37 days dietary exposure to
DON and/or mycotoxin binder on gut health and performance in pigs.
1.4.2 Specific objectives
The specific objectives of the research were to study the effect of DON on gut health and
growth performance and to investigate if a mycotoxin binder can reduce the negative effects
induced by DON.
1.4.3 Research questions
The research questions are: 1) What was the effect of DON and/ or the mycotoxin binder on
growth performance? 2) What was the effect of DON and/ or the mycotoxin binder on
intestinal permeability? 3) What was the effect of DON and/ or the mycotoxin binder on the
gene expression of TJPs, pro-inflammatory cytokines and brush border enzyme?
1.4.4 Hypothesis of the study
We hypothesized that the mycotoxin binder could reduce or prevent detrimental interactions of
DON and its metabolites with the gut mucosa and hereby improve animal performances, either
via binding or other interactions.
1.5 Limitations of the study
![Page 13: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/13.jpg)
3
We artificially added DON to contaminate experimental diets in this study. The toxin was a
mixture of DON and its acetylated derivates. DON and its acetylated derivates show different
toxic potential which made our study complicated.
1.6 Description of the study area
Mycotoxins produced by Fusarium are the most frequently occurring mycotoxins worldwide.
A long-term survey from 2004 to 2012 showed that DON was present in 56% of the samples
worldwide. From Figure 1-1, we can see that DON is one of the single most prevalent
mycotoxins in EU (33%-64%). Therefore this thesis will focus on DON in EU.
Figure 1-1 Global occurrence of mycotoxins (Schatzmayr and Streit, 2013)
![Page 14: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/14.jpg)
4
Chapter 2 Literature study
2.1 Mycotoxins in pig feed
The term mycotoxin was first mentioned following a sudden and fatal outbreak with more than
100,000 young turkeys that died due to the consumption of peanut meal contaminated with
aflatoxins. It took place in 1960 on poultry farms in England, resulting in Turkey X disease
(Asao et al., 1963). Mycotoxins are harmful secondary metabolites of fungi which can cause
intoxications at very low amounts. These metabolites are produced by various fungi ,
commonly known as moulds. Mycotoxins are found in naturally contaminated feedstuffs and
also foods for human consumption, such as fruits and nuts. It has been estimated by FAO that
at least 25% of the grain production is contaminated all over the world every year (Richard et
al., 2003).
The most important mycotoxins present in animal feeds are mainly generated by the fungi of
genera Aspergillus, Penicillium, Fusarium, Alternaria and Claviceps (Steyn, 1998). Toxigenic
moulds can develop under all climate conditions and certain moisture (Aw>0.6) in two ways;
either in the field or during storage. Aspergillus and Penicillium species are referred to as
storage mycotoxins because they generally invade feed commodities after crop harvest
(Filtenborg et al., 1996). Fusarium species are known as field fungi as they develop
mycotoxins during the growth of the plant.
So far, more than 300 different mycotoxins have been identified (Binder, 2007). Some of these
are of biological and economic significance in animal production. From a global perspective,
aflatoxins, fumonisins, zearalenone (ZEA), ochratoxin and trichothecenes are the five most
frequent reported mycotoxins or mycotoxin groups in agriculture (Shephard, 2008).
Mycotoxins are very heat stable and difficult to be destroyed by normal food processing,
making it easy to enter the feed and food chain. Despite the fact that mycotoxins are tasteless
and odourless, they are still a big issue in animal production due to their toxicity after ingestion.
When consumed, they can lead to various adverse health impacts. The main toxic effects are
growth depression, reproductive disorders, immunosuppression and other abnormal
physiological effects. Aflatoxins produced by Aspergillus were first isolated and identified in
poultry in England in the earlier 1960s, then in pigs. Aflatoxins are one of the
most carcinogenic toxins known (Hudler, 1999). Aflatoxin B1 (AFB1) as the most
predominant naturally occurring aflatoxin has been classified as a group 1, being carcinogenic
to human beings by the International Agency for Research on Cancer (IARC) (WHO-IARC,
1993). AFB1 considered as very toxic for animals will lead to lowered growth rate, impaired
reproduction and other adverse effects (Rawal et al., 2010). Fumonisins are a family of
![Page 15: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/15.jpg)
5
mycotoxins produced by Fusarium. Of these mycotoxins, fumonisin B1 (FB1) is the most
abundantly produced and the most toxic. FB1 has been classiflied as group 2B human
carcinogen by IARC. FB1 will lead to pulmonary swelling and hydrothorax in pigs. ZEA
produced by Fusarium is of critical importance in terms of its frequent occurrence and toxic
potency. Dietary exposure to low doses of ZEA will produce significant toxic effects, such as
hyperoestrogenic syndromes and subsequent reproductive dysfunction in swine. Many cases of
nephropathy in pigs were reported in Denmark that resulted from barley, being naturally
contaminated by Ochratoxin A (OTA). This resulted in the identification and characterization
of chronic detrimental effects of contaminated feed on farm animals (Krogh et al., 1973). OTA
produced by Aspergillus and Penicillium is the most commonly and most toxic member of
Ochratoxins. Pigs are particularly sensitive to OTA for its tissue accumulation, owing to a
rather long serum half-life and the enterohepatic recirculation. OTA is important for both
animal and human health because OTA is regarded as a human carcinogen by IARC when
indirect exposure through the animal derived food. Next to ZEA and FB1, the most important
Fusarium mycotoxins are the trichothecenes.
2.1.1 The trichothecenes and deoxynivalenol (DON)
2.1.1.1The trichothecenes
Trichothecenes are a large group of sesquiterpenoid mycotoxins mainly produced by different
species of Fusarium, Stachybotrys, Cephalosporum, Trichoderma, Verticimonosporium,
Myrothecium, Trichothecium and other fungi (EFSA, 2004). They share a tetracyclic
12,13-epoxytrichothec-9-ene back bone in common which is responsible for the toxicological
activity (Figure 2-1) (Desjardins et al., 1993, Sudakin, 2003). According to the absence or
presence of their functional groups, trichothecenes can be grouped into four types being type A,
B, C and D (Ueno, 1985, Ueno et al., 1973). As one of the type A members, T-2 attracted most
concern due to its acute toxicity (Calvert et al., 2005). The most frequently occurring
trichothecene, DON and other type B members such as nivalenon (NIV) are also very
important to animal health. On the other hand, type C and type D trichothecenes cause less
concern (Gutleb et al., 2002). Trichothecenes are the most prevalent mycotoxins produced by
Fusarium, mainly occurring in cereals. Acute high dose of trichothecenes will cause diarrhea,
emesis, and ultimately death. Chronic exposure to trichothecenes will lead to impaired appetite,
reduced weight gain, gastrointestinal hemorrhage and immunologic alterations (Bondy and
Pestka, 2000). Numerous laboratory animals studies have revealed that trichothecenes can be
both immunosuppressive and immunostimulatory, depending on various factors including the
dose of trichothecenes, the route and duration of exposure, the animal status and so on (Bondy
and Pestka, 2000).
![Page 16: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/16.jpg)
6
Figure 2-1 General chemical structure of trichothecenes (Calvert et al., 2005). They share a
tetracyclic 12,13-epoxytrichothec-9-ene back bone in common.
2.1.1.2 The occurrence of DON
DON as a type B trichothecene, is an epoxy-sesquiterpenoid chemically described as (3α,
7α)-3, 7, 15-trihydroxy-12, 13-epoxytrichothec-9-en-8-one (Figure 2-2, C15 H20O6). DON is the
most commonly encountered trichothecene found in cereals in Europe and North America
(Richard et al., 2003, Schothorst and van Egmond, 2004). DON is highly toxic and is
particularly noted for two typical toxicological effects: reduced feed consumption and emesis
in swine, hence another name vomitoxin. DON is developed at field superior to harvest and the
production cannot be avoided completely under production conditions due to the high
uncertainty of weather, thus DON is of particular importance. Surveys have illustrated that
DON occurs predominantly in cereals and grains such as oats (68%), barley (59%), wheat
(57%), rye (49%) and maize (41%) and less often in rice (27%) (JECFA, 2002). It was also
detected in triticale, sorghum and popcorn and some other products. The occurrence of DON is
primarily related to two typical plant pathogens, Fusarium graminearum (Gibberella zeae) and
Fusarium culmorum. Infection by these fungi might cause Gibberella ear rot in maize and
Fusarium head blight in wheat (JECFA, 2002). Moisture at the time of flowering is the main
risk factor affecting the prevalence of Fusarium head blight. In cereals stored properly at dry
condition and free of toxin after harvest, DON production has not been observed in storage
(Jacobsen et al., 2007).
Under natural conditions, DON is present along with its two major acetylated forms,
3-acetyl-deoxynivalenol (3A-DON) and 15-acetyl-deoxynivalenol (15A-DON) at lower
concentrations in cereals (EFSA, 2004). This was confirmed by some studies that feedstuffs
naturally contaminated with DON inclined to exhibit higher toxicity than feed added with pure
DON. Feed co-contaminated with other Fusarium mycotoxins, including ZEA, NIV, as well as
FBs, is also regularly observed.
![Page 17: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/17.jpg)
7
Figure 2-2 Chemical structure of DON: (3α,7α)-3,7,15-trihydroxy-12,13-epoxytrichothec-9-en-
8-one
2.1.1.3 Toxicokinetics of DON
Toxicokinetics studies describe the processes including absorption, distribution, metabolism
and excretion (ADME) when toxins enter the body. Upon ingestion, DON is speedily adsorbed
in swine with an oral bioavailability around 54% after single oral bolus administration
(Goyarts and Danicke, 2006). While after chronic exposure, systemic DON absorption
increased to 89% (Goyarts and Danicke, 2006). In animal studies with pigs intragastric dosing
of radio-labeled DON, it was demonstrated that the time necessary for reaching maximal
plasma concentrations was within half an hour (Prelusky et al., 1988). The rapid appearance
indicated that the greater part of DON was adsorbed from the upper part of the GIT, involving
stomach and the small intestine. However, the plasma elimination of DON is slower in pigs
compared to other species. Different studies showed that the half-life of elimination varied
between 1.2 h and 4 h in pigs (Coppock et al., 1985, Prelusky and Trenholm, 1991, Eriksen et
al., 2003, Prelusky et al., 1988). Plasma clearance was observed to be 7.14 h in pigs after
gavaging radio-labeled DON (Prelusky et al., 1988). Excretion of DON is principally via urine.
93% of intragastrically administered dose was detected in urine when pigs were given DON at
a dose of 0.6 mg/kg of body weight. Accumulation of DON in tissues or transmission to milk
or eggs is very limited (Prelusky and Trenholm, 1991).
DON may be metabolized by de-epoxidation, yielding less toxic products. The main
metabolite of DON is de-epoxy-deoxynivalenol (DOM-1), which is de-epoxidized by the
intestinal commensal bacteria (Danicke et al., 2004a). In contrast to other species, only a small
part of DON is metabolized. Though DOM-1 was eliminated in the urine, it has not been
discovered in blood (Eriksen et al., 2003, Danicke et al., 2004b). Besides de-epoxidation
reactions in the GIT, DON and DOM-1 both can be conjugated with glucuronic acid in the
intestinal mucosa and liver. The glucuronide conjugate of DON in pigs fed 3A-DON account
for 33% and 42% of the DON in urine and plasma, respectively (Eriksen et al., 2003).
![Page 18: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/18.jpg)
8
Cereals and their by products may contain DON and its acetylated derivatives
acetylated-deoxynivalenols (ADONs). In vitro study with pig faeces and ileal digesta showed
that 3A-DON was de-acetylated to free DON (Eriksen et al., 2002). Some in vivo studies also
showed that the acetylated forms of DON were rapidly de-acetylated in the proximal part of
the GIT and absorbed exclusively as free DON (Veršilovskis et al., 2012, Eriksen et al., 2003).
12% of the dose administered was detected as free DON in the stomach after one hour
administration of 3A-DON and 15A-DON, indicating that acetylated derivatives could be
hydrolyzed in the stomach (Veršilovskis et al., 2012). Veršilovskis et al. also confirmed that the
acetylated DON can be glucuronidated in the stomach without deacetylation (Veršilovskis et al.,
2012). In pigs fed 2.5 mg/kg 3A-DON, neither 3A-DON nor de-epoxide metabolite of
3A-DON could be detected in plasma (Eriksen et al., 2003). Taken together, 3A-DON could be
nearly completely hydrolyzed to DON, and 15A-DON to a less extent to DON.
Some studies conducted in livestock found that feedstuffs naturally contaminated with DON
inclined to exhibit higher toxicity than feeds with purified DON. These findings cause concern
on the potential different toxicity of ADONs. The toxicity of DON is well investigated.
However, there are few publications on the toxicity of its derivatives 3A-DON and 15A-DON.
Pigs administered either with DON, 3A-DON or 15A-DON at dose of 0.9 mg per kg feed,
ADONs showed increased bioavailability and in vivo hydrolysis compared to DON. This may
be due to the decreased polarity of ADONs which leads to an increased passive diffusion and
oral absorption. Different models in vitro and in vivo that has been done to explore the toxicity
of DON and its acetylated forms. Results showed that 15A-DON is the most toxic, followed by
DON and 3A-DON (Table 2-1) (Pinton et al., 2012). The higher toxicity of 15A-DON should
be taken into consideration for the maximum level in feedstuffs.
Table 2-1 Toxicity of DON, 3A-DON and 15A-DON in different models
2.1.1.4 Toxicodynamics of DON
DON exhibits toxic effects after administration to experimental animals, with impaired growth
rate being the most consistent effect observed in most species in routine analysis of toxicity
(JECFA, 2002). Studies have also demonstrated alternations in immune function induced by
![Page 19: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/19.jpg)
9
DON. These alternatives can be explained by the cellular and molecular mechanism of DON
(Figure 2-3) (Pestka, 2007). DON is known to be an inhibitor of protein synthesis as well as
nucleic acid synthesis (Ueno, 1983). DON binds to the 60S mammalian ribosomal subunit and
interferes with the active site of peptidyl transferase, inhibiting protein synthesis of chain
initiation and elongation (Ehrlich and Daigle, 1987). Futhermore, inhibitors of the peptidyl
transferase can trigger cell apoptosis by aribotoxic stress response (RSR). Binding of DON to
ribosomes can rapidly activate stress-activated protein kinases/cJun N-terminal kinases
(SAPK/JNK), which is a mitogen-activated protein kinase (MAPK) (Iordanov et al., 1997).
DON-induced MAPK activity activates transcription factors that promote gene expression of
pro-inflammatory cytokines as well as induce apoptosis (Yang et al., 2000, Zhou et al., 2003,
Moon and Pestka, 2002).
Exposure to low concentrations of DON appears to promote expression of chemokines,
cytokines and pro-inflammatory genes together with immune stimulation in vitro and in vivo
(Pestka, 2007). However exposure to high doses, leukocyte apoptosis ensues, resulting in
immunosuppression (Pestka, 2007). In intestinal epithelium, the toxicity of DON has been
related to MAPK activation along with a reduced expression of TJPs and loss of barrier
function (Pestka, 2010, Pinton et al., 2010, Sergent et al., 2006). Literature indicates the
following order of decreasing toxicity: 15A-DON, DON and 3A-DON (Pinton et al., 2012).
The molecular basis for the higher toxicity of 15-ADON was due to its potential to increase
phosphorylation of MAPK.
Figure 2-3 Molecular mechanism for DON. DON enters the cell via diffusion and binds to 60S
mammalian ribosomal subunit and interferes with the active site of peptidyl transferase, which
transduces signal to RNA-activated protein kinase (PKR) and hematopoietic cell kinase (HCK).
![Page 20: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/20.jpg)
10
DON-induced mitogen-activated protein kinases (MAPK) activity activates transcription
factors that promote gene expression of pro-inflammatory cytokines as well as induce
apoptosis(Pestka, 2007)
2.1.1.5 Effect of DON on growth performance in pigs
DON is physically stable and easily enters the food chain (Turner et al., 2008). Humans and all
animal species can exhibit toxic effects by DON ingestion (Pestka and Smolinski, 2005).
Although DON is not considered as a major acute toxin to domestic animals, it is considered as
a critical factor for economic loss due to loss of productivity. Among all the animals, pigs
exhibit the greatest sensitivity to DON through their cereal-rich diet (Eriksen and Pettersson,
2004). Dietary exposure of animals to feeds contaminated with DON can affect metabolic
disturbances, influence the immune system (Pestka and Smolinski, 2005, Pinton et al., 2008,
Wache et al., 2009) and cause reproductive alterations (Tiemann and Danicke, 2007). DON
contaminated feed can affect pigs’ appetite depending on the dose. Clinical signs in affected
swine include digestive problems, such as soft faeces, diarrhea, and an increased susceptibility
to other diseases and reduced feed intake and other impaired growth performance.
After administration of DON regardless long term or short term, reduced feed intake and lower
growth rate are the principal effects shown in pigs. Feed contaminated with as low as 1 mg/kg
DON have been related to reduced feed intake and feed refusal in pigs. However more
typically, doses over 2-5 mg/kg are required for reduced feed consumption and lowered weight
gain. Concentrations over 12 mg/kg are required for complete feed refusal followed by
concentrations over 20 mg/kg for vomiting (Haschek et al., 2002, Abbas et al., 1986, Pestka et
al., 1987, Young et al., 1983). Figure 2-4 (House, 2003) represents data collected from
numerous studies conducted to assess the effect of dietary exposure to DON on feed intake in
swine. Each point represents the mean value of a treatment and the trend line has been plotted.
On the basis of simple regression analysis, approximately 7.5% reduction in feed intake for
every 1 mg/kg DON is expected. Feed refusal even shows up when pigs are administered with
DON intraperitoneally, thus, feed refusal is not owing to taste (Prelusky, 1997). Feed refusal
and emesis seem to be a result of neurochemical imbalances on the level of brain.
![Page 21: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/21.jpg)
11
Figure 2-4 The effect of dietary exposure to DON on feed intake in swine (House, 2003).
2.1.1.6 Effect of DON on gut health in pigs
The GIT acts as the first barrier against the uptake of xenobiotics such as nutritional antigens,
food contaminants and bacteria present in the intestinal lumen (Arrieta et al., 2006). After
consumption of feed contaminated with DON, the intestine can expose to high levels of the
toxin (Pinton et al., 2009). The normal homeostasis may be destroyed by influencing
self-renewing capacities of the intestinal epithelial cells.
2.1.1.6.1 Effect on intestinal cell viability and proliferation
Effects of trichothecenes on intestinal epithelium viability and proliferation were measured in
various cell types in vitro. Different studies show that there is a great heterogeneity in
sensitivity among different cell types. Proliferating intestinal epithelial cells are more sensitive
to DON-induced toxicity compared to differentiated cells. The higher sensitivity of
proliferating intestinal epithelium is probably depending on the capacity of DON to inhibit
protein synthesis as well as DNA and RNA synthesis(Bony et al., 2006). When studying the
effects of DON on intestinal epithelial cell viability, it has been shown that cytotoxicity is
affected in a time and dose dependent manner. High concentrations of DON exhibit toxic
effects negatively affecting the intestinal barrier integrity. Whereas at low concentrations,
DON do not induce toxic effects, but has modulatory effects on cellular regulation (Diesing et
al., 2011b). Studies concerning the effects of DON on intestinal epithelium proliferation reveal
![Page 22: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/22.jpg)
12
that high doses of DON influence cell proliferation by blocking the cell cycle in the G2/M
phase (Yang et al., 2008).
2.1.1.6.2 Effect on intestinal histology and morphology
A wide range of histomorphological alterations are related to the presence of contaminants in
animal feeds. Studies show that DON can affect the intestinal histology and morphology by
affecting intestinal cell viability and proliferation. DON and its acetyl derivatives are
associated with mucosal morphological abnormalities in pigs. Villi height decrease or atrophy
and other regressive lesions in the GIT are frequently reported in pigs (Kolf-Clauw et al., 2009,
Zielonka et al., 2009, Bracarense et al., 2012). These alterations can result by suppression of
mitosis and protein synthesis (Eriksen and Pettersson, 2004, Yunus et al., 2012).
2.1.1.6.3 Effect on intestinal immune response
The intestinal mucosa functions as a vital barrier between the intestinal milieu and the luminal
content, and has to face important chemical and biological challenges. The intestinal
epithelium are connected by TJPs and covered with mucus (Schenk and Mueller, 2008). The
mucosal immunity can be influenced by feed contaminants, such as Fusarium mycotoxins
(Figure 2-5) (Bouhet and Oswald, 2005). It is indicated that DON will enlarge the permeability
of the intestinal epithelium in pigs (Pinton et al., 2009). DON is also able to regulate the
production of pro-inflammatory cytokines, increasing the expression of IL-1β, IL-2 and IL-6 in
the jejunum, and IL-1β, IL-6 and TNF-α in the ileum in pigs (Bracarense et al., 2012).
Figure 2-5 Overview of the effects of DON on intestinal immune response. DON alters the
![Page 23: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/23.jpg)
13
intestinal defense mechanisms including cell proliferation, immunoglobulins (Ig) production,
pro-inflammatory cytokines production and intestinal permeability (Bouhet and Oswald,
2005).
2.1.1.6.4 Effect on intestinal barrier function
Epithelial integrity can be measured by transepithelial electrical resistance (TEER) and the
passage of macromolecular markers, such as FITC-dextran 4 (FD4), across the epithelial
monolayer. Several in vitro studies indicated that DON is able to decrease TEER and increase
the intestinal permeability of IPEC-1 cells in a dose and time dependent manner (Pinton et al.,
2009). The alterations in these two parameters are related to the decrease in the expression of
specific TJPs (Pinton et al., 2009, Diesing et al., 2011a). Claudins are the most important
components of the TJPs. The family of zonula occludens (ZO) is a part of the cytoplasmic
plaque of the TJPs. These are important parameters as DON leads to the impaired intestinal
barrier function through the reduced expression of the TJPs. It was reported that claudin 3 and
claudin 4 showed reduced protein expression in IPEC-1 monolayer epithelium exposed to
DON (9000 ng/mL) (Pinton et al., 2009, Pinton et al., 2010). Testing 2000 ng/ml DON on the
intestinal cell lines resulted in disintegration of zonula occludens-1 (ZO-1), while 200ng/ml
showed no effect on this parameter (Diesing et al., 2011b). The activation of MAPK by DON
and its acetyl derivatives suppresses the expression of TJPs, which is responsible for the loss of
barrier function (Pinton et al., 2012). In this way, DON is able to decrease the expression of
TJPs, which in turn lowers the intestinal barrier function.
2.1.1.6.5 Effect on secretion of intestinal defense components
Feed contaminants can modulate mucus secretion. The mucin glycoproteins produced by
goblet cells have direct antimicrobial properties that limit the growth of microorganisms in the
mucus. Secretory antibodies, IgA and IgG are very important components of the mucosal
barrier, and are secreted into the mucus by the epithelial cells (Strugnell and Wijburg, 2010).
Some studies dealing with the effect of DON on pigs showed interesting results related to
immunologic alterations. Several studies have demonstrated the concentration of IgA in the
serum of pigs treated with contaminated feed (Etienne et al., 2008). It was indicated that the
concentration of IgA in the serum of piglets significantly increased when piglets were fed with
600 µg/kg DON (Drochner et al., 2004). However, the concentrations of IgA in the plasma
remained unchanged when piglets were applied with 4 mg/kg of DON for 3 months (Bergsjo et
al., 1992, Danicke et al., 2004b).
2.1.1.7 EU regulation of DON in animal feed
Maximum levels for DON in animal feedstuffs have not been set in EU. In Europe, guidance
![Page 24: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/24.jpg)
14
values for the presence of DON in animal feedstuffs have been established by the European
Commission (Table 2-2).
Table 2-2 The guidance values for the presence of DON in products intended for animal feed
(feedstuffs with a relative moisture of 12%) (The commission of the European Commission,
2006)
Mycotoxin Products intended for animal feed Guidance value in mg/kg
DON Feed materials:
Cereals and cereal products with the exception of maize by-products 8
Maize by-products 12
Complementary and complete feedingstuffs:
Complementary and complete feedingstuffs with the exception of*: 5
*Complementary and complete feedingstuffs for pigs 0.9
*Complementary and complete feedingstuffs for calves (< 4 months), lambs and kids 2
2.2 Mycotoxin binders
2.2.1 Definition
Supplementation with mycotoxin binders to feeds contaminated with mycotoxins has been
considered to be the most promising dietary strategy to reduce the negative effects of
mycotoxins. Regarding the establishment of the new feed additive in EU, a basic worry is that
the safety towards farm animals and in vivo efficacy in binding mycotoxins of the majority of
these feed additives have not been completely tested yet (Ledoux et al., 2001). Therefore, the
commission regulation (EC, 386/2009) defines mycotoxin detoxifying agents as “Substances
for reduction of the contamination of feed by mycotoxins: substances that can suppress or
reduce the absorption, promote the excretion or modify their mode of action”. In other words,
these are substances that can modify mechanisms of mycotoxins. On the one hand, they can
decrease or inhibit the absorption of mycotoxins, and on the other hand, they can promote the
excretion of mycotoxins.
2.2.2 Types
Depending on different mechanisms, we can divide mycotoxin detoxifying agents into two
main subcategories: absorbing agents and biotransforming agents. Mycotoxin absorbing agents
are also called mycotoxin binders, leading to a reduction of the bioavailability of the
mycotoxins (Huwig et al., 2001). Mycotoxin binders are large weight molecules and capable of
![Page 25: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/25.jpg)
15
binding to mycotoxins in animal feeds efficiently without dissociating in the digestive tract
under all conditions of the GIT (Döll and Dänicke, 2004). Then the complex passes through
the GIT and is excreted via the faeces whereby mycotoxin uptake by the animal is prevented.
This helps minimize absorption of mycotoxins by target organs. Some typical binders of
absorbing agents are listed below.
2.2.2.1 Aluminosilicates
Aluminosilicate minerals are inorganic substances composed of aluminium, silicon oxygen and
countercations. Most studies on the mycotoxin binders have focused on aluminosilicates, such
as montmorillonites, bentonites, zeolite and hydrated sodium calcium aluminosilicate
(HSCAS). HSCAS is the most preferred one among the absorbents (Galvano et al., 2001,
Kabak et al., 2006).
2.2.2.2 Activated carbon
Activated carbon (AC) is an organic mycotoxin binder of interest. It is also called as activated
charcoal, activated coal, or carbo activates. AC is formed by pyrolysis of different kinds of
organic substances. It is produced by activation processes to develop a highly permeable
structure available for adsorption or chemical reactions (Galvano et al., 2001). Different
original AC shows different adsorbing properties. AC is one of the non-toxic and most
effective mycotoxin binders with a wide variety of toxins. AC has been commonly used for
severe intoxications and demonstrated to be an effective mycotoxin binder of DON, AFB1 and
OTA (Devreese et al., 2012, Huwig et al., 2001).
2.2.2.3 Yeast Cell Wall
Cell walls naturally derived from the Saccharomyces cerevisiae yeasts are commonly used as
an organic mycotoxin binder. Yeast cell walls are mainly made up of carbohydrates and
proteins, exhibiting various different but easy approachable adsorption centers. Instead of the
whole cell but only using yeast cell walls shows enhanced binding ability to mycotoxins. This
binder has demonstrated to effectively bind to DON, AFB1, ZEA, OTA and T-2 (Bejaoui et al.,
2004, Freimund et al., 2003, Yiannikouris et al., 2004).
2.3 Effect of mycotoxin binders
In summary, the present data provide strong evidence that exposure to DON in domestic
animals will result in reduced feed intake and vomiting with decreased performances. Pigs are
more sensitive to these negative effects. Available data regarding dietary exposure to DON in
pigs is not complete and no safe level for feed intake is worked out for pigs.
In order to solve the problem caused by mycotoxicosis, various strategies have been
![Page 26: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/26.jpg)
16
investigated, such as physical, chemical, and biological methods (Doyle et al., 1982, Ramos
and Hernandez, 1997). The most applied method is the utilization of mycotoxin binders mixed
with the feed (Huwig et al., 2001). The mycotoxin binders are stable over a wide pH range and
able to absorb a wide range of mycotoxins. Also binders can bind different levels of
contamination and have low inclusion rate. All these properties have proven that the addition
of a non-nutritive absorbent material to animal diets is practically feasible and very useful.
Binders help reduce gastrointestinal absorption of mycotoxins and the mycotoxins are no
longer absorbed by the animal (Huwig et al., 2001). Some in vivo and in vitro studies about the
absorption of DON by different mycotoxin binders are given in Table 2-3 and Table 2-4. Some
authors suggest that mycotoxin binder not only bind to the mycotoxin, but perhaps, can bind
also other toxins such as bacterial endotoxins. In that respect, supplementation with binders
could potentially reduce the risk for infection and inflammatory responses by Gram-negative
bacteria (Collier et al., 2011).
Table 2-3 Effect of mycotoxin binders on growth inhibition of trichothecenes
Adsorbent Concentration Mycotoxin Effects observed* Reference
Super-activated charcoal 0.5 trichothecenes No effect (Edrington et al., 1997)
Inorganic 0.5 trichothecenes 25%(broiler chickens) (Bailey et al., 1998)
HSCAS 0.5 trichothecenes No effect (Kubena et al., 1990)
HSCAS 0.5 trichothecenes 3% ( chickens) (Kubena et al., 1993)
HSCAS 0.25/0.375/0.8 trichothecenes 43% (young broiler chickens) (Kubena et al., 1998)
HSCAS 0.5/1.0 trichothecenes No significant effect (pigs) (Patterson and Young,
* Effects observed was calculated as percentage of the decline of growth inhibition.
Table 2-4 In vitro absorption of trichothecenes by different mycotoxin binders
Adsorbent Mycotoxin Adsorption Index (%) Reference
Activated carbon DON 1.8-98.9 (Lemke et al., 2001)
Activated carbon trichothecenes 1.3 (Galvano et al., 1998)
HSCAS DON 3.9 (Galvano et al., 1998)
Sepiolite DON 4.5 (Galvano et al., 1998)
Diatomaceous earth trichothecenes 0.5-1.5 (Natour and Yousef, 1998)
Modified yeast cell walls extract trichothecenes 0.2-1.9 (Howes and Newman, 2000) Adsorption Index is defined as the ratio of difference between the amount of mycotoxin bound and the amount
desorbed to the initial amount.
In a word, mycotoxin binders can reduce the uptake of the toxins and alleviate the adverse
effects of mycotoxins. The efficiency of the absorption relies on the chemical structure of both
the mycotoxins and the binders. As different mycotoxins act in different ways, it is necessary
![Page 27: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/27.jpg)
17
to investigate that the mycotoxin binder does not eliminate essential nutrients from the diet
before applying this technique into practice.
![Page 28: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/28.jpg)
18
Chapter 3 Materials and methods
3.1 Animals and experiment treatments
To test the hypothesis, we performed an animal feeding experiment in a 2 × 2 factorial design
with either or not addition of DON, and either or not addition of binder to the feed. A total of
120 weaning (3.5week suckling period) piglets with an average weight of 7.3 kg were used in
the feeding trial for 37 days. They were provided with water and feed ad libitum throughout
the whole experimental period. Animal experimental procedures were in accordance to the
guidelines of the Ethical Committee of the Faculty of Veterinary Sciences, Ghent University.
Piglets were allocated randomly to 4 different dietary treatments. Each treatment contained 5
pens with 6 piglets per pen. The 4 different treatments were as follows:
T1. Negative control diet (uncontaminated basal diet);
T2. Negative control diet with 1 kg/ton mycotoxin binder;
T3. Negative control diet with DON;
T4. Negative control diet with DON and 1 kg/ton mycotoxin binder
From day 0 until day 14 (sampling on day 14) of the experiment, the diet of T3 and T4 was
artificially contaminated with 3 mg/kg of a mixture of DON (2.6 mg/kg), 3A-DON (0.1 mg/kg)
and 15A-DON (0.3 mg/kg), after which the DON contamination level was reduced to 1 mg/kg
from day 14 until day 37.
3.2 Feed and diet
The compositions of the negative control diets used in this study are given in Table 3-1. They
were wheat-barley based diets.
The challenge diets were artificially contaminated with the fungal culture containing DON and
its metabolites. DON was produced in vitro by F. graminearum mixing on MIN medium. The
MIN medium contained per liter: 10 mg FeSO4·7H2O, 0.5 g KCl, 0.5 g MgSO4·7H2O, 1 g
KH2PO4, 2 g NaNO3, 30 g sucrose, 200 μL trace element solution (per 100 mL contained
50 mg MnSO4·H2O, 50 mg H3BO3, 50 mg NaMoO4·2H2O, 5 g ZnSO4·7H2O, 5 g citric acid,
0.25 g CuSO4·5H2O), pH 6.5 with NaOH, and 5g Arginine. After growing up of the mold, the
amount of DON was quantified by ELISA assay on the MIN medium. The result was verified
by LC/MSMS on the certified standard blank wheat. Taken together, the MIN medium
contained 240 mg/kg total DON metabolites (87.5% DON, 2.7% 3A-DON and 9.8%
15A-DON). All other mycotoxins were under the detection limit thus considered as negligible.
Based on the concentration of the MIN medium, we calculated the amount of medium needed
![Page 29: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/29.jpg)
19
for 3 mg/kg and 1 mg/kg pig diet respectively. After homogenization, MIN medium was added
to the basal diet. Thus, the diet was artificially contaminated with an exact amount of DON.
Table 3-1 Composition of the negative control diets for pre-starter (d0-d14) and starter
(d14-d37) periods
Pre-starter Starter
Ingredients Value (%) Ingredients Value (%)
Wheat 22.5714% Barley 25.000%
Barley 22.5000% Wheat 22.932%
Whey 7.0000% Corn 15.000%
Extruded soybeans 2.4000% Toasted soybeans 12.000%
Calcium formate and Agricid 1.0000% Whey 4.200%
Potato protein 2.0000% Extruded soybeans 1.700%
Toasted soybeans 12.0000% Calcium formate and Agricid 0.500%
Extruded oats and barley 10.0000% Coconut 0.200%
Corn 7.5000% Soybean meal, 49/3,5 ARGtype9 9.072%
Soybean meal, 49/3,5 ARGtype9 4.0401% Wheat gluten feed 2.690%
Fat, min 88% triglycerides 0.5000% Beet pulp, sugar 72% 2.000%
Sodium bicarbonate 0.3019% Fat, min 88% triglycerides 0.952%
CB Organic acids mixture 0.3000% CB Organic acids mixture 0.300%
Lime fine 0.2856% Salt 0.052%
Lysine HCl 0.0010% Lysine HCl 0.001%
Premix 7.6000% Threonine 0.001%
Total 100.000% Premix 3.400%
Total 100.000%
We used 3 mg/kg for pre-starter period (from day 0 until day 14) before sampling because
typically feed contamination with 2-5 mg/kg DON is required for reduced feed intake and
decreased body weight gain (Haschek et al. 2002). We reduced to 1 mg/kg DON for starter
period (from day 14 until day 37) after sampling because the maximum tolerable level in the
complete feed for pigs is 0.9 mg/kg DON (refer to Table 2-1). Chronic exposure to low
concentration of DON will impair animal performances, such as decreased feed intake and can
cause more severe problems on long term than an acute toxic dosage. Feed contamination with
as low as 1 mg/kg DON can result in decreased feed intake in pigs.
![Page 30: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/30.jpg)
20
The mycotoxin binder produced by Nutrex NV(Free-Tox) is a blend of well selected
indigestible adsorbents that bind mycotoxins in the GIT and prevent their uptake into the blood.
We choose1kg/ton toxin binders because this is the most commonly used dosage in practice.
The mycotoxin binder was added as an additive to the basal diet.
3.4 Sampling
After 14 days of feeding, one pig out of each pen was euthanized. The whole GIT was
removed and the small intestine was obtained and measured for the sample collection. A 10 cm
segment from the 75% length of the small intestine (distal small intestine, ileum) was collected
for Ussing chamber measurements. Another 20 cm segment from the same region was
processed to harvest mucosa, and frozen immediately in liquid nitrogen then stored at -80°C
for gene expression analysis.
3.5 Growth performance
The piglets as well as feed intake were weighed at d0, d14 and d37. Average Daily Gain (ADG,
g/d), Average Daily Feed Intake (ADFI, g/d) and Feed conversion rate (FC) were analyzed for
period d0-d14, d14-d37 and d0-d37. Diarrhea and mortality were checked and recorded for
every piglet every day.
3.6 Ex vivo measurement of intestinal permeability
Permeability was assessed ex vivo by measuring the permeability for the macromolecular
marker FITC-dextran 4 (FD4) across sheets of the mucosa by Ussing chamber technique as
described by Wang et al (Wang et al., 2016). Briefly, fresh segments of mucosa samples from
the 75% of the small intestine were got from the seromuscular layer and then mounted in
Ussing chamber system. They were bathed on 6.5 mL Ringer bicarbonate buffer solution with
6 mM glucose and 6 mM mannitol in the serosal and mocosal sides, respectively. The system
was maintained at 37°C and oxygenated (95% O2 and5% CO2). After a 20-min equilibration
period, 0.8 mg/mL 4-kDa FD4 (Sigma-Aldrich, Bornem, Belgium) was added to the mucosal
side. Samples from the serosal compartment were taken at 20-min intervals for 80 minutes to
monitor mucosal-to-serosal flux of FD4. Fluorescence intensity of FD4 was determined by
fluorescence spectrophotometry (Thermo Fisher Scientific, Marietta, OH, USA). The flux over
the 100-min period was calculated.
3.7 RNA isolation and reverse-transcription quantitative real-time
PCR
Relative mRNA expression of TJPs (ZO-1, ZO-2, Occludin, Claudin 1, Claudin 2, Claudin 5,
Claudin 7) and pro-inflammatory cytokines (TLR-4, TNF-α, IFN-γ, IL-1β, IL-8) and a brush
![Page 31: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/31.jpg)
21
border enzyme intestinal alkaline phosphatase (IAP) were determined by quantitative real-time
PCR. Briefly, mucosal total RNA was extracted using the Bio-Rad Aurum Total RNA Fatty
and Fibrous Tissue Kit (Bio-Rad Laboratories, Inc.,Hercules, CA, USA) and treated with
DNase I to remove genomic DNA (gDNA). The concentration and purity (260/280) of RNA
were measured with the NanoDrop ND-1000 (NanoDrop Technologies, Thermo Scientific,
Wilmington, DE, USA). 1 μg RNA was analyzed by 1% agarose gel electrophoresis to check
RNA integrity (18S, 28S rRNA bands). In addition to this assessment, a control PCR was
performed to verify the absence of any gDNA contamination. Following this, 1 μg of extracted
RNA was reverse transcribed in the 20 μL reverse-transcription reaction with the ImProm-II
cDNA synthesis kit (Promega, Madison, WI, USA), containing both oligo dT and random
primers. The obtained cDNA was diluted 10 times with molecular grade water to a final
concentration of 5 μg/μL. A control PCR using 2 μL cDNA was performed to verify the
reverse-transcription reaction.
Primers (Table 3-2) used for genes in the study were designed with Primer3Plus. The
mutations, the secondary structure and single nucleotide polymorphism (SNP) in target
sequence were checked with RepeatMarker, mfold and dbSNP, respectively. All these primer
sequences were gene isoform specific as they were designed based on certain exon-exon
boundaries of published pig gene sequences corresponding to the accession number. Primers
were then purchased from IDT (Integrated DNA Technologies, Leuven, Belgium).
The qRT-PCR was performed on the CFX96 Touch Real-Time PCR Detection System
(Bio-Rad Laboratories, Inc.). Briefly, 2μL cDNA template, 5 μL 2X KAPA SYBR FAST
qPCR Kit Master Mix (Kapa Biosystems, Inc., Wilmington, MA, USA), 2 μL molecular grade
water, 0.5 μL forward primer and 0.5 μL reverse primer were added to a total volume of 10 μL.
The amplification conditions were as follows: 1) enzyme activation and initial denaturation
(95°C for 3 min); 2) denaturation (95°C for 20 s ) and annealing/extension and data
acquisition(annealing temperature depending on primer for 40 s) repeated 40 cycles; and 3)
dissociation( melt curve analysis from 70 to 90°C with 0.5°C increment every 5 s).
Primers used in this study were first optimized by gradient quantitative real-time PCR. A
5-fold dilution series of cDNA as standard curve was included at 3 gradient temperatures to
determine PCR amplification efficiency (E) and specificity. The standard curve was also
included in each run to determine PCR efficiency. In this study, PCR amplification efficiencies
were consistently between 90 and 110%. Gene-specific amplification was verified by agarose
gel electrophoresis melting and curve analysis.
The cycle in which fluorescence can be detected is termed quantification cycle (Cq value). Cq
values are directly related to the starting quantity of DNA. Efficiency was used to convert the
![Page 32: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/32.jpg)
22
Cq value into raw data with the highest expressed samples (lowest Cq value) as a calibrator for
the normalization of raw data. The relative expression was expressed as the percentage of the
target gene in the stable expressed reference gene.
Table 3-2 Primer sequences used for reverse-transcription quantitative real-time PCR
Gene
symbol
Accession
number
Nucleotide sequence of primers, 5'-3' Product
length(bp Tm Forward Reverse
CLDN-1 NM_001244539.1 TATGACCCCATGACCCCAGT GCAGCAAAGTAGGGCACCTC 108 59
CLDN-2 NM_001161638.1 TTCCTCCCTGTTCTCCCTGA CACTCTTGGCTTTGGGTGGT 152 62
CLDN-5 NM_001161636.1 GTGGTCCGCGAGTTCTACGA CTTGACAGGGAAGCCGAGGT 171 60
CLDN-7 NM_001160076.1 GGTCCCCACAAACGTGAAGTA TCACTCCCAGGACAAGAGCA 114 60
HPRT-1 DQ178126 CCGAGGATTTGGAAAAGGT CTATTTCTGTTCAGTGCTTTGATGT 181 60
IAP XM_003133729.3 GGCCAACTACCAGACCATCG CCGACTTCCCTGCTTTCTTG 116 60
IFN-Ƴ NM_213948.1 GCTTTTCAGCTTTGCGTGACT CACTCTCCTCTTTCCAATTCTTCA 166 58
IL-1β NM_214055.1 GCACCCAAAACCTGGACCT CTGGGAGGAGGGATTCTTCA 143 58
IL-8 XM_003361958.3 TGTCAATGGAAAAGAGGTCTGC CTGCTGTTGTTGTTGCTTCTCA 100 60
OCLD NM_001163647.2 CATGGCTGCCTTCTGCTTCATTGC ACCATCACACCCAGGATAGCACTCA 129 65
PPIA NM_214353 CTGAAGCATACGGGTCCTGG TGCCCTCTTTCACTTTGCCA 139 65
TBP DQ178129 GATGGACGTTCGGTTTAGG AGCAGCACAGTACGAGCAA 124 59
TLR-4 NM_001113039.2 TTCTTGCAGTGGGTCAAGGA GACGGCCTCGCTTATCTGAC 135 58
TNF-α NM_214022.1 CATGATCCGAGACGTGGAGC AACCTCGAAGTGCAGTAGGC 151 62
ZO-1 XM_003480423.3 ATCTCGGAAAAGTGCCAGGA CCCCTCAGAAACCCATACCA 172 61
ZO-2 XM_005660148.2 CCAGGAAGCACAGAATGCAA AAGTCTGGCGGGACCTCTCT 148 61
CLDN-1, claudin-1; CLDN-2, claudin-2; CLDN-5, claudin-5; CLDN-7, claudin-7; HPRT-1, Hypoxanthine Phosphoribosyltransferase 1; IAP, intestinal alkaline phosphatase; IFN-Ƴ, interferon gamma; IL-1β, interleukin 1 beta; IL-8, interleukin 8; OCLN, occludin; PPIA, Peptidylprolyl isomerase A; TBP, TATA-binding protein; TLR-4, toll like receptor 4; TNF-α, tumor necrosis factor, alpha; ZO-1, zona occulden 1; ZO-2, zona occulden 2.
3.7.1 Reference gene selection
A selection of reference gene was done as described by Wang et al (Wang et al., 2016). PPIA,
HPRT1 and TBP were used as the reference gene in this study to normalize the raw data from
reverse-transcription quantitative real-time PCR. Primers for HPRT1 and TBP were obtained
from Erkens et al.(Erkens et al., 2006), whereas PPIA was obtained from Wang et al. (Wang et
al., 2016)
3.8 Statistical analysis
All data were expressed as mean ± standard errors. After determination of normality and
![Page 33: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/33.jpg)
23
variance homogeneity, general linear model with fixed effect of DON addition, binder addition
and the interaction was used with Tukey’s test as a multiple comparison test in SAS Enterprise
Guide 7(SAS Institute, Cary, NC, USA). P value < 0.05 was considered as significant.
Principal component analysis (PCA) as described by Montagne et al. was then conducted to
work out the variables that contributed most to the variation between subjects (Montagne et al.,
2007). In brief, the data of 17 variables were standardised before the application of PCA. At
first, a scree plot was carried out to fix the number of principal components to be maintained.
After that, 5 principal components retained with the eigenvalues > 1.0. In addition, variables
that did not show any principal component retained were excluded (correlation coefficient
between variables and principal components ≤ 0.5). Then, retained variables were grouped into
families to check the correlation. Only the main representative variable with highest principal
component loading together with high correlation (r > 0.55; P < 0.05) was retained for the final
analysis. Finally, 11 variables entered the final PCA.
![Page 34: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/34.jpg)
24
Chapter 4 Results and discussion
4.1 Growth performance
After 37 days dietary exposure to DON and/or mycotoxin binder, the growth performances
(ADG, ADFI, FC) for period d0-d14, d14-d37 and d0-d37 on different levels are given in
Table 4-1. Only few pigs from different groups had diarrhea problems in the first few days of
the experiment probably due to weaning stress. No case of emesis and mortality was observed.
Overall, no clinical signal of toxicity was observed.
On mycotoxin level, there was no significant difference between DON-control groups (T1 and
T2) and DON-challenged groups (T3 and T4).
On binder level, pigs supplemented with binder (T2 and T4) consumed more feed per day for
the first 14 days when compared to pigs that received diets with no binder (T1 and T3) (265
g/d vs 242 g/d) (p < 0.05). This resulted in a significant better growth for groups that received
diets with binder (T2 and T4) compared to groups that received diets with no binder (T1 and
T3) in the same period (197 g/d vs 170 g/d). That was the same case for period d0-d37. Groups
received diets with binder (T2 and T4) had a significant better ADG (368 g/d vs 341 g/d) and
ADFI (548 g/d vs 519 g/d) for the whole period compared to groups that received diets without
binder (T1 and T3). Meanwhile, there was a tendency that groups that received diets with
binder (T2 and T4) had a better feed conversion rate compared to groups that received diets
without binder (T1 and T3) from day 1 until day 14 of the experiment (p<0.10). No significant
difference for other parameters was found.
There were interesting interactions on the growth performance between mycotoxin and binder.
For the first 14 days of the experiment, DON contaminated diet supplemented with mycotoxin
binder (T4) had significant higher ADFI compared to diet only contaminated with DON (T3)
(272 g/d vs 227 g/d). This again resulted in a better growth rate for group received diet
contaminated with DON in combination with mycotoxin binder (T4) compared to group
received diet only contaminated with DON (T3) for period d0-d14 (205 g/d vs 159 g/d). No
significant difference for other parameters was found.
4.2 Permeability measurements in distal small intestine
At the moment of sampling (d14) of this study, the average value for permeability did not
differ significantly. Hence, there was no significant effect of DON, nor the binder addition on
the FD4 flux (Table 4-2).
On mycotoxin level, the average value of DON-control groups (T1 and T2) was 7.5×10-7 cm/s;
while the average value of DON-challenged groups (T3 and T4) was 7.6×10-7 cm/s.
![Page 35: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/35.jpg)
25
On binder level, the difference of FD4 flux between groups that received diets with the
addition of binder (T2 and T4) and groups that received diets without the addition of binder
(T1 and T3) was larger compared to the difference between DON-challenged and DON-control
groups but still not significant. The average value for groups that received diet with the
addition of binder (T2 and T4) was 6.5 ×10-7 cm/s while the average value for groups that
received diet without the addition of binder (T1 and T3) was 8.6 ×10-7 cm/s.
4.3 mRNA expression of tight junction proteins, inflammatory
cytokines and brush border enzyme in distal small intestine
The gene expression of TJPs (ZO-1, ZO-2, OCLN, CLDN-1, CLDN-2, CLDN-5, CLDN-7),
pro-inflammatory cytokines (TLR4, TNF-α, IFN-γ, IL-1β, IL-8) and brush border enzyme
(IAP) in distal small intestine was summarised in Table 4-3.
Ingestion of diets contaminated with or without DON, did not significantly change the gene
expression of junction proteins, pro-inflammatory cytokines and brush border enzyme in distal
small intestine.
Ingestion of diets supplemented with mycotoxin binder (T2 and T4) significantly
down-regulated the expression of TLR-4 compared to diets with no binder (T1 and T3) (0.72
vs 1.00). At the same time, there was a tendency that groups that received diet with the
addition of binder (T2 and T4) up-regulated the expression of OCLN compared to groups that
received diet without the addition of binder (T1 and T3) (p < 0.10). No significant difference
for other parameters was found.
There were interesting interactions on the relative mRNA expression between mycotoxin and
mycotoxin binder. DON contaminated diet supplemented with mycotoxin binder (T4)
significantly down-regulated the expression of TLR-4 compared to diet only contaminated
with DON (T3) (0.57 vs 1.11). At the same time, there was a tendency that group received diet
contaminated with DON in combination with mycotoxin binder (T4) up-regulated the
expression of ZO-1 compared to group received diet only contaminated with DON (T3) (p <
0.10). No significant difference for other parameters was found.
![Page 36: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/36.jpg)
26
Table 4-1 growth performance (ADG, ADFI, and FC) for period d0-d14, d14-d37 and d0-d37
mycotoxin binder interaction P value
mycotoxin + - + - + + - - mycotoxin binder interaction
binder + - + -
ADG d0-d14 (g/d) 182 ± 7 185 ± 8 197 ± 7b 170 ± 7a 205 ± 9b 159 ± 10a 188 ± 11ab 181 ± 10ab 0.80 0.02 0.03
ADFI d0-d14 (g/d) 250 ± 7 257 ± 8 265 ± 8b 242 ± 7a 272 ± 10b 227 ± 10a 257 ± 12ab 256 ± 10ab 0.50 0.05 0.05
FC d0-d14 1.38 ± 0.03 1.40 ± 0.03 1.35 ± 0.03 1.43 ± 0.03 1.33 ± 0.04 1.43 ± 0.04 1.38 ± 0.05 1.43 ± 0.04 0.64 0.08 0.25
ADG d14-d37 (g/d) 455 ± 10 457 ± 12 467 ± 11 445 ± 11 466 ± 13 444 ± 15 469 ± 17 446 ± 17 0.86 0.17 0.55
ADFI d14-d37 (g/d) 733 ± 14 742 ± 16 755 ± 15 720 ± 15 750 ± 19 716 ± 21 760 ± 23 724 ± 21 0.68 0.11 0.44
FC d14-d37 1.62 ± 0.02 1.60 ± 0.02 1.62 ± 0.02 1.60 ± 0.02 1.62 ± 0.03 1.62 ± 0.03 1.62 ± 0.03 1.59 ± 0.03 0.68 0.55 0.83
ADG d0-d37 (g/d) 353 ± 8 355 ± 10 368 ± 9b 341 ± 9a 370 ± 11 337 ± 12 366 ± 14 344 ± 14 0.90 0.05 0.21
ADFI d0-d37 (g/d) 530 ± 9 537 ± 10 548 ± 10b 519 ± 10a 549 ± 13 511 ± 14 548 ± 16 527 ± 14 0.59 0.05 0.19
FC d0-d37 1.50 ± 0.02 1.50 ± 0.02 1.50 ± 0.02 1.51 ± 0.02 1.49 ± 0.02 1.51 ± 0.03 1.50 ± 0.03 1.50 ± 0.03 0.84 0.63 0.92 Values are means ± SEM. Symbol + means addition of mycotoxin or binder; symbol - means without the addition of mycotoxin or binder. Means with different small letters (a,b) represent
differences among different groups. P < 0.05 was considered significant.
Table 4-2 Intestinal permeability in distal small intestine (10-7cm/s)
mycotoxin binder interaction P value
mycotoxin + - + - + + - - mycotoxin binder interaction
binder + - + -
permeability 7.59 ± 1.11 7.51 ± 1.23 6.48 ± 1.18 8.62 ± 1.16 7.33 ± 1.49 7.86 ± 1.63 5.63 ± 1.83 9.39 ± 1.63 0.96 0.21 0.51
Values are means ± SEM. Symbol + means addition of mycotoxin or binder; symbol - means without the addition of mycotoxin or binder.
![Page 37: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/37.jpg)
27
Table 4-3 Relative mRNA expression of TJPs and pro-inflammatory cytokines and IAP
mycotoxin binder interaction P value
mycotoxin + - + - + + - - mycotoxin binder interaction
binder + - + -
ZO-1 1.58 ± 0.11 1.47 ± 0.12 1.66 ± 0.12 1.39 ± 0.11 1.88 ± 0.15 1.29 ± 0.16 1.45 ± 0.18 1.50 ± 0.16 0.50 0.12 0.08
ZO-2 1.23 ± 0.11 1.29 ± 0.12 1.30 ± 0.11 1.26 ± 0.12 1.42 ± 0.15 1.13 ± 0.17 1.18 ± 0.17 1.40 ± 0.17 0.95 0.82 0.50
OCLN 1.21 ± 0.16 1.03 ± 0.17 1.29 ± 0.16 0.96 ± 0.17 1.60 ± 0.22 0.83 ± 0.24 0.97 ± 0.24 1.09 ± 0.24 0.45 0.18 0.13
CLDN-1 1.19 ± 0.10 1.20 ± 0.11 1.33 ± 0.10 1.06 ± 0.11 1.36 ± 0.15 1.03 ± 0.15 1.30 ± 0.15 1.10 ± 0.17 0.96 0.10 0.36
CLDN-2 1.06 ± 0.19 1.43 ± 0.19 1.21 ± 0.19 1.28 ± 0.19 1.25 ± 0.25 0.87 ± 0.28 1.17 ± 0.28 1.68 ± 0.28 0.19 0.81 0.26
CLDN-5 0.71 ± 0.15 0.99 ± 0.16 0.85 ± 0.15 0.86 ± 0.16 0.66 ± 0.21 0.76 ± 0.23 1.04 ± 0.23 0.95 ± 0.23 0.22 0.98 0.61
CLDN-7 1.41 ± 0.16 1.60 ± 0.17 1.49 ± 0.16 1.52 ± 0.17 1.62 ± 0.21 1.20 ± 0.23 1.36 ± 0.23 1.83 ± 0.23 0.42 0.92 0.26
TLR-4 0.84 ± 0.09 0.88 ± 0.09 0.72 ± 0.08a 1.00 ± 0.09b 0.57 ± 0.11a 1.11 ± 0.14b 0.87 ± 0.12ab 0.88 ± 0.12ab 0.77 0.04 0.05
TNF-α 0.92 ± 0.14 0.91 ± 0.14 0.91 ± 0.14 0.92 ± 0.14 0.98 ± 0.18 0.85 ± 0.20 0.84 ± 0.20 0.98 ± 0.20 0.99 0.98 0.92
IFN-γ 0.59 ± 0.12 0.34 ± 0.13 0.38 ± 0.12 0.55 ± 0.13 0.45 ± 0.17 0.73 ± 0.18 0.30 ± 0.18 0.38 ± 0.18 0.18 0.34 0.41
IL-1β 0.99 ± 0.16 0.94 ± 0.17 0.85 ± 0.16 1.08 ± 0.17 0.79 ± 0.22 1.20 ± 0.24 0.92 ± 0.24 0.97 ± 0.24 0.83 0.34 0.65
IL-8 1.05 ± 0.21 1.24 ± 0.22 1.10 ± 0.21 1.19 ± 0.22 1.20 ± 0.28 0.89 ± 0.31 1.00 ± 0.31 1.48 ± 0.31 0.54 0.78 0.57
IAP 0.88 ± 0.15 0.96 ± 0.16 1.015 ± 0.15 0.82 ± 0.16 1.03 ± 0.20 0.73 ± 0.22 1.00 ± 0.22 0.91 ± 0.22 0.72 0.37 0.65
Values are means ± SEM. Symbol + means addition of mycotoxin or binder; symbol - means without the addition of mycotoxin or binder. Means with different small letters (a,b) represent
differences among different groups. P<0.05 was considered significant.
![Page 38: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/38.jpg)
28
4.4 Principal component analysis
Weight at d0, weight at d14, ADG d0-d14, permeability, ZO-1, ZO-2, OCLN, CLDN-1,
CLDN-2, CLDN-5, CLDN-7, TLR4, TNF-α, IFN-γ, IL-1β, IL-8 and IAP were the 17 variables
used in the PCA. After the application of a first PCA, 5 principal components were retained
following a scree plot. Weight at d0 was the only variable that did not show any principal
component and was excluded. Then, weight at d14 and ADG d0-d14 were grouped into growth
performance family and ZO-1, ZO-2, OCLN, CLDN-1, CLDN-2, CLDN-5 and CLDN-7 were
grouped into TJPs family as well as TNF-α, IFN-γ, IL-1β and IL-8 were grouped into
inflammatory cytokines family. Some variables were highly correlated within each family. In
growth performance family, ADG d0-d14 was highly correlated with weight at d14 (r = 0.966,
p < 0.01). Within the family of TJPS, OCLN was correlated with ZO-1 (r = 0.762, p < 0.01),
ZO-2 (r = 0.811, p < 0.01) and CLDN-7 (r = 0.683, p < 0.01). Then, OCLD, CLDN-1,
CLDN-2 and CLDN-5 were retained for the final PCA. For the family of inflammatory
cytokines, only IFN-γ was excluded. Finally, 11 variables were kept for this final PCA (Table
4-4). The 5 principal components explained 85.5% of the variance, of which the first principal
component contributing 22.6% and the second principal component contributing 22.2%. The
first principal component grouped the TJPs family OCLN, CLDN-1, CLDN-2 as well as
TNF-α and brush border enzyme IAP together. General linear model with fixed factor
mycotoxin addition, binder addition and the interaction was then conducted for the scores of
piglets for these 5 principal components. On binder level, principal component 1 had higher
principal component score in groups with addition of binder (T2 and T4) compared to groups
without addition of binder (T1 and T3) (0.330 vs -0.398) (p < 0.1). In other words, ingestion of
diets supplemented with binder tended to have higher gene expression of OCLN, CLDN-1,
CLDN-2 and IAP compared to diet without binder. This finding is consistent with the gene
expression result of CLDN-1 in Table 4-3. What’s more, it provided strong evidence that
binder may also up-regulate the expression of other TJPs (OCLN, CLDN-2) and IAP. Taken
the correlation into consideration, binder may stimulate the expression of other TJPs as OCLN
is highly correlated to ZO-1, ZO-2 and CLDN-7. The second principal component indicates
that the high expression of TLR-4 was associated with high expression of TNF-α and IL-1β.
The third principal component indicates that high expression of CLDN-1, CLDN-2 and
CLDN-5 was related to higher weight at d14. The other principal components are more
complicated and difficult to interpret.
![Page 39: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/39.jpg)
29
Table 4-4 Description of 5 principal components obtained by principal component analysis
(PCA) of 11 variables *
Principal component
1 2 3 4 5
Mycotoxin§ + 0.054 0.000 -0.243 -0.203 -0.016
Mycotoxin§ - -0.122 0.063 0.255 0.196 0.031
Binder§ + 0.330A -0.312 0.135 -0.128 -0.303
Binder§ - -0.398B 0.375 -0.123 0.121 0.318
Weight at d14 0.889
Permeability 0.974
OCLN 0.813
CLDN1 0.767 0.401
CLDN2 0.343 0.335 0.754
CLDN5 0.546 0.713
TLR4 0.891
TNF-α 0.498 0.666
IL-1β 0.866
IL-8 0.910
IAP 0.856 *Rotation method: varimax with Kaiser normalisation.
§ General linear model with fixed factor mycotoxin addition, binder addition and the interaction was conducted for
the scores of piglets for these 5 principal components.
Symbol + means addition of mycotoxin or binder; symbol - means without the addition of mycotoxin or binder.
Scores with different capital letters (A, B) represent a tendency of differences among different groups within main
factors (P < 0.1).
Only correlations with |r| >0.3 are indicated.
4.5 Discussion
4.5.1 Effect of DON addition to feed on gut health and performance
The gastrointestinal epithelium is an important dynamic barrier against the uptake of
xenobiotics such as nutritional antigens, food contaminants and bacteria present in the gut
(Arrieta et al., 2006). Intestinal epithelium form a polarised layer with two separate
compartments; the apical (luminal) and the basolateral, thereby constituting a physical barrier.
The intestine has to deal with the xenobiotics from the mucosa protected apical side, as well as
the already absorbed ones from the basolateral side. Literature shows that ingestion of feed
contaminated with DON could exhibit toxic effects on performance, reproduction, GIT and
![Page 40: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/40.jpg)
30
other organs, with the reduced feed intake and lower growth rate being the most consistent
ones (Rotter et al., 1994). Thus, we performed a study with weaning pigs fed with
contaminated feed to investigate the effects of DON on the intestinal barrier function and
growth performance. We fed 3mg DON per kg feed for the first 14 days and reduced to 1
mg/kg for the remaining days. DON was present with its two acetylated forms 3A-DON and
15A-DON in this study. All other mycotoxins were below the detection limit thus could be
considered as negligible.
After 37 days dietary exposure to DON, no case of emesis or mortality was found. In our study,
there were no significant differences for growth performance between DON-control and
DON-challenged groups. The gender, age, health status of piglets may influence the effect of
DON and it’s difficult to see significant difference on growth performance level.
In addition, our results did not show significant differences of DON on gut health in the distal
small intestine (ileum), regarding intestinal permeability and mRNA expression of TJPs and
pro-inflammatory cytokines as well as IAP. This may be associated with its toxicokinetics
property. As we know from literature, after chronic exposure to DON in pigs, a fast and almost
complete absorption ( > 90%) was observed, with DON appearing within 15 minutes in the
blood and reaching maximal concentrations 1.65 h after oral exposure (Goyarts and Danicke,
2006). Danicke et al. also revealed that 88.5% of the DON dose was detected in stomach
whereas only 1.5% in the small intestine (Dänicke et al., 2004). Also, the acetylated derivatives
of DON are rapidly hydrolyzed to DON in vivo and then absorbed. In vivo and in vitro studies
demonstrated that DON and its acetylated forms were rapidly absorbed from the upper GIT,
involving stomach until proximal jejunum. Thus, the ileum is less susceptible to DON as the
majority of DON is already absorbed in the proximal parts of the GIT (Awad et al., 2007).
That’s may be the explanation for the slight effects of DON on gut health in ileum where the
majority of DON was already absorbed.
Our knowledge about the effect of DON is expanding quickly. All animal species can exhibit
toxic effects when exposed to DON (Pestka and Smolinski, 2005), with pigs being the most
susceptible one (Eriksen and Pettersson, 2004). However, the severity depends on various
factors, including type and dose of DON, the routine and duration of application, as well as the
animal status (Bondy and Pestka, 2000). After application of DON on the apical side or on the
basolateral side of the IPEC-J2 cell, Diesing et al. found that the apical epithelium seems to be
more resistant to DON application while the same concentration of DON from basolateral side
severely impairs barrier integrity (Diesing et al., 2011a). In our case, it can be assumed that the
majority of DON was adsorbed in the upper GIT, reaching the more susceptible basolateral
side whereby only a small part of DON was left in the less susceptible apical side. That’s
![Page 41: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/41.jpg)
31
probably the reason for little differences of DON on gut health could be seen in samples from
ileum.
So far, data about the effects of DON is incomplete, especially lack of in vivo data. At first,
feed naturally contaminated with DON was used in studies in vivo and in vitro. However, the
situation with naturally contaminated diets is very complicated as co-occurrence with other
mycotoxins is commonly found in cereals and mycotoxicoses may be caused by multiple
toxins, making it difficult to focus on the effects of the target mycotoxin DON. At present, it is
challenging to study the effect of DON and its masked mycotoxins ADONs. Also, purified
mycotoxins are generally used in in vitro experiments. However, it is difficult to correlate in
vitro exposure with in vivo dosage as the amount of mycotoxin that can be absorbed in vivo
does not necessarily correspond to the amount absorbed by cells in culture. Taken together, it’s
difficult to say at what dose DON will exhibit toxic properties as the dose, the type of
mycotoxin, the routine and duration of exposure all are factors influencing the mode of action.
4.5.2 Effect of binder addition to feed on gut health and performance
Based on literature study, we know that DON might negatively influence the gut health and
growth performance in pigs. Mycotoxin binder as mycotoxin detoxifying agents are supposed
to reduce the negative effects induced by DON. Addition of mycotoxin binder in this study
was to check how it could act with DON and other materials. The mycotoxin binder used in the
study was a combination of silicates, yeast cell walls and organic acids and salts, provided by
Nutrex NV.
To evaluate the effect of the mycotoxin binder on nutrient binding, a tolerance trial was
performed by Nutrex with inclusion of 20 kg/ton (10× the advised maximum dosage) in an
uncontaminated piglet diet. Results showed no significant difference between control and
mycotoxin group (ADG: 359 g/d vs 361 g/d; FC: 1.91 vs 1.83). Then, it’s clear that no
essential nutrient binding could have taken place. It was also confirmed that no vitamin E is
absorbed at the maximum advised dosage of 2 kg/ton mycotoxin binder compared to control
feed. Thus, to our knowledge, addition of the mycotoxin binder in this study will neither
reduce nutrient absorption nor cause bad effects.
From our results of performance (Table 4-1), we found that groups that received diets with
binder (T2 and T4) had a significant higher ADG and ADFI for the period d0-d14 as well as
the whole period d0-d37 compared to groups that received diets without binder (T1 and T3).
Meanwhile, there was a tendency that pigs supplemented with binder (T2 and T4) had a better
feed conversion rate compared to pigs without binder (T1 and T3) from day 0 until day 14 of
the experiment (p < 0.10). Based on the results above, to some extent we can conclude that the
binder could improve the growth performance regardless of DON. However, little is known
![Page 42: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/42.jpg)
32
about the mechanism by which the myctoxin binder improved growth performance. It is
probably related to the immune response after the addition of myxotoxin binder.
As to gene expression of pro-inflammatory cytokines (Table 4-3), ingestion of diet
supplemented with mycotoxin binder (T2 and T4) significantly reduced the expression of
TLR-4 compared to diet with no binder (T1 and T3). TLR-4 plays an important role in
recognizing pathogen and activating of the innate immune system. Activation of TLR-4 leads
to the release of its downstream inflammatory modulators including TNF-α and IL-1 (Telepnev
et al., 2003). This mechanism is clearly illustrated by the positive association between mRNA
TLR-4, TNF-α and Il-1β as found for principal component 2 (Table 4-4). TLR-4 is most
well-known for recognizing lipopolysaccharide (LPS), a structural component of the outer
membrane of Gram-negative bacteria. LPS, also known as endotoxin, consists of a lipid,
O-antigen and core. The toxic component of the LPS is the lipid portion, called lipid A. LPS
will induce strong inflammatory responses in vivo. Under certain circumstances, endotoxins
are toxic to specific hosts (Goscinski et al., 2003). LPS is only released when the cell is lysed
or during bacterial cell division. Supplementation of toxin binders in other studies showed
reduced expression of pro-inflammatory cytokines such as IL-1β and IL-6 and other immune
responses in LPS-induced pigs (Collier et al., 2011). In other words, the mycotoxin binder not
only can bind to mycotoxins, but might also bind other toxins such as bacterial endotoxins.
That may be the case in our study. Perhaps, this binder could adsorb LPS and helped reduce
the production of cytokines. Still, the effect of toxin binder on cytokine production warrants
further study as current literature is limited.
At the same time, there was a tendency that groups with the supplementation of binder (T2 and
T4) up-regulated the expression of CLDN-1 compared to groups without binder (T1 and T3)
(p<0.10). Claudins function as major components of the tight junction strands that regulate the
permeability of epithelia. CLDN-1, as a member of the claudin family, is an integral membrane
protein. CLDN-1 can decrease paracellular permeability and tighten the tight junctions. As the
mycotoxin binder in the current study is able to absorb a wide range of toxins, it could bind
other xenobiotics which might impair the barrier function, thus addition of mycotoxin binder
improved the gut health by increasing the production of TJPs.
From the result of PCA (Table 4-4), we know that groups with the supplementation of binder
(T2 and T4) tended to have higher gene expression of OCLN, CLDN-1, CLDN-2 and IAP
compared to diet without binder (T1 and T3). This finding is consistent with the gene
expression result of CLDN-1 in Table 4-3. The PCA results provided strong evidence that
binder may also up-regulate the expression of other TJPs (OCLN, CLDN-2) and IAP. OCLN,
together with the Claudin group of proteins, is an important component of the tight junctions. It
was the first transmembrane protein of TJPs to be discovered in 1993 by Shoichiro and Tsukita
![Page 43: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/43.jpg)
33
(Tsukita and Tstlkita, 1993). Studies have shown that rather than being important in assembly
and maintenance of tight junctions, OCLN is important in stability and barrier function of tight
junctions. As the OCLN gene is essential and plays a fundamental role in modulating the
epithelial tight junctions, OCLN is a good marker of epithelial barrier and its presence or
absence could reflect the permeability of intestinal epithelium (Saitou et al., 2000). Taken the
correlation into consideration, binder may stimulate the expression of other TJPs as OCLN is
highly correlated to ZO-1, ZO-2 and CLDN-7. The family of ZO is a part of the cytoplasmic
plaque of the TJPs.
IAP is a brush border enzyme which is a component of the gut mucosal defense system. IAP is
involved in regulating secretion of bicarbonate in the duodenum. Failure to neutralize acid
environment can lead to acidified chyme injuring cells, finally increasing inflammation and
intestinal permeability. IAP is also known to detoxify LPS and prevent bacterial translocation
in the gut (Bates et al., 2007). As discussed, LPS will induce strong inflammatory responses in
vivo. In other words, IAP can inhibit the inflammatory responses by detoxification of LPS. So,
IAP is an important indicator to gut health.
Taken together, the addition of mycotoxin binder could improve the gut health by increasing
the expression of TJPs and IAP as well as decreasing the expression of TLR-4. However, the
detailed mode of action by which the mycotoxin binder showed positive effects on gut health
remains unclear. More researches should be carried out to explore the mechanism.
4.5.3 Interaction between mycotoxin and mycotoxin binder
There were interesting interactions on the growth performance between mycotoxin and binder.
For the first 14 days of the experiment, diet contaminated with DON in combination with
mycotoxin binder (T4) had significant higher ADFI compared to diet only contaminated with
DON (T3). This again resulted in a better growth rate for pigs fed diet contaminated with DON
in combination with binder (T4) compared to pigs fed diet only contaminated with DON (T3)
for period d0-d14. From the growth performance level, we can see that the binder could help
improve the production when challenged with DON.
As to the immune response, the group that received diets contaminated with DON in
combination with the mycotoxin binder (T4) significantly down-regulated the expression of
TLR-4 compared to diet only contaminated with DON (T3). DON is also able to regulate the
production of pro-inflammatory cytokines, increasing the expression of IL-1β, IL-2 and IL-6 in
the jejunum, and IL-1β, IL-6 and TNF-α in the ileum in pigs (Bracarense et al., 2012).
At the same time, there was a tendency that the group received diets contaminated with DON
in combination with the mycotoxin binder (T4) up-regulated the expression of ZO-1 compared
to diet only contaminated with DON (T3) (p < 0.10). We learn from literature that DON
![Page 44: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/44.jpg)
34
impairs gut barrier by increasing the permeability of the intestinal epithelium and decreasing
the expression of TJPs in pigs (Pinton et al., 2009). Mycotoxin binder here could bind DON in
the diets without dissociating in the GIT (Döll and Dänicke, 2004). And then the complex
passes through the GIT and is excreted via the faeces whereby mycotoxin uptake by the animal
is prevented. Finally, this helps minimize absorption of DON by target organs. So
supplementation of mytoxin binder could reduce the potential negative effects induced by
DON.
In this experiment, the results of growth performance and gut health between the group
contaminated with DON in combination with binder and the group only contaminated with
DON differed a lot. Statistically we can say that there were interactions between mycotoxin
and binder.
According to the results above, we can conclude that the mycotoxin binder can reduce the
negative effects caused by DON to some extent.
![Page 45: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/45.jpg)
35
Chapter 5 Conclusions and recommendations
5.1 General conclusions
From literature, we can conclude that the toxicity of DON may be influenced by various
factors, such as the type and concentration of DON, the routine and duration of exposure as
well as the animal status and so on. It’s difficult to say at what dosage DON will exhibit toxic
properties. Here in our case, we could only say that the inclusion rate of DON showed no
significant effects on growth performance and gut health.
However, this mycotoxin binder, in combination of DON or not, both could indeed improve
growth performance especially in the first 14 days and also for the whole period. It also
improves gut health by increasing the expression of TJPs and reducing the expression of
TLR-4. So the mycotoxin binder could be a good feed additive regardless of mycotoxin
contamination or not.
5.2 Recommendations for further research
In further study, pure mycotoxin could be applied as not only DON but also its acetylated
forms were present in the culture medium in this study. DON and ADONs show different toxic
potential which made our study complicated.
Different models, perhaps challenged with LPS, could be investigated to check the interaction
between LPS and binder.
![Page 46: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/46.jpg)
36
Chapter 6 Reference list
ABBAS, H., MIROCHA, C. & TUITE, J. 1986. Natural occurrence of deoxynivalenol,
15-acetyl-deoxynivalenol, and zearalenone in refusal factor corn stored since 1972. Applied
and environmental microbiology, 51, 841-843.
ARRIETA, M., BISTRITZ, L. & MEDDINGS, J. 2006. Alterations in intestinal permeability.
Gut, 55, 1512-1520.
ASAO, T., WOGAN, G. N., CHANG, S. B., BUCHI, G., WICK, E. L. & ABDELKAD.MM
1963. Aflatoxins B and G. Journal of the American Chemical Society, 85, 1706-&.
AWAD, W., ASCHENBACH, J., SETYABUDI, F., RAZZAZI-FAZELI, E., B HM, J. &
ZENTEK, J. 2007. In vitro effects of deoxynivalenol on small intestinal D-glucose uptake and
absorption of deoxynivalenol across the isolated jejunal epithelium of laying hens. Poultry
science, 86, 15-20.
BAILEY, R., KUBENA, L., HARVEY, R., BUCKLEY, S. & ROTTINGHAUS, G. 1998.
Efficacy of various inorganic sorbents to reduce the toxicity of aflatoxin and T-2 toxin in
broiler chickens. Poultry Science, 77, 1623-1630.
BATES, J. M., AKERLUND, J., MITTGE, E. & GUILLEMIN, K. 2007. Intestinal alkaline
phosphatase detoxifies lipopolysaccharide and prevents inflammation in zebrafish in response
to the gut microbiota. Cell host & microbe, 2, 371-382.
BEJAOUI, H., MATHIEU, F., TAILLANDIER, P. & LEBRIHI, A. 2004. Ochratoxin A
removal in synthetic and natural grape juices by selected oenological Saccharomyces strains.
Journal of applied microbiology, 97, 1038-1044.
BERGSJO, B., MATRE, T. & NAFSTAD, I. 1992. Effects of Diets with Graded-Levels of
Deoxynivalenol on Performance in Growing Pigs. Journal of Veterinary Medicine Series
a-Zentralblatt Fur Veterinarmedizin Reihe a-Physiology Pathology Clinical Medicine, 39,
752-758.
BINDER, E. M. 2007. Managing the risk of mycotoxins in modern feed production. Animal
Feed Science and Technology, 133, 149-166.
BONDY, G. S. & PESTKA, J. J. 2000. Immunomodulation by fungal toxins. J Toxicol
Environ Health B Crit Rev, 3, 109-43.
BONY, S., CARCELEN, M., OLIVIER, L. & DEVAUX, A. 2006. Genotoxicity assessment of
deoxynivalenol in the Caco-2 cell line model using the Comet assay. Toxicology letters, 166,
67-76.
![Page 47: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/47.jpg)
37
BOUHET, S. & OSWALD, I. P. 2005. The effects of mycotoxins, fungal food contaminants,
on the intestinal epithelial cell-derived innate immune response. Veterinary Immunology and
Immunopathology, 108, 199-209.
BRACARENSE, A. P. F. L., LUCIOLI, J., GRENIER, B., PACHECO, G. D., MOLL, W. D.,
SCHATZMAYR, G. & OSWALD, I. P. 2012. Chronic ingestion of deoxynivalenol and
fumonisin, alone or in interaction, induces morphological and immunological changes in the
intestine of piglets. British Journal of Nutrition, 107, 1776-1786.
CALVERT, T. W., AIDOO, K. E., CANDLISH, A. G. G. & FUAT, A. R. M. 2005.
Comparison of in vitro cytotoxicity of Fusarium mycotoxins, deoxynivalenol, T-2 toxin and
zearalenone on selected human epithelial cell lines. Mycopathologia, 159, 413-419.
COLLIER, C. T., CARROLL, J. A., BALLOU, M. A., STARKEY, J. D. & SPARKS, J. C.
2011. Oral administration of Saccharomyces cerevisiae boulardii reduces mortality associated
with immune and cortisol responses to Escherichia coli endotoxin in pigs. Journal of Animal
Science, 89, 52-58.
COPPOCK, R., SWANSON, S., GELBERG, H., KORITZ, G., HOFFMAN, W., BUCK, W. &
VESONDER, R. 1985. Preliminary study of the pharmacokinetics and toxicopathy of
deoxynivalenol (vomitoxin) in swine. American journal of veterinary research, 46, 169-174.
DOLL, S. & DANICKE, S. 2004. In vivo detoxification of Fusarium toxins. Archives of
animal nutrition, 58, 419-441.
DANICKE, S., VALENTA, H., KLOBASA, F., DOLL, S., GANTER, M. & FLACHOWSKY,
G. 2004. Effects of graded levels of Fusarium toxin contaminated wheat in diets for fattening
pigs on growth performance, nutrient digestibility, deoxynivalenol balance and clinical serum
characteristics. Archives of animal nutrition, 58, 1-17.
DANICKE, S., VALENTA, H. & DOLL, S. 2004a. On the toxicokinetics and the metabolism
of deoxynivalenol (DON) in the pig. Arch Anim Nutr, 58, 169-80.
DANICKE, S., VALENTA, H., DOLL, S., GANTER, A. & FLACHOWSKY, G. 2004b. On
the effectiveness of a detoxifying agent in preventing fusario-toxicosis in fattening pigs.
Animal Feed Science and Technology, 114, 141-157.
DESJARDINS, A. E., HOHN, T. M. & MCCORMICK, S. P. 1993. Trichothecene
Biosynthesis in Fusarium Species - Chemistry, Genetics, and Significance. Microbiological
Reviews, 57, 595-604.
DEVREESE, M., OSSELAERE, A., GOOSSENS, J., VANDENBROUCKE, V., DE BAERE,
S., EECKHOUT, M., DE BACKER, P. & CROUBELS, S. 2012. New bolus models for in
![Page 48: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/48.jpg)
38
vivo efficacy testing of mycotoxin-detoxifying agents in relation to EFSA guidelines, assessed
using deoxynivalenol in broiler chickens. Food Additives & Contaminants: Part A, 29,
1101-1107.
DIESING, A. K., NOSSOL, C., DANICKE, S., WALK, N., POST, A., KAHLERT, S.,
ROTHKOTTER, H. J. & KLUESS, J. 2011a. Vulnerability of Polarised Intestinal Porcine
Epithelial Cells to Mycotoxin Deoxynivalenol Depends on the Route of Application. Plos One,
6.
DIESING, A. K., NOSSOL, C., PANTHER, P., WALK, N., POST, A., KLUESS, J.,
KREUTZMANN, P., DANICKE, S., ROTHKOTTER, H. J. & KAHLERT, S. 2011b.
Mycotoxin deoxynivalenol (DON) mediates biphasic cellular response in intestinal porcine
epithelial cell lines IPEC-1 and IPEC-J2. Toxicology Letters, 200, 8-18.
DOYLE, M., APPLEBAUM, R., BRACKETT, R. & MARTH, E. 1982. Physical, chemical
and biological degradation of mycotoxins in foods and agricultural commodities. Journal of
Food Protection®, 45, 964-971.
DROCHNER, W., SCHOLLENBERGER, M., PIEPHO, H.-P., G TZ, S., LAUBER, U.,
TAFAJ, M., KLOBASA, F., WEILER, U., CLAUS, R. & STEFFL, M. 2004. Serum
IgA-promoting effects induced by feed loads containing isolated deoxynivalenol (DON) in
growing piglets. Journal of Toxicology and Environmental Health, Part A, 67, 1051-1067.
EDRINGTON, T., KUBENA, L., HARVEY, R. & ROTTINGHAUS, G. 1997. Influence of a
superactivated charcoal on the toxic effects of aflatoxin or T-2 toxin in growing broilers.
Poultry Science, 76, 1205-1211.
EFSA, S. 2004. Opinion of the Scientific Panel on Contaminants in the Food Chain on a
request from the Commission related to Deoxynivalenol (DON) as undesirable substance in
animal feed. EFSA J, 73, 1-42.
EHRLICH, K. C. & DAIGLE, K. W. 1987. Protein synthesis inhibition by 8-oxo-12,
13-epoxytrichothecenes. Biochimica et Biophysica Acta (BBA)-General Subjects, 923,
206-213.
ERIKSEN, G. S. & PETTERSSON, H. 2004. Toxicological evaluation of trichothecenes in
animal feed. Animal Feed Science and Technology, 114, 205-239.
ERIKSEN, G. S., PETTERSSON, H., JOHNSEN, K. & LINDBERG, J. 2002. Transformation
of trichothecenes in ileal digesta and faeces from pigs. Archives of animal nutrition, 56,
263-274.
ERIKSEN, G. S., PETTERSSON, H. & LINDBERG, J. 2003. Absorption, metabolism and
![Page 49: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/49.jpg)
39
excretion of 3-acetyl DON in pigs. Archives of animal nutrition, 57, 335-345.
ERKENS, T., VAN POUCKE, M., VANDESOMPELE, J., GOOSSENS, K., VAN ZEVEREN,
A. & PEELMAN, L. J. 2006. Development of a new set of reference genes for normalization
of real-time RT-PCR data of porcine backfat and longissimus dorsi muscle, and evaluation
with PPARGC1A. BMC Biotechnol, 6, 41.
ETIENNE, M., WACHE, Y., OSWALD, I. & TARANU, I. 2008. Biological and physiological
effects of deoxynivalenol (DON) in the pig. Mycotoxins in farm animals, 113-130.
FILTENBORG, O., FRISVAD, J. C. & THRANE, U. 1996. Moulds in food spoilage. Int J
Food Microbiol, 33, 85-102.
FREIMUND, S., SAUTER, M. & RYS, P. 2003. Efficient Adsorption of the Mycotoxins
Zearalenone and T‐2 Toxin on a Modified Yeast Glucan. Journal of Environmental Science
and Health, Part B, 38, 243-255.
GALVANO, F., PIETRI, A., BERTUZZI, T., PIVA, A., CHIES, L. & GALVANO, M. 1998.
Activated carbons: in vitro affinity for ochratoxin A and deoxynivalenol and relation of
adsorption ability to physicochemical parameters. Journal of Food Protection®, 61, 469-475.
GALVANO, F., PIVA, A., RITIENI, A. & GALVANO, G. 2001. Dietary strategies to
counteract the effects of mycotoxins: a review. Journal of Food Protection®, 64, 120-131.
GOSCINSKI, G., LIPCSEY, M., ERIKSSON, M., LARSSON, A., TANO, E. & SJ LIN, J.
2003. Endotoxin neutralization and anti-inflammatory effects of tobramycin and ceftazidime in
porcine endotoxin shock. Critical Care, 8, R35.
GOYARTS, T. & DANICKE, S. 2006. Bioavailability of the Fusarium toxin deoxynivalenol
(DON) from naturally contaminated wheat for the pig. Toxicology Letters, 163, 171-182.
GUTLEB, A. C., MORRISON, E. & MURK, A. J. 2002. Cytotoxicity assays for mycotoxins
produced by Fusarium strains: a review. Environ Toxicol Pharmacol, 11, 309-20.
HASCHEK, W., VOSS, K. & BEASLEY, V. 2002. Selected mycotoxins affecting animal and
human health. Handbook of toxicologic pathology, 1, 645-699.
HECHT, G. 1999. Innate mechanisms of epithelial host defense: spotlight on intestine.
American Journal of Physiology-Cell Physiology, 277, C351-C358.
HOUSE, J. In Search of a Magic Bullet! Strategies for Dealing with Fusarium-Contaminated
Grains in the Swine Industry. Proceedings of the 2003 Manitoba Swine Seminar, 2003.
133-144.
HOWES, A. D. & NEWMAN, K. E. 2000. Compositions and methods for removal of
mycotoxins from animal feed. Google Patents.
![Page 50: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/50.jpg)
40
HUDLER, G. W. 1999. Magical mushrooms, mischievous molds: The remarkable story of the
fungus kingdom and its impact on human affairs. Virginia Quarterly Review, 75, 103-104.
HUWIG, A., FREIMUND, S., KAPPELI, O. & DUTLER, H. 2001. Mycotoxin detoxication of
animal feed by different adsorbents. Toxicology Letters, 122, 179-188.
IORDANOV, M. S., PRIBNOW, D., MAGUN, J. L., DINH, T.-H., PEARSON, J. A., CHEN,
S. & MAGUN, B. E. 1997. Ribotoxic stress response: activation of the stress-activated protein
kinase JNK1 by inhibitors of the peptidyl transferase reaction and by sequence-specific RNA
damage to the alpha-sarcin/ricin loop in the 28S rRNA. Molecular and cellular biology, 17,
3373-3381.
JACOBSEN, B., BOWEN, K., SHELBY, R., DIENER, U., KEMPPAINEN, B. & FLOYD, J.
2007. Mycotoxins and mycotoxicoses. Montana State University Extension Publication
EBO174, Montana State University, Bozeman, MT.
JECFA 2002. Evaluation of certain mycotoxins in food. Fifty-sixth report of the Joint
FAO/WHO Expert Committee on Food Additives. World Health Organ Tech Rep Ser, 906,
i-viii, 1-62.
KABAK, B., DOBSON, A. D. & VAR, I. L. 2006. Strategies to prevent mycotoxin
contamination of food and animal feed: a review. Critical reviews in food science and nutrition,
46, 593-619.
KOLF-CLAUW, M., CASTELLOTE, J., JOLY, B., BOURGES-ABELLA, N.,
RAYMOND-LETRON, I., PINTON, P. & OSWALD, I. P. 2009. Development of a pig jejunal
explant culture for studying the gastrointestinal toxicity of the mycotoxin deoxynivalenol:
Histopathological analysis. Toxicology in vitro, 23, 1580-1584.
KROGH, P., HALD, B. & PEDERSEN, E. J. 1973. Occurrence of Ochratoxin-a and Citrinin in
Cereals Associated with Mycotoxic Porcine Nephropathy. Acta Pathologica Et Microbiologica
Scandinavica Section B-Microbiology, B 81, 689-695.
KUBENA, L., HARVEY, R., BAILEY, R., BUCKLEY, S. & ROTTINGHAUS, G. 1998.
Effects of a hydrated sodium calcium aluminosilicate (T-Bind) on mycotoxicosis in young
broiler chickens. Poultry Science, 77, 1502-1509.
KUBENA, L., HARVEY, R., HUFF, W., CORRIER, D., PHILLIPS, T. & ROTTINGHAUS,
G. 1990. Efficacy of a hydrated sodium calcium aluminosilicate to reduce the toxicity of
aflatoxin and T-2 toxin. Poultry science, 69, 1078-1086.
KUBENA, L., HARVEY, R., HUFF, W., ELISSALDE, M., YERSIN, A., PHILLIPS, T. &
ROTTINGHAUS, G. 1993. Efficacy of a hydrated sodium calcium aluminosilicate to reduce
![Page 51: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/51.jpg)
41
the toxicity of aflatoxin and diacetoxyscirpenol. Poultry Science, 72, 51-59.
LEDOUX, D., ROTTINGHOUS, G., BERMUDEZ, A., KOE, W., SAMSON, R., VAN
EGMOND, H., GILBERT, J. & SABINO, M. 2001. In vitro binding of mycotoxins by
adsorbents does not always translate into in vivo efficacy. Mycotoxins and Phycotoxins in
Perspective at the Turn of the Millennium, 279-287.
LEMKE, S., OTTINGER, S., MAYURA, K., AKE, C., PIMPUKDEE, K., WANG, N. &
PHILLIPS, T. 2001. Development of a multi-tiered approach to the in vitro prescreening of
clay-based enterosorbents. Animal Feed Science and Technology, 93, 17-29.
MONTAGNE, L., BOUDRY, G., FAVIER, C., LE HU ROU-LURON, I., LALLES, J.-P. &
SEVE, B. 2007. Main intestinal markers associated with the changes in gut architecture and
function in piglets after weaning. British Journal of Nutrition, 97, 45-57.
MOON, Y. & PESTKA, J. J. 2002. Vomitoxin-induced cyclooxygenase-2 gene expression in
macrophages mediated by activation of ERK and p38 but not JNK mitogen-activated protein
kinases. Toxicological Sciences, 69, 373-382.
NATOUR, R. & YOUSEF, S. 1998. Adsorption efficiency of diatomaceous earth for
mycotoxin. Arab gulf journal of scientific research, 16, 113-127.
OTTE, J.-M., ZDEBIK, A.-E., BRAND, S., CHROMIK, A. M., STRAUSS, S., SCHMITZ, F.,
STEINSTRAESSER, L. & SCHMIDT, W. E. 2009. Effects of the cathelicidin LL-37 on
intestinal epithelial barrier integrity. Regulatory peptides, 156, 104-117.
PATTERSON, R. & YOUNG, L. 1993. Efficacy of hydrated sodium calcium aluminosilicate,
screening and dilution in reducing the effects of mold contaminated corn in pigs. Canadian
Journal of Animal Science, 73, 615-624.
PESTKA, J., LIN, W.-S. & MILLER, E. 1987. Emetic activity of the trichothecene
15-acetyldeoxynivalenol in swine. Food and Chemical Toxicology, 25, 855-858.
PESTKA, J. J. 2007. Deoxynivalenol: Toxicity, mechanisms and animal health risks. Animal
Feed Science and Technology, 137, 283-298.
PESTKA, J. J. 2010. Deoxynivalenol: mechanisms of action, human exposure, and
toxicological relevance. Archives of Toxicology, 84, 663-679.
PESTKA, J. J. & SMOLINSKI, A. T. 2005. Deoxynivalenol: Toxicology and potential effects
on humans. Journal of Toxicology and Environmental Health-Part B-Critical Reviews, 8,
39-69.
PINTON, P., ACCENSI, F., BEAUCHAMP, E., COSSALTER, A. M., CALLU, P.,
GROSJEAN, F. & OSWALD, I. P. 2008. Ingestion of deoxynivalenol (DON) contaminated
![Page 52: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/52.jpg)
42
feed alters the pig vaccinal immune responses. Toxicology Letters, 177, 215-222.
PINTON, P., BRAICU, C., NOUGAYREDE, J.-P., LAFFITTE, J., TARANU, I. & OSWALD,
I. P. 2010. Deoxynivalenol impairs porcine intestinal barrier function and decreases the protein
expression of claudin-4 through a mitogen-activated protein kinase-dependent mechanism. The
Journal of nutrition, 140, 1956-1962.
PINTON, P., NOUGAYR DE, J.-P., DEL RIO, J.-C., MORENO, C., MARIN, D. E.,
FERRIER, L., BRACARENSE, A.-P., KOLF-CLAUW, M. & OSWALD, I. P. 2009. The food
contaminant deoxynivalenol, decreases intestinal barrier permeability and reduces claudin
expression. Toxicology and applied pharmacology, 237, 41-48.
PINTON, P., TSYBULSKYY, D., LUCIOLI, J., LAFFITTE, J., CALLU, P., LYAZHRI, F.,
GROSJEAN, F., BRACARENSE, A.-P., MARTINE, K.-C. & OSWALD, I. P. 2012. Toxicity
of deoxynivalenol and its acetylated derivatives on the intestine: differential effects on
morphology, barrier function, tight junctions proteins and MAPKinases. Toxicological
Sciences, kfs239.
PODOLSKY, D. 2000. Review article: healing after inflammatory injury–coordination of a
regulatory peptide network. Alimentary pharmacology & therapeutics, 14, 87-93.
PRELUSKY, D., HARTIN, K., TRENHOLM, H. & MILLER, J. 1988. Pharmacokinetic Fate
of14C-Labeled Deoxynivalenol in Swine. Toxicological Sciences, 10, 276-286.
PRELUSKY, D. B. 1997. Effect of intraperitoneal infusion of deoxynivalenol on feed
consumption and weight gain in the pig. Natural toxins, 5, 121-125.
PRELUSKY, D. B. & TRENHOLM, H. L. 1991. Tissue distribution of deoxynivalenol in
swine dosed intravenously. Journal of Agricultural and Food Chemistry, 39, 748-751.
RAMOS, A. J. & HERNANDEZ, E. 1997. Prevention of aflatoxicosis in farm animals by
means of hydrated sodium calcium aluminosilicate addition to feedstuffs: A review. Animal
Feed Science and Technology, 65, 197-206.
RAWAL, S., KIM, J. E. & COULOMBE, R. 2010. Aflatoxin B-1 in poultry: Toxicology,
metabolism and prevention. Research in Veterinary Science, 89, 325-331.
RICHARD, J., PAYNE, G., EDS, DESJARDINS, A., MARAGOS, C., NORRED, W. &
PESTKA, J. 2003. Mycotoxins: risks in plant, animal and human systems. CAST Task Force
Report, 139, 101-103.
ROTTER, B., THOMPSON, B., LESSARD, M., TRENHOLM, H. & TRYPHONAS, H. 1994.
Influence of low-level exposure to Fusarium mycotoxins on selected immunological and
hematological parameters in young swine. Toxicological Sciences, 23, 117-124.
![Page 53: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/53.jpg)
43
SAITOU, M., FURUSE, M., SASAKI, H., SCHULZKE, J.-D., FROMM, M., TAKANO, H.,
NODA, T. & TSUKITA, S. 2000. Complex phenotype of mice lacking occludin, a component
of tight junction strands. Molecular biology of the cell, 11, 4131-4142.
SCHATZMAYR, G. & STREIT, E. 2013. Global occurrence of mycotoxins in the food and
feed chain: facts and figures. World Mycotoxin Journal, 6, 213-222.
SCHENK, M. & MUELLER, C. 2008. The mucosal immune system at the gastrointestinal
barrier. Best Practice & Research in Clinical Gastroenterology, 22, 391-409.
SCHOTHORST, R. C. & VAN EGMOND, H. P. 2004. Report from SCOOP task 3.2.10
"collection of occurrence data of Fusarium toxins in food and assessment of dietary intake by
the population of EU member states" - Subtask: trichothecenes. Toxicology Letters, 153,
133-143.
SERGENT, T., PARYS, M., GARSOU, S., PUSSEMIER, L., SCHNEIDER, Y.-J. &
LARONDELLE, Y. 2006. Deoxynivalenol transport across human intestinal Caco-2 cells and
its effects on cellular metabolism at realistic intestinal concentrations. Toxicology letters, 164,
167-176.
SHEPHARD, G. S. 2008. Determination of mycotoxins in human foods. Chemical Society
Reviews, 37, 2468-2477.
STEYN, P. S. 1998. The biosynthesis of mycotoxins. Revue De Medecine Veterinaire, 149,
469-478.
STRUGNELL, R. A. & WIJBURG, O. L. 2010. The role of secretory antibodies in infection
immunity. Nat Rev Microbiol, 8, 656-67.
SUDAKIN, D. L. 2003. Trichothecenes in the environment: relevance to human health.
Toxicology Letters, 143, 97-107.
TELEPNEV, M., GOLOVLIOV, I., GRUNDSTR M, T., T RNVIK, A. & SJ STEDT, A. 2003.
Francisella tularensis inhibits Toll‐like receptor‐mediated activation of intracellular signalling
and secretion of TNF‐α and IL‐1 from murine macrophages. Cellular microbiology, 5, 41-51.
TIEMANN, U. & DANICKE, S. 2007. In vivo and in vitro effects of the mycotoxins
zearalenone and deoxynivalenol on different non-reproductive and reproductive organs in
female pigs: A review. Food Additives and Contaminants, 24, 306-314.
TSUKITA, S. & TSTLKITA, S. 1993. Occludin: a novel integral membrane protein localizing
at tight junctions. J Cell Biol, 123, 17771788.
TURNER, P. C., BURLEY, V. J., ROTHWELL, J. A., WHITE, K. L., CADE, J. E. & WILD,
C. P. 2008. Deoxynivalenol: Rationale for development and application of a urinary biomarker.
![Page 54: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/54.jpg)
44
Food Additives and Contaminants, 25, 864-871.
UENO, Y. 1983. Trichothecenes. Chemical, biological and toxicological aspects, Elsevier.
UENO, Y. 1985. The toxicology of mycotoxins. Crit Rev Toxicol, 14, 99-132.
UENO, Y., NAKAJIMA, M., SAKAI, K., ISHII, K. & SATO, N. 1973. Comparative
toxicology of trichothec mycotoxins: inhibition of protein synthesis in animal cells. J Biochem,
74, 285-96.
VERŠILOVSKIS, A., GEYS, J., HUYBRECHTS, B., GOOSSENS, E., DE SAEGER, S. &
CALLEBAUT, A. 2012. Simultaneous determination of masked forms of deoxynivalenol and
zearalenone after oral dosing in rats by LC-MS/MS. World Mycotoxin Journal, 5, 303-318.
WACHE, Y. J., HBABI-HADDIOUI, L., GUZYLACK-PIRIOU, L., BELKHELFA, H.,
ROQUES, C. & OSWALD, I. P. 2009. The mycotoxin Deoxynivalenol inhibits the cell surface
expression of activation markers in human macrophages. Toxicology, 262, 239-244.
WANG, W., DEGROOTE, J., VAN GINNEKEN, C., VAN POUCKE, M., VERGAUWEN,
H., DAM, T. M., VANROMPAY, D., PEELMAN, L. J., DE SMET, S. & MICHIELS, J. 2016.
Intrauterine growth restriction in neonatal piglets affects small intestinal mucosal permeability
and mRNA expression of redox-sensitive genes. FASEB J, 30, 863-73.
WHO-IARC 1993. Toxins derived from Fusarium moniliforme: fumonisins B1 and B2 and
fusarin C. IARC Monogr Eval Carcinog Risks Hum, 56, 445-66.
YANG, G.-H., JARVIS, B. B., CHUNG, Y.-J. & PESTKA, J. J. 2000. Apoptosis induction by
the satratoxins and other trichothecene mycotoxins: relationship to ERK, p38 MAPK, and
SAPK/JNK activation. Toxicology and applied pharmacology, 164, 149-160.
YANG, H., CHUNG, D. H., KIM, Y. B., CHOI, Y. H. & MOON, Y. 2008. Ribotoxic
mycotoxin deoxynivalenol induces G 2/M cell cycle arrest via p21 Cip/WAF1 mRNA
stabilization in human epithelial cells. Toxicology, 243, 145-154.
YIANNIKOURIS, A., FRANCOIS, J., POUGHON, L., DUSSAP, C.-G., BERTIN, G.,
JEMINET, G. & JOUANY, J.-P. 2004. Adsorption of zearalenone by β-D-glucans in the
Saccharomyces cerevisiae cell wall. Journal of Food Protection®, 67, 1195-1200.
YOUNG, L., MCGIRR, L., VALLI, V., LUMSDEN, J. & LUN, A. 1983. Vomitoxin in corn
fed to young pigs. Journal of animal science, 57, 655-664.
YUNUS, A. W., BLAJET-KOSICKA, A., KOSICKI, R., KHAN, M. Z., REHMAN, H. &
BOHM, J. 2012. Deoxynivalenol as a contaminant of broiler feed: Intestinal development,
absorptive functionality, and metabolism of the mycotoxin. Poultry Science, 91, 852-861.
ZHOU, H.-R., ISLAM, Z. & PESTKA, J. J. 2003. Rapid, sequential activation of
![Page 55: Effect of a mycotoxin binder on gut health and performance ...](https://reader034.fdocuments.in/reader034/viewer/2022043013/626bb754e009161139214eaa/html5/thumbnails/55.jpg)
45
mitogen-activated protein kinases and transcription factors precedes proinflammatory cytokine
mRNA expression in spleens of mice exposed to the trichothecene vomitoxin. Toxicological
sciences, 72, 130-142.
ZIELONKA, L., WISNIEWSKA, M., GAJECKA, M., OBREMSKI, K. & GAJECKI, M. 2009.
Influence of low doses of deoxynivalenol on histopathology of selected organs of pigs. Pol. J.
Vet. Sci, 12, 89-95.