The EMBO Journal vol. 1 1 no. 7 pp. 2633 - 2641, 1 992

E.coli polynucleotide phosphorylase expression isautoregulated through an RNase III-dependentmechanism

Murielle Robert-Le Meur and Claude Portier

Institut de Biologie Physico-Chimique, 13 rue Pierre et Marie Curie.75005-Paris, France

Communicated by M.Grunberg-Manago

It has been previously shown that the pnp messengerRNAs are cleaved by RNase III at the 5' end and thatthese cleavages induce a rapid decay of these messengers.A translational fusion between pnp and lacZ wasintroduced into the chromosome of a Alac strain to studythe expression ofpnp. In the presence of increased cellularconcentrations of polynucleotide phosphorylase, the levelof the hybrid ,B-galactosidase is repressed, whereasthe synthesis rate of the corresponding message is notsignificantly affected. In the absence ofpnp, the level ofthe hybrid protein increases strongly. Thus, polynucleo-tide phosphorylase is post-transcriptionally auto-controlled. However, autocontrol is totally abolished instrains where the RNase III site on the pnp message hasbeen deleted or in strains devoid of RNase III. Theseresults suggest that polynucleotide phosphorylase requiresRNase III cleavages to autoregulate the translation of itsmessage. Other mutations in the ribosome binding siteregion support the hypothesis that this 3' to 5' processiveenzyme could recognize a specific repressor binding siteat the 5' end ofpnp mRNA. Implications of these resultson the mechanism of regulation and on messengerdegradation are discussed.Key words: autogenous control/messenger inactivation/mRNA processing/ribonuclease III

IntroductionPost-transcriptional regulation of gene expression is wellestablished for many eukaryotic and prokaryotic genes. Geneexpression is modulated by the translation initiation rate,which is dependent upon the amount and translationalefficiency of the messenger. Degradation or inactivationof mRNA affects the amount of translatable messages(Schmeissner et al., 1984; Pachter et al., 1987). Modifica-tions of sequences in the initiating region show that not onlyprimary, but secondary and tertiary structures can influencethe translational efficiency, either directly or by a proteinbinding to a specific mRNA structure and inhibitingtranslation (Hall et al., 1982; Parkin et al., 1988; Cho andYanovsky, 1988; McCarthy and Bokelmann, 1988; Altuviaet al., 1991). The second case is frequently observed intranslational autocontrol, for example, in the regulation ofexpression of many ribosomal protein genes in Escherichiacoli. The regulator protein binding site is generally locatedin the 5' region of the message, often overlapping theribosome binding site. Therefore, competition between the

regulatory protein and the ribosome for mRNA binding, ora stabilization of a translational inhibitory mRNA confor-mation, occurs (Draper, 1987; Winter et al., 1987; Moineet al., 1990; Tuerk et al., 1990).

Also, the mRNA degradation rate has been shown to beinvolved in regulation of gene expression (Newbury et al.,1987), although no direct relation has been found in vivobetween the message half-life and the amount of thecorresponding protein (Petersen and Reeh, 1978). Messengerinactivation, triggering an increased degradation rate, appearsto be a necessary step (Ono and Kuwano, 1979; Schmeissneret al., 1984; Portier et al., 1987), suggesting that the proteinsynthesis rate is primarily affected by an initial hit in themessage which could either lower the translational capacityof the messenger by inducing a conformational change inthe mRNA or allow exonucleases to degrade it. Thedegradation rate would be a consequence of these modifica-tions, hence not directly linked to the inactivation rate.Studies of the inactivation step suggest that endonucleasesare involved (Cannistraro et al., 1986; Melefors and vonGabain, 1988; Mudd et al., 1990; Babitze and Kushner,1991).In the case of the expression of polynucleotide phosphory-

lase, the first step of inactivation is the cleavage of the pnpmessenger by RNase III at two sites located 81 and 119nucleotides upstream of the initiation codon (Regnier andPortier, 1986). It was demonstrated that message half-lifeincreases sharply in a strain devoid of RNase III, conse-quently overproducing polynucleotide phosphorylase

- 10-fold (Portier et al., 1987). In the presence of RNaseIII, the inverse is observed: both the pnp messenger half-life and the amount of polynucleotide phosphorylase decreasein the cell. Nevertheless, the mechanism of the degradationremains unclear. The cleavages, located well upstream ofthe ribosome binding site, apparently do not cause theformation of alternative secondary structures which couldaccount for a decrease in translation, promoting mRNAdegradation (Singer and Nomura, 1985) or for the creationof a nuclease site which would enable a more or less specificnuclease to attack the messenger. As no 5' to 3' exonucleaseshave been described thus far in E. coli, the putative nucleaseinvolved would presumably be an endonuclease like RNase E.

Here, a translational fusion between pnp and lacZ wasconstructed to study polynucleotide phosphorylase expressionunder different conditions. It is shown that the expressionof the pnp gene is negatively autoregulated at the translationallevel and that this autoregulation is mediated by poly-nucleotide phosphorylase after the message is cleaved byRNase III. Thus, the cellular concentration of polynucleotidephosphorylase appears to be under the primary control ofRNase III and the increased messenger degradation ratefound after RNase III processing may not be the cause ofthe decrease in synthesis of polynucleotide phosphorylase,but more likely the consequence (Cole and Nomura, 1986).

© Oxford University Press 2633

M.Robert-Le Meur and C.Portier

ResultsTranslational control of pnp: repression of pnp - lacZfusions

It has been shown previously that the polynucleotidephosphorylase level increase in the presence of a plasmidcarrying the pnp gene (Portier et al., 1981). To discriminatebetween the chromosomal and the plasmid contribution tothe total polynucleotide phosphorylase concentration, atranslational fusion (plasmid pGF) between the 5' region ofthe rpsO-pnp operon, including the first 61 codons ofpnpand the reporter gene, lacZ, was constructed (Figure 1). Asecond fusion (plasmid pPF) conserves the junction ofpnp-lacZ, but deletes the rpsO promoter. In these fusions,polynucleotide phosphorylase is expressed either from boththe rpsO-pnp promoters (plasmid pGF), or solely from itsown promoter (plasmid pPF). Both fusions were insertedinto a hybrid X phage containing the right arm of Xgt4 andthe left arm of X+ (see Materials and methods). Theresulting phages, XGF1 and XPF1 (Figure 2), were used tolysogenize the Alac strain AB53 11 resulting in strainsGF5311 and PF5311 (Table I).When the plasmid pBP1 11, carrying the rpsO-pnp

operon, is present in strain GF53 11, the ,B-galactosidaseproduced from the fusion decreases - 8- to 9-fold ascompared with the control (Table II). The same experimentperformed with PF53 11 shows a lower repression, -4- to

5-fold. Plasmid pBPA7, carrying only rpsO, has no effecton 3-galactosidase expression, but plasmid pBPA 10,expressing only pnp represses the fusions (Table II). Thus,the repression is induced solely by polynucleotide phos-phorylase.The effect of polynucleotide phosphorylase overproduction

on the pnp transcription rate was analysed by measuring themessenger synthesis rate of the pnp- lacZ fusion messagein the presence of plasmids carrying pnp. The presence ofpnp in trans induces only a slight decrease in the transcrip-tion rate of the pnp -lacZ fusion (Table III), suggesting thatpolynucleotide phosphorylase overproduction has no directeffect on the pnp transcription rate. Therefore, the decreaseof fl-galactosidase activity in the presence of pnp in transdoes not correspond to a similar decrease in the mRNAsynthesis rate of the fusions, suggesting that the pnpexpression is autocontrolled at a post-transcriptional step.

Derepression of the pnp - lacZ fusionFrom these results, it can be deduced that the cellular levelof polynucleotide phosphorylase is autogenously regulated.In the absence of polynucleotide phosphorylase, the,B-galactosidase produced from the fusion should bederepressed. To test this hypothesis, a lysogenic straindisrupted at pnp by transposon TnS, carrying a kanamycinresistance determinant (Portier et aL., 1981), was constructed.The strain GF532 1, was P1 transduced to pnp- by selecting

SstlI

Fig. 1. Construction of pnp-lacZ fusions expressed by either one (pPF) or two (pGF) promoters. A HpaI-Hpal fragment of pBPI 11 was insertedinto the SmaI site of pNM480. Colonies transformed with the resulting plasmid, pGF, are blue on Xgal plates. The fusion is expressed from rpsOand pnp promoters. A PstI fragment from pGF was inserted into the PstI site of pNM480 giving pPF. In this fusion, ,B-galactosidase is expressedsolely from the pnp promoter. Circular arrows indicate the direction of transcription of the genes. ApR, ,B-lactamase gene; rpsO, S 15 gene; pnppolynucleotide phosphorylase gene. lacZ', pnp' and rpsO' represent truncations of the corresponding genes.

2634

Autogenous control of an exonuclease is endonuclease-dependent

GF2

lacAXS2W

A,4-%

2,flIJ

J-|~~~~~~~~~~~c

-

uF1 -.,i; . ,,-:-- :Fig. 2. Transfer of the fusions onto X: pGF and pPF plasmids, cut by EcoRI and partially by SstII, were ligated to Xgt4 (cleaved by EcoRI) and X+(digested with SstII). M13 derivatives carrying the fusions (see text) were cut by EcoRI and HindIII and ligated to Xgt4 (cleaved by EcoRI) andXSKS107 (cut by HindIII). After in vitro packaging, blue, clear plaques, were isolated. The positions of the two alternative structures inserted in thereconstituted phages are shown as large crossed bars. Horizontal arrows indicate the direction of transcription and horizontal single lines, deletions.lacZ', pnp' and rpsO' represent truncations of the corresponding genes. The broken lines in lac indicate that the genes are not represented in totality.

Table I. Genotype of the strains used in this work

Strains Genotype Origin or Reference

AB5311 argE3, AlacX74, supE44, rpsL, recAl M.SpringerCP150 pnp::Tn5 derivative of YA149 This workGF493 rnc::TnlO, argG6, argE3, his4, AlacX74, rpsL, (XGFI) This workGF494 pnp::TnS derivative of GF493 by P1 transduction This workGF5311 argE3, AlacX74, supE44, rpsL, recAl, (XGFI) This workGF5321 argG6, argE3, his4, AlacX74, rpsL, (XGFI) This workGF5322 pnp: :TnS derivative of GF5321 This workGFARN5321 argG6, argE3, his4, AlacX74, rpsL, (XGF2) This work

(deletion mutant)GFV5311 argE3, AlacX74, supE44, rpsL, recAl, (XGF2) This work

(point mutation)GFX5311 argE3, AlacX74, supE44, rpsL, recAl, (XGF2) This work

(point mutation)IBPC5321 argG6, argE3, his4, AlacX74, rpsL Plumbridge et al. (1985)IBPC493 rnc::TnlO derivative of IBPC5321 by P1 transduction J.PlumbridgeJC3560 argG6, metBI, his], leu6, supE44, pnp::Tn5, rpsL Portier et al. (1981)JM1O0 F' lacld, lacz, AMJS, proAB Messing (1983)

Alac-pro, supEJMlOlTR recA56, srl-300::TnIO derivative of JMO1I by M.Springer

P1 transductionPF5311 argE3, AlacX74, supE44, rpsL, recAl, (XPFI) This workYA149 pyrF40, spoT, relA CGSC

2635

Ecc-

--l ApsplS

M.Robert-Le Meur and C.Portier

Table II. 13-galactosidase levels in different strains in the presence ofpnp in trans

Plasmids pBR322 pBPl11 Repression pBPA7 pBPA1O RepressionStrains (control) (rpsO-pnp) ratio (rpsO) (pnp) ratio

GF5311 135 15 9 110 27 5(control)PF5311 86 17 5 82 39 2.1GFXS311 426 115 3.7 466 236 1.8GFVS311 120 27 4.5 115 70 1.7

The repression ratio corresponds to the f-galactosidase activity (Millerunits) in the presence of the control plasmid (pBR322) divided by thevalue obtained when the strain carries another plasmid (pBP 111,pBPA7 or pBPA10).

Table III. mRNA synthesis rate of pnp-lacZ gene in the presence ofpnp in trans

Plasmids % Input/nucleotide %/thrS mRNAitn trans mRNA x 0-4 (internal control)

thrS lacZ

pBR322 1.26 0.66 52(control)pBPll1 1.14 0.49 43(ipsO-pnp)pBPA7 0.88 0.45 51(rpsO)pBPA1O 1.11 0.52 47(pnp)

Hybridizations were performed as described in Materials and methods.The percentage per nucleotide represents the fraction of radioactivityhybridized in the specific DNA probe divided by the number ofnucleotides in the probe. All the values measured by the lacZ mRNAare expressed as percentages of thrS mRNA used as internal standard.

Table IV. Derepression of the pnp-lacZ fusion in the absence ofpolynucleotide phosphorylase and deregulation in the absence of RNaseIII cleavages of pnp mRNA

Plasmids pBPA7 pBPA 10 RepressionStrains (rpsO) (pnp) ratio

GF5321 326 103 3.2(rnc+, pnp+)GF5322 2175 130 16.7(mc+, pnp-)GF493 1439 1414 1.0(mc-, pnp+)GF494 2940 2596 1.1(mc-, pnp-)GFARN5321 626 603 1.0(mc+, pnp+)

The /3-galactosidase levels are measured as described in Table II.GFARNS321 should be compared with its parental strain GF5321. Forunknown reasons, the 13-galactosidase concentration in this strain is- 2-fold higher than in GFS3 11. See text for details.

for kanamycin resistance. The corresponding mutant,GF5322, exhibits no polynucleotide phosphorylase activity.The fl-galactosidase levels of this strain and of GF5321, inthe presence of pBPA 10 and pBPA7, are given in Table IV.In GF5322, the activity of f-galactosidase produced fromthe fusion increases dramatically from 326 to 2175 units,a value -7-fold higher than obtained from GF532 1,suggesting that derepression occurs. The expression of thefusion in the presence ofpBPA 10 is almost identical in both2636 -'

strains (130 compared with 103 units). The difference in therepression ratio between the two strains is explained by thehigh expression of the fusion in the totally derepressed strain,GF5322. Thus, polynucleotide phosphorylase expression isclearly autogenously regulated.

Effect of polynucleotide phosphorylase overproductionon the,-galactosidase synthesis from a wild-type lacoperonWhat is the mechanism of polynucleotide phosphorylaseautoregulation? In the fusion, the repression of f-galacto-sidase expression can be explained by the binding ofpolynucleotide phosphorylase onto the message, but does thisexonuclease bind to the 5' part of the pnp- lacZ messengerand stop translation initiation, or does it bind to the 3' end?Since this exonuclease degrades mRNAs processively from3' to 5', overproduction of this enzyme might thenphosphorolyse the distal lacZ part of the chimeric messengerand this trivial effect could be responsible for the decreasedlevel of f-galactosidase observed. In fact, decay of thepnp - lacZ messenger is drastically increased when poly-nucleotide phosphorylase is overproduced. Its half-lifedecreases from 4 min to 1 min 20 s (Figure 3). This resultsupports the hypothesis that autoregulation occurs due toincreased 3' to 5' processive phosphorolysis of the lacZ partof the hybrid message by polynucleotide phosphorylase. Iftrue, this mechanism should also be observed with the wild-type lacZ message. To verify this hypothesis, a strain devoidof polynucleotide phosphorylase, CP150, was constructedby P1 transduction (see Materials and methods). This strainis isogenic to YA149, a lac+ strain, used as a control.These two strains were transformed with pBPl 11, carryingthe rpsO-pnp genes, or by pBR322 and the degradationrate of the lacZ and thrS (control) mRNAs was measuredby hybridization of specific probes (Figure 3, bottom). Theseprobes cover either approximately the proximal half (forthrS) or the terminal two thirds (for lacZ) of the message:in strain YA149, the half-life of the 13-galactosidasemessenger is -4 min 45 s in the presence of pBR322 and

- 3 min 30 s in the presence of pBPl 11. This differencecorresponds to a decreased half-life of -30%. The samevariation is observed for the thrS mRNA half-life whichdecreased from 3 to 2 min. When the same experiments arerepeated in CP150, a strain devoid of polynucleotidephosphorylase, the differences are less: - 10% for lacZ(3 min 10 s compared with 2 min 45 s in the presence ofpBPl 1 1) and no effect for thrS (2 min 20 s in each case).Thus, the half-lives of both messages are not significantlyaffected by overproduction of polynucleotide phosphorylase.On the other hand, the 13-galactosidase activities of thesestrains were measured in the same conditions. As shown inTable V, the presence of polynucleotide phosphorylasein trans has no significant effect on the ,B-galactosidase levelin either strain. As lacZ mRNA is quite sensitive to 3'degradation (see Discussion), this result supports the mRNAdecay experiments. Therefore, the repression previouslyobserved in ,-galactosidase expression from the fusion isnot the consequence of an increase in the degradation ratefrom 3' to 5' of the pnp - lac messenger by polynucleotidephosphorylase. Also, if polynucleotide phosphorylaseexpression is autocontrolled, another conclusion can bededuced from these results: the sequences involved in theregulatory mechanisms are located in the 5' region of thepnp - lacZ messenger. Since repression is observed for both

Autogenous control of an exonuclease is endonuclease-dependent

100

so

10

100

I

aI

IYA149 (pBR322)

100

so

I I I

10 1j

133.IlIlti(mdi)Iohra 7o t c t (min)

CPISO (pBR322)CPwn O (pBPy II)

100

110

0 2 4t t (min)GF5311

Fig. 3. Polynucleotide phosphorylase effect on the decay of thrS, lacZand pnp-IlacZ mRNAs. Top and middle: thrS and lacZ decay;

exponential cultures of YA149 and CP150 (pnp-) carrying either

pBR322 or pBP 11I (pnp') were grown at 30'C on glycerol in the

presence of IPTG to an OD6W of 0.5, pulse-labelled for 2 min with

[3H]uridine and RNA synthesis stopped by the addition of rifampicin,nalidixic acid and cold uridine (time zero). Samples were withdrawn atdifferent times, RNA extracted and hybridized with single strandedspecific probes. For each time, the results are expressed as a

percentage of the maximum radioactivity hybridized to the probe. Oneminute after rifampicin addition, the maximum net counts per minhybridizing to thrS and lacZ probes vary respectively from 440 to2644 and from 2174 to 13664 depending upon the strains used, thelowest incorporation being observed for CP150 carrying pBR322.Squares, thrS mRNA; circles, lacZ mRNA. Bottom: pnp-lacZ decay:the lysogenic strain GF5311 carrying the fusion pnp-lacZ was

cultivated as above but on glucose instead of glycerol and withoutIPTG. RNA extractions and hybridization were performed in the same

conditions as above. A, with pBR322; A, with pBPl 11.

Table V. Effect of polynucleotide phosphorylase overproduction on the3-galactosidase activity of a lac+ strain

Plasmids pBR322 pBPI 11 RepressionStrains (control) (pnp) ratio

YA149 5978 5324 1.1(pnp+)CP150 4407 3969 1.1(pnp-)

fusions, it appears that all sequences necessary for controlby polynucleotide phosphorylase (called hereafter theoperator site) are present in the messenger transcribed fromthe pnp promoter.

Expression of the pnp -lacZ fusion in a mc strainSince the pnp messengers are cut by RNase HI, do the RNaseIII cleavages affect the autoregulation by polynucleotidephosphorylase? In other words, is the operator site locatedupstream, or downstream of these sites? Since the RNaseIII cleavages occur very rapidly after pnp mRNA synthesis(Regnier and Portier, 1986), and the processing is almosttotal, a comparison of fusion expression in strains with, andwithout, RNase III should shed light on this question. TheAlac, mc strain, IPBC493, was used along with IBPC532 1,its mc+ isogenic counterpart for comparison. The twostrains were lysogenized with XGF 1 and the fl-galactosidaselevel determined in the presence and absence ofpnp in trans.The results clearly establish that there is no repression inthe presence of the plasmid pBPA10 (Table IV, GF493compared with GF532 1) and that the autocontrol requiresthe cleavages of the messenger by RNase III.The same type of experiments with mc strains devoid of

polynucleotide phosphorylase (pnp: :TnS) confirms thepreceding results (Table IV). In the double mutation, mc,pnp (GF494), the expression of the pnp -lacZ fusion isapproximately the same as that observed in pnp strainGF5322 (2940 units and 2175 units, respectively), wherethe fusion is totally derepressed. Thus, in the absence ofcleavage by RNase III, the pnp messenger is not subject toautogenous control. The result suggests that polynucleotidephosphorylase could recognize the new 5' region of themessage liberated after the cleavage to decrease translation.

Isolation of deregulated mutantsTo verify that the translational operator, or at least a partof it, is located in the region spanning - 153 to -48, tworestriction sites (Bgll and HpaI) were created in the upstreampart of the message at positions - 153 and -51 by a singlenucleotide change in M13GF8 (see Materials and methodsand Figure 4). These mutations have no effect on the control.(All the mutations described here and below have beeninserted into X, see Materials and methods and Figure 2.)A clone deleted for the RNase mI sensitive site was created

by removing the DNA fragment between the newly createdBglH and HpaI sites (M13GFARN8, Figure 4); the mutation,on the X vector was called XARNGF2. The ,B-galactosidaseexpression of the corresponding lysogen, GFARN5321, isinsensitive to increased concentration of polynucleotidephosphorylase (Table IV). This loss of the autocontrolsuggests that the operator site overlaps the RNase HI sensitivesite.

2637

M.Robert-Le Meur and C.Portier

Bgl II Hpa I

Rill / HF

t 1 \ / /EcoR V

-0 pP2\

pnp'

Bgl II Hp

fi Ii

t?2 ISD

pnp'

pa I/ Sma I

4IacZ'

Hpa / Sma I

I M13 GFARN8=_1_

IacZ'

RNase III

1-80 -70 -60 -50 -40 -30 -20

11 1 1 1TTAGTCGCGAGGATGCGCAGAAGATCGGGTATTAACACCAGTGCCGTAAGGTACTGTCTAAG

(Hpa I site)

-10 +1 +10 +20 +160 +170 +180

AAAGAGAAAGGATATTACA CTA ATCGTTCG.......CAGGACTTCTTCCCACTGACCGSD ,acZ'

(GFV531 1) (GFX531 1)

Fig. 4. Top: the rpsO-pnp translational fusion: the positions of the two genes, rpsO and pnp, are indicated along with the promoters, P1 and P2(black squares), the rpsO terminator, tl, and the RNase III sensitive site (RIII). Horizontal arrows indicate the direction of transcription. Onlypertinent restriction sites are indicated. Relative positions of those created by site directed mutagenesis are indicated in bold type. The broken line forlacZ' indicates that the gene is not represented in totality. Middle: deletion of the fragment located between BgllI and HpaI gives the mutantM13GFARN8. Bottom: the sequence of the 5' processed pnp messenger is shown to indicate the position of point mutations present in strainsGFV5311 and GFX53 11. SD: Shine-Dalgarno sequence. The initiation codon is framed.

Attempts to isolate spontaneous deregulated mutants were

performed using strain GF53 1 1 in the presence of pBP 1 1,by selecting for colonies able to grow on lactose media. Nomutants were obtained, therefore the fusion was introducedin-frame into phage M13mpl 8 (see Material and methods).The resulting replicative form of this phage, M13GF18, was

treated with hydroxylamine. JMlO1TR was then transfectedby the mutagenized phages and the presumptive deregulatedmutants screened for by the appearance of deep blue plaqueson Xgal medium. From several clones purified andsequenced, only one mutant was isolated, M13GF108, whichcarries three point mutations (T for C) in the vicinity of theShine-Dalgarno sequence at positions -2 and +10 and justupstream of the junction of the fusion at position + 171(Figure 4). This allele was transferred onto a phage X,

lysogenized and the resulting strain (GFX531 1) was analysedfor f-galactosidase expression in the presence of pnp intrans. Table II shows that ,3-galactosidase expressionincreases - 3-fold in this mutant compared with the control(426 units instead of 135). The autocontrol is not entirelyabolished, but it decreases from 9 to 3.7 (Table II, firstcolumn, rows 2 and 4). This expression is 2.5-fold higher

than in the control strain, GF53 1 1, suggesting that this regionis likely to be involved in the autogenous regulation. Theeffect of polynucleotide phosphorylase overproduction on

the pnp transcription rate was also analysed by measuringthe messenger synthesis rate ofpnp - lacZ fusion (data notshown). The presence ofpnp in trans induces only a slightdecrease in the transcription rate of both the pnp - lacZfusions and thrS, the control, suggesting again thatpolynucleotide phosphorylase overproduction has no majordirect effect on the pnp transcription rate.An EcoRV site was created, four nucleotides upstream

of the initiation codon, by substituting C for T at position-4 (Figure 4). This point mutation modifies the control.The concentration of 3-galactosidase produced from thismutant, GFV5311, is identical to that of the wild-type fu-sion. However, in the presence of pnp in trans, therepression ratio decreases only - 2-fold compared with thecontrol, suggesting that this region is involved in theregulation of pnp expression (Table II).Thus, point mutations, when located in the proximity of

the ribosome binding site, induce a partial loss of autocontrol.Taken together, these results suggest that the operator site

2638

Sma / Hpa I

IP1,z

rpsO

Sma I / Hpa I

P1m

rpsO

1- m -, -. -. ------41F ........-I

m I r I

)a I

Autogenous control of an exonuclease is endonuclease-dependent

extends from the newly processed 5' end till the beginningof the coding region.

DiscussionAlong with the previous studies (Portier et al., 1981; Portierand Regnier, 1984; Regnier and Portier, 1986; Portier et al.,1987; Portier et al., 1990), the results presented show thatthe expression of polynucleotide phosphorylase is quitecomplex.Chromosomal pnp expression is strongly decreased when

the cellular concentration of polynucleotide phosphorylaseis greatly increased. No correlative decrease is observed inthe message synthesis rate, suggesting that polynucleotidephosphorylase synthesis is post-transcriptionally auto-regulated. In this work, all the messages of the fusion arecut completely by RNase III and thus always have the same5' end which should result in the same translationalefficiency. Then, the repressed level should be the same foreither fusion used, GF or PF, and depends only on theabsolute value of free polynucleotide phosphorylase presentin the cell at a defined growth rate.

Isolation of mutations located in the fusion can, of course,modify the level of the hybrid protein synthesized byaffecting the translational efficiency and/or the autocontrolmechanism. In the first case, the repression ratio should notbe modified. But any modification in the repression ratioshould correspond to a loss (partial or total) in the auto-control. This point is illustrated by the mutants isolated inthis work.

Obviously, the cleavages by RNase III at the 5' part ofthis message have important consequences at the post-transcriptional level: first, the two messages, synthesizedboth from P1 and P2 (Figure 4), become identical; second,the autocontrol can occur; third, the decay of the messageis greatly increased (Portier et al., 1987). If the maturationof the pnp messenger by RNase III is the first event in theinactivation of the message, the second event should be thebinding of polynucleotide phosphorylase to sequences withinits 5' region, as generally occurs in translationally auto-controlled gene expression. At first glance, it is unexpectedthat polynucleotide phosphorylase, a 3' to 5' non-specificexonuclease, might bind specifically to its own messengerand, particularly, at the 5' part of it. Changes at the 5' end,which would affect the accessibility of the 3' end topolynucleotide phosphorylase are unlikely because translationis coupled to transcription in E. coli. Moreover, thismodification of accessibility would have to be shared by boththe wild-type pnp and pnp-lacZ fusion messages, whichhave the same 5' ends but different 3' ends. The controlexperiments measuring 3-galactosidase half-lives and ,3-galactosidase level in lac+ strains in the presence ofpolynucleotide phosphorylase overproduction exclude thepossibility of regulation by an increase in the 3' to 5'messenger degradation rate. A limited increase of degrada-tion at the 3' end of the lacZ message would have beendetected since the loss of only 30 nucleotides induces atotal inactivation of [B-galactosidase (Mandecki et al., 1981).Thus, the 3' end of the lacZ message is not specificallydegraded by overproduction of polynucleotide phosphorylaseand another mechanism is involved.

If polynucleotide phosphorylase binds to the 5' region of

its message, does it recognize an RNA structure? A particularRNA sequence seems unlikely since no sequence specificityhas ever been described for this exonuclease. On the otherhand, this paper clearly shows that the autocontrol does notproceed until the message is processed by RNase III. Thus,specific features appear to be created in the pnp RNA afterRNase III cleavages that could be recognized by poly-nucleotide phosphorylase. This could imply that the new 5'end is recognized and bound by the enzyme, or that theRNase III cleavages induce a modification of the secondaryand tertiary structures of the processed messenger. However,the location of point mutations, in the vicinity of the initiationcodon, suggests that the operator site extends near theShine-Dalgarno sequence or that an RNA structuredecreasing the translational efficiency is created. A modelfor regulation could be that the binding of polynucleotidephosphorylase blocks translation initiation on the message,either by steric hindrance, or by inducing a long rangemodification in the secondary and tertiary structures of themessage. More information is necessary before drawing aprecise mechanism for polynucleotide phosphorylase auto-regulation.The results suggest that the creation of a monophosphate

5' end is not sufficient per se to trigger degradation of thepnp message. The binding of polynucleotide phosphorylaseis a second step necessary before message can decay.Whether binding confers an alternative secondary structurein the message that could be recognized by endonucleases,or whether degradation is strongly stimulated by the loweredtranslational efficiency, is not known. In either case,polynucleotide phosphorylase synthesis would be inhibitedbefore chemical degradation proceeds. The high level ofpolynucleotide phosphorylase observed in mc strains wouldthus correspond to a derepressed state and not necessarilyto a longer message half-life. This second phenomenonwould be a consequence of the continued translation on theunprocessed message. Contrary to classical translationalcontrol, the polynucleotide phosphorylase binding to mRNAwould not be dependent only on the free concentration ofenzyme and mRNA, but also upon the RNase Ill processingactivity. Thus, the level of polynucleotide phosphorylase issubjected to a double control, by RNase III and itself. Thisilluminates the major role of polynucleotide phosphorylasein RNA metabolism in prokaryotic cells.

In conclusion, the system studied here exhibits a novelcharacteristic when compared with other translationallycontrolled genes: the operator site is created, or activated,by message processing. Curiously, the repressor is a 3' to5' exonuclease which somehow inhibits translation initia-tion, allowing for message decay.

Materials and methodsStrains, plasmids and mediaRelevant characteristics of E.coli strains used in this work are indicatedin Table I. CP150 was constructed by P1 transduction of YA149 with aphage grown on JC3560 (Portier et al., 1981). The resulting pnp::TnStransductants were selected on LB plates containing kanamycin at aconcentration of 60 jig/ml.M 13mp8, M13mpl8 (Messing, 1983) and plasmids, pNM480 (Alacl,

AlacOP, lacZ, lacY, lacA, Minton, 1984), pBR322 (Bolivar et al., 1977),pBP 1 11 (rpsO, pnp, Portier et al., 1981) pBPA7 (rpsO), pBPA1O (pnp,Portier et al., 1990) have been previously described. The phages, X+, Xgt4

2639

M.Robert-Le Meur and C.Portier

(Davis et al., 1980) and XSKS107 (Graffe et al., 1991) were used to transferthe gene fusions onto the E. coli chromosome.The cultures were grown at 30 or 37°C in LB, 2 xYT or MOPS buffer

supplemented with all amino acids as previously described (Portier et al.,1990). Ampicillin was added to the growth medium for transformed strainsat a concentration of 100 Ag/ml except for plasmids, pBPA7 and pBPA 10,where the concentration was 50 fig/ml.Construction of two translational fusions between pnp andlacZThe plasmid pBPl 11, carrying the entire rpsO-pnp operon was cleavedby HpaI and plasmid pNM480 (encoding the lac operon without its promotor-operator region), by SmaI. After mixing and ligation, in-phase translationalfusions were selected on LB plates containing 100 jig/mI of ampicillin andscreened for blue colonies. One of these clones was isolated, purified,sequenced and named pGF (Figure 1). A second, shorter, pnp-lacZtranslational fusion was constructed by digesting pGF with PstI, isolatingthe fragment carrying pnp and subcloning it into pNM480 cleaved by PstI(Figure 1). A blue colony carrying this fusion was isolated, sequenced andcalled pPF.The pGF fusion was transferred into M 13mp8 by inserting a

EcoRI-HindIII fragment of pGF into the corresponding sites in the phagepolylinker and screening for white plaques. The resulting white phage wascalled M13GFB8. Reading frame was re-established by cutting and fillingin the BamHI site of the polylinker. A blue plaque was isolated, sequencedand designated M13GF8. An EcoRI-BamHI fragment from pGF was clonedinto M13mpl8 creating a direct in-frame fusion called M13GF18.Both translational fusions were introduced on X phages by cloning the

EcoRI-SstII fragment containing the gene fusion and remaining lacsequences from either plasmids, pGF or pPF, between the left arm of XV(SstII) and the right arm of Xgt4 (cl857, nin5) (EcoRI) giving XGFI andXPF1, respectively (Figure 2). The EcoRI-SstLI fragment of pGF and pPFcarries the fusion with all the remaining part of the lac operon. In otherexperiments, the EcoRI-HindIIl fragment from M13GF8 was insertedbetween the left arm of XSKS107 (imm2l, nin5, cleaved by HindIII) andthe right arm of Xgt4 (digested by EcoRI) giving XGF2 (Figure 2). XSKS 107carries the lacZ gene only, without its initiation site, but with a Hindillrestriction site located at the beginning of the lacZ coding sequence (Shapiraet al., 1983).

In every case, the reconstituted phages give clear blue plaques at 37°Con Xgal plates (cl857, lacZ+). The different strains were lysogenized withthese phages at a m.o.i of 0.1.

MutagenesisMutagenesis was performed on 25 Ag/ml of replicative form M13GF18DNA at 65°C for 10 h in 100 mM KH2PO4, 1 mM EDTA with 0.8 Mhydroxylamine and 360 mM NaOH at pH 6.5. The incubation was continueduntil the transformation efficiency dropped to - 7 x 106 as compared withthe control. The DNA was dialysed against 10 mM Tris pH 8.0, 1 mMEDTA, overnight and used for transfection on strain JMIOITR (Maniatiset al., 1982). Plaques exhibiting a deep blue phenotype were isolated andsequenced.

Site directed mutagenesis was performed by the Eckstein method(Nakamaye and Eckstein, 1985).

DeletionA deletion was created in a M 13GF8 mutated derivative by eliminating theDNA fragment between two restriction sites (see text and Figure 4).

RNA -DNA hybridizationmRNA was pulse labelled for 1 min with [3H]uridine (Amersham,30 Ci/mmol; 100 jCi/mn), extracted and hybridized as described previously(Portier et al., 1987). The mnRNA level was measured using single strandedDNA probes derived from M13 clones and fixed on nitrocellulose (Milliporefilter type HA45). The probes for lacZ (1956 nucleotides) and thrS (856nucleotides) have been described (Butler et al., 1986).

For decay rate experiments, 600 Ag/ml rifampicin, 30 jig/mi nalidixicacid and 800 jig/mI cold uridine were added just at the end of the labellingperiod (2 mmn) and total RNA was extracted at different times after additionand hybridized on filters with single stranded DNA probes as described(Portier et al., 1987). For YA149 and CP150, ,B-galactosidase synthesiswas fully induced in the cells before labelling by using a MOPS mediumsupplemented with all amino acids, uracil, 0.2% glycerol (instead of glucose),l0-3 M ITPG (isopropyl-(3-D-thiogalactoside) and, in strains carryingplasmids, with 100 aig/ml ampicillin.

,/-galactosidase activityMonolysogens were screened on lysogenized strains AB53 11, IPBC5321and IPBC493 as described previously (Portier et al., 1990). All the ,B-galactosidase levels were determined at 30°C on cultures in exponentialgrowth as described by Miller (1972) in the presence of MOPS buffer (Portieret al., 1987).

Sequence determinationsAll the constructions and the mutations were sequenced using the dideoxychain termination method (Sanger et al., 1977).

AcknowledgementsWe are grateful to L.Dondon for gift of the X phages used in this study,to M.Springer for gift of strains, M.Graffe for preparation of packagingcell extracts and to M.Grunberg-Manago for her interest in this work. Wealso thank C.Olsson for advice and careful reading of the manuscript. Thiswork was supported by grants from the Centre National de la RechercheScientifique (URA 1139), from the Institut National de la Sante et de laRecherche Mddicale (Contrat de Recherche Externe no. 891017), from theFondation pour la Recherche Medicale and from the Commission desCommunautes Europeennes (contrats C.E.E. no. CII-0790-M (DSCN) andSCI */0194-C(AM)).

ReferencesAltuvia,S., Kornitzer,D., Kobi,S. and Oppenheim,A.B. (1991) J. MoI. Biol.,

218, 723-733.Babitze,P. and Kushner,S. (1991) Proc. Natl. Acad. Sci. USA, 88, 1-5.Bolivar,F., Rodriguez,R.L., Green,P.J., Betlach,M.C., Heyneker,H.L.,

Boyer,H.W., Crosa,J.H. and Falkow,S. (1977) Gene, 2, 95-113.Butler,J.S., Springer,M., Dondon,J., Graffe,M. and Grunberg-Manago,M.

(1986) J. Mol. Biol., 192, 767-780.Cannistraro,V.J., Subbarao,M.N. and Kennell,D. (1986) J. Mol. Biol., 192,

257-274.Cho,K.-O. and Yanofsky,C. (1988) J. Mol. Biol., 204, 51-60.Cole,J.R. and Nomura,M. (1986) J. Mol. Biol., 188, 383-392.Davis,R.W., Botstein,D. and Roth,J.R. (1980) Advanced Bacterial Genetics.

Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.Draper,D.E. (1987) In Ilan,J. (ed.), Translational Regulation of Gene

Expression. Plenum Press, New York, pp. 1-26.Graffe,M., Dondon,J., Caillet,J., Romby,R., Ehresmann,C., Ehresmann,B.

and Springer,M. (1991) Science, 255, 994-996.Hall,M.N., Gabay,J., Debarbouille,M. and Schwartz,M. (1982) Nature,

295, 616-618.Mandecki,W., Fowler,A.V. and Zabin,I. (1981) J. Bacteriol., 147,694-697.

Maniatis,T., Fritsch,E.F. and Sambrook,J. (1982) Molecular Cloning: ALaboratory Manual. Cold Spring Harbor Laboratory Press, Cold SpringHarbor, NY, pp. 250-251.

McCarthy,J.E.G. and Bokelmann,C. (1988) Mol. Microbiol., 2, 455-465.Melefors,O. and von Gabain,A. (1988) Cell, 52, 893-901.Messing,J. (1983) Methods Enzymol., 101, 20-29.Miller,J.H. (ed.) (1972) Experiments in Molecular Genetics. Cold Spring

Harbor Laboratory Press, Cold Spring Harbor, NY.Minton,N.P. (1984) Gene, 31, 269-273.Moine,H., Romby,P., Springer,M., Grunberg-Manago,M., Ebel,J.-P.,

Ehresmann,B. and Ehresmann,C. (1990) J. Mol. Biol., 216, 299 -3 10.Mudd,E., Carpoussis,A.J. and Krisch,H.M. (1990) Genes Dev., 4,

873 -881.Nakamaye,K. and Eckstein,F. (1985) Nucleic Acids Res., 14, 9679 -9698.Newbury,S.F., Smith,N.H. and Higgins,C.F. (1987) Cell, 51, 1131-1143.Ono,M. and Kuwano,M. (1979) J. Mol. Biol., 129, 343-357.Pachter,J.S., Yen,T.J. and Cleveland,D.W. (1987) J. Mol. Biol., 51,

283 -292.Parkin,N.T., Cohen,E.A., Darveau,A., Rosen,C., Haseltine,W. and

Sonenberg,N. (1988) EMBO J., 7, 2831-2837.Petersen,S. and Reeh,S. (1978) Mol. Gen. Genet., 166, 329-336.Plumbridge,J.A., Dondon,J. and Nakamura,Y. (1985) Nucleic Acids Res.,

13, 3371 -3388.Portier,C. and Regnier,P. (1984) Nucleic Acids Res., 12, 6091-6102.Portier,C., Migot,C. and Grunberg-Manago,M. (1981) Mol. Gen. Genet.,

183, 306-313.

2640

Autogenous control of an exonuclease is n

Portier,C., Dondon.L., Grunberg-Manago,M. and Regnier,P. (1987)EMBO J., 6, 2165-2170.

Portier,C., Dondon,L. and Grunberg-Manago,M. (1990) J. Mol. Biol., 211,407-414.

Regnier,P. and Portier,C. (1986) J. Mol. Biol., 187, 23-32.Sanger,F., Nicklen,S. and Coulson,A.R. (1977) Proc. Natl. Acad. Sci. USA,

74, 5463-5467.Schmeissner,U., McKenney,K., Rosenberg,M. and Court,D. (1984) J. Mol.

Biol., 176, 39-53.Shapira,S.K., Chou,J., Richaud,F.V. and Casadaban,M.J. (1983) Gene,

25, 71-82.Singer,P. and Nomura,M. (1985) Mol. Gen. Genet., 199, 543-546.Tuerk,C., Eddy,S., Parma,D. and Gold,L. (1990) J. Mol. Biol., 213,

749-761.Winter,R.B., Morrissey,L., Gauss,P., Gold,L., Hsu,T. and Karamj. (1987)

Proc. Natl. Acad. Sci. USA, 84, 7822-7826.

Received on Dece,nber 16, 1991; revised on March 5, 1992

2641

endonuclease-dependent