E. Thomas Danielsen, Morten E. Moeller, Naoki Yamanaka, … · 2016. 6. 20. · Kondo, Christian H....
Transcript of E. Thomas Danielsen, Morten E. Moeller, Naoki Yamanaka, … · 2016. 6. 20. · Kondo, Christian H....
![Page 1: E. Thomas Danielsen, Morten E. Moeller, Naoki Yamanaka, … · 2016. 6. 20. · Kondo, Christian H. Nielsen, Eva B. Harvald, Nils J. Faergeman, Macy J. Haley, Kyle A. O'Connor, Kirst](https://reader036.fdocuments.in/reader036/viewer/2022081614/5fc475ca536eab1b222343ab/html5/thumbnails/1.jpg)
Developmental Cell, Volume 37
Supplemental Information
A Drosophila Genome-Wide Screen Identifies
Regulators of Steroid Hormone Production
and Developmental Timing
E. Thomas Danielsen, Morten E. Moeller, Naoki Yamanaka, Qiuxiang Ou, Janne M.Laursen, Caecilie Soenderholm, Ran Zhuo, Brian Phelps, Kevin Tang, Jie Zeng, ShuKondo, Christian H. Nielsen, Eva B. Harvald, Nils J. Faergeman, Macy J. Haley, Kyle A.O'Connor, Kirst King-Jones, Michael B. O'Connor, and Kim F. Rewitz
![Page 2: E. Thomas Danielsen, Morten E. Moeller, Naoki Yamanaka, … · 2016. 6. 20. · Kondo, Christian H. Nielsen, Eva B. Harvald, Nils J. Faergeman, Macy J. Haley, Kyle A. O'Connor, Kirst](https://reader036.fdocuments.in/reader036/viewer/2022081614/5fc475ca536eab1b222343ab/html5/thumbnails/2.jpg)
Supplemental Figures
Figure S1 (related to Figure 1). (A) Gene ontology (GO) analysis of the gene set showing the top enriched
functional categories. Genes were grouped into common functional categories based on GO terms from both
Drosophila genes and their human orthologs. (B) Venn diagrams showing overlap between enriched GO
terms of gene sets associated with different phenotypes. Numbers indicate total number of GO terms for each
gene set.
![Page 3: E. Thomas Danielsen, Morten E. Moeller, Naoki Yamanaka, … · 2016. 6. 20. · Kondo, Christian H. Nielsen, Eva B. Harvald, Nils J. Faergeman, Macy J. Haley, Kyle A. O'Connor, Kirst](https://reader036.fdocuments.in/reader036/viewer/2022081614/5fc475ca536eab1b222343ab/html5/thumbnails/3.jpg)
Figure S2 (related to Figure 2). (A) Phylogenetic tree showing relationship between the Drosophila Sit
protein and human very long chain fatty acid elongase (ELOVL) proteins. Neighbor-joining tree is based on
a ClustalW multiple alignment. Hsap; Homo sapiens. Dmel; Drosophila melanogaster. (B) sit mRNA levels
![Page 4: E. Thomas Danielsen, Morten E. Moeller, Naoki Yamanaka, … · 2016. 6. 20. · Kondo, Christian H. Nielsen, Eva B. Harvald, Nils J. Faergeman, Macy J. Haley, Kyle A. O'Connor, Kirst](https://reader036.fdocuments.in/reader036/viewer/2022081614/5fc475ca536eab1b222343ab/html5/thumbnails/4.jpg)
in various tissues from larvae (whole body, fat body, midgut and brain) and adults (ovary, testis, accessory
gland). (C) Effect of PG-specific sit knockdown on pupal size. (D) Schematic representation of the sit
genomic locus with the 1325 bp CRISPR/Cas9 induced deletion that removes the sit coding region
generating the sit1D
and sit2C
alleles. (E) Nucleotides deleted in the sit1D
and sit2C
mutants compared to wild
type. The 20 bp sgRNA sequences (green) and the protospacer adjacent motif (PAM: blue) are indicated. (F)
Survival of sit1D
and sit2C
mutants. (G) Quantification shows that animals with RNAi knockdown of sit and
Npc1a in PG and the sit loss-of-function mutant have significantly increased number of the lipid droplets in
PG cells. CARS microscopy images of PG (H) fat body and crop (I) of sit mutants. (J) Cholesterol ester
levels in L3 larvae with ubiquitous RNAi mediated silencing of Npc1a or sit. RNAi knockdown was
conditionally induced in L2 larvae 96 hours after egg lay (AEL) by shifting larvae from 18oC to 29
oC and
assayed two days later. wt; wild type. Detailed description of genotypes is given in Supplemental
Experimental Procedures. Error bars indicate SEM (***P<0.001).
![Page 5: E. Thomas Danielsen, Morten E. Moeller, Naoki Yamanaka, … · 2016. 6. 20. · Kondo, Christian H. Nielsen, Eva B. Harvald, Nils J. Faergeman, Macy J. Haley, Kyle A. O'Connor, Kirst](https://reader036.fdocuments.in/reader036/viewer/2022081614/5fc475ca536eab1b222343ab/html5/thumbnails/5.jpg)
Figure S3 (related to Figure 2). (A) A high cholesterol diet (+) rescues the L1 arrest phenotype otherwise
caused by Npc1a-RNAi in the PG. Five day old larvae. (B) Addition of 40 µg/ml cholesterol to the diet (+
![Page 6: E. Thomas Danielsen, Morten E. Moeller, Naoki Yamanaka, … · 2016. 6. 20. · Kondo, Christian H. Nielsen, Eva B. Harvald, Nils J. Faergeman, Macy J. Haley, Kyle A. O'Connor, Kirst](https://reader036.fdocuments.in/reader036/viewer/2022081614/5fc475ca536eab1b222343ab/html5/thumbnails/6.jpg)
cholesterol) rescues the pupariation delay caused by knock down of sit in the PG. (C) Ex vivo incubation of
ring glands with NBD-cholesterol. RNAi induced silencing of either sit or the ceramide synthase schlank in
the PG results in accumulation of NBD-cholesterol. (D) Quantification of lipid droplets in PG cells with
reduced expression of schlank compared to the control. (E) Analysis of ceramide (Cer) levels in L3 larvae
using LC-MS. RNAi was induced conditionally in L2 and ceramide levels were determined in L3 larvae 48
hours later. (F) Knockdown of sit or schlank in PG blocks trafficking and degradation of GFP-LAMP
causing an accumulation. Dotted white lines encircle the PG cells. (G) Rab7 (late endosome marker) vesicles
of PG cells from animals with reduced expression sit and schlank. (H) Quantification shows an increased
frequency of enlarged Rab7 vesicles in PG cells with reduced expression of sit or schlank. Detailed
description of genotypes is given in Supplemental Experimental Procedures. AEL; after egg lay. Error bars
indicate SEM (*P<0.05; **P<0.01; ***P<0.001).
![Page 7: E. Thomas Danielsen, Morten E. Moeller, Naoki Yamanaka, … · 2016. 6. 20. · Kondo, Christian H. Nielsen, Eva B. Harvald, Nils J. Faergeman, Macy J. Haley, Kyle A. O'Connor, Kirst](https://reader036.fdocuments.in/reader036/viewer/2022081614/5fc475ca536eab1b222343ab/html5/thumbnails/7.jpg)
Figure S4 (related to Figure 4 and Figure 6). (A) Quantification of lipid droplets in PG cells from CARS
images. Inhibition of TOR signaling by overexpression of TSC1/2 in the PG reduces number of lipid
droplets, while inhibition (Akt-RNAi) or stimulation (InR) of insulin signaling has no effect. (B) Blocking
ecdysone signaling in the PG cells by overexpression of EcRDN
or by knockdown of EcR (EcR-RNAi) results
in an increase of lipid droplets in PG cells. (C) Quantification of lipid droplets from CARS images.
Inhibition of TOR signaling by overexpression of TSC1/2 prevents accumulation of lipid droplets in Npc1a-
RNAi PG cells. Detailed description of genotypes is given in Supplemental Experimental Procedures. Error
bars indicate SEM (***P<0.001).
![Page 8: E. Thomas Danielsen, Morten E. Moeller, Naoki Yamanaka, … · 2016. 6. 20. · Kondo, Christian H. Nielsen, Eva B. Harvald, Nils J. Faergeman, Macy J. Haley, Kyle A. O'Connor, Kirst](https://reader036.fdocuments.in/reader036/viewer/2022081614/5fc475ca536eab1b222343ab/html5/thumbnails/8.jpg)
Supplemental Tables
Table S1. Primary screen results (related to Figure 1). All genes screened for effects of PG-specific
knockdown on developmental progression. Transgenic RNAi lines (see transformant ID) targeting 12,504
Drosophila genes were used to specifically knockdown genes in the PG using the phm-Gal4 driver.
Knockdown of 1,906 genes in the PG caused developmental arrest and delay phenotypes. NOP; no obvious
phenotype.
Table S2. Gene Ontology (GO) analysis (related to Figure 1). GO term enrichment analysis of gene hits
identified the primary screen. GO terms from both Drosophila genes and their human orthologs were
included.
![Page 9: E. Thomas Danielsen, Morten E. Moeller, Naoki Yamanaka, … · 2016. 6. 20. · Kondo, Christian H. Nielsen, Eva B. Harvald, Nils J. Faergeman, Macy J. Haley, Kyle A. O'Connor, Kirst](https://reader036.fdocuments.in/reader036/viewer/2022081614/5fc475ca536eab1b222343ab/html5/thumbnails/9.jpg)
Supplemental Experimental Procedures
Developmental timing assays, temperature shift experiments, starvation and cholesterol
treatment
For developmental timing analysis, larvae were synchronized by allowing flies to deposit eggs at 25˚C for 4
hours in a humid chamber on apple juice agar plates supplemented with yeast paste. Newly hatched L1
larvae were collected 24 hours later, transferred to standard food (25 larvae/vial). For rescue experiments
with dietary cholesterol, the food was supplemented with 40 μg/ml cholesterol dissolved in ethanol.
Conditional induction of RNAi or overexpression was done using the temperature dependent tub-Gal80ts.
Eggs were collected at 25˚C on apple juice agar plates supplemented with yeast for four hours and incubated
at 18˚C (permissive temperature). L1 larvae were collected 48 hours later and transferred into vials (25
larvae/vial) and reared at 18°C for two days before shifted to 29°C (restrictive temperature) for two
additional days. For starvation, synchronized larvae were raised on normal standard food at 25˚C and
transferred 92 hours AEL to either normal food or 0.8% agar (starvation condition). Larvae were reared
under these different conditions for 10 hours before collected for analyses.
GO term analysis
All genes were annotated with GO terms, and to increase the coverage of GO annotations on the genes in the
dataset, GO terms for the human orthologs of the Drosophila genes were added to the gene annotation (using
Ensembl 79 HomoSapiensGRCh38.p2). Obsolete GO terms were excluded from the analysis. GO terms were
assigned to functional categories based on results from QuickGo (https://www.ebi.ac.uk/QuickGO/) and then
manually curated. Regardless of the number and categorization of the GO terms of a gene, a single gene only
contributed at most once to any functional category. Significantly enriched GO terms in genes associated
with developmental defects were assessed with Fischer's exact test with Bonferroni correction for multiple
testing. Analyses were performed using Unix command line tools, Python v 2.7.2 and R v. 3.0.3.
Ecdysteroid measurements
Ecdysteroid levels were measured with a commercial ELISA kit (ACE Enzyme Immunoassay, Cayman
Chemicals) which detects ecdysone and 20-hydroxyecdysone (20E) with the similar affinity (Porcheron et
al., 1976). Briefly, ecdysteroids were extracted from whole animals at the designated time points by
homogenization in 0.5 ml methanol by a close fitting pestle, followed by centrifugation at 14,000 g and
![Page 10: E. Thomas Danielsen, Morten E. Moeller, Naoki Yamanaka, … · 2016. 6. 20. · Kondo, Christian H. Nielsen, Eva B. Harvald, Nils J. Faergeman, Macy J. Haley, Kyle A. O'Connor, Kirst](https://reader036.fdocuments.in/reader036/viewer/2022081614/5fc475ca536eab1b222343ab/html5/thumbnails/10.jpg)
collection of the supernatant. The remaining tissues were re-extracted using the same procedure; first with
0.5 ml methanol and then with 0.5 ml ethanol. The supernatants were pooled and 0.5 ml was evaporated
using a SpeedVac followed by re-suspension in ELISA buffer (1 M phosphate solution, 1% BSA, 4 M
sodium chloride and 10 mM EDTA). The ELISA was performed according to the manufacturer’s protocol,
with a standard curve of 20E (Sigma). Absorbance was measured at 405 nm on a plate reader, ELx80
(BioTek) using Gen5 software (BioTek).
Pupal size measurements
For analysis of pupal size, pupae were aligned on a cover slide and imaged using Zeiss AxioCam ICc 1
camera mounted on a Zeiss AxioZoom.V16 microscope. Images of a total of 30-40 pupae per genotype were
processed using homemade Matlab software that determines pupal size kindly provided by Pierre Leopold.
Phylogenetic tree
Phylogenetic relationships of Drosophila Sit and the human ELOVL family of proteins were performed by
generating a neighbor-joining tree based on multiple alignments of the entire amino acid sequences of
Drosophila Sit and human ELOVL proteins using ClustalW (Larkin et al., 2007).
Ex vivo NBD-cholesterol incubation assay
Analysis of fluorescent NBD-cholesterol uptake in tissues ex vivo was performed as described (Enya et al.,
2014). Brain-ring gland complexes (BRGC) from feeding third instar larvae were dissected in Schneider’s
Drosophila Medium (Gibco) containing 10% Fetal Bovine Serum (Gibco), 100 U/ml penicillin and 100
µg/ml streptomycin (Gibco). Exposure to light was avoided due to light-sensitivity of NBD-cholesterol
(Molecular Probes). Tissues were transferred to fresh medium containing 0.5% 10 µM NDB-cholesterol
(dissolved in 96% ethanol) and incubated at room temperature for six hours in dark and humid conditions
under gentle shaking. For co-localization of Atg8a vesicles and NBD-cholesterol, tissues were incubated
under these conditions for 8 hours. After the incubation, samples were washed twice with PBS followed by
fixation in 4% formaldehyde for 20 min at room temperature. The fixed tissues were washed three times with
PBS, mounted in PBS and immediately imaged using a Zeiss LSM 710 confocal microscope. Images were
processed and analyzed using ImageJ (NIH).
Analysis of cholesterol levels
![Page 11: E. Thomas Danielsen, Morten E. Moeller, Naoki Yamanaka, … · 2016. 6. 20. · Kondo, Christian H. Nielsen, Eva B. Harvald, Nils J. Faergeman, Macy J. Haley, Kyle A. O'Connor, Kirst](https://reader036.fdocuments.in/reader036/viewer/2022081614/5fc475ca536eab1b222343ab/html5/thumbnails/11.jpg)
Total lipids were extracted from whole larvae in a solution of 100 µl H2O, 125 µl chloroform and 250 µl
methanol and sonicated for 10 minutes at medium intensity using a Biorupter (Diagenode). Chloroform (125
µl) and 0.2 M KCL (125 µl) was added and samples were vortexed and centrifuged for 10 min at 2,000 rpm
at room temperature. The bottom phase was transferred to a new tube for further lipid analysis. The top
phase was re-extracted with 100 µl chloroform, vortexed, centrifuged and the bottom phase was transferred
and combined with the first bottom phase. The interphase was lyophilized and re-suspended in H2O and used
to determine protein levels using standard Bradford protein assay. The combined bottom phases were dried
under a stream of N2, re-suspended in chloroform/methanol (1:1) and examined by high performance thin
layer chromatography (HP-TLC) using cholesterol as standard. Band intensities were determined by
densiometry and normalized to amount of protein.
Extraction and quantification of ceramides in Drosophila larvae
Lipids were extracted from 5 larvae as previously described (Fong et al., 2009) except from the lower phase
was used for ceramide analyses. Prior to extraction ceramide-d18:1/17:0 was added as internal standard. The
lower phase was dried down under flow of nitrogen gas and resuspended in isopropanol/methanol/H2O
(5:1:4) with 5 mM NH4OAc and 0.1 % CH3COOH (mobile phase A). Ceramide species were quantified by
LC-MS. Extracted samples (5 μl) were injected on to an Agilent 1290-LC and separated on an Agilent
Zorbax Extended C18 rapid resolution column (2.1x150 mm, 1.8 μm) kept at 50 °C. Lipids were resolved
using a gradient starting from 100% mobile phase A at a flow rate of 0.350 ml/min for 3 min, to 20% mobile
phase B (isopropanol/H2O (99/1) with 5 mM NH4OAc and 0.1 % CH3COOH over 2 min at a linear gradient,
then to 30% over 20 min, then to 95% mobile phase B over 10 min, and then with 95% mobile phase B for 1
min. Ceramides were detected on an Agilent 6530 Accurate-Mass QTOF mass spectrometer equipped with a
Jetstream ESI ion source, which was operated in positive mode. Instrument parameters were set as follows:
sheath gas temperature, 350°C; sheath gas flow, 12 L/min; nebulizer, 35 psi; dry gas temperature, 300°C; dry
gas flow, 11 L/min; and capillary entrance voltage, 3500 V. Fragmentor and skimmer was operated at 125 V
and 65 V, respectively. The MS scan data were collected at a rate of 4 spectra/s in the range of m/z 100–
1500. The m/z of all ions in the mass spectra were corrected by two reference ions m/z 121.050873 and m/z
922.009798 (Agilent). Data were collected with MassHunter Data Acquisition ver. B.06.01 (Agilent), and
MassHunter Qualitative Analysis ver. B.07.00 (Agilent) was applied to identify lipid species. Peak areas of
the internal standard and ceramides were integrated from extracted ion chromatograms (EIC) by Profinder
B.06.00 (Agilent).
Immunostaining
![Page 12: E. Thomas Danielsen, Morten E. Moeller, Naoki Yamanaka, … · 2016. 6. 20. · Kondo, Christian H. Nielsen, Eva B. Harvald, Nils J. Faergeman, Macy J. Haley, Kyle A. O'Connor, Kirst](https://reader036.fdocuments.in/reader036/viewer/2022081614/5fc475ca536eab1b222343ab/html5/thumbnails/12.jpg)
Tissues were dissected in PBS followed by fixation in 4% formaldehyde for 25 minutes at room temperature.
After fixation, samples were washed with PBS containing 0.1% Triton X100 (PBT). Tissues were blocked
for 1 hour in PBT containing 5% normal goat serum (NGS) and incubated overnight at 4˚C with primary
antibodies diluted in PBT with 5% NGS. Tissues were then washed in PBT and incubated at room
temperature with secondary antibodies diluted in PBT with 5% NGS for 2 hours. The following primary
antibodies were used: guinea pig anti-LpR2 1:100 a generous gift from Joaquim Culi (Parra-Peralbo and
Culi, 2011), rabbit anti-Phm 1:200 (Parvy et al., 2005), rabbit anti-GFP 1:200 (MBL, #598), mouse anti-GFP
1:200 (Clontech, #632380). The following fluorescent conjugated secondary antibodies were used in this
study: goat anti-rabbit Alexa Fluor 555 (Invitrogen, #A21429), goat anti-mouse Alexa Fluor 488 (Invitrogen,
#A11001), goat anti-guinea pig Alexa Fluor 555 (Invitrogen, #A21435). Tissues were then washed and
mounted in ProLong Gold Antifade (Molecular Probes). Imaging was performed using a Zeiss LSM 710
confocal microscope. Images were further processed and analyzed using ImageJ (NIH) software.
Western blotting
For Western blot analysis, five whole larvae were rinsed in PBS and homogenized in 100 µl Laemeli Sample
Buffer (Bio-Rad) containing 2-mercaptoethanol. Tissue samples were boiled for five minutes and cleared for
debris by centrifugation at 14,000 g for three minutes. Proteins from the samples were resolved on a 4-20%
polyacrylamide gradient gel (Bio-Rad) and transferred onto a PVDF membrane (Millipore). Primary
antibodies used were: guinea pig anti-LpR2 1:1000, rabbit anti-GFP 1:1000, and mouse anti-tubulin 1:5000
(Sigma Aldrich, #T9026). Primary antibodies were detected using the IRDye 680RD and 800CW infrared
dye secondary antibodies 1:10,000 (LI-COR) and membranes were imaged on an Odessey Fc (LI-COR) and
quantified using the Image Studio software.
Quantitative RT-PCR
For gene expression analysis using quantitative RT-PCR (qPCR) five whole larvae or pooled tissues were
used for each replicate. Extraction of total RNA was performed using RNeasy mini kit (Qiagen) according to
the manufacturer’s instructions. The RNA was treated with DNase (Qiagen) and quantified using NanoDrop
(Thermo Scientific) before converted into cDNA using iScript Reverse Transcription Supermix (Bio-Rad).
Relative gene expression was measured with Quantitect SYBR Green PCR Kit (Qiagen) using Mx3005P
qPCR System (Agilent Technologies). Melting curves for each primer pair were validated to ensure
amplification of a single PCR product. Primers used for qPCR were designed using the Primer3
(Untergasser et al., 2012) and are listed below. Gene expression was normalized to the reference genes,
Rpl23 and Rpl32, as previous described (Danielsen et al., 2014).
![Page 13: E. Thomas Danielsen, Morten E. Moeller, Naoki Yamanaka, … · 2016. 6. 20. · Kondo, Christian H. Nielsen, Eva B. Harvald, Nils J. Faergeman, Macy J. Haley, Kyle A. O'Connor, Kirst](https://reader036.fdocuments.in/reader036/viewer/2022081614/5fc475ca536eab1b222343ab/html5/thumbnails/13.jpg)
List of oligonucleotides used for qPCR
Target gene Forward primer 5’-3’ Reverse primer 5’-3’
sit (CG5278) GTCAACGCAACACAGGTGGA ACGAAGAAGAGATAGAAGGCCAG
Npc1a TTGCAACCAAGCAGTTAGCA CAATTTTGAAGGGCTCTGGA
LpR1 TGGCGGTAAGGATGGTACAC GACCGACTGGGACAAACAG
LpR2 GAAATAGCCTTGCATGTGATTGC GTGGTAGACGGGATTCTCGAA
Rpl23 GACAACACCGGAGCCAAGAACC GTTTGCGCTGCCGAATAACCAC
Rpl32 TAAGCTGTCGCACAAATGGCG AACGCGGTTCTGCATGAGCA
Genotypes
Figure Name Genotype
Figure 1
B Control
UAS-RNAi lines
w; +; phm-Gal4/ +
w; UAS-RNAi lines/+; phm-Gal4/+
Figure 2
B w1118
C-E
Control
sit-RNAi
w; +; phm-Gal4/ +
w; UAS-sit-RNAi/+; phm-Gal4/ +
F
Control
sit-RNAi
sit1D/2C
Npc1a-RNAi
schlank-RNAi
w; +; phm-Gal4, UAS-GFP/ +
w; UAS-sit-RNAi/+; phm-Gal4, UAS-GFP/ +
+; +; Sit1D
/ Sit2C
w; tub-Gal80ts/ UAS-Npc1a-RNAi
KK; phm-Gal4, UAS-GFP/ +
w; UAS-Schlank-RNAi/+; phm-Gal4, UAS-GFP/ +
G w; UAS-sit-RNAi/+; phm-Gal4/ +
H
Control
Npc1a-RNAi
sit-RNAi
w; Act-Gal4/ +; tub-Gal80ts/ +
w; Act-Gal4/ UAS-Npc1aKK
-RNAi; tub-Gal80ts/ +
w; Act-Gal4/ UAS-sit-RNAi; tub-Gal80ts/ +
I
Control
Npc1a-RNA
sit-HA
w; +; phm-Gal4/ +
w; +; phm-Gal4/ UAS-Npc1aGD
-RNAi
w; UAS-sit-HA/+; phm-Gal4/ UAS-Npc1aGD
-RNAi
Figure 3
![Page 14: E. Thomas Danielsen, Morten E. Moeller, Naoki Yamanaka, … · 2016. 6. 20. · Kondo, Christian H. Nielsen, Eva B. Harvald, Nils J. Faergeman, Macy J. Haley, Kyle A. O'Connor, Kirst](https://reader036.fdocuments.in/reader036/viewer/2022081614/5fc475ca536eab1b222343ab/html5/thumbnails/14.jpg)
A w1118
B
Control
InR
Rheb
w; +; phm-Gal4, UAS-GFP/ +
w; +; phm-Gal4, UAS-GFP/ UAS-InR29.4
w; +; phm-Gal4, UAS-GFP/ UAS-Rheb
C
Control
Rheb
EcRDN
w; +; phm-Gal4, Sit-venus/ +
w; +; phm-Gal4, Sit-venus/ UAS-Rheb
w; UAS-EcRDN
/ +; phm-Gal4, sit-venus/ +
D
Control
EcRDN
w; +; phm-Gal4, UAS-GFP/ +
w; UAS-EcRDN
/ +; phm-Gal4, UAS-GFP/ +
E
Control
Rheb
EcRDN
w; +; phm-Gal4, UAS-GFP/ +
w; +; phm-Gal4, UAS-GFP/ UAS-Rheb
w; UAS-EcRDN
/ +; phm-Gal4, UAS-GFP/ +
Figure 4
A
Control
Akt-RNAi
InR
TSC1/2
EcRDN
EcR-RNAi
w; tub-Gal80ts/ +; phm-Gal4, UAS-GFP/ +
w; tub-Gal80ts/UAS-Akt1-RNAi; phm-Gal4, UAS-GFP/ +
w; tub-Gal80ts/ +; phm-Gal4, UAS-GFP/ UAS-InR
29.4
w; tub-Gal80ts/ +; phm-Gal4, UAS-GFP/ UAS-TSC-1, UAS-TSC-2
w; UAS-EcRDN
/ +; phm-Gal4, UAS-GFP/ +
w; UAS-EcR-RNAi/ +; phm-Gal4, UAS-GFP/ +
B-D
Control
EcRDN
w; +; phm-Gal4/ +
w; UAS-EcRDN
/ +; phm-Gal4/ +
E and F Control
Rheb
w; UAS-mCherry-Atg8a/ +; phm-Gal4/ +
w; UAS-mCherry-Atg8a/ +; phm-Gal4/ UAS-Rheb
Figure 5
A and
B
Control
Atg1-RNAi
Atg7-RNAi
Atg8a-RNAi
Atg8aKG07569
w; +; phm-Gal4, UAS-GFP/ +
w; UAS-Atg1-RNAi/ +; phm-Gal4, UAS-GFP/ +
w; UAS-Atg7-RNAi/ +; phm-Gal4, UAS-GFP/ +
w; UAS-Atg8a-RNAi/ +; phm-Gal4, UAS-GFP/ +
Atg8aKG07569
(X chromosome); +; +; +
C w; UAS-mCherry-Atg8a/ +; phm-Gal4/ +
D w1118
E w; +; Sit-venus
![Page 15: E. Thomas Danielsen, Morten E. Moeller, Naoki Yamanaka, … · 2016. 6. 20. · Kondo, Christian H. Nielsen, Eva B. Harvald, Nils J. Faergeman, Macy J. Haley, Kyle A. O'Connor, Kirst](https://reader036.fdocuments.in/reader036/viewer/2022081614/5fc475ca536eab1b222343ab/html5/thumbnails/15.jpg)
Figure 6
A
Control
Npc1a-RNAi
TSC1/2
Npc1a-RNAi;
TSC1/2
w; +; P0206-Gal4, UAS-mCD8::GFP/ +
w; +; P0206-Gal4, UAS-mCD8::GFP/ UAS-Npc1aGD
-RNAi
w; +; P0206-Gal4, UAS-mCD8::GFP/ UAS-TSC-1, UAS-TSC-2
w; +; P0206-Gal4, UAS-mCD8::GFP/ UAS-Npc1aGD
-RNAi, UAS-TSC-1,
UAS-TSC-2
B and C
Control
Npc1a-RNAi
Atg1/13; Npc1a-
RNAi
w; +; P0206-Gal4, UAS-mCD8::GFP/ +
w; +; P0206-Gal4, UAS-mCD8::GFP/ UAS-Npc1aGD
-RNAi
w; UAS-Atg1, UAS-Atg13/+; P0206-Gal4, UAS-mCD8::GFP/ UAS-
Npc1aGD
-RNAi
Figure S2
B w1118
C
Control
sit-RNAi
w; +; phm-Gal4/ +
w; UAS-sit-RNAi/+; phm-Gal4/ +
F
sit1D
sit2c
sit1D/2c
+; +; sit1D
/sit1D
+; +; sit2C
/sit2C
+; +; sit1D
/sit2C
G
Control (left panel)
sit-RNAi
sit-/sit
-
Control (right
panel)
Npc1a-RNAi
w; +; phm-Gal4, UAS-GFP/ +
w; UAS-sit-RNAi/+; phm-Gal4, UAS-GFP/ +
+; +; sit-/sit
-
w; tub-Gal80ts/ +; phm-Gal4, UAS-GFP/ +
w; tub-Gal80ts/ UAS-Npc1a-RNAi
KK; phm-Gal4, UAS-GFP/ +
H
Control
sit1D
sit2C
y2 cho
2 v
1; +; +
+; +; sit1D
/sit1D
+; +; sit2C
/sit2C
I
Control
sit1D/2c
y2 cho
2 v
1; +; +
+; +; sit1D
/sit2C
J
Control
Npc1a-RNAi
sit-RNAi
w; Act-Gal4/ +; tub-Gal80ts/ +
w; Act-Gal4/ UAS-Npc1aKK
-RNAi; tub-Gal80ts/ +
w; Act-Gal4/ UAS-sit-RNAi; tub-Gal80ts/ +
Figure S3
![Page 16: E. Thomas Danielsen, Morten E. Moeller, Naoki Yamanaka, … · 2016. 6. 20. · Kondo, Christian H. Nielsen, Eva B. Harvald, Nils J. Faergeman, Macy J. Haley, Kyle A. O'Connor, Kirst](https://reader036.fdocuments.in/reader036/viewer/2022081614/5fc475ca536eab1b222343ab/html5/thumbnails/16.jpg)
A
Control
Npc1a-RNAi
w; +; phm-Gal4/ +
w; UAS-Npc1aKK
-RNAi/+; phm-Gal4/ +
B
Control
sit-RNAi
w; +; phm-Gal4/ +
w; UAS-sit-RNAi/+; phm-Gal4/ +
C
Control
sit-RNAi
schlank-RNAi
w; +; phm-Gal4/ +
w; UAS-sit-RNAi/+; phm-Gal4/ +
w; UAS-schlank-RNAi/+; phm-Gal4/ +
D
Control
schlank-RNAi
w; +; phm-Gal4, UAS-GFP/ +
w; UAS-schlank-RNAi/+; phm-Gal4, UAS-GFP/ +
E
Control
sit-RNAi
w; Act-Gal4/ +; tub-Gal80ts/ +
w; Act-Gal4/ UAS-sit-RNAi; tub-Gal80ts/ +
F
Control
sit-RNAi
schlank-RNAi
w; αtub-GFP-LAMP/ +; phm-Gal4/ +
w; UAS-sit-RNAi/ αtub-GFP-LAMP; phm-Gal4/ +
w; UAS-schlank-RNAi/ αtub-GFP-LAMP; phm-Gal4/ +
G and
H
Control
sit-RNAi
schlank-RNAi
w; UAS-Rab7-GFP/ +; phm-Gal4/ +
w; UAS-sit-RNAi/ UAS-Rab7-GFP; phm-Gal4/ +
w; UAS-schlank-RNAi/ UAS-Rab7-GFP; phm-Gal4/ +
Figure S4
A
Control
Akt-RNAi
InR
TSC1/2
w; tub-Gal80ts/ +; phm-Gal4, UAS-GFP/ +
w; tub-Gal80ts/UAS-Akt1-RNAi; phm-Gal4, UAS-GFP/ +
w; tub-Gal80ts/ +; phm-Gal4, UAS-GFP/ UAS-InR
29.4
w; tub-Gal80ts/ +; phm-Gal4, UAS-GFP/ UAS-TSC-1, UAS-TSC-2
B
Control
EcRDN
EcR-RNAi
w; +; phm-Gal4, UAS-GFP/ +
w; UAS-EcRDN
/ +; phm-Gal4, UAS-GFP/ +
w; UAS-EcR-RNAi/ +; phm-Gal4, UAS-GFP/ +
C
Control
Npc1a-RNAi
TSC1/2
Npc1a-RNAi;
TSC1/2
w; +; P0206-Gal4, UAS-mCD8::GFP/ +
w; +; P0206-Gal4, UAS-mCD8::GFP/ UAS-Npc1aGD
-RNAi
w; +; P0206-Gal4, UAS-mCD8::GFP/ UAS-TSC-1, UAS-TSC-2
w; +; P0206-Gal4, UAS-mCD8::GFP/ UAS-Npc1aGD
-RNAi, UAS-TSC-1,
UAS-TSC-2
![Page 17: E. Thomas Danielsen, Morten E. Moeller, Naoki Yamanaka, … · 2016. 6. 20. · Kondo, Christian H. Nielsen, Eva B. Harvald, Nils J. Faergeman, Macy J. Haley, Kyle A. O'Connor, Kirst](https://reader036.fdocuments.in/reader036/viewer/2022081614/5fc475ca536eab1b222343ab/html5/thumbnails/17.jpg)
Supplemental References
Danielsen, E.T., Moeller, M.E., Dorry, E., Komura-Kawa, T., Fujimoto, Y., Troelsen, J.T., Herder, R., O'Connor,
M.B., Niwa, R., and Rewitz, K.F. (2014). Transcriptional Control of Steroid Biosynthesis Genes in the
Drosophila Prothoracic Gland by Ventral Veins Lacking and Knirps. PLoS Genet 10, e1004343.
Enya, S., Ameku, T., Igarashi, F., Iga, M., Kataoka, H., Shinoda, T., and Niwa, R. (2014). A Halloween gene
noppera-bo encodes a glutathione S-transferase essential for ecdysteroid biosynthesis via regulating the
behaviour of cholesterol in Drosophila. Sci Rep 4, 6586.
Fong, B., Norris, C., Lowe, E., and McJarrow, P. (2009). Liquid chromatography-high-resolution mass
spectrometry for quantitative analysis of gangliosides. Lipids 44, 867-874.
Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F.,
Wallace, I.M., Wilm, A., Lopez, R., et al. (2007). Clustal W and Clustal X version 2.0. Bioinformatics 23, 2947-
2948.
Parra-Peralbo, E., and Culi, J. (2011). Drosophila lipophorin receptors mediate the uptake of neutral lipids in
oocytes and imaginal disc cells by an endocytosis-independent mechanism. PLoS Genet 7, e1001297.
Parvy, J.P., Blais, C., Bernard, F., Warren, J.T., Petryk, A., Gilbert, L.I., O'Connor, M.B., and Dauphin-
Villemant, C. (2005). A role for betaFTZ-F1 in regulating ecdysteroid titers during post-embryonic
development in Drosophila melanogaster. Dev Biol 282, 84-94.
Porcheron, P., Foucrier, J., Gros, C., Pradelles, P., Cassier, P., and Dray, F. (1976). Radioimmunoassay of
arthropod moulting hormone:beta-ecdysone antibodies production and 125 I-iodinated tracer preparation.
FEBS Lett 61, 159-162.
Untergasser, A., Cutcutache, I., Koressaar, T., Ye, J., Faircloth, B.C., Remm, M., and Rozen, S.G. (2012).
Primer3--new capabilities and interfaces. Nucleic Acids Res 40, e115.