Plant Science 165 (2003) 11931199

Duplicated coding sequence in the waxy allele of tropicalglutinous rice (Oryza sativa L.)

Samart Wanchana a, Theerayut Toojinda a, Somvong Tragoonrung b, Apichart Vanavichit a,a Rice Gene Discovery, National Center for Genetic Engineering and Biotechnology, Kasetsart University, Kamphangsaen Campus,

Nakorn Pathom 73140, Thailandb DNA Technology Laboratory, National Center for Genetic Engineering and Biotechnology, Kasetsart University, Kamphangsaen Campus,

Nakorn Pathom 73140, Thailand

Received 21 June 2003; received in revised form 21 June 2003; accepted 12 July 2003

Abstract

Rice starch consists of amylopectin and amylose, the latter component being controlled by the Waxy (Wx) gene. Two alleles Wxa and Wxbwere found to regulate the quantitative level of the Wx protein as well as the amylose content. A comparison of the genomic sequences ofrice Wx genes responsible for the synthesis of grain amylose was made between two pairs of glutinous and non-glutinous reverse mutants.By comparing their 5 splice codons in the first intron, the low-amylose and glutinous rices were characterized as the Wxb allele based on theG-to-T base substitution, which caused an aberrant splicing. When the entire genomic sequences of Wxb were compared, a unique duplicationof 23 bp was found to be present only in the glutinous mutants. This 23 bp insertion was truly unique for tropical glutinous rice because of itssimilarity between the 800 bp sequences around the duplicated sequences of 24 glutinous varieties and two annual diploid wild rice accessions.This in-frame duplication created a premature translation stop codon at 78 bp downstream. The insertion was unique and none of the structurewas identical to any transposon or retrotransposon ever reported in rice before. This unique duplicated sequence opens up opportunities todevelop PCR-based markers useful for classifying grain amylose in rice. 2003 Elsevier Ireland Ltd. All rights reserved.

Keywords: Waxy; Glutinous rice; Oryza sativa; Splice site; Duplicated sequence; (CT)n repeat; PCR-based markers

1. Introduction

The amylose content in endosperm starch is a major de-terminant of processing, cooking and consumption of ricegrains. Rice varieties may be classified as glutinous (orwaxy), low, intermediate and high with 02, 25% of apparent amylose, respectively [1]. The riceWaxy gene (Wx) encodes a granule-bound starch synthase(GBSS) necessary for the synthesis of endosperm amylose.Although the inheritance of amylose content is rather com-plicated, the GBSS alleles, Wx protein, and Wx gene ex-pression were found to be highly correlated and associatedwith the variation of amylose content [2]. Genetic studieshave showed that the Wx gene consists of 13 exons with a1.1 kb untranslated leader intron [24]. The amylose con-tent of rice endosperm is regulated post-transcriptionally. It

Corresponding author. Tel.: +66-34-355192; fax: +66-34-355196.E-mail address: apichart@dna.kps.ku.ac.th (A. Vanavichit).

was found that sequence variation in the 5 splice site of theleader intron affected the amylose content among the ricevarieties [2]. Two alleles Wxa and Wxb were found to reg-ulate the quantitative level of the gene product as well asthe amylose content. The Wxa allele contains an efficientintron 1 splice site (AGG

TATA) for normal gene expres-sion and plants expressing this allele contain intermediate tohigh grain amylose content [2]. The Wxb allele commonlycarries a single nucleotide variation at the first intron splicesite (AG(G/T

)TATA). The G-to-T base substitution reducesthe efficiency of the first intron splicing, and subsequentlydepresses GBSS expression [2,57]. Recently, it has beenlearned that the amylose content is influenced by the tem-perature and that the splicing aberrant of the Wxb allele isaffected by extreme temperatures. Therefore, the amylosecontent can be enhanced at low temperatures but depressedat high temperatures [8,9].

The waxy rice was first reported as a loss-of-functionmutation in the gene Wxa encoding GBSS which caused

0168-9452/$ see front matter 2003 Elsevier Ireland Ltd. All rights reserved.doi:10.1016/S0168-9452(03)00326-1

1194 S. Wanchana et al. / Plant Science 165 (2003) 11931199

a low-amylose content [2]. Molecular characteriza-tion of wx mutations, by uses of EMS-induction andgamma-ray-induction, revealed base substitutions in severalexons and introns, and base deletion in intron 4. In addi-tion, a spontaneous wx mutation, in the japonica traditionalcultivar Kinoshita-mochi, showed that exon 2 had a 23 bpduplication in the coding sequence [10].

In Indochina, particularly in Thailand and Laos, glutinousrice is popularly grown for in-house consumption. In addi-tion to direct consumption, its unique starch quality makesit to be in high demand by modified food manufacturersfor the production of such things as rice crackers. Gluti-nous rice is not only interesting for its origin but also for itsadaptability to lowland rainfed fields, where growing con-ditions are harsh and diverse. In Thailand, 70% of the ricegrown is on lowland rainfed fields. Here, glutinous rice pro-duction is constrained by salinity, low soil fertility, droughtand submergence. Most of the glutinous rice varieties arephotoperiod sensitive landraces. Being photoperiod sensi-tive landraces, most of these glutinous rice varieties haveto be improved genetically emphasizing in a specific starchquality.

There have been a few studies conducted on the regu-lation of starch quality of glutinous rice. The objective ofthese studies is to identify a correlation between the amylosecontent and a coding sequence in the waxy allele in tropicalglutinous rice. In addition, a hypothesis of the phenomenonthat halted the translation and accumulation of grain amy-lose in all tropical glutinous rice was proposed. An efficientPCR-based marker was also developed to diagnose the gluti-nous from normal starchy rice and this in turn will benefitrice breeding programs.

2. Materials and methods

2.1. Plant materials

To determine the extent of changes in the amylose con-tent, two strains of low-amylose (KDML105 and Jao HomNin) and glutinous lowland rice (RD6 and Neaw Hom Nin)were utilized as reference varieties for sequence compari-son of their Wx genes. The KDML105, RD6, Oryza rufi-pogon and Oryza nivara, the two accessions of annual wildrice which are believed to be the ancestors of cultivated in-dica rice [11], and additional tropical glutinous rice varietieswere supplied either by the Rice Research Institute (RRI)in Thailand, or collected from farmers fields. The majorityof the glutinous and landrace rice is popularly grown in thenorth and northeast of Thailand. The names and accessionnumbers of rice varieties were listed in Table 1.

2.2. Genomic DNA isolation

All the rice plants were grown in a greenhouse. Laterleaves of 3-week-old plants were collected for isolation

Table 1List of rice varieties and accession numbers used in the experiment

Accessionnumber

Cultivar (CT)n Leader intron 5splice site

5149 Hom Thong 18 AGTTATA6738 Hom Udom Thai 18 AGTTATA5725 Fa mui 17 AGTTATA9380 Dam Tab Moo 17 AGTTATA6684 Hom Lao 18 AGTTATA6730 Hom Lai 18 AGTTATA7498 Prae Hom 17 AGTTATA

10125 Hom Udom 17 AGTTATA6735 Hom Intok 17 AGTTATA

10665 Hom Tung Dao 18 AGTTATA9043 Hom Huan 18 AGTTATA6626 Glam Hom 17 AGTTATA9041 Hom Dao 18 AGTTATA6728 Hom Daeng Noi 17 AGTTATA3101 Do Mana 18 AGTTATA6726 Kam Pun 18 AGTTATA3370 Nang Nuan 17 AGTTATA4045 Hom Prateep 18 AGTTATA

RD6 17 AGTTATARD8 18 AGTTATARD10 17 AGTTATASan Pa Tong 17 AGTTATADoi Saket (aromatic) 17 AGTTATADoi Saket (non-aromatic) 17 AGTTATALai Hen 17 AGTTATAKao Dok Mali 105 17 AGTTATAJao Hom Nin 18 AGTTATANeaw Hom Nin 17 AGTTATA

18223 O. nivara16226 O. rufipogonThe (CT) repeating units and 5 splice site of the leader intron are alsopresented.

of genomic DNA using a CTAB extraction procedure[12].

2.3. Sequencing strategy

The full 7.5 kb fragment of a rice Wx gene was retrievedby BLAST search using the NCBIs non-redundant database(http://ncbi.nlm.nih.gov/blast). The overlapping PCR strat-egy was applied in order to sequence the whole gene. Six-teen primer pairs were designed using Primer3 program togenerate sixteen 800 bp overlapping templates optimum fordirect PCR sequencing (http://www.genome.wi.mit.edu/cgi-bin/primer/primer3 www.cgi). The Wx gene structurewith PCR primer positions is shown in Fig. 1. ThePCR templates were sequenced from both directionsby ABI 377 XL using Big-dye terminator chemistry(ABI). After sequencing, the sequences of each frag-ment were assembled using Phred/Phrap/Consed programs(http://www.phrap.org/). The assembled sequences werecompared using the multiple-sequence-alignment program,ClustalW (http://clustalw.genome.ad.jp/). The differencebetween non-glutinous and glutinous reference varietiesin each of the specific region were further confirmed by

S. Wanchana et al. / Plant Science 165 (2003) 11931199 1195

1F 2F 3F 5F4F AF BF CF DF FF GF HF JFIFEF4nF

1R 2R 3R 5R4R AR BR CR DR FR GR HR JRIRER4nR

1 kb

ATG TGAAATAAA

(A)

(B)

Exon 1 2 3 4 5 6 7 8 9 10 11 12 13

Fig. 1. (A) Primer positions and directions (triangles) of the rice Wx gene. The template sequence was retrieved by BLAST searching using the NCBIsnon-redundant database. Sixteen primer pairs were designed to generate overlapping templates of approximately 800 bp for direct PCR sequencing. (B)Bars indicate the expected amplified DNA fragments. The position of all exons, the start codon (ATG), stop codon (TGA) and poly (A) signal are alsomarked where appropriate.

sequencing 24 cultivated glutinous varieties using the sameprimer sets and sequencing chemistry.

2.4. Development of Wx allele-specific markers

The newly developed primer pair referred as Glu-23F(5-TGCAGAGATCTTCCACAGCA-3) and Glu-23R(5-GCTGGTCGTCACGCTGAG-3), were used to gener-ate amplicons specific for glutinous/non-glutinous alleles.The basic procedure of the PCR analysis was as follows:20l reaction mixture containing 20 ng of genomic DNAas the template, 0.2 mM of dNTPs, 0.2M of each primer,0.5 U of Taq DNA polymerase, 50 mM KCl, 2.0 mM MgCl2,and 10 mM TrisHCl (pH 8.3), and deionized H2O wereadded to make 20l final volume. The amplification re-actions were carried out by the following profile: 94 Cpre-denaturation for 2 min following by 35 cycles of (94 Cdenaturation for 30 s, 60 C annealing for 30 s and 72 Cextension for 1 min) and the final extension at 72 C for5 min. The amplification products including 196 and 173 bpfor glutinous and non-glutinous, were then resolved in 4.5%polyacrylamide gel electrophoresis.

2.5. Determination of apparent amylose content

The apparent amylose content was determined accordingto the Juliano method [1]. One hundred milligrams of ricepowder was homogenized with 1 ml of 95% ethanol and9 ml of 1N NaOH. The sample was heated for 10 min in aboiling water bath to gelatinize the starch. Subsequently, itwas cooled and transferred into a 100 ml volumetric flaskand filled to full volume with water. Two milliliters of io-dine solution (0.2% I2, 2% KI) was added to 5 ml of thestarch solution. The solution was made up to 100 ml withwater, shaken, and let it stand for 20 min. By using a spec-trophotometer, the solution absorbance at 620 nm (A620) was

measured. The amylose content was determined based on astandard curve or conversion factor.

3. Results and discussion

3.1. Variation in (CT)n repeats

The complete sequence of the entire 7.5 kb Wx gene ofthe two non-glutinous and the two glutinous reversed mu-tants revealed several characteristics of the Wx gene. Thesecharacteristics are the short 137 bp exon 1 and the long1.13 kb intron 1 (Fig. 2a). The variation in dinucleotide re-peats (CT)n in the truncated exon 1, was identified. Thealignment showed that Jao Hom Nin and RD6 shared the(CT)18 repeat while Neaw Hom Nin and KDML105 con-tained the (CT)17 repeat (Fig. 2b). However, both (CT)17and (CT)18 repeats were present in the short exon 1 amongthe 24 tropical glutinous landraces (Table 1). To date, eight(CT)n repeat variants in the first exon of Wx gene have beenused to classify US rice cultivars differing in cooking quality[13]. However, the results from the (CT)n repeat variation inglutinous varieties showed insignificant difference betweenthe glutinous and the low-amylose groups. Therefore, thesimple sequence repeat is not a reliable marker for amylosecontent in rice, especially in the low-amylose group.

3.2. All glutinous rice strains carry Wxb allele

The first intron 5 splice acceptor motif AGT

TATA,which exists at 53 bp downstream from the (CT)n repeats,was found in both pairs of glutinous and non-glutinousalleles (Fig. 2b). This aberrant splice codon, representingthe G-to-T base substitution, is one of the characteris-tics of the Wxb allele commonly found among japonicaand low-amylose indica rice strains [2]. Furthermore, 24

1196 S. Wanchana et al. / Plant Science 165 (2003) 11931199

Fig. 2. (a) Comparison of nucleotide sequences of Wx from the 5 regulatory region to exon 2 among four rice varieties differing in amylose content.KDML105 and Jao Hom Nin are non-glutinous rice, RD6 and Neaw Hom Nin are glutinous rice. TATA box (CT)n repeats, 5 splice site, start codonand 23 bp duplicated sequence are enclosed in boxes. Exons are shown in underlined capital letters, and the intron sequences are shown as lower-caseletters. Similar nucleotides are shown in dots. (b) Variation of the number of (CT)n repeat located in the 55 bp upstream of first consensus splice site,AGTTATA, were presented. Both Jao Hom Nin and RD6 have (CT)18 but KDML105 and Neaw Hom Nin have (CT)17. The 5 splice site of the firstintron is also enclosed in a box. (c) The duplication of 23 bp sequence, ACGGGTTCCAGGGCCTCAAGCCC, present in glutinous rice, RD6 and NeawHom Nin, is compared to the corresponding sequence in non-glutinous varieties, KDML105 and Jao Hom Nin.

tropical glutinous landraces were investigated for sequencevariation. The results revealed that none of them showedsequence variation in the 100 bp encompassing the firstintron of Wxb allele (Table 1). Several reports showed thatpartial aberrant splicing of the first intron resulted in thereduction of the Wx gene expression in low-amylose strainscarrying G-to-T mutation in splice codon [2,57]. This

study showed that both glutinous and low-amylose contentvarieties carried not only the identical G-to-T mutation atthe first intron 5 splice site, but also all splice sites (datanot shown). According to these results, it is possible thatboth glutinous and low-amylose strains accumulated a smallamount of fully spliced mRNA. This idea was consistentwith another study by Isshiki et al. which showed that two

S. Wanchana et al. / Plant Science 165 (2003) 11931199 1197

rice wx mutations in the japonica background containedapproximately 20% of the fully spliced wx mRNA relativeto the wild type [14]. Although G-to-T mutation could beused to explain the amylose content variation among high-and low-amylose groups (data not shown), this explanationwas not relevant to the low-amylose and glutinous rice sincetheir amylose contents varied from 0 to 16%. In this study,the amylose contents of RD6, Neaw Hom Nin, Jao HomNin and KDML105 were 0, 0, 13 and 16%, respectively.

3.3. Unusual duplication in a coding region ofWx gene in glutinous rice

The result of the sequence alignment between low-amyloseand glutinous rice revealed the most interesting region lo-cated 108 bp downstream from the translation start site inthe exon 2 (Fig. 2a and c). From position 108131, the 23 bpsequence motif, ACGGGTTCCAGGGCCTCAAGCCC,was found to duplicate only in glutinous strains, RD6 andNeaw Hom Nin. When translation was predicted to beinitiated from the first ATG, this 23 bp insert motif wasin-frame and the translation was terminated prematurely atnucleotide 172 in exon 2 (Fig. 3). In contrast with Wx genesfrom RD6 and Neaw Hom Nin, one copy of the 23 bp insertmotif from Wx genes of KDML105 and Jao Hom Nin wasnot prematurely terminated. To examine further whetherthe duplicated sequence in a tropical glutinous rice was acommon phenomenon, the sequence analysis of 24 tropical

Fig. 3. Predicted reading frame of Wx genes from the start codon to 342 bp in the non-glutinous (KDML105 and Jao Hom Nin) and glutinous rice (RD6and Neaw Hom Nin). The stop codon was found at nucleotide 172 in the exon 2 of the glutinous varieties.

glutinous varieties was conducted. Interestingly, the same23 bp duplicated motifs were found exactly in the sameexon 2 of all glutinous rices (Fig. 4.). This result was notonly unique in tropical glutinous varieties but also in otherspontaneous wx mutants [10,14]. The presence of prema-ture translation termination codons in the exons indicatedthat the lower accumulation of fully spliced mRNA in themutants was caused by a nonsense-mediated decay (NMD),which is an RNA surveillance system universally found ineukaryotes [14].

3.4. Molecular marker for glutinous rice

Since the 23 bp insertion in the exon 2 was uniquelypresent among all glutinous rice varieties, a pair of oligomers(Glu-23F and Glu-23R) flanking the duplication was used toverify glutinous and non-glutinous classes of rice varieties.Using the Glu-23F/R primers, 196 and 173 bp fragmentswere amplified from the glutinous and non-glutinous vari-eties, respectively. As expected, the 196 bp fragments werepresent in all glutinous rice strains, including 12 landracesand one newly improved glutinous rice, RD10 (Fig. 5). Inthe non-glutinous rice, the 173 bp was present in a widevariety of rice strains such as japonica (Nipponbare, Xua-hao, Heibao), high-amylose lowland rice (IR64, Abhaya),high-amylose upland rice (Azucena, CT9993), red-kerneldeepwater rice (FR13A) and two annual wild rices (O. rufi-pogon and O. nivara). In some glutinous rice accessions, the

1198 S. Wanchana et al. / Plant Science 165 (2003) 11931199

Fig. 4. The 318 bp fragments, amplified with primers BF and AR, were sequenced and compared. The alignment of 100 nucleotide sequences, a part ofthe 318 bp sequence, of 25 tropical glutinous rice varieties are shown. The 23 bp duplicated sequences were found in all tropical glutinous rice.

173 bp fragments were weakly present along with the main196 bp fragments (Fig. 5). This result was possibly due toa trace amount of natural mutation usually found in stickyrice germplasms. Such contamination has been a problemin quality control of rice exportation for a long time. Thedevelopment of the specific marker for glutinous rice intoa higher throughput diagnosis will be utilized as a tool forimproving the quality control of rice exportation.

3.5. The origin of tropical glutinous rice

One possible explanation for the lack of amylose and Wxprotein in a glutinous rice was the presence of 23 bp dupli-cated sequence in the exon 2 resulting in a chain termination.Umeda et al. found that the lack of amylose and Wx proteinwas related to a short interspersed elements (SINE) element[4]. From their study, a wx mutant of O. glaberrima con-

Fig. 5. Amplified products from glutinous and non-glutinous rice varieties using specific primers (Glu-23F and Glu-23R) flanking 23 bp repeat. All glutinousvarieties generated 196 bp amplified fragments while 173 bp fragments were found in all non-glutinous rice varieties and two annual wild rice accessions.

tained 139 bp SINE in intron 10. The same SINE elementswere found in glutinous O. sativa, where Wx protein andamylose were absent. Such elements had no similarity to the23 bp sequence found in all tropical glutinous rice in thisstudy. To determine whether the 23 bases were a member ofa transposable element family, the sequence was searchedthrough BLAST against the non-redundant database of Gen-Bank and all public transposon/retrotransposon databases.No similarity between the 23 bp sequence and the trans-posons/retrotransposons database was found.

The genomic sequences of Wx genes of two annual wildrices (O. rufipogon and O. nivara) were investigated in orderto understand when the insertional mutagenesis emerged.The result showed that the 23 bp duplicated sequence wasabsent in both wild progenitors. By using pairs of reversedmutants including KDML105/RD6, Jao hom nin/Neaw homnin and all 24 glutinous varieties, the result showed that

S. Wanchana et al. / Plant Science 165 (2003) 11931199 1199

these reversed mutants carried the same aberrant 5 splicecodon and the similar sets of (CT)n repeats. It is likely thatall tropical glutinous varieties, which originated from theWxb group were similar to those low-amylose rice strains.Although the glutinous rice carrying Wxa allele has neverbeen detected so far, it seems that all tropical glutinousrices may have evolved from low-amylose rice, by a dupli-cating mutagenesis, carrying the Wxb allele. Finally, the useof such unique duplicated sequence methods will greatlyenhance the ability to develop PCR-based markers andwill improve the efficiency of amylose classification in ricegrain.

Acknowledgements

This project was jointly funded by the Royal Golden Ju-bilee Ph.D. Program, DNA Technology Laboratory, RiceGene Discovery and Kasetsart University. We are very grate-ful to the Rice Research Institute for supplying several trop-ical glutinous rice landraces for experiments. These experi-ments complied with the current Biosafety guidelines of thecountry in which the experiments were performed.

References

[1] B.O. Juliano, A simplified assay for milled-rice amylose, Cereal Sci.Today 16 (1971) 334340.

[2] Z.Y. Wang, F.Q. Zheng, G.Z. Shen, J.P. Gao, D.P. Snustad, M.G. Li,J.L. Zhang, M.M. Hong, The amylose content in rice endosperm isrelated to the post-transcriptional regulation of the Waxy gene, PlantJ. 7 (1995) 613622.

[3] H.Y. Hirano, Y. Sano, Molecular characterization of the waxy locusof rice (Oryza sativa), Plant Cell Physiol. 32 (1991) 989997.

[4] M. Umeda, H. Ohtsubo, E. Ohtsubo, Diversification of the rice Waxygene by insertion of mobile DNA elements into introns, Jpn. J.Genet. 66 (1991) 569586.

[5] H.F.J. Bligh, P.D. Larkin, P.S. Roach, C.A. Jones, H. Fu, W.D. Park,Use of alternate splice sites in granule-bound starch synthase mRNAfrom low-amylose rice varieties, Plant Mol. Biol. 38 (1998) 407415.

[6] X. Cai, Z. Wang, Y. Xing, J. Zhang, M. Hong, Aberrant splicing ofintron 1 leads to the heterogeneous 5 UTR and decreased expressionof Waxy gene in rice cultivars of intermediate amylose content, PlantJ. 14 (1998) 459465.

[7] M. Isshiki, K. Morino, M. Nakajima, R.O. Okagaki, S.R. Wessler,T. Izawa, K. Shimamoto, A naturally occurring functional allele ofthe rice waxy locus has a GT to TT mutation at the 5 splice siteof the first intron, Plant J. 15 (1998) 133138.

[8] H.Y. Hirano, Y. Sano, Enhancement of Wx gene expression and theaccumulation of amylose in response to cool temperature during seeddevelopment in rice, Plant Cell Physiol. 39 (1998) 807812.

[9] P.D. Larkin, W.D. Park, Transcript accumulation and utilization ofalternate and non-consensus splice sites in rice granule-bound starchsynthase are temperature-sensitive and controlled by a single nu-cleotide polymorphism, Plant J. 40 (1999) 719727.

[10] T. Inukai, A. Sako, H.Y. Hirano, Y. Sano, Analysis of intragenicrecombination at wx in rice: correlation between the molecular andgenetic map within the locus, Genome 43 (2000) 589596.

[11] H.Y. Hirano, M. Eiguchi, A single base change altered the regu-lation of the Waxy gene at the post-transcriptional level during thedomestication of rice, Mol. Biol. Evol. 15 (1998) 978987.

[12] S.O. Rogers, A.J. Bendich, Extraction of total cellular DNA fromplants, algae and fungi, Plant Mol. Biol. Manual D 2 (1994) 18.

[13] N.M. Ayres, A.M. McClung, P.D. Larkin, H.F. Bligh, C.A. Jones,W.D. Park, Microsatellites and a single-nucleotide polymorphismdifferentiate apparent amylose classes in an extended pedigree of USrice germplasm, Theor. Appl. Genet. 94 (1997) 773781.

[14] M. Isshiki, Y. Yamamoto, H. Satoh, K. Shimamoto, Nonsense-mediated decay of mutant Waxy mRNA in rice, Plant Physiol. 125(2001) 13881395.

Duplicated coding sequence in the waxy allele of tropical glutinous rice (Oryza sativa L.)IntroductionMaterials and methodsPlant materialsGenomic DNA isolationSequencing strategyDevelopment of Wx allele-specific markersDetermination of apparent amylose content

Results and discussionVariation in (CT)n repeatsAll glutinous rice strains carry Wxb alleleUnusual duplication in a coding region of Wx gene in glutinous riceMolecular marker for glutinous riceThe origin of tropical glutinous rice

AcknowledgementsReferences