Draft...Draft 2 24 Abstract 25 Agricultural practices such as manure applications could contribute...

Draft

Impact of liquid hog manure applications on antibiotic resistance genes concentration in soil and drainage water in

field crops

Journal: Canadian Journal of Microbiology

Manuscript ID cjm-2019-0343.R2

Manuscript Type: Article

Date Submitted by the Author: 31-Mar-2020

Complete List of Authors: Larouche, Elodie; Research and Development Institute for the Agri-EnvironmentGénéreux, Mylène; Research and Development Institute for the Agri-EnvironmentTremblay, Marie-Ève; Research and Development Institute for the Agri-EnvironmentRhouma, Mohamed; University of Montreal, Pathology and microbiologyGasser, Marc-Olivier; Research and Development Institute for the Agri-EnvironmentQuessy, Sylvain; University of Montreal, Veterinary medicineCôté, Caroline ; Research and Development Institute for the Agri-Environment

Keyword: Hog manure, Soil, Drainage water, Tillage practices, Antibiotic resistance genes

Is the invited manuscript for consideration in a Special

Issue? :Not applicable (regular submission)

https://mc06.manuscriptcentral.com/cjm-pubs

Canadian Journal of Microbiology

Draft

1

1 IMPACT OF LIQUID HOG MANURE APPLICATIONS ON ANTIBIOTIC RESISTANCE

2 GENES CONCENTRATION IN SOIL AND DRAINAGE WATER IN FIELD CROPS

3 Élodie Larouche, Mylène Généreux, Marie-Ève Tremblay, Mohamed Rhouma, Marc-Olivier Gasser,

4 Sylvain Quessy, Caroline Côté.

5 Mylène Généreux. Research and Development Institute for the Agri-environment (IRDA), 335

6 Vingt-Cinq East Road, Saint-Bruno-de-Montarville, Quebec, Canada, J3V 0G7. Email:

7 [email protected]

8 Marie-Ève Tremblay. Research and Development Institute for the Agri-environment, 2700

9 Einstein Street, Quebec, Canada, G1P 3W8. Email: [email protected]

10 Mohamed Rhouma. Department of pathology and microbiology, Faculty of veterinary

11 medicine, University of Montreal, 3200 Sicotte Street, Saint-Hyacinthe, Quebec, Canada, J2S

12 2M2. Email: [email protected]

13 Marc-Olivier Gasser. Research and Development Institute for the Agri-environment (IRDA),

14 2700 Einstein Street, Quebec, Canada, G1P 3W8. Email: [email protected]

15 Sylvain Quessy. Department of pathology and microbiology, Faculty of veterinary medicine,

16 University of Montreal, 3200 Sicotte Street, Saint-Hyacinthe, Quebec, Canada, J2S 2M2. Email:

17 [email protected]

18 Caroline Côté. Research and Development Institute for the Agri-environment (IRDA), 335

19 Vingt-Cinq East Road, Saint-Bruno-de-Montarville, Quebec, Canada, J3V 0G7. Email:

20 [email protected]

21 Corresponding author: Élodie Larouche. Research and Development Institute for the Agri-

22 environment (IRDA), 335 Vingt-Cinq East Road, Saint-Bruno-de-Montarville, Quebec, Canada,

23 J3V 0G7. Phone number: 450-653-7368 extension 313. Email: [email protected]

Page 1 of 43



mailto:[email protected]:[email protected]:[email protected]:[email protected]:[email protected]:[email protected]:[email protected]

Draft

2

24 Abstract

25 Agricultural practices such as manure applications could contribute to the spread of antibiotic

26 resistance genes (ARGs) within the environment. The objective was to assess the impact of some

27 fertilization methods (mineral or manure) and tillage practices (reduced or conventional) on the

28 presence of ARGs and bacteria in soil and drainage water under wheat and grain corn crops.

29 Targeted ARGs such as tet(T), sul1, and blaCTX-M-1 genes were quantified by qPCR in liquid hog

30 manure, soil and water samples. The detection of mcr-1 and mcr-2 was conducted using

31 conventional PCR. ARGs in control plots were detected despite the absence of manure,

32 representing an environmental reservoir of resistant microorganisms. The manure application rate

33 higher than 39m3/ha increased tet(T) and sul1 gene concentrations in soil for more than 180 days.

34 Tillage practices had no impact on ARG concentrations in soil and water samples. blaCTX-M-1 genes

35 were only detected in seven water samples in 2016, but no link was established with the treatments.

36 The mcr-1 and mcr-2 genes were not detected in all tested samples. This study demonstrated that

37 tet(T) and sul1 gene concentrations increased in soil after liquid hog manure application as well as

38 in drainage water in the next weeks.

39

40

41

42

43

44 KEYWORDS: Hog manure, soil, drainage water, tillage practices, antibiotic resistance genes.

Page 2 of 43



Draft

3

45 Introduction

46 Antibiotic resistance is now recognized globally as a major public health issue and has raised

47 serious concern among physicians and veterinarians. The decrease and sometime the loss of

48 antibiotics effectiveness for the treatment of bacterial infections has led to a significant increases

49 in health care costs worldwide (O’Neill 2016). Antibiotics are used in humans, animals, and crops

50 for the treatment as well as for the control and prevention of bacterial infections. Some antibiotics

51 are also used as growth promoters to improve feed efficiency in food-producing animals. Indeed,

52 tetracyclines, sulfonamides and β-lactams are among the most common antibiotic families used in

53 pig production in Canada (Pakpour et al. 2012; Brown et al. 2017). Their use also exerted selective

54 pressure on microorganisms and led to the emergence of new resistant strains (Looft et al., 2012).

55 The number and diversity of antibiotic resistant pathogenic microorganisms have increased since

56 these compounds were adopted in medicine (Roberts 2005; World Health Organization 2015).

57 Manure application on agricultural fields may introduce antibiotic resistant microorganisms in soil

58 (Zhu et al. 2013). Indeed, hog manure contains resistant and non-resistant microorganisms as well

59 as diverse antibiotics and their degradation products. There may be genetic exchanges of ARGs

60 between bacteria and these genes can then be spread in the environment (Frey et al. 2015). Tillage

61 practices are suspected to have an impact on propagation of ARGs in the environment through

62 drainage water (Garder et al. 2014). However, the contribution of the environment in the

63 dissemination of ARGs is still not well known (Zhang et al. 2015a).

64 Among ARGs that were found in soils fertilized with organic fertilizers, there are genes conferring

65 resistance to sulfonamides (sul1, sul2, sul3, sulA), tetracyclines (tet(A), tetA(P), tetB(P), tet(B),

66 tet(E), tet(G), tet(L), tet(M), tet(O), tet(T), tet(W), tet(X)), beta-lactams (blaCTX-M-1, blaOXA-20,

Page 3 of 43



Draft

4

67 blaTEM-71), quinolones (qnr(A)), aminoglycosides (str(B)) and macrolides lincosamides

68 streptogramins B (MLSB) (erm(A), erm(B), erm(F)) (Heuer and Smalla 2007; Hartmann et al.

69 2012; Marti et al. 2013, 2014; Zhang et al. 2015a; Wang et al. 2015). The occurrence of tetracycline

70 resistance genes coding for the NADPH-oxidoreductase leading to ribosomal protection such as

71 tet(T) genes have been little studied (Marti et al. 2013). Sulfonamide resistance was evaluated in

72 the environment by detecting sul1, sul2 and sul3 genes coding for an enzyme dihydropteroate

73 synthase (Sköld 2000; Marti et al. 2013). The sul1 genes are generally carried by a conjugative

74 plasmid which is included within a class I integron. It makes it a gene of interest to assess the

75 impact of manure spreading (Gündoğdu et al. 2011; Bueno et al. 2017; Razavi et al. 2017).

76 Resistance to β-lactams mediated by blaCTX-M-1 gene is the most prevalent extended-spectrum β-

77 lactamase (ESBL) and is also widespread (Dohmen et al. 2015). Colistin sulfate is a cationic

78 antibiotic peptide, which is approved for use in pigs in several countries (Rhouma et al. 2016a,

79 2016c). However, colistin sulfate is not yet approved for use in food animals in countries such as

80 Canada. This antibiotic was sometimes used under veterinarian responsibility for the treatment of

81 post weaning diarrhea in pigs in Canada (Rhouma et al. 2016b). Since the first identification, in

82 2015, of a plasmid-mediated colistin resistance gene (mcr-1), the environment has been

83 incriminated as a potential source of colistin resistance spread (Schwarz and Johnson 2016).

84 Indeed, mcr-1 was found in Escherichia coli isolates from animal production, meat, water and

85 vegetables. However, the role of hog manure applications in the dissemination of colistin

86 resistance genes in agricultural land has not been investigated yet.

87 Reducing transport of microbial contaminants, which may be resistant to antibiotics, from the

88 surface soil to agricultural drains is therefore a major challenge for improving water quality in

89 agricultural watersheds (Jamieson et al. 2002). We hypothesized that repeated application of liquid

Page 4 of 43



Draft

5

90 hog manure increases E. coli and enterococci counts as well as ARG concentrations in soil and

91 that environmental dissemination of these genes is influenced by agricultural tillage practices. The

92 objective of the current study was: (1) to measure the effect of fertilization and tillage practices on

93 microbiological quality of soil and drainage water in wheat crop in 2016 and in grain-corn crop in

94 2017, and (2) to assess the effect of repeated hog manure applications on the presence of ARGs in

95 soil and drainage water.

Page 5 of 43



Draft

6

96 Materials and methods

97 Field operations. The experimental site of the current study is a long-term field set in 1978 at the

98 IRDA research farm located in Saint-Lambert-de-Lauzon, Quebec, Canada. Crop rotation is grain

99 corn, wheat and canola since 2006, the site being dedicated to grain corn production before this

100 period. Wheat and grain corn were grown respectively in 2016 and 2017. The 0-20 cm surface

101 texture of soil varies from a silty clay loam and loam, through a silt loam and clay loam. Since

102 1998, a subsurface drain system was placed at 90 centimeters below the ground surface, allowing

103 drainage water sampling for each plot individually. Since spring 2011, half of plots were subjected

104 to reduced tillage, and the other half to conventional tillage (Figure S1 in supplementary

105 materials). Reduced tillage consisted of superficially incorporating manure (

Draft

7

119 incorporation in post-application. Drainage water flow was measured (Table S4), and weather data

120 were recorded every 10 minutes (air and soil temperature, precipitation and air humidity).

121 Sample collection of hog manure, soil and drainage water. Liquid hog manure was collected

122 three times during spreading to measure variability of its properties. In 2016, soil was sampled in

123 each plot 10 days prior to hog manure application, a few hours after application, and 116 days

124 after, corresponding to grain corn harvest day. Similarly, in 2017, soil samples were taken 9 days

125 prior to hog manure application, as well as a few hours and 180 days after spreading. Soil was

126 sampled in each plot at a depth of 0-10 cm, 10-20 cm and 20-40 cm before manure application and

127 at the harvest day for a total of 84 samples per year. A mixture of 5 sub-samples taken randomly

128 in each plot was made to be representative of the whole plot area. Drainage water samples

129 associated to each plot were collected every time that water flow at the end of the drain system

130 could be collected in a 500 ml bottle within a maximum of 2 hours. In 2016, six drainage water

131 sampling campaigns were done for a total of 72 samples. In 2017, four rain events leading to

132 drainage water occurrence were sampled as well as an event with insufficient water flow in

133 October and another in spring 2018 during snow melt, totalizing 65 water samples. Each sample

134 was collected aseptically to avoid cross contamination and to maintain the integrity of the samples.

135 Isolation of E. coli and Enterococcus spp. To measure the effect of fertilization and tillage

136 practices on microbiological quality of soil and drainage water, the E. coli and enterococci bacteria

137 have been isolated since they are good indicators of fecal contamination and frequently carry

138 ARGs. Bacteria were counted following the Quebec government’s official protocols of CEAEQ

139 MA.700-Ec.BCIG 1.0 for the isolation of E.coli in water samples and MA.700-Ent 1.0 for the

140 isolation of Enterococcus spp. Based on the previous two procedures, a protocol was adapted for

141 the isolation of enterococci in soil and hog manure samples. Fifty grams of hog manure and soil

Page 7 of 43



Draft

8

142 samples were weighed and diluted in a 0.0003M phosphate buffer solution. Hog manure samples

143 were filtered with 1, 5 and 10 ml of a 1:1000 dilution. Soil samples were filtered with 1, 5 and 25

144 ml of a 1:100 dilution. Water samples were not diluted. The filtered volumes of water were

145 determined according to the turbidity of the sample and varied between 10 and 150 ml. Enterococci

146 were confirmed with Enterolert* test kit based on IDEXX’s patented Defined Substrate

147 Technology* (DST*). The volume allowing a count of bacteria between 20 and 80 CFU per petri

148 dish was used to obtain the final bacterial count (CFU/g of manure or soil and CFU/100ml of

149 drainage water). They were transformed with logarithm to the base 10.

150 Genomic DNA extraction. Amounts of 500 mg of soil and 400 mg of liquid hog manure were

151 weighed to carry out DNA extraction. Water samples were filtered using a 0.45 μm pore membrane

152 to recover microorganisms and suspended matter. A maximum of 250 ml of water were filtered

153 per membrane. The resulting membranes from manure, soil and water samples were then placed

154 in extraction kit microtubes. DNA extraction was done with the Fast DNA Spin Kit for feces and

155 soil combined to the FastPrep® system from MP Biomedicals. The same soil kit was used to isolate

156 genomic DNA from water samples. Concentration and purity of DNA extracts were verified with

157 a Tecan Infinite F200 Pro spectrophotometer and 1% agarose gel migration.

158 Quantification and detection of target genes. Quantification of tet(T), sul1 and blaCTX-M-1

159 antibiotic resistance genes in DNA extracts was performed using the Real-Time Polymerase Chain

160 Reaction (qPCR) method. The qPCRs were performed with the CFX96 thermal cycler and Sso

161 Advanced™ Universal Inhibitor-Tolerant SYBR® Green Supermix reagents from Bio-Rad.

162 Running of qPCRs was rigorously checked for each gene and reaction conditions were adjusted as

163 needed. DNA amplification protocol of tet(T), sul1 and blaCTX-M-1 genes is summarized in Table

164 1. To determine the number of gene copy in DNA extracts, a standard curve was performed using

Page 8 of 43



Draft

9

165 known increasing concentrations of the target gene fragment with an increment of dilutions 1:5.

166 These synthetic gene fragments and primers were obtained from IDT company (Integrated DNA

167 Technologies, Inc., Iowa, USA) (Table S5). Regarding samples in 2016, each reaction contained,

168 on average, 9.5 ± 1.1 ng of hog manure DNA, 6.4 ± 2.6 ng of soil DNA or 7.8 ± 6.7 ng of drainage

169 water DNA extract. Regarding samples of 2017, each qPCR contained an average number of 2.4

170 ± 0.6 ng hog manure DNA, 7.4 ± 2.7 ng soil DNA or 10.1 ± 8.0 ng of drainage water DNA extract.

171 Each sample was runned in three technical replicates to confirm the precision of the target gene

172 quantification. A negative control without DNA was carried out with deionized water. The total

173 volume of each reaction was 25 μl. The limit of detection (LOD) of qPCR-targeted genes, define

174 as the minimum of gene copy numbers that can be detected with the qPCR method, were 14 copies

175 per reaction for tet(T), 20 copies/reaction for sul1 and 39 copies/reaction for blaCTX-M-1. The limit

176 of quantification (LOQ), define as the gene copy numbers that can be quantitatively determined

177 with accuracy and precision, were 357 copies/reaction for tet(T), 98 copies/reaction for sul1 as

178 well as 195 copies/reaction for blaCTX-M-1. An internal amplification control (IAC) was also added

179 to ensure that qPCR was not inhibited and that there were no false negatives. Sequences of IAC

180 primers as well as those of phage lambda synthetic DNA fragment used as IAC are summarized

181 in Supplementary material (Table S6). The purity and specificity of amplicons were confirmed

182 with a melting curve as well as with a 3% agarose gel migration for detection of target genes. It

183 was also possible to determine the number of samples containing the targeted ARG and to calculate

184 gene prevalences of each sample type. All results were reported as number of copies per gram of

185 hog manure or wet soil and per ml of filtered water and then transformed using logarithm to the

186 base 10. In samples taken in 2016, mcr-1 and mcr-2 genes were evaluated with conventional PCR

187 using a protocol previously described (Liu et al. 2016).

Page 9 of 43



Draft

10

188 Data analysis and statistical methods. Each factor has been compared with a statistical analysis

189 for each year separately. Given the multiple variables and different length of sampling time, the

190 results between the two year under study have not been compared with a statistical analysis.

191 Association between each factor and prevalence of genes in samples were verified using

192 contingency tables and Fisher exact test available with SAS PROC FREQ (version 9.4). For counts

193 of bacteria and resistance genes, a general linear mixed model with a logarithmic binding function

194 was fitted to count data in order to evaluate the effects of factors and interactions (Littell et al.

195 2007). Binomial or negative Poisson distribution were specified, and random effects and repeated

196 measures were considered in the model. Random part of the model was simplified when

197 convergence was not respected. PROC GLIMMIX procedure of SAS was used and threshold was

198 set at 0.05.

Page 10 of 43



Draft

11

199 Results

200 E. coli and enterococci enumeration in liquid hog manure and soil. The average counts of E.

201 coli in hog manure were higher in 2016 than in 2017 with respectively 5.0 ± 0.1 and 4.6 ± 0.1

202 Log10 CFU/g. The opposite was observed with the enterococci counts which were more

203 concentrated in 2017 than in 2016 with respectively 4.8 ± 0.1 and 4.2 ± 0.1 CFU/g of hog manure.

204 The effect of tillage practice on bacterial and ARGs transport was first analyzed at the soil surface

205 since tillage was done at a maximum depth of 10 cm. In 2016 and 2017, there were more E. coli

206 and enterococci in soil surface (depth of 0-10 cm) after manure application than the two other

207 sampling dates (before application and harvest) (Figure 1A, B, C and D). Also, tillage practice

208 did not affect the average bacterial counts in soil (results presented only in supplementary material,

209 Table S7). There were more bacteria in the 2X manured soil than in the 1X, and less in the MIN

210 than the other manure rates for the two years under study. Bacterial counts were equivalent

211 between the MIN plots, although there was a slight increase of average counts after manure

212 application in the spring. The E. coli and enterococci counts after harvest in 2016 (116 days post-

213 application) (Figure 1A and C) and 2017 (180 days post-application) (Figure 1B and D)

214 decreased to counts like those observed prior to fertilization in the manure-receiving plots, except

215 in all plots in 2016 for enterococci counts and in the 1X plots in 2017 for E. coli. Although not

216 significant, there was generally more E. coli and enterococci in soil surface samples than in soil

217 sampled at a depth of 10-20 cm and 20-40 cm (results presented only in supplementary material,

218 Table S7). Thus, there was no established link between soil depth and bacteria counts in this study.

219 E. coli and enterococci populations in drainage water. E. coli populations in drainage water

220 ranged between 0.0 and 3.2 Log10 CFU/100 ml in 2016, 0.0 and 2.3 Log10 CFU/100 ml in 2017,

Page 11 of 43



Draft

12

221 and between 0.0 and 1.3 Log10 CFU/100 ml in spring 2018. The December 1, 2016 sampling date

222 was not included in the statistical analysis of E. coli counts to obtain the convergence of the

223 statistical model. The populations of E. coli in 2016 were influenced by the sampling date and the

224 fertilization method. Indeed, the average counts of E. coli in drainage water at the outlet of the

225 drains was higher with 1X manure rate than with MIN in 2016 (Figure 2A). Also, the 2X manured

226 plots contained more E. coli counts in June 7 and June 13, 2016 than in 1X manured plots or MIN

227 control plots. E. coli counts in drainage water decreased between June 7 and June 13, 2016,

228 corresponding to 19 and 25 days after hog manure application. For the same sampling date, tillage

229 practice had no effect on bacterial counts in drainage water regardless of the fertilization method

230 (results presented in supplementary material, Table S8). No statistical analysis was done for E.

231 coli counts in drainage water in 2017 since average counts were generally under the LOD of 1

232 CFU/100ml and did not vary between treatments. Counts were higher on October 16, 2017 than

233 the other sampling dates in only three plots next to each other. Given the proximity of the plots, it

234 is possible that the contamination was caused by an external source such as wild animal feces.

235 Enterococci counts in drainage water ranged between 0.0 and 3.0 Log10 CFU/100 ml in 2016

236 (Figure 2B), 0.0 and 2.8 Log10 CFU/100 ml in 2017 (Figure 2C), and 0.7 and 1.9 Log10 CFU/100

237 ml in the spring of 2018. Enterococci counts in water taken in 2016 and 2017 were influenced by

238 the sampling date. Enterococci counts decreased between June 7 and June 13, 2016. However,

239 there was an increase of enterococci counts in drainage water on October 21, and a decrease on

240 November 4, 2016, corresponding to 169 days after hog manure application. In 2017, regardless

241 of other treatments, enterococci counts were different between all sampling dates. Despite an

242 increase in October 2016 and 2017, there was a decrease in E. coli and enterococci counts in

243 drainage water samples during the agricultural season, although enterococci persisted longer. The

Page 12 of 43



Draft

13

244 sampling date of October 16, 2017 has not been considered in the statistical analysis as there were

245 seven missing data since some drains had an insufficient flow to be sampled. Enterococci counts

246 at this date ranged from 2.1 to 2.4 Log10 CFU/100 ml. Counts were also at their lowest prior to

247 manure application on May 24, 2017. They reached approximately 2.6 Log10 CFU/100ml in

248 October (the first runoff event of drains after fertilization in May 2017) and decreased to 1.7 Log10

249 CFU/100ml on November 6, corresponding to 166 days after manure application. In 2017,

250 drainage water from plots with 1X manure rate and conventional tillage contained more

251 enterococci (1.4 Log10 CFU/100ml) than those with reduced tillage practice (1.0 Log10

252 CFU/100ml, p=0.0116) (Table S8). The same statistical observation was made with the plots

253 fertilized with MIN (1.5 vs 0.9 Log10 CFU/100ml, p=0.0016). There were more enterococci in

254 drainage water in 2017 from plots fertilized with 2X manure rate and reduced tillage practice (1.4

255 Log10 CFU/100ml) than those receiving 1X (1.0 Log10 CFU/100ml) or MIN treatments (0.9 Log10

256 CFU/100ml, p=0.0088).

257 Concentration of ARGs in manure and soil. In 2016, average concentrations of tetracycline

258 tet(T) and sulfonamide sul1 resistance genes in hog manure were respectively 9.49 ± 2.97 and 8.35

259 ± 3.10 Log10 copies/g of wet soil. In 2017, the average concentrations of tet(T) and sul1 genes in

260 hog manure were respectively 9.11 ± 3.24 and 8.44 ± 3.38 Log10 copies/g. Indeed, tet(T) and sul1

261 gene concentrations in 2016 and 2017 in manure were similar.

262 The concentrations of tet(T) and sul1 genes in soil surface in 2016 and 2017 varied depending on

263 fertilization method and sampling date. Prior to hog manure application in both years,

264 concentrations of tet(T) genes were similar in plots receiving 1X, 2X or MIN treatments (Figure

265 3A and B). Also, there were more tet(T) genes in soil surface fertilized with 1X manure rate than

266 in those fertilized with MIN on May 15, 2017. The sul1 gene concentrations increased as hog

Page 13 of 43



Draft

14

267 manure rate increased. Indeed, there was generally more sul1 genes in soil fertilized with 2X

268 manure rate than in those with 1X before manure application for both years under study (Figure

269 3C and D). A few hours after hog manure application, there were more tet(T) and sul1 genes in

270 plots receiving 1X or 2X manure rate than in those fertilized with MIN in 2016 and 2017. In

271 addition, there were more tet(T) genes in plots with 2X manure rate than in those with 1X in 2016.

272 At the harvest, plots receiving 2X manure rate had higher tet(T) gene concentrations than the other

273 plots for both years. Even after 116 days in 2016 and 180 days following the manure application,

274 the concentration of tet(T) and sul1 genes were still higher in 2X plots than MIN control plots. It

275 is possible that the delay between hog manure application and harvest was not long enough to

276 allow a reduction of gene concentrations to comparable levels observed in plots receiving MIN

277 (background levels). In 2017, tet(T) and sul1 gene concentrations in MIN plots increased after hog

278 manure application. Also, at harvest, the average concentrations returned to levels like those prior

279 to application. At the 2X manure rate, tet(T) gene concentrations were higher after hog manure

280 application than before spreading or at harvest. Tillage practice and soil depth did not affect the

281 average concentration of tet(T) and sul1 genes in both years under study (results presented only in

282 supplementary material, Tables S9-10). There were generally fewer tet(T) and sul1 genes in

283 deeper soil (10-20 cm and 20-40 cm) than in soil surface (0-10 cm). Thus, there was no established

284 link between soil depth and ARGs in this study.

285 ARGs transport in drainage water. Since tet(T) gene concentrations in drainage water in 2017

286 and 2018 were all under the LOQ, ranging from 0.00 to 300.00 copies/ml, no statistical analysis

287 was performed with these data. The sampling date had an impact on concentration of tet(T) genes

288 in drainage water in 2016 and sul1 in 2017. Indeed, the tet(T) gene concentrations in drainage

289 water were at its highest on 7 and June 13, 2016, at least 19 days after manure application (Figure

Page 14 of 43



Draft

15

290 4A). Since June 13, 2016, a significant decrease in bacterial concentration was observed in

291 drainage water as well as a decrease in tet(T) and sul1 genes. The sul1 gene concentrations were

292 2.28 Log10 copies/ml in 2016 and 2.51 Log10 copies/ml in 2017 in drainage water in October.

293 Concentrations were similar and decreased in the next water samples taken in November and

294 December as well as E. coli and enterococci counts in water for both years. On June 13, 2016,

295 gene concentrations in water samples were generally higher in conventionally-worked plots (2.36

296 for tet(T) and 2.21 Log10 copies/ml for sul1) than those in reduced tillage (1.56 for tet(T) and 1.67

297 Log10 copies/ml for sul1) (results presented only in supplementary material, Table S10). The sul1

298 gene concentrations in drainage water were influenced by the fertilization method in 2016 and

299 2017 (Figure 4B and C). Indeed, there were more genes in drainage water samples from plots

300 fertilized with 2X manure rate than those with 1X or MIN in 2016, and more genes in plots

301 fertilized with 2X and 1X than those with MIN in 2017. Mean sul1 gene concentrations were

302 higher on June 7, 2016 and then decreased. There were fewer sul1 genes in drainage water sampled

303 prior to hog manure application in May 2017 than in water sampled in the fall of the same growing

304 season.

305 Prevalence of ARGs in environmental samples. The mcr-1 and mcr-2 genes were below the

306 LOD of the conventional PCR and were not detected on the agarose gel. The blaCTX-M genes were

307 lower in number than LOD of qPCR method, but beta-lactams genes were still found on agarose

308 gel in some samples. In 2016, the prevalence of blaCTX-M genes in drainage water was 9.7% and

309 100% in hog manure, but they were not detected in soil samples (Table 2). The tet(T) and sul1

310 gene prevalences were mainly influenced by soil depth and fertilization method. The prevalence

311 of sul1 and tet(T) genes after grain corn harvest in 2017 (respectively 88.9 and 100.0%) was higher

312 than after wheat harvest in 2016 (respectively 66.7 and 86.1%). Plots fertilized with MIN had

Page 15 of 43



Draft

16

313 slightly lower prevalence than other plots fertilized with liquid hog manure. Interestingly, sul1

314 genes had high prevalences (75.0 to 100.0%) in all tested soil samples. In 2016, the prevalence of

315 sul1 genes was higher in soil surface samples (100.0%) than in the other deeper soil depth (87.5%

316 10-20 cm and 79.2% 20-40 cm). In addition, there was lower prevalence of sul1 genes in plots

317 fertilized with MIN (75.0%) than with 1X (100.0%) or 2X (96.4%) manure rates. The prevalence

318 of tet(T) genes in soil samples taken at 20-40 cm (45.8% in 2016 and 70.8% in 2017) were lower

319 than in the two other soil depth (79.2 to 100.0%). In 2016, there was lower prevalence of tet(T)

320 genes in plots fertilized with MIN (78.6%) than with 1X (96.4%) or 2X (100%) manure rates.

321 There were almost twice as many sul1 genes in water samples as tet(T) genes for both agricultural

322 seasons under study. The unfertilized soil plots already contained tet(T) and sul1 genes prior to

323 manure application. Indeed, the prevalence of sul1 has increased by 8.3% in 2016 and 5.6% in

324 2017 after manure application, while those of tet(T) increased by 22.2% in 2016 and 8.3% in 2017.

Page 16 of 43



Draft

17

325 Discussion

326 The objectives achieved in the current study were to measure the effect of fertilization and tillage

327 practices on microbiological quality of soil and drainage water and to assess the effect of repeated

328 hog manure applications on the presence of ARGs in samples. This research was conducted in

329 2016 in wheat crop while in grain-corn crop in 2017. The results combining the two years of the

330 study have been globally discussed but they could not be statistically analysed together given the

331 multiple variables and length of sampling time. Both sul1 and tet(T) genes have been reported in

332 pathogenic bacteria isolated from humans and animals as well as in the environment (water, soil,

333 plants, swine manure) (Clermont et al. 1997; Antunes et al. 2005; Roberts 2005; Marti et al. 2013).

334 Results of the current study showed that there was an increase concentration of sul1 and tet(T)

335 genes in soil after the application of liquid hog manure for the two years of the experiment.

336 Although less significant than in plots receiving manure, there was also an increase in plots

337 receiving MIN, suggesting that concentrations of tetracycline- and sulfonamide-resistant

338 microorganisms may have increased in soil at the beginning of the growing seasons. This may

339 explain, in part, the increase of gene concentrations in plots fertilized with hog manure. However,

340 at the high rate of hog manure (2X), the concentration of tet(T) and sul1 genes remained higher

341 until wheat harvest in September 2016 as well as grain corn in November 2017 than before manure

342 application. A delay of 116 days in 2016 and 180 days in 2017 (grain crop growing seasons in

343 Canada) after hog manure application was not enough to reduce ARGs in soil at the background

344 levels observed in control plots. Thus, it would be better to apply hog manure at an agronomic rate

345 (1X) to reduce the risk of spreading these genes across crops. It is generally recommended to

346 harvest at least 90 to 120 days after manure application to ensure that human pathogens, such as

347 E. coli and Enterococcus spp., reach undetectable levels (Bernard et al. 2003; Marti et al. 2014).

Page 17 of 43



Draft

18

348 Several studies have reported high abundances of ARGs in soils that have received hog manure

349 for more than one growing season (Knapp et al. 2010; Hartmann et al. 2012; Garder et al. 2014;

350 Marti et al. 2014; Zhang et al. 2015a; Wang et al. 2015).

351 The presence of ARGs in soil after spreading is impacted by various factors such as manure source,

352 spreading rate, application time, weather conditions and soil type. It has been reported that fall

353 spreading tends to increase frequency of genes detection in soil (Marti et al. 2014). In early spring,

354 the ARGs were less concentrated than at the end of autumn, although more genes remained in plots

355 fertilized with organic fertilizers than in the control plots receiving only MIN. Garder et al. (2014)

356 published results showing an increase in erm(B) and erm(F) genes in silty soil after hog manure

357 application in France, but their abundance after 12 months decreased to levels equivalent to those

358 observed in control plots that did not receive manure. They also mentioned that detection of other

359 resistance genes could have led to other findings and conclusions. Scott et al. (2018) reported an

360 increase in abundance of sul1, str(A), str(B), aad(A), erm(B) and int1 genes after spreading a pig

361 manure compost on a clay loam soil of Brookston in Ontario compared to unfertilized soil. This

362 increase in ARGs abundance was significant for at least 5 years after application, further

363 demonstrating long-term effects of organic fertilizer applications on increased ARGs abundance.

364 In addition, heavy metals and antibiotic residues are added to soil during manure application.

365 ARGs have been associated with heavy-metal resistance genes, allowing co-selection of antibiotic

366 resistance (Zhu et al. 2013). In addition, subtherapeutic levels of antibiotic substances in soil and

367 water exert a selection pressure for gene acquisition by environmental microorganisms (Baquero

368 et al. 2008).

369 In the current study, prior to manure application in May 2016 and 2017, concentration of sul1 and

370 tet(T) genes was higher in plots fertilized with liquid hog manure than in MIN-fertilized one. This

Page 18 of 43



Draft

19

371 higher concentration of genes in manure-fertilized plots could be explained by the repeated

372 applications of previous years that led to an accumulation of these genes in soil (Zhang et al.

373 2015a). Marti et al. (2014) reported that sul1 genes were significantly higher in fertilized soils at

374 79 and 112m3/ha compared to unfertilized soils. Although 2X rate was twice as low in this study

375 as in that of Marti et al. (2014), there were still more genes for sulfonamide and tetracycline

376 resistance in these plots. It is normal to observe an increase in the number of microorganisms and

377 resistance genes in soil and drainage water samples after hog manure application. This increase in

378 genes concentration should not be attributed exclusively to addition of ARGs contained in manure,

379 but also to the stimulation of soil microbial populations. Manure applications as well as mineral

380 fertilizer provide nutrients useful for agricultural crops to improve soil quality and crop yield, but

381 they also support growth of microorganisms already present in soil (Larney and Angers 2012;

382 Meen et al. 2014).

383 The detection of genes in soil and water samples from plots receiving only MIN has led to a better

384 knowledge of their amounts and prevalence when soil has not been fertilized with organic fertilizer

385 for several years. Thus, this background concentration and prevalence of ARGs was compared

386 with other plots receiving hog manure. It was found that all soil samples, regardless of treatment,

387 contained tet(T) and sul1 genes after manure application. The sul1 genes were found in different

388 soil types that were not always fertilized with organic fertilizers demonstrating that indigenous soil

389 microorganisms may carry them (Heuer and Smalla 2007; Marti et al. 2014; Zhang et al. 2015b;

390 Wang et al. 2015). Thus, there is already an established reservoir of sul1 and tet(T) genes in soil,

391 but the prevalence and concentration of these genes has increased after hog manure spreading

392 during at least one growing season. Researchers had detected tet(T) genes in soil fertilized with

393 manure as well as in soil fertilized with organic fertilizer (Marti et al. 2013). The same research

Page 19 of 43



Draft

20

394 team also reported that relative abundance of sul1 genes was significantly higher in soils fertilized

395 with organic fertilizers than in soils fertilized with MIN for at least one growing season (Marti et

396 al. 2014).

397 In the current study, blaCTX-M-1 genes were under the LOD of qPCR in all samples. Prevalence of

398 extended-spectrum β-lactamase (ESBL) genes has been associated with high use of antibiotics

399 such as penicillin and cephalosporin in animal breeding (Dohmen et al. 2015). Results could have

400 been different depending on the use of antibiotics for pig rearing. A study in France enabled

401 researchers to detect the blaCTX-M-1 or blaCTX-M-9 and blaTEM-71 genes in soil of different agricultural

402 land receiving organic fertilizers. This study suggests that beta-lactam resistance may be caused

403 by other resistance genes (Hartmann et al. 2012). The genes of mcr-1 and mcr-2 were not detected

404 in liquid hog manure, soil and drainage water samples. Indeed, these results seem to corroborate

405 the limited use of colistin on Canadian hog farms, primarily for treatment of post-weaning diarrhea

406 in piglets (Rhouma et al. 2017). Guenther et al. (2017) identified mcr-1 gene in swine manure in

407 Germany, which was associated with significant use of colistin on these farms (Guenther et al.,

408 2017).

409 The results of the current study did not demonstrate that conventional or reduced tillage practices

410 have impacted the bacterial counts and gene concentrations in soil and in drainage water. Garder

411 et al. (2014) did not demonstrate that tillage practice had an impact on presence of erythromycin

412 resistance genes in soil and on transport of these genes in drainage water. The authors also

413 mentioned that other findings and conclusions could have been observed if other genes have been

414 studied as part of their study. To date, our study is one of the first to evaluate the impact of tillage

415 practices on transport of ARGs in drainage water. Further studies will be needed to fully

416 understand relationship between tillage practice and transport of ARGs in the environment through

Page 20 of 43



Draft

21

417 agricultural drains considering the characteristics of each cultivated region (weather, moisture,

418 type of soil). It is known that tillage practice may impact the movement of water through soil

419 macrospores (Jamieson et al. 2002). In addition, researchers have indicated that diversity of

420 microorganisms in soil was greater in soil surface when tillage was reduced (van Groenigen et al.

421 2010).

422 The current study has clearly demonstrated that hog manure application on soil increased the

423 number of E. coli and enterococci as well as tet(T) and sul1 genes in drainage water. In October,

424 a decrease in bacterial concentration was observed in drainage water as well as a decrease in tet(T)

425 in 2016 and sul1 genes in both years under study. The results in soil and drainage water can be

426 explained by reduced number of sulfonamide resistant microorganisms found in drainage water.

427 In 2016, May and June were relatively wet in Saint-Lambert-de-Lauzon and precipitation reached

428 144mm in June. It is possible that antibiotic resistant microorganisms and ARGs have left

429 agricultural soil via runoff rather than drains. However, preferential transport of water in soil

430 would be particularly active in clay soil during floods while soil profile is saturated and subjected

431 to surface runoff, thus promoting a relatively rapid flow to drains by soil macropores (Jamieson et

432 al. 2002). It is know that bacterial counts and resistance genes in water are influenced by weather

433 conditions (Sura et al. 2016).

434 Liquid hog manure contained high counts of E. coli and enterococci, so this may explain the

435 increase in counts in soil and drainage water in both years of culture. Enterococci generally survive

436 better than E. coli in the environment (Bernard et al. 2003; Marti et al. 2014). Probabilities to

437 recover fecal microorganisms in drainage water depend on their potential for survival and transport

438 through soil (Jamieson et al. 2002; Unc and Goss 2004). Counts of indicator microorganisms and

439 fecal contamination such as E. coli generally follow an exponential decay in soil and may persist

Page 21 of 43



Draft

22

440 for up to 100 days with initial high bacterial content manure (Côté and Quessy 2005). This bacteria

441 survival is impacted by a multitude of factors such as exposure to UV rays, as well as moisture,

442 temperature and microbiological activity of soil, which can be influenced by tillage practices

443 (Licht and Al-Kaisi 2005). According to Jamieson et al. (2002), the two most important parameters

444 influencing transport of microorganisms to drains are soil moisture during application and

445 precipitation occurring within two or three weeks after spreading. Many enteric microorganisms

446 are released in weeks following application. Also, changes in soil microflora after organic fertilizer

447 application could have an impact on public health in longer term, as well as the presence of

448 antibiotic resistant microorganisms in soil and water.

449 Results of this study are to be interpreted in the context of agricultural lands in the Chaudière-

450 Appalaches region of Quebec (Canada), where rainy weather prevailed in 2016 and 2017. Marti et

451 al. (2014) hypothesized that climatic conditions may impact gene concentration. They reported

452 that warm and dry conditions reduce persistence of resistant bacteria, while cool and wet

453 conditions promote growth of resistant bacteria. Wet weather conditions at the experimental site

454 may have influenced transport of genes and bacteria in drainage water, as well as their

455 concentration in soil. In the current study, tet(T) and sul1 gene concentrations increased in soil

456 after liquid hog manure application as well as in drainage water in the next weeks. According to

457 various agricultural activities, soil could constitute a reservoir of tetracycline and sulfonamides

458 resistance genes as well as potential resistant bacteria.

Page 22 of 43



Draft

23

459 Acknowledgements

460 This study was founded by Ministry of Agriculture, Fisheries and Food of Quebec (MAPAQ).

461 We thank K. Roseberry, A. Fortin, E. Latour and T. Raymond for their important technical support

462 in the laboratory during this project. We also thank all the farm workers and our farm cooperators.

463 We would like to thank Dr. Pascal Sanders and Prof. Dr. Surbhi Malhorta-Kumar for providing

464 DNA from Escherichia coli harboring respectively mcr-1 and mcr-2 genes.

Page 23 of 43



Draft

24

465 References

466 Aminov, R.I., Chee-Sanford, J.C., Garrigues, N., Teferedegne, B., Krapac, I.J., White, B.A., and

467 Mackie, R.I. 2002. Development, Validation, and Application of PCR Primers for

468 Detection of Tetracycline Efflux Genes of Gram-Negative Bacteria. Appl. Environ.

469 Microbiol. 68(4): 1786–1793. doi:10.1128/AEM.68.4.1786-1793.2002.

470 Antunes, P., Machado, J., Sousa, J.C., and Peixe, L. 2005. Dissemination of sulfonamide

471 resistance genes (sul1, sul2, and sul3) in Portuguese Salmonella enterica strains and

472 relation with integrons. Antimicrob. Agents Chemother. 49(2): 836–839.

473 doi:10.1128/AAC.49.2.836-839.2005.

474 Baquero, F., Martínez, J.-L., and Cantón, R. 2008. Antibiotics and antibiotic resistance in water

475 environments. Curr. Opin. Biotechnol. 19(3): 260–265.

476 doi:10.1016/j.copbio.2008.05.006.

477 Bernard, C., Côté, C., Côté, D., Giroux, M., Grégoire, R., Joncas, R., and Martin, D.-Y. 2003,

478 April 16. Mémoire de l’Institut de recherche et de développement en agroenvironnement

479 inc. Institut de Recherche et de Développement en Agroenvironnement inc. Available

480 from http://www.bape.gouv.qc.ca/sections/mandats/prod-

481 porcine/documents/MEMO303.pdf.

482 Brown, K., Uwiera, R.R.E., Kalmokoff, M.L., Brooks, S.P.J., and Inglis, G.D. 2017.

483 Antimicrobial growth promoter use in livestock: a requirement to understand their modes

484 of action to develop effective alternatives. Int. J. Antimicrob. Agents 49(1): 12–24.

485 doi:10.1016/j.ijantimicag.2016.08.006.

486 Bueno, I., Williams-Nguyen, J., Hwang, H., Sargeant, J.M., Nault, A.J., and Singer, R.S. 2017.

487 Impact of point sources on antibiotic resistance genes in the natural environment: a

Page 24 of 43



Draft

25

488 systematic review of the evidence. Anim. Health Res. Rev. 18(2): 112–127.

489 doi:10.1017/S146625231700007X.

490 Clermont, D., Chesneau, O., De Cespédès, G., and Horaud, T. 1997. New tetracycline resistance

491 determinants coding for ribosomal protection in streptococci and nucleotide sequence of

492 tet(T) isolated from Streptococcus pyogenes A498. Antimicrob. Agents Chemother.

493 41(1): 112–116.

494 Côté, C., and Quessy, S. 2005. Persistence of E. coli and Salmonella in surface soil following

495 application of loiquid hog manure for production of pickling cucumbers. J. Food Prot.

496 68(5): 900–905.

497 Dohmen, W., Bonten, M.J.M., Bos, M.E.H., van Marm, S., Scharringa, J., Wagenaar, J.A., and

498 Heederik, D.J.J. 2015. Carriage of extended-spectrum β-lactamases in pig farmers is

499 associated with occurrence in pigs. Clin. Microbiol. Infect. Off. Publ. Eur. Soc. Clin.

500 Microbiol. Infect. Dis. 21(10): 917–923. doi:10.1016/j.cmi.2015.05.032.

501 Frey, S.K., Topp, E., Khan, I.U.H., Ball, B.R., Edwards, M., Gottschall, N., Sunohara, M., and

502 Lapen, D.R. 2015. Quantitative Campylobacter spp., antibiotic resistance genes, and

503 veterinary antibiotics in surface and ground water following manure application:

504 Influence of tile drainage control. Sci. Total Environ. 532(Supplement C): 138–153.

505 doi:10.1016/j.scitotenv.2015.03.114.

506 Garder, J.L., Moorman, T.B., and Soupir, M.L. 2014. Transport and Persistence of Tylosin-

507 Resistant Enterococci, Genes, and Tylosin in Soil and Drainage Water from Fields

508 Receiving Swine Manure. J. Environ. Qual. 43(4): 1484–1493.

509 doi:10.2134/jeq2013.09.0379.

Page 25 of 43



Draft

26

510 van Groenigen, K.-J., Bloem, J., Bååth, E., Boeckx, P., Rousk, J., Bodé, S., Forristal, D., and

511 Jones, M.B. 2010. Abundance, production and stabilization of microbial biomass under

512 conventional and reduced tillage. Soil Biol. Biochem. 42(1): 48–55.

513 doi:10.1016/j.soilbio.2009.09.023.

514 Guenther, S., Falgenhauer, L., Semmler, T., Imirzalioglu, C., Chakraborty, T., Roesler, U., and

515 Roschanski, N. 2017. Environmental emission of multiresistant Escherichia coli carrying

516 the colistin resistance gene mcr-1 from German swine farms. J. Antimicrob. Chemother.

517 72(5): 1289–1292. doi:10.1093/jac/dkw585.

518 Gündoğdu, A., Long, Y.B., Vollmerhausen, T.L., and Katouli, M. 2011. Antimicrobial resistance

519 and distribution of sul genes and integron-associated intI genes among uropathogenic

520 Escherichia coli in Queensland, Australia. J. Med. Microbiol. 60(Pt 11): 1633–1642.

521 doi:10.1099/jmm.0.034140-0.

522 Hartmann, A., Locatelli, A., Amoureux, L., Depret, G., Jolivet, C., Gueneau, E., and Neuwirth,

523 C. 2012. Occurrence of CTX-M Producing Escherichia coli in Soils, Cattle, and Farm

524 Environment in France (Burgundy Region). Front. Microbiol. 3.

525 doi:10.3389/fmicb.2012.00083.

526 Heuer, H., and Smalla, K. 2007. Manure and sulfadiazine synergistically increased bacterial

527 antibiotic resistance in soil over at least two months. Environ. Microbiol. 9(3): 657–666.

528 doi:10.1111/j.1462-2920.2006.01185.x.

529 Jamieson, R.C., Gordon, R.J., Sharples, K.E., Stratton, G.W., and Madani, A. 2002. Movement

530 and persistence of fecal bacteria in agricultural soils and subsurface drainage water: a

531 review. Can. Biosyst. Eng. Génie Biosystèmes Au Can. 44. Available from http://csbe-

532 scgab.ca/publications/cbe-journal/browse/3555-movement-and-persistence-of-fecal-

Page 26 of 43



Draft

27

533 bacteria-in-agricultural-soils-and-subsurface-drainage-water-a-review [accessed 4 August

534 2017].

535 Knapp, C.W., Dolfing, J., Ehlert, P.A.I., and Graham, D.W. 2010. Evidence of increasing

536 antibiotic resistance gene abundances in archived soils since 1940. Environ. Sci. Technol.

537 44(2): 580–587. doi:10.1021/es901221x.

538 Larney, F.J., and Angers, D.A. 2012. The role of organic amendments in soil reclamation: A

539 review. Can. J. Soil Sci. 92(1): 19–38. doi:10.4141/cjss2010-064.

540 Licht, M.A., and Al-Kaisi, M. 2005. Strip-tillage effect on seedbed soil temperature and other

541 soil physical properties. Soil Tillage Res. 80(1): 233–249.

542 doi:10.1016/j.still.2004.03.017.

543 Littell, R.C., Milliken, G.A., Stroup, W.W., Wolfinger, R.D., and Schabenberger, O. 2007. SAS

544 for Mixed Models, Second Edition. SAS Institute.

545 Liu, Y.-Y., Wang, Y., Walsh, T.R., Yi, L.-X., Zhang, R., Spencer, J., Doi, Y., Tian, G., Dong,

546 B., Huang, X., Yu, L.-F., Gu, D., Ren, H., Chen, X., Lv, L., He, D., Zhou, H., Liang, Z.,

547 Liu, J.-H., and Shen, J. 2016. Emergence of plasmid-mediated colistin resistance

548 mechanism MCR-1 in animals and human beings in China: a microbiological and

549 molecular biological study. Lancet Infect. Dis. 16(2): 161–168. doi:10.1016/S1473-

550 3099(15)00424-7.

551 Marti, R., Scott, A., Tien, Y.-C., Murray, R., Sabourin, L., Zhang, Y., and Topp, E. 2013. Impact

552 of manure fertilization on the abundance of antibiotic-resistant bacteria and frequency of

553 detection of antibiotic resistance genes in soil and on vegetables at harvest. Appl.

554 Environ. Microbiol. 79(18): 5701–5709. doi:10.1128/AEM.01682-13.

Page 27 of 43



Draft

28

555 Marti, R., Tien, Y.-C., Murray, R., Scott, A., Sabourin, L., and Topp, E. 2014. Safely Coupling

556 Livestock and Crop Production Systems: How Rapidly Do Antibiotic Resistance Genes

557 Dissipate in Soil following a Commercial Application of Swine or Dairy Manure? Appl.

558 Environ. Microbiol. 80(10): 3258–3265. doi:10.1128/AEM.00231-14.

559 Meen, V.S., Maurya, B.R., Meena*, R.S., Meena, S.K., Singh, N.P., Malik, V.K., Kumar, V.,

560 and Jat, L.K. 2014. Microbial dynamics as influenced by concentrate manure and

561 inorganic fertilizer in alluvium soil of Varanasi, India. Afr. J. Microbiol. Res. 8(3): 257–

562 263. doi:10.5897/AJMR2013.5448.

563 O’Neill, J. 2016. Tackling drug-resistant infections globally: final report and recommendations.

564 Review on Antimicrobial Resistance. Available from https://amr-

565 review.org/sites/default/files/160518_Final%20paper_with%20cover.pdf.

566 Pakpour, S., Jabaji, S., and Chénier, M.R. 2012. Frequency of antibiotic resistance in a swine

567 facility 2.5 years after a ban on antibiotics. Microb. Ecol. 63: 41–50.

568 Parent, L.-É., and Gagné, G. (Editors). 2010. Guide de référence en fertilisation, 2e édition.

569 CRAAQ, Québec.

570 Razavi, M., Marathe, N.P., Gillings, M.R., Flach, C.-F., Kristiansson, E., and Joakim Larsson,

571 D.G. 2017. Discovery of the fourth mobile sulfonamide resistance gene. Microbiome

572 5(1): 160. doi:10.1186/s40168-017-0379-y.

573 Rhouma, M., Beaudry, F., and Letellier, A. 2016a. Resistance to colistin: what is the fate for this

574 antibiotic in pig production? Int. J. Antimicrob. Agents 48(2): 119–126.

575 doi:10.1016/j.ijantimicag.2016.04.008.

576 Rhouma, M., Beaudry, F., Thériault, W., Bergeron, N., Beauchamp, G., Laurent-Lewandowski,

577 S., Fairbrother, J.M., and Letellier, A. 2016b. In vivo therapeutic efficacy and

Page 28 of 43



Draft

29

578 pharmacokinetics of colistin sulfate in an experimental model of enterotoxigenic

579 Escherichia coli infection in weaned pigs. Vet. Res. 47. doi:10.1186/s13567-016-0344-y.

580 Rhouma, M., Beaudry, F., Thériault, W., and Letellier, A. 2016c. Colistin in Pig Production:

581 Chemistry, Mechanism of Antibacterial Action, Microbial Resistance Emergence, and

582 One Health Perspectives. Front. Microbiol. 7. doi:10.3389/fmicb.2016.01789.

583 Rhouma, M., Fairbrother, J.M., Beaudry, F., and Letellier, A. 2017. Post weaning diarrhea in

584 pigs: risk factors and non-colistin-based control strategies. Acta Vet. Scand. 59: 31.

585 doi:10.1186/s13028-017-0299-7.

586 Roberts, M.C. 2005. Update on acquired tetracycline resistance genes. FEMS Microbiol. Lett.

587 245(2): 195–203. doi:10.1016/j.femsle.2005.02.034.

588 Schwarz, S., and Johnson, A.P. 2016. Transferable resistance to colistin: a new but old threat. J.

589 Antimicrob. Chemother. 71(8): 2066–2070. doi:10.1093/jac/dkw274.

590 Scott, A., Tien, Y.-C., Drury, C.F., Reynolds, W.D., and Topp, E. 2018. Enrichment of antibiotic

591 resistance genes in soil receiving composts derived from swine manure, yard wastes, or

592 food wastes, and evidence for multiyear persistence of swine Clostridium spp. Can. J.

593 Microbiol. 64(3): 201–208. doi:10.1139/cjm-2017-0642.

594 Sköld, O. 2000. Sulfonamide resistance: mechanisms and trends. Drug Resist. Updat. Rev.

595 Comment. Antimicrob. Anticancer Chemother. 3(3): 155–160.

596 doi:10.1054/drup.2000.0146.

597 Sura, S., Degenhardt, D., Cessna, A.J., Larney, F.J., Olson, A.F., and McAllister, T.A. 2016.

598 Transport of Three Antimicrobials in Runoff from Windrows of Composting Beef Cattle

599 Manure. J. Environ. Qual. 45(2): 494–502. doi:10.2134/jeq2015.05.0254.

Page 29 of 43



Draft

30

600 Unc, A., and Goss, M. 2004. Transport of bacteria from manure and protection of water

601 resources. ResearchGate Applied Soil Ecology(25): 1–18.

602 doi:http://dx.doi.org/10.1016/j.apsoil.2003.08.007.

603 Wang, F.-H., Qiao, M., Chen, Z., Su, J.-Q., and Zhu, Y.-G. 2015. Antibiotic resistance genes in

604 manure-amended soil and vegetables at harvest. J. Hazard. Mater. 299: 215–221.

605 doi:10.1016/j.jhazmat.2015.05.028.

606 World Health Organization. 2015, November. Antibiotic resistance: Multi-country public

607 awareness survey. World Health Organization. Available from

608 http://www.who.int/drugresistance/documents/baselinesurveynov2015/en/.

609 Zhang, S., Gu, J., Wang, C., Wang, P., Jiao, S., He, Z., Han, B., Zhang, S., Gu, J., Wang, C.,

610 Wang, P., Jiao, S., He, Z., and Han, B. 2015a. Characterization of Antibiotics and

611 Antibiotic Resistance Genes on an Ecological Farm System,. J. Chem. J. Chem. 2015.

612 doi:10.1155/2015/526143, 10.1155/2015/526143.

613 Zhang, X., Liu, D., Zhang, S., Wei, X., Song, J., Zhang, Y., Jin, M., Shen, Z., Wang, X., Feng,

614 Z., and Li, J. 2015b. Host-virus interaction: the antiviral defense function of small

615 interfering RNAs can be enhanced by host microRNA-7 in vitro. Sci. Rep. 5.

616 doi:10.1038/srep09722.

617 Zhu, Y.-G., Johnson, T.A., Su, J.-Q., Qiao, M., Guo, G.-X., Stedtfeld, R.D., Hashsham, S.A., and

618 Tiedje, J.M. 2013. Diverse and abundant antibiotic resistance genes in Chinese swine

619 farms. Proc. Natl. Acad. Sci. U. S. A. 110(9): 3435–3440. doi:10.1073/pnas.1222743110.

Page 30 of 43



Draft

621 Tables & figures

622 Table 1 Protocol and primers selected for the quantitative PCR

Name Sequence (5’ → 3’)Product

size (bp)

Primer

concentration

(nM)

Denaturation

temperature

(°C)

Annealing

temperature

(°C)

Primer

references

tet(T)

tet(T)-F

tet(T)-R

AAGGTTTATTATATAAAAGTG

AGGTGTATCTATGATATTTAC167 250 94 46

(Aminov et

al. 2002;

Marti et al.

2013)

sul1

sul1-F

sul1-R

GACTGCAGGCTGGTGGTTAT

GAAGAACCGCACAATCTCGT

105 200 98 64(Marti et al.

2014)

blaCTX-M-1CTX-M-F469

CTX-M-R532

CAGCTGGGAGACGAAACGTT

CCGGAATGGCGGTGTTTA64 400 98 60

(Hartmann

et al. 2012;

Marti et al.

2013)

Page 31 of 43



Draft

624 Table 2 Prevalence of beta-lactam, sulfonamide and tetracycline resistance genes in drainage water, soil and hog manure

Prevalence (%)

Year GeneDrainage water

Soil before

spreading

Soil after

spreadingHarvest Hog manure

blaCTX-Mb 9.7 0.0 0.0 0.0 100.0

sul1 94.4 91.7 100.0 86.1 100.02016

tet(T) 54.2 77.8 100.0 66.7 100.0

sul1 100.0 94.4 100.0 100.0 100.02017

tet(T) 67.3 91.7 100.0 88.9 100.0

sul1 100.0 NAc NA NA NA2018a

tet(T) 58.3 NA NA NA NA

Page 32 of 43



Draft

626 Figure 1 Bacterial counts in soil surface in 2016 and 2017

627

Page 33 of 43



Draft

633 Figure 2 Bacterial counts in drainage water in 2016 and 2017

634

Page 34 of 43



Draft

35

635 Figure 3 Tetracycline and sulfonamide resistance gene concentrations in soil in 2016

636 and 2017

637

Page 35 of 43



Draft

638 Figure 4 Tetracycline and sulfonamide resistance gene concentrations in drainage

639 water in 2016 and 2017

640

Page 36 of 43



Draft

642 Legends of figures and tables643 Table 2: aIn 2018, there was only one sampling of drainage water in the spring, when the snow

644 melted. bThe blaCTX-M gene was sought in 2016 but not in 2017 and 2018. cNA = Not Available

645 since there were no soil and hog manure samples in 2018.

646 Figure 1: A) E. coli counts in soil surface in 2016 B) E. coli counts in soil surface in 2017 C)

647 Enterococci counts in soil surface in 2016 D) Enterococci counts in soil surface in 2017. The data

648 presented are the average of 4 sampling replicates of surface soil samples (0-10 cm). The error

649 bars represent the 95% confidence interval of the statistical model. The LOD of the E. coli and

650 enterococci counts were 0.3 Log10 CFU/g of wet soil. Manure rates are represented according to

651 recommended rate by CRAAQ 1X or 2X and mineral fertilizers by MIN. The hog manure

652 application was made on May 19, 2016 (Julian day 140) and on May 24, 2017 (Julian day 144).

653 The grain corn and wheat harvest were made respectively on September 12, 2016 (Julian day 256)

654 and on November 20, 2017 (Julian day 324). *The average was statistically different between

655 fertilization mode at the sampling date (p

Draft

38

665 statistically different between fertilization mode at the sampling date (p

Draft

39

688 Log10 copies/ml of water while the LOQ was between 2.38 and 2.60 Log10 copies/ml of water. The

689 LOD of sul1 was between 1.12 and 1.34 Log10 copies/ml of water while the LOQ was between

690 1.82 and 2.04 Log10 copies/ml of water. In 2016, May 9 was 10 days before hog manure application

691 (Julian day 130), May 19 was the date of application (Julian day 140) (not shown on the graphs),

692 and wheat harvest was made on September 12 (Julian day 256). In 2017, May 15 was 9 days before

693 hog manure application (Julian day 135), May 24 was the date of application (Julian day 144), and

694 corn harvest was made on November 20 (Julian day 324). The manure rates are represented

695 according to the recommended rate by CRAAQ 1X or 2X and mineral fertilizers by MIN. *The

696 average was statistically different between fertilization mode at the sampling date (p

DraftJulian days 2016120 150 180 210 240 270

E.c

oli

(Log

10 C

FU

/g o

f w

et s

oil)

-2.5

-2.0

-1.5

-1.0

-0.5

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

MIN 1X 2X

Julian days 2017120 150 180 210 240 270 300 330

-2.5

-2.0

-1.5

-1.0

-0.5

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

Julian days 2016120 150 180 210 240 270

Ent

eroc

occi

(L

og10

CF

U/g

of

wet

soi

l)

-2.5

-2.0

-1.5

-1.0

-0.5

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

4.0

Julian days 2017120 150 180 210 240 270 300 330

-2.5

-2.0

-1.5

-1.0

-0.5

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

4.0

A) B)

C) D)

*

**

*

Page 40 of 43



Draft

Julian days 2016150 180 210 240 270 300 330

E. c

oli

(Log

10 C

FU

/100

ml)

-1.0

-0.5

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5 MIN 1X 2X

Julian days 2016150 180 210 240 270 300 330 360

Ent

eroc

occi

(L

og10

CF

U/1

00m

l)

-2.5

-2.0

-1.5

-1.0

-0.5

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

Julian days 201730 60 90 120 150 180 210 240 270 300 330

Ent

eroc

occi

(L

og10

CF

U/1

00m

l)

-2.5

-2.0

-1.5

-1.0

-0.5

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

A)

B)

C)

†

Page 41 of 43



DraftJulian days 2016120 150 180 210 240 270

tet(

T)

(Log

10 c

opie

s/g

of w

et s

oil)

3.5

4.0

4.5

5.0

5.5

6.0

6.5

7.0

7.5

8.0

8.5 MIN 1X 2X

Julian days 2016120 150 180 210 240 270

sul1

(L

og10

cop

ies/

g of

wet

soi

l)

4.5

5.0

5.5

6.0

6.5

7.0

7.5

Julian days 2017120 150 180 210 240 270 300 330

3.5

4.0

4.5

5.0

5.5

6.0

6.5

7.0

7.5

8.0

8.5

Julian days 2017120 150 180 210 240 270 300 330

4.5

5.0

5.5

6.0

6.5

7.0

7.5

B)

C)

A)

D)

*

*

*

**

*

*

*

*

*

Page 42 of 43



Draft

Julian days 2016150 180 210 240 270 300 330 360

tet (

T)

(Log

10 c

opie

s/m

l)

-10.00-9.00-8.00-7.00

-2.50-2.00-1.50-1.00-0.500.000.501.001.502.002.503.003.504.00

MIN 1X 2X

Julian days 2016150 180 210 240 270 300 330 360

sul 1

(L

og10

cop

ies/

ml)

0.50

1.00

1.50

2.00

2.50

3.00

3.50

4.00

4.50

Julian days 201730 60 90 120 150 180 210 240 270 300 330

1.00

1.50

2.00

2.50

3.00

3.50

sul 1

(L

og10

cop

ies/

ml)

A)

B)

C)

†

††

Page 43 of 43



Draft...Draft 2 24 Abstract 25 Agricultural practices such as manure applications could contribute...

Documents

Transcript of Draft...Draft 2 24 Abstract 25 Agricultural practices such as manure applications could contribute...