Downloaded from //jcm.asm.org/content/jcm/early/2011/03/16/JCM... · obtained from almost all TBM...

1

LOOP-MEDIATED ISOTHERMAL AMPLIFICATION FOR RAPID AND RELIABLE 1

DIAGNOSIS OF TUBERCULOUS MENINGITIS 2

Khushboo J. Nagdev1,

, Rajpal S. Kashyap1,Manmohan M. Parida

2, Rajkumar C. Kapgate

1, 3

Hemant J. Purohit3, Girdhar M. Taori

1 and Hatim F. Daginawala

1*. 4

1. Biochemistry Research Laboratory, Central India Institute of Medical Sciences, Nagpur - 440 5

010, India. 6

2. Division of Virology, Defence Research & Development Establishment, Gwalior, Madhya 7

Pradesh 474002, India 8

3. Environmental Genomics Unit, National Environmental Engineering Research Institute, Nehru 9

Marg, Nagpur-440020, India. 10

Email addresses: 11

KN: [email protected] 12

RK: [email protected] ; 13

MP: [email protected] 14

RK: [email protected] 15

HP: [email protected] 16

GT: [email protected] 17

HFD: [email protected] 18

Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Clin. Microbiol. doi:10.1128/JCM.00824-10 JCM Accepts, published online ahead of print on 16 March 2011

on March 10, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

2

* Corresponding Author 19

Dr.H.F.Daginawala 20

Biochemistry research Laboratory, 21

Central India Institute of Medical Sciences, 22

88/2 Bajaj Nagar, Nagpur-440010. 23

Maharashtra,India. 24

Tel no. (lab): +91-712-2233381 *Ext. 262/263. Fax no.:0712-2236416 25

E-mail: [email protected] 26

Running title: LAMP for TBM diagnosis 27

Affiliations 28

Khushboo J. Nagdev-M.Sc. 29

Rajpal S. Kashyap –M.Sc., Ph.D. 30

Manmohan M. Parida - M.Sc., Ph.D. 31

Hemant J. Purohit M.Sc., Ph.D. 32

Girdhar M. Taori- M.D., F.R.C.P. 33

Hatim F. Daginawala-M.Sc., Ph.D. 34


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

3

Abstract 35

Diagnosis of Tuberculous Meningitis (TBM) is often difficult. A reliable, simple and rapid 36

diagnostic test, which can be performed in any standard laboratory, could be helpful in TBM 37

diagnosis. In this study, a loop mediated isothermal amplification assay (LAMP) was evaluated 38

to rapidly detect and diagnose TBM infection and was compared to the performance of nested 39

PCR. Six specific primers were used to recognize the IS6110 genomic sequence from 40

Mycobacterium tuberculosis (MTB), which included one forward outer primer, one reverse outer 41

primer, two respective inner primers and two loop primers. The optimum reaction temperature 42

and time were 63°C and 60 min, respectively. Nested PCR was performed targeting the IS6110 43

region from MTB using a commercial kit. The LAMP method yielded a sensitivity of 88.23% 44

and a specificity of 80%, compared to the nested PCR assay, which yielded a sensitivity of 45

52.9% and a specificity of 90% for TBM diagnosis. Comparative experiments showed that the 46

LAMP assay is a rapid, sensitive and specific method to detect TBM infection, and that it is 47

superior to the nested PCR assay. LAMP is very simple, and it can be performed in any 48

laboratory and in rural settings. 49


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

4

50

Background 51

Tuberculous meningitis (TBM) is a fatal complication of the central nervous system (CNS) (10, 52

29). A major obstacle in treatment of TBM lies in the initial delay of treatment. This delay is 53

caused by poor disease diagnosis at the initial onset of symptoms. Diagnosis of TBM relies on 54

detection of Mycobacterium tuberculosis (MTB), in cerebrospinal fluid (CSF) by acid fast bacilli 55

(AFB) staining and culturing (9). However, AFB staining of CSF is not very sensitive. Although 56

for diagnosis of TBM in culture, with respect to sensitivity, is better than AFB staining, it takes 57

3-5 weeks and is thus unable to provide the appropriate and timely diagnosis required for proper 58

patient management (32). 59

During the past decade, molecular methods such as the Polymerase Chain Reaction (PCR) have 60

been widely evaluated in TBM diagnosis (4, 17, 26). In addition to conventional PCR, recent 61

advanced technologies, like nested PCR and real time PCR, have been used for early and rapid 62

detection of TBM (27,28,31). Although nested PCR and real time PCR are beneficial, they both 63

require expensive equipment as well as a huge amount of space in routine diagnostic 64

laboratories, limiting their use to highly sophisticated facilities. These methods can be 65

technically difficult, and they require considerable expertise, which can be a major hindrance in 66

providing correct diagnosis to the patient. 67

To overcome the limitations of current molecular techniques, a new molecular-biological 68

technique, known as Loop Mediated Isothermal Amplification (LAMP), was developed by 69

Notomi et al.(19). This technique has many merits. It is highly sensitive and specific, which is 70


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

5

due to the fact that all six primer pairs recognize eight distinct regions in the target DNA. A large 71

amount of product is formed due to the auto displacement activity of the enzyme and due to this 72

property, identification of a positive reaction does not require any special processing or 73

electrophoresis (13). It can be detected by a color change of the reaction mixture in ambient light 74

when a DNA binding dye is used. Another advantage of this assay is that the whole reaction 75

takes about one hour, saving a considerable amount of time (16). The most important benefit of 76

LAMP is that it can be conducted under isothermal conditions (ranging from 60 to 65°C), 77

eliminating the need for specialized equipment or expertise. 78

Due to all these characteristics, LAMP has the potential to be adopted in any laboratory and can 79

be used as a near-patient test. LAMP is increasingly used by various investigators to rapidly 80

detect and type mycobacteria in pulmonary samples (1, 2, 3, 8, 12, 21, 25, 33, 34). To the best of 81

our knowledge, there are currently no studies regarding the efficacy of the LAMP assay in 82

diagnosing TBM infections. In the present study, a one-step, single-tube, real-time, accelerated 83

LAMP assay targeting the IS6110 region was evaluated in diagnosis of TBM infection. Since 84

nested PCR is the method of choice for molecular diagnosis of TBM, we compared the LAMP 85

assay results to the results obtained by nested PCR. 86


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

6

Materials and Methods. 87

Clinical samples. A total of 27 CSF specimens were evaluated retrospectively using the LAMP 88

assay and the results were compared to the nested PCR assay results. All specimens were 89

collected from patients who were admitted to the Central India Institute of Medical Sciences 90

(CIIMS), Nagpur between September 2009 and December 2009. Patients included 17 cases with 91

TBM cases (17 clinically suspected with complete clinical findings) and 10 non-TBM disorder 92

cases (four infectious and six non-infectious neurological disorders). The age of the patients with 93

TBM ranged from 6 to 73 years, and there were 17 males and 10 females. CSF samples were 94

obtained from almost all TBM patients before initiation of anti Koch’s treatment (AKT) and 95

were stored at - 20°C until they were tested. The Institutional Ethics Committee of CIIMS, 96

Nagpur, approved the study. 97

98

Inclusion and exclusion criteria. 99

This study includes patients that were suspected to be infected with MTB based on their clinical 100

characteristics, and for whom the follow-up in response to treatment was available. Patients were 101

excluded if there was microbiological evidence of another central nervous system (CNS) 102

infection. 103

104

The clinical diagnosis of these entire groups was based on the criteria described below. 105


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

7

TBM group (=17) 106

TBM diagnosis was based on clinical features including subacute or chronic fever and signs of 107

meningeal irritation with or without other features of CNS abnormality. CSF findings in these 108

patients could be described as increased protein levels, decreased glucose levels (CSF/blood 109

glucose ratio, ≤0.5) and pleocytosis with lymphocyte predominance. Patients where AFB was 110

demonstrated by smear and/or cultures were considered “confirmed” cases of TBM. In the 111

remaining cases, evidence of tuberculosis meningitis from both computed tomography (CT) or 112

magnetic resonance imaging (MRI), and response to AKT, high Adenosine Deaminase Activity 113

(ADA) values were used as the criteria for the “suspected/probable” cases of TBM diagnosis. 114

115

Non-TBM group (=10) 116

Three female patients and seven male patients with a mean age of 39.25 years (age range, 117

19 to 73 years) with other infectious diseases of the CNS were enrolled as controls: 4 had 118

viral meningoencephalitis with a typical self-limited clinical course, slightly elevated CSF 119

protein concentrations, and increased cell counts dominated by lymphocytes; and 1 120

cryptococcus meningitis verified with an India ink preparation; and 5 had other 121

noninfectious neurological diseases including 2 cases of polyneuritis and 2 case of cerebral 122

infarction and 1 case of pituitary adenoma. 123


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

8

Microbiological Investigations. 124

125

CSF samples of approximately 3-4 ml were initially available. A total of 2 ml of CSF samples 126

were used for routine biochemical and microbiological tests. Briefly, 2 ml of CSF was 127

centrifuged, and a portion of the pellet was examined by Gram, India ink and Ziehl-Neelsen 128

stains. The remaining portion of the pellet was cultured on blood and chocolate agar for bacteria 129

and fungi, on Löwenstein-Jensen medium (Becton Dickinson) and in liquid 7H9 media 130

(Mycobacterium Growth Indicator Tubes, Becton Dickinson) for mycobacteria. CSF cultures 131

were incubated at 37°C for 12 weeks and examined weekly for growth. The supernatant was 132

used in routine biochemical tests. 133

Phenol Chloroform based DNA extraction. Approximately 1-1.5 ml of sample was used to 134

extract DNA. The DNA extracted was further used in the LAMP and the nested PCR assays as 135

previously described (4). Briefly, 100 ul of pellet suspensions of CSF samples were subjected to 136

cell lysis using detergents and then purified by phenol chloroform extraction. The resulting DNA 137

was ethanol precipitated and dissolved in 50 ul of TE buffer. 138

Primer Design. The LAMP reaction was designed using six primers targeting the MTB IS6110 139

gene as previously described by Aryan et al. (2): a forward inner primer (FIP), a reverse inner 140

primer (BIP), two outer primers (F3 and B3) and two loop primers (FLP and BLP). FIP consists 141

of a complementary F1 sequence and an F2 sense sequence. BIP consists of a B1 sense sequence 142

and a B2 complementary sequence. And two loop primers [the forward loop primer (FLP) and 143

the reverse loop primer (BLP)] were designed to accelerate the amplification reaction. The 144

primer sequences are as follows: F3 (5- AGACCTCACCTATGTGTCGA -3), B3 (5-145

TCGCTGAACCGGATCGA-3),FIP,(5-ATGGAGGTGGCCATCGTGGAAGCCTACGTGGC 146


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

9

CTTTGTCAC-3), BIP (5AAGCCATCT GGACCCGCCAACCCCTATCGTATGGTGGAT-3), 147

FLP (AGGATCCTGCGAGCGTAG) and BLP (AAGAAGGCGTACTCGACCTG). 148

LAMP reaction. LAMP was carried out in a 25 µl reaction mixture containing 50 pmol each of 149

the FIP and BIP primers, 5 pmol each of the outer F3 and B3 primers, 25 pmol each of the loop 150

primers F and B and 8 U of the large Bst DNA polymerase fragment (New England Biolabs, 151

Beverly, MA) in 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 8 mM MgSO4 10 mM (NH4)2SO4, 152

0.1% Tween 20, 0.8 M betaine (Sigma, St. Louis, MO), and 1.4 mM of each dNTP and the 153

template DNA. The LAMP assay was monitored in real-time by incubating the reaction mixture 154

at 63°C for 60 min in a Loopamp real-time turbidimeter (LA-200; Teramecs, Japan). Positive 155

and negative controls were included in each run, and all precautions to prevent cross-156

contamination were observed. 157

158

Detection of the amplification products 159

Three detection methods were used to analyze false positive and false negative results real-time 160

turbidity detection, agarose gel analysis and visual detection. Changes in absorbance at 400 nm 161

were measured in real-time using a Loopamp real-time turbidimeter (LA-200) to detect changes 162

in turbidity. 163

164

Nested PCR. The sensitivity and specificity of the LAMP assay was compared with the 165

specificity and sensitivity of nested PCR targeting the IS6110 region according to the manual’s 166

instruction (Genei Amplification kit, Bangalore Genei, Banglore, India). In the first step, the IS 167

region of the complex MTB DNA sequence (220 bp) was amplified using specific external 168

primers. In the second step, nested primers were added to further amplify a 123 bp product. 169


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

10

Amplification products were separated on 2% agarose gels, visualized on a Gel Doc system 170

(Biotech R & D Laboratories, Yercud, Salem, India) and photographed. To prevent cross-171

contamination, different sets of pipettes and distinct work areas were used for DNA template 172

preparation, PCR mixture preparation, DNA amplification and gel analysis. Moreover, one 173

positive and negative control, included with every set of samples, was used during DNA 174

extraction, PCR and LAMP. 175

176

Statistical analysis 177

An O.D. cut-off value used in differentiating TBM from non-TBM patients was determined 178

using the Medcalc statistical software receiver operating characteristic curve (ROC) analysis. 179

The ROC point of inflexion was used as a diagnostic cut-off. Sensitivity was calculated as the 180

number of true positives/(number of true positives + number of false negatives), and the 181

specificity was calculated as the number of true negatives/(number of true negatives + number of 182

false positives). The positive predictive value (PPV) was calculated as true positives × 100/ (true 183

positives + false positives) and the negative predictive value (NPV) was calculated as true 184

negatives × 100/ (true negatives + false negatives). The concordance between the two tests was 185

calculated using Kappa statistics and expressed as a -value. 186


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

11

Results 187

Figure 1 shows the ROC curve for determining the cut-off value, which was determined to be 188

0.0024. Specimens with absorbance equal to or greater than the cut-off value were considered 189

positive reactions. 190

The TBM and non-TBM CSF LAMP assay results are listed in Table 1. The samples were 191

considered to be positive or negative on the basis of the turbidometric results. In 17 of the 192

clinically suspected TBM patients tested using the LAMP assay, 88.23% (15/17) were positive 193

for TBM. Clinical diagnosis of the two false negative cases revealed one case had HIV 194

encephalopathy with TBM, while the other case had TBM with pyogenic meningitis. Twenty 195

percent (2/10) of the non-TBM patients scored positive in the LAMP assay. One case was 196

diagnosed with encephalitis, but the patient had suffered from pulmonary TB five years prior to 197

the test, raising the possibility of TBM infection. The other case was diagnosed as being in a 198

multi-infarction state. Since AKT was not initiated in either of these cases, they were considered 199

to be non-TBM samples. Thus, specificity of the LAMP assay was 80%. The test PPV and NPV 200

were 88.23 % and 80%, respectively. 201

202

The nested PCR assay results for the TBM and non-TBM CSF samples are listed in Table 2. In 203

52.9% (09/17) of cases, the nested PCR result was positive, while the specificity of the nested 204

PCR was about 90%. The test PPV and NPV were 90% and 52.94%, respectively. 205

Table 3 shows the concordance of TBM diagnosis using both LAMP and nested PCR. Eight 206

samples were positive, while one sample was negative in both tests. Thus, there was concordance 207

between the two test results in 9 of 17 samples, and agreement was found to be 52% ( = 0.014). 208


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

12

Similarly, 7 of 10 samples in the non-TBM group were negative in both tests, yielding a 209

concordance of 80% ( =0.375). Two samples from the non-TBM infectious disorder group were 210

positive using the LAMP assay, and one of these samples was also positive using the nested PCR 211

assay. 212

To understand the reason for the high percentage of positive samples using the LAMP assay 213

compared to nested PCR, we analyzed the respective O.D. values obtained from the LAMP 214

assay. Table 4 lists the nested PCR and LAMP assay results from the clinically suspected TB 215

group. In subjects that had a positive nested PCR results, the LAMP O.D. values were 216

considerably higher than for samples that had negative nested PCR results. There was one 217

exception that had a positive nested PCR result and an O.D. value of -0.081, and this sample was 218

therefore negative in the LAMP assay. Another negative sample in the LAMP assay had an O.D. 219

value of -0.004 and was also negative in the nested PCR assay. 220

221

Comparative analysis was performed between the three methods used to detect LAMP products: 222

turbidometric analysis, visual detection by the naked eye and the gel-based detection assay. 223

Turbidometric analysis was performed as mentioned above. Visual detection was performed with 224

the naked eye using SYBR green I, which turns green in the presence of amplified DNA. A 225

sample was considered positive when the reaction mixture turned green after the addition of 226

SYBR green I dye. The end point determination for a positive sample by agarose gel-based 227

detection was done by observing a typical ladder pattern. The results obtained using SYBR green 228

I were not truly consistent with the results from the real-time turbidometer. Figure 2 shows that 229

all three systems were equally sensitive in detecting highly positive and negative cases. 230

However, CSF samples from the clinically suspected TBM group, in which the O.D. for the 231


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

13

LAMP assay was only slightly above the set threshold limit, were not easily discriminated as 232

positive or negative using the SYBR green assay. In all these cases, the typical ladder pattern 233

was detected on the gel. 234


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

14

Discussion 235

Therapy for TBM treatment is usually initiated empirically on the basis of strong clinical 236

suspicion, radiological, CSF cytological and biochemical, ADA findings (11,15,30). Newer 237

diagnostic modalities that can rapidly aid in confirming the clinical suspicion of TBM are 238

still needed. The present study in this context describes the diagnostic utility of LAMP in 239

the diagnosis of TBM which is difficult to diagnose clinically. LAMP detected MTB in 240

88.23% of culture negative cases, illustrating that LAMP can be a sensitive technique that 241

can provide clinical confirmation of suspected TBM cases. To the best of our knowledge, 242

our work is the first to report the use of LAMP to diagnose TBM in patients. However, a lot 243

of previous work detecting MTB in pulmonary samples, such as sputum, has been done and is in 244

good agreement with our study. Studies done by Pandey et al., have found a sensitivity of 96.1% 245

(49/51) in smear-positive and-culture positive sputum samples, but in smear-negative and 246

culture-positive samples, the sensitivity decreased to 85.0% (17/20 sputum samples). The 247

specificity was reported to be 76.7% (23/30 sputum samples) (21). In another study, the 248

sensitivity of MTB-LAMP in smear- and culture-positive sputum samples was 97.7% (173/177), 249

whereas the sensitivity was much lower than in the present results at only of 48.8% (21/43) in 250

smear-negative and culture- positive samples (3). These studies are in agreement with our study 251

and reflect that LAMP is useful not only for clinical confirmation in culture positive cases, but 252

also in the clinical confirmation where bacterial load is low. However, more studies are needed 253

to improve the sensitivity of the LAMP assay in culture negative cases. 254

255

The reason for high sensitivity in our study may be due to three factors. First, the sample 256

tested was CSF which have less inhibition as compared to other biological samples. The 257


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

15

second factor is the selection of primers targeting high copy number gene i.e IS6110. This is 258

supported by work done by Aryan et al., who have shown that by designing primers to this 259

region, 5 fg of MTB (equivalent to 1 copy) could be detected which was better than when 260

used by other primers(2). We have also performed experiments on serial dilutions by 261

spiking a control CSF sample with known concentrations of M.tuberculosis, and obtained a 262

high analytical sensitivity of about 10 CFU/100ul, demonstrating that by using the IS6110 263

primers, LAMP can also be effective in CSF samples. The second important point that we 264

have taken into account is the determination of an appropriate cut-off, or threshold value, 265

that can be helpful in discriminating between a TBM and non-TBM samples, even with a 266

very low load. This differs from the standard threshold value of 0.1 that had been 267

determined earlier by several workers (7, 14, 20, 22). With this O.D., a large number of 268

samples would have turned out to be false negatives. Therefore, we calculated a different 269

threshold value of 0.0024, which was more appropriate for CSF samples. This was similar 270

to the work done by, Han et al., who used different threshold values to differentiate 271

between different species of plasmodium (6). 272

273

LAMP performance was also compared to nested PCR in the same set of samples. Nested 274

PCR is the molecular method of choice for diagnosis of TBM infection in samples 275

harboring a low microbial load (27, 28).In accordance with few earlier published reports 276

(23,24), in our study also the LAMP assay was more sensitive than nested PCR. The 277

possible reason of lower sensitivity could have been inhibition of the nested PCR reaction 278

as mentioned in previous study (5). However in our study this was ruled out because all the 279

internal controls in nested PCR reaction yielded positive results. Even the clinical 280


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

16

sensitivity of the test was high in our previous studies (18). The reason which we could 281

figure out for the discrepancy between the two tests was the analytical sensitivity of the 282

nested PCR kit. By performing the spiking experiments in CSF, the analytical sensitivity of 283

nested PCR was found to be 20 CFU/100ul which is lower than the analytical sensitivity of 284

LAMP. It may be due to this fact that some samples with very low bacterial load have 285

turned out to be LAMP positive but nested PCR negative. Since it was further observed 286

that these LAMP positive but nested PCR negative samples have a low O.D value with 287

LAMP strongly suggests the presence of low bacterial load in these samples. Further 288

analysis of these LAMP-positive samples verified that these were positive samples, which 289

was determined through patient follow-up. This suggests LAMP can be useful for detecting 290

TBM cases at an early stage of disease that can be missed by other diagnostic test. 291

Despite the encouraging results obtained using LAMP, there were some issues of major concern. 292

Two of the clinically suspected TBM cases appeared to be LAMP-negative. In spite of having a 293

confirmatory observation, this issue needs to be further studied by incorporating internal 294

amplification controls. This will be helpful in determining whether any kind of inhibition is 295

occurring in these reactions that may be responsible for such results. Since the turbidity assay is 296

carried out in a closed system, the risk of contamination is lower than when agarose gel 297

electrophoresis is used, providing an additional advantage of the LAMP assay in clinical use. 298

However, we still obtained two false positive results using this assay. Analysis of false positive 299

reactions using sequencing and restriction enzyme analysis would easily distinguish between 300

false positives and contamination. To reduce the chances of contamination, we carried out 301

necessary precautions for avoiding any discrepancies in the results, however technical limitations 302

can be possible for erroneous results. 303


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

17

One of the great advantages of the LAMP assay is that amplification can be monitored with 304

the naked eye using SYBR Green I dye. Boehme et al., have found that this type of 305

detection system is easy and helpful in discriminating TB and non-TB samples, and they 306

have shown an inter-reader variability of only 0.4% (3). However, in our case, some 307

samples were not easily discriminated by visual detection. Although gel electrophoresis was 308

sensitive, real-time monitoring using an inexpensive turbidometer was the most suitable 309

method for interpretation of results because it was able to resolve small variability in 310

sample concentrations. 311

The LAMP technique can be a useful option for detecting TBM infection in low copy number 312

CSF samples. However, a greater number of samples have to be analyzed to compare it with 313

other commonly used methods. Based on our study, we propose the importance of setting 314

appropriate threshold limits, which should vary according to the biological fluid analyzed and the 315

amount of microbial load it harbors. For instance, it may be necessary to have a lower threshold 316

limit for CSF and a higher threshold limit for sputum samples for the same infection, such as TB, 317

for the assays to be clinically meaningful. 318

Conclusion 319

The LAMP assay can be beneficial in confirming TBM infection in clinically suspicious cases 320

when small mycobacterial loads are present. It is more sensitive than nested PCR. In addition, it 321

only takes 60 min, compared to the 3-4 hr it takes for other molecular tests, making it beneficial 322

for tertiary health care centers demanding quick results. 323

Acknowledgment 324

The study was funded by the Central India Institute of Medical Sciences (CIIMS) as part of an 325

in-house project.326


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

18

References 327

1. Adhikari, B.R., B.D. Pandey, P. Ghimire, B.Shrestha,M. Khadka, T. Yoda and Y. Suzuki. 328

2009. Loop-mediated isothermal amplification (LAMP) for the direct detection of human 329

pulmonary infections with environmental (nontuberculosis) mycobacteria. Jpn. J. Infect. 330

Dis. 62:212-214. 331

2. Aryan, E., M. Makvandi, A. Farajzadeh, K. Huygen, P. Bifani P, S.L., Mousavi , A. 332

Fateh ,A. Jelodar, M.M. Gouya and M. Romano.2010. A novel and more sensitive loop-333

mediated isothermal amplification assay targeting IS6110 for detection of 334

Mycobacterium tuberculosis complex. Microbiol. Res.165:211-220. 335

3. Boehme, C.C.,P. Nabeta , G. Henostroza , R. Raqib , Z. Rahim, M. Gerhardt, E. Sanga, 336

M. Hoelscher,T. Notomi, T. Hase, and M.D. Perkins.2007. Operational Feasibility of 337

Using Loop-Mediated Isothermal Amplification for Diagnosis of Pulmonary 338

Tuberculosisin Microscopy Centers of Developing Countries. J. Clin. Microbiol. 45: 339

1936–1940. 340

4. Deshpande, P.S., R.S. Kashyap , S.S. Ramteke , K.J. Nagdev , H.J. Purohit ,G.M. Taori 341

and H.F.Daginawala.2007. Evaluation of the IS6110 PCR assay for the rapid diagnosis of 342

tuberculous meningitis. Cerebrospinal Fluid Res.4: 10. 343

5. Enosawa, M.,S. Kageyama , K. Sawai , K. Watanabe ,T. Notomi, S. Onoe ,Y. Mori and 344

Y.Yokomizo.2003. Use of loop-mediated isothermal amplification of the IS900 sequence 345

for rapid detection of cultured Mycobacterium avium subsp. paratuberculosis. J Clin 346

Microbiol. 41:4359-4365. 347

6. Han, E.T., R. Watanabe, J. Sattabongkot , B. Khuntirat, J. Sirichaisinthop ,H. Iriko, L. Jin 348

,S. Takeo and T. Tsuboi.2007. Detection of four Plasmodium species by genus- and 349


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

19

species-specific loop-mediated isothermal amplification for clinical diagnosis. J. Clin. 350

Microbiol.45:2521-2528. 351

7. Hong, T.C., Q.L. Mai , D.V. Cuong, M. Parida, H. Minekawa, T. Notomi, F. Hasebe , 352

and K.Morita.2004.Development and evaluation of a novel loop-mediated isothermal 353

amplification method for rapid detection of severe acute respiratory syndrome 354

coronavirus. J. Clin. Microbiol.42:1956-1961. 355

8. Iwamoto, T., T. Sonobe and Hayashi. 2003, Loop-mediated isothermal amplification for 356

direct detection of Mycobacterium tuberculosis complex, M. avium, and M. intracellulare 357

in sputum samples. J Clin Microbiol. 41:2616-2622. 358

9. Kashyap, R.S., K.M. Dobos, J.T. Belisle, H.J. Purohit, N.H. Chandak, G.M. Taori and 359

H.F.Daginawala.2005.Demonstration of components of antigen 85 complex in 360

cerebrospinal fluid of tuberculous meningitis patients. Clin. Diagn. Lab. Immunol. 361

12:752-758. 362

10. Kashyap, R.S., S.P. Ramteke, P.S. Deshpande, H.J. Purohit, G.M. Taori and Daginawala 363

HF.2007. Comparison of an adenosine deaminase assay with ELISA for the diagnosis of 364

tuberculous meningitis infection. Med Sci Monit.13:200-204. 365

11. Katti, M.K.2004. Pathogenesis, diagnosis, treatment, and outcome aspects of cerebral 366

tuberculosis. Med Sci Monit.10:215-229. 367

12. Lee, M.F., Y.H. Chen and C.F. Peng.2009. Evaluation of reverse transcription loop-368

mediated isothermal amplification in conjunction with ELISA-hybridization assay for 369

molecular detection of Mycobacterium tuberculosis. J Microbiol Methods. 76:174-180. 370


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

20

13. Mori, Y., K. Nagamine, N. Tomita, and T. Notomi. 2001. Detection of loop-mediated 371

isothermal amplification reaction by turbidity derived from magnesium pyrophosphate 372

formation. Biochem. Biophys. Res. Commun. 289:150–154. 373

14. Mori, Y., M. Kitao, N. Tomita, and T. Notomi. 2004. Real-time turbidimetry of LAMP 374

reaction for quantifying template DNA. J. Biochem. Biophys. Methods 59:145-157. 375

15. Murakami, S., M. Takeno ,H. Oka , A. Ueda, T. Kurokawa , Y. Kuroiwa and Y. 376

Ishigatsubo . 2008. Diagnosis of tuberculous meningitis due to detection of ESAT-6-377

specific gamma interferon production in cerebrospinal fluid enzyme-linked immunospot 378

assay. Clin Vaccine Immunol. 15:897-899. 379

16. Nagamine, K., T. Hase, and T. Notomi. 2002. Accelerated reaction by loop mediated 380

isothermal amplification using loop primers. Mol. Cell Probes 16:223–229. 381

17. Nagdev, K.J., R.S. Kashyap, P.S. Deshpande, H.J. Purohit, G.M. Taori and H.F. 2010. 382

Comparative evaluation of a PCR assay with an in-house ELISA method for diagnosis of 383

Tuberculous meningitis. Med Sci Monit.16:289-295. 384

18. Nagdev, K.J., R.S. Kashyap, P.S. Deshpande, H.J. Purohit, G.M. Taori and H.F. 385

Daginawala. 2010. Determination of polymerase chain reaction efficiency for diagnosis 386

of tuberculous meningitis in Chelex-100® extracted DNA samples. Int J Tuberc Lung 387

Dis 14:1–7. 388

19. Notomi, T., H.Okayama, H. Masubuchi, T. Yonekawa, K. Watanabe, and N. Amino. 389

2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28:E63. 390

20. Okafuji, T., N. Yoshida,M. Fujino, Y. Motegi, T. Ihara ,Y. Ota, T. Notomi , and T. 391

Nakayama.2005. Rapid diagnostic method for detection of mumps virus genome by loop-392

mediated isothermal amplification. J. Clin. Microbiol. 43:1625-1631. 393


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

21

394

21. Pandey, B.D., A. Poudel, T. Yoda, A. Tamaru, N. Oda , Y. Fukushima, B. Lekhak, B. 395

Risal ,B. Acharya, B. Sapkota, C. Nakajima, T. Taniguchi, B. Phetsuksiri ,and Y. 396

Suzuki.2008. Development of an in-house loop-mediated isothermal amplification 397

(LAMP) assay for detection of Mycobacterium tuberculosis and evaluation in sputum 398

samples of Nepalese patients. J. Med. Microbiol. 57:439-443. 399

22. Parida, M.M., S.R. Santhosh, P.K. Dash, N.K. Tripathi, P. Saxena, S. Ambuj, A.K. Sahni, 400

P.V. Lakshmana Rao, and K.Morita.2006. Development and evaluation of reverse 401

transcription-loop-mediated isothermal amplification assay for rapid and real-time 402

detection of Japanese encephalitis virus. J Clin Microbiol.44:4172-4178. 403

23. Paris, D.H., M. Imwong , A.M. Faiz , M. Hasan, E.B. Yunus, K. Silamut, S.J. Lee, N.P. 404

Day and A.M. Dondorp. Loop-mediated isothermal PCR (LAMP) for the diagnosis of 405

falciparum malaria. Am J Trop Med Hyg.77:972-976. 406

24. Pham, H.M., C. Nakajima, K. Ohashi and M. Onuma. Loop-mediated isothermal 407

amplification for rapid detection of Newcastle disease virus.2005. J. Clin. Microbiol. 43: 408

1646–1650. 409

25. Poudel, A., B.D. Pandey , B. Lekhak , B. Rijal ,B.R. Sapkota and Y. Suzuki .Clinical 410

profiling and use of loop-mediated isothermal amplification assay for rapid detection of 411

Mycobacterium tuberculosis from sputum. Kathmandu Univ Med J (KUMJ). 2009.7:109-412

114. 413

26. Rafi, W., M.M. Venkataswamy, S. Nagarathna, P. Satishchandra and A. Chandramuki. 414

Role of IS6110 uniplex PCR in the diagnosis of tuberculous meningitis: experience at a 415

tertiary neurocentre.2007. Int J Tuberc Lung Dis. 11:209-214. 416


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

22

27. Takahashi, T., T. Nakayama, M. Tamura ,K. Ogawa ,H. Tsuda ,A. Morita, M. Hara, 417

M.Togo, H. Shiota , Y. Suzuki, M. Minami, H. Ishikawa, K. Miki , E. Shikata, S. 418

Takahashi and T. Kuragano.2005. Nested polymerase chain reaction for assessing the 419

clinical course of tuberculous meningitis. Neurology.64:1789-1793. 420

28. Takahashi, T., M. Tamura, Y. Asami , E. Kitamura, K. Saito, T. Suzuki , S.N. 421

Takahashi, K. Matsumoto, S. Sawada , E.Yokoyama and T. Takasu. 2008. Novel Wide-422

Range Quantitative Nested Real-Time PCR Assay for Mycobacterium tuberculosis 423

DNA: Clinical Application for Diagnosis of Tuberculous Meningitis . J Clin Microbiol. 424

46: 1698–1707. 425

29. Thwaites, G. E., T. T. Chau, K. Stepniewska, N. H. Phu, L. V. Chuong, D. X. Sinh, N. 426

J.White, C. M. Parry, and J. J. Farrar. 2002. Diagnosis of adult tuberculous meningitis by 427

use of clinical and laboratory features. Lancet 360:1287-1292. 428

30. Venkataswamy, M.M., W. Rafi , S. Nagarathna ,V. Ravi , A. Chandramuki. Comparative 429

evaluation of Bactec 460TB system and Lowenstein Jensen medium for the isolation of 430

M. tuberculosis from cerebrospinal fluid samples of tuberculous meningitis patients. Ind J 431

Med Microbiol 2007;25:236-40. 432

31. Wada, T., S. Maeda, A. Tamaru, S. Imai, A. Hase, and K. Kobayashi. 2004. Dual- probe 433

assay for rapid detection of drug-resistant Mycobacterium tuberculosis by real-time PCR. 434

J. Clin. Microbiol. 42:5277–5285. 435

32. Wang, J. T., C. C. Hung, W. H. Sheng, J. Y. Wang, S. C. Chang, and K. T. Luh. 2002. 436

Prognosis of tuberculous meningitis in adults in the era of modern antituberculous 437

chemotherapy. J Microbiol Immunol Infect. 35:215-222. 438


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

23

33. Zhang, J., G. H. Zhang ,L. Yang , R. Huang, Y. Zhang ,K. Jia, W. Yuan and S.J. Li . 6 439

Feb 2010. Development of a loop-mediated isothermal amplification assay for the 440

detection of Mycobacterium bovis. Vet J. doi:10.1016/j.tvjl.2010.01.001 441

34. Zhu, R.Y., K.X. Zhang, M.Q. Zhao , Y.H. Liu ,Y.Y. Xu , C.M. Ju, B. Li and J.D. Chen. 442

2009.Use of visual loop-mediated isotheral amplification of rimM sequence for rapid 443

detection of Mycobacterium tuberculosis and Mycobacterium bovis. J Microbiol 444

Methods. 78:339-343. 445


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

24

Table 1: Sensitivity, specificity, positive predictive value and negative predictive value for 446

LAMP in clinically suspected TBM and non-TBM classified groups. 447

448

449

450

Group Clinically

suspected TBM

cases=17

NON-TBM

cases=10

Sensitivity Specificity PPV NPV

LAMP

positive

15 2

LAMP

negative

2 8

88.23%

80%

88.23%

80.00%


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

25

Table 2: Sensitivity, specificity, positive predictive value and negative predictive value for 451

the nested PCR assay in clinically suspected TBM and non-TBM classified 452

groups. 453

454

455

456

457

458

459

Group Clinically

suspected TBM

cases=17

NON-TBM

cases=10

Sensitivity Specificity PPV NPV

PCR

positive

9 1

PCR

negative

8 9

52.9%

90%

90%

52.94%


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

26

Table 3: Concordance between PCR and LAMP results for TBM and non-TBM patients. 460

461

DIAGNOSIS LAMP Results PCR Positive PCR Negative Concordance( )

LAMP (+ 15) 8 7 TBM (17)

LAMP (- 02) 1 1

52% (0.014)

LAMP (+02) 1 1 Non-TBM (10)

LAMP (-08) 1 07

80% (0.375)


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

27

462

Table 4: Nested PCR and corresponding LAMP results in individual patients from the 463

clinically suspected TBM group. 464

Clinically suspected

TBM patients=

NESTED PCR LAMP result Corresponding

LAMP O.D.

values

1 Positive Positive .21








9 Positive Negative -.081

10 Negative Positive .003







17 Negative Negative -.004


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

values

0 20 40 60 80 100

100

80

60

40

20

0

100-Specificity

Se

nsitiv

ity

Sensitivity: 88.2 Specificity: 80.0 Criterion : >0.0024

Figure 1: ROC curve analysis of the sensitivities and specificities of the LAMP

methods, with 0.0024 derived as the cut-off value


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

L1 L2 L3 L4 L5 L6

T1 T2 T3 T4 T5 T6

SAMPLES TBM TBM TBM TBM TBM NTBM

O.D. at 440 nm .378 .025 .034 .051 .03 -.081

FIG. 2: O. D. values, visualization with the naked eye after SYBR green addition and electrophoretic analysis of LAMP

products. T1-T5- Tubes representing visual detection by addition of SYBR green dye in clinically suspected TBM cases,

T6-non-TBM. L1-L6-respective gel pattern forT1-T6


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

Downloaded from //jcm.asm.org/content/jcm/early/2011/03/16/JCM... · obtained from almost all TBM...

Documents

Transcript of Downloaded from //jcm.asm.org/content/jcm/early/2011/03/16/JCM... · obtained from almost all TBM...