Downloaded from //aem.asm.org/content/aem/early/2017/07/31/... · 22 Indole is a molecule of...

Genetic and Biochemical Characterization of Indole Biodegradation in 1

Acinetobacter sp. Strain O153 2

3

Mikas Sadauskas#, Justas Vaitekūnas, Renata Gasparavičiūtė, Rolandas Meškys 4

5

Department of Molecular Microbiology and Biotechnology, Institute of 6

Biochemistry, Life Sciences Center, Vilnius University, Sauletekio al. 7, Vilnius, LT-7

10257, Lithuania. 8

E-mail addresses: 9

Mikas Sadauskas – [email protected] 10

Justas Vaitekūnas – [email protected] 11

Renata Gasparavičiūtė – [email protected] 12

Rolandas Meškys – [email protected] 13

14

Running Head: Indole biodegradation in Acinetobacter sp. O153 15

Keywords: indole, biodegradation, bacterial metabolism, Acinetobacter, bacterial 16

signalling, cofactor-independent oxygenases 17

18

#Address correspondence to Mikas Sadauskas, Sauletekio al. 7, Vilnius, LT-19

10257, Lithuania, +37062230055, [email protected] 20

AEM Accepted Manuscript Posted Online 4 August 2017Appl. Environ. Microbiol. doi:10.1128/AEM.01453-17Copyright © 2017 American Society for Microbiology. All Rights Reserved.

on April 23, 2020 by guest

http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

2

ABSTRACT 21

Indole is a molecule of considerable biochemical significance, acting as both an 22

interspecies signal molecule and a building block of biological elements. Bacterial indole 23

degradation has been demonstrated for a number of cases; however, very little is known 24

about genes and proteins involved in this process. This study reports the cloning and 25

initial functional characterization of genes (iif and ant cluster), responsible for indole 26

biodegradation in Acinetobacter sp. strain O153. Catabolic cascade was reconstituted in 27

vitro with recombinant proteins and each protein was assigned an enzymatic function. 28

Degradation starts with oxidation, mediated by IifC and IifD flavin-dependent two 29

component oxygenase system. Formation of indigo is prevented by IifB and the final 30

product – anthranilic acid – is formed by IifA, an enzyme which is both structurally and 31

functionally comparable to cofactor-independent oxygenases. Moreover, the iif cluster 32

was identified in the genomes of wide range of bacteria, suggesting the potential 33

widespread of Iif-mediated indole degradation. This work provides novel insights into 34

genetic background of microbial indole biodegradation. 35

36

IMPORTANCE 37

The key finding of this research is identification of genes, responsible for 38

microbial biodegradation of indole, a toxic N-heterocyclic compound. A large amount of 39

indole is present in urban waste water and sewage sludge raising a demand for efficient 40

and eco-friendly means to eliminate this pollutant. A common strategy of oxidizing 41

indole to indigo has a major drawback of producing insoluble material. Genes and 42

proteins of Acinetobacter sp. strain O153 (DSM 103907) reported here pave the way for 43


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

3

effective and indigo-free indole removal. In addition, this work suggests possible novel 44

means of indole-mediated bacterial interactions and provides the basis for future research 45

on indole metabolism. 46


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

4

INTRODUCTION 47

48

Indole is an N-heterocyclic aromatic compound derived mainly by TnaA 49

tryptophanase from L-tryptophan in Escherichia coli (1) and is widely found in natural 50

environments. Indole acts as cell-to-cell signalling molecule that regulates the expression 51

of several virulence genes (2-4), promotes biofilm formation (5-7) and mediates complex 52

predator-prey interactions (8, 9). At high concentrations indole and its derivatives exhibit 53

toxic activity to both prokaryotic cells and animals and are even considered mutagens 54

(10). Toxic indole concentration reportedly varies for different microorganisms in the 55

range of 0.5–5 mM (11). The main mechanisms of indole toxicity are reported to be an 56

alteration of membrane potential with subsequent inhibition of cell division (12), 57

depletion of ATP levels (13) and an inhibition of acyl-homoserine lactone (AHL)-based 58

quorum-sensing by regulator misfolding (14). 59

In order to utilize aromatic compounds as energy source, microorganisms have to 60

cope with the problem of high resonance energy that stabilizes the aromatic ring system 61

(15). A common strategy is the use of oxygenases and O2, which itself requires the 62

activation of dioxygen. In addition to being thermodynamically unfavourable, reactions 63

between dioxygen (triple state) and most of the organic compounds (singlet state) are not 64

possible due to a spin barrier (16). Diverse elements, including transition metals (iron, 65

manganese, copper) or organic cofactors (flavins, pterin) are used extensively by 66

oxygenases to form a superoxide, a reactive singlet state form of dioxygen (17). As 67

nature never ceases to amaze, a remarkable group of cofactor-independent oxygenases 68

have been described which require neither an organic cofactor nor a metal to catalyse the 69


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

5

incorporation of (di)oxygen into a single molecule of organic substrate (18, 19). 70

Establishment of the catalytic mechanisms for this group of enzymes provides interesting 71

mechanistic insights into substrate-assisted oxygen activation (20, 21). 72

To defend against its toxicity, indole-encountering bacteria have established 73

enzymatic detoxification systems, notably the oxidation of indole to insoluble non-toxic 74

indigoid pigments (22, 23) and biodegradation mechanisms (24, 25). A number of indole 75

degrading bacterial microorganisms (26-28) as well as bacterial consortia (29) were 76

reported, but no genetic background in these reports have been specified. Several 77

possible intermediates in bacterial indole degradation are also known, but proteins with 78

specific enzyme activities that drive the degradation cascade have not been identified in 79

this context. In this paper, the identification of indole degradation gene cluster (iif) in 80

indole-degrading Acinetobacter sp. strain O153 is reported. Catabolic pathway was 81

reconstituted in vitro with the recombinant proteins encoded by the iif genes and the 82

function of each enzyme was identified by analysing the reaction products. 83


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

6

MATERIALS AND METHODS 84

Bacterial strains, chemicals and standard techniques 85

Escherichia coli DH5α and BL21(DE3) strains were used as cloning and protein 86

expression hosts, respectively. Transformation of bacteria by electroporation was 87

performed as described previously (31). E. coli strains with plasmids were cultivated in 88

LB medium supplemented with corresponding antibiotic (ampicillin, 100 μg/ml or 89

kanamycin, 50 μg/ml). Plasmid DNA was isolated using ZR Plasmid Miniprep Classic 90

kit (ZYMO Research). Indole, isatin and anthranilic acid were purchased from Sigma-91

Aldrich, 5-bromoindoline was obtained from Combi-Blocks Inc. All other chemicals 92

used in this study were of analytical grade. All media and reagent solutions were 93

prepared with Milli-Q water (Merck Millipore). 94

Isolation and identification of indole-oxidizing bacterial strain 95

Indole-oxidizing microorganisms were isolated from the intestine of Orconectes 96

limosus. Crustacean samples were collected at Lake Ruzis, Alytus district, Lithuania. 97

Intestines were suspended in 0.9 % NaCl solution and plated on Luria-Bertani (LB) agar 98

plates supplemented with 1 mM 5-bromoindoline. Following an overnight incubation at 99

30 °C purple pigment-forming colonies were isolated and maintained as pure cultures. 100

16S rRNA gene of isolate strain was amplified with universal bacterial primers 27F and 101

1492R (Table 1) according to (30) and sequenced. Phylogenetic analysis was performed 102

with blastn algorithm (https://blast.ncbi.nlm.nih.gov, 31) against the database of 16S 103

ribosomal RNA sequences. 104

Table 1 105


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

7

Genomic DNA of strain O153 was extracted as described (32), digested with 106

HindIII (ThermoFisher Scientific) to obtain 5–20 kb DNA fragments, which were cloned 107

into pUC19 (ThermoFisher Scientific). Resulting library was transformed into E. coli 108

DH5α, cells were plated on LB agar with 5-bromoindoline, incubated overnight at 37 °C 109

and screened for purple pigment-producing colonies. 110

Whole-cell bioconversion assays and growth conditions 111

For growth kinetics experiments, an overnight culture of strain O153 grown in 112

LB medium was centrifuged, washed with potassium phosphate buffer and re-suspended 113

in 0.9 % NaCl. Cells were diluted in fresh M9 media with different carbon (5 mM 114

succinate or 1 mM indole) and nitrogen (5 g/L NH4Cl or different concentrations of 115

indole) sources. Cell suspensions were incubated at 30 °C with shaking (180 RPM). 116

Growth was monitored by measuring the absorbance at 600 nm. At least three 117

independent experiments were performed. 118

For whole-cell experiments, an overnight culture of Acinetobacer sp. O153 was 119

grown in M9 medium (3.5 g/L Na2HPO4, 1.5 g/L KH2PO4, 2.5 g/L NaCl, 0.2 g/L 120

MgSO4, 0.01 g/L CaCl2) supplemented with 5 mM succinate and 1 mM indole (induced 121

cells) or succinate and 5 g/L NH4Cl (uninduced cells). Cells were pelleted by 122

centrifugation, washed with 20 mM potassium phosphate buffer, pH 7.8, and re-123

suspended in M9 minimal medium to a final concentration of OD600 = 0.8 in a volume of 124

1 ml containing 1mM of appropriate substrate. Cells were incubated at 30 °C with 125

shaking. The sample without cells was used as an evaporation (negative) control. 126

Absorbance spectra of the cell-free supernatants were recorded every hour to monitor 127

substrate consumption. 128


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

8

Cloning, expression and purification of proteins involved in indole 129

degradation 130

All reagents used for the cloning experiments were purchased from ThermoFisher 131

Scientific (Lithuania). Target genes were amplified by PCR in Mastercycler ep Gradient 132

S (Eppendorf) using the primer pairs listed in Table 1, Maxima Hot Start Green PCR 133

Master Mix and a colony of Acinetobacter sp. O153 cells. PCR conditions were as 134

follows: initial denaturation at 98 °C for 4 min, followed by 30 cycles of denaturation at 135

98 °C for 30s, annealing at varying temperatures for 30s, elongation at 72 °C for 90s and 136

final elongation at 72 °C for 10 min. DNA fragments obtained were cloned into 137

pTZ57R/T vector according to manufacturer’s protocol and sequenced. Resulting 138

plasmids were digested with restriction endonucleases that recognize the primer-139

introduced sequences (Table 1) and fragments were ligated into pET28-c(+) (Novagen) 140

previously digested with the same restriction endonucleases. Expression plasmids with 141

N-terminally encoded 6xHis tag were transformed into E. coli BL21 (DE3) for protein 142

expression. Protein expression and purification were carried out as described earlier (33). 143

Protein concentration was determined with Coomassie Protein Assay Kit (Pierce) using 144

bovine serum albumin as the standard. 145

Enzyme assays and detection of reaction products 146

Flavin reductase activity of the purified IifD protein was determined from the 147

decrease of the absorbance at 340 nm due to oxidation of NADH or NADPH (ε340 = 6220 148

M-1

cm-1

), using spectrophotometer and was performed at room temperature. A total 149

reaction volume of 1 ml contained 50 mM Tris-HCl, pH 7.5, variable amounts of NADH 150

or NADPH and flavins (FAD, FMN or riboflavin). Kinetic parameters for NADH and 151


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

9

NADPH were determined using constant concentration of FAD (20 μM) and varying 152

concentrations of NAD(P)H (5–200 μM). In addition, varying concentrations of flavin 153

(1–40 μM) and a constant concentration of NADH (200 μM) were used for analysis of 154

the enzyme kinetics. Reactions were initiated by adding 0.3 μg of the enzyme. One unit 155

(U) of enzyme activity was defined as the amount of enzyme catalysing the oxidation of 156

1 μmol of NAD(P)H per minute. 157

Indole oxidation activity of IifC was determined as a function of indigo formation 158

in reaction mixture. An initial indole oxidation rather than spontaneous dimerization was 159

assumed to be a rate-limiting step. A typical reaction contained 50 mM Tris-HCl, pH 7.5, 160

100 μM flavin, 250 μM NADH or NADPH, varying concentrations of indole (10–500 161

μM) and was initiated by adding 3 μg of IifD as well as 3 μg of IifC. Reactions were 162

incubated at room temperature for 15 min and indigo particles were pelleted by 163

centrifugation at 16000 g for 5 min. Precipitant was dissolved in 100 μl of 164

dimethylformamide (DMF), dissolving was facilitated by incubating the mixture at 37 °C 165

for 15 min. Indigo concentration was determined as described (34), using a molar 166

absorptivity coefficient of ε620 = 14000 M-1

cm-1

. One unit of enzyme activity was 167

defined as the amount catalysing the formation of 1 μmol of indigo per minute. 168

Oxygenase activity of IifA was measured from the increase of absorbance at 315 169

nm (formation of anthranilic acid from 3-hydroxyindolin-2-one). A typical assay 170

contained varying concentrations (10–300 μM) of 3-hydroxyindolin-2-one (synthesized 171

as described below) in 50 mM Tris-HCl, pH 7.5, air-saturated (oxygen concentration ~ 172

250 μM) buffer. Reactions were initiated by adding 3 μg of IifA and the concentration of 173

anthranilic acid formed was determined using a molar absorptivity coefficient of ε315 = 174


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

10

1600 M-1

cm-1

(calculated using Beer-Lambert Law and data on the absorbance of 0.05-5 175

mM anthranilic acid in 50 mM Tris-HCl, pH 7.5. One unit of enzyme activity was 176

defined as the amount catalysing the formation of 1 μmol of anthranilic acid per minute 177

at given conditions. All kinetic parameters were determined by fitting the data to 178

Lineweaver-Burk (double-reciprocal) plots and performing a linear regression. All 179

kinetic experiments were performed in duplicate and average means were derived. 180

Enzymatic conversion of indole by Iif proteins was analysed by monitoring 181

substrate consumption and formation of corresponding reaction products in in vitro 182

reactions. Under standard conditions, a total volume of 250 μl reaction mixture contained 183

50 mM Tris-HCl, pH 7.5, 50 μM flavin cofactor, 100 μM NAD(P)H, 1 mM indole and 3 184

μg of each purified Iif protein. The combinations of proteins tested were as depicted in 185

Fig. 4. Reaction mixtures were incubated at room temperature for 1 hour with shaking 186

(700 rpm, Eppendorf Thermomixer Comfort). Substrate consumption and formation of 187

products were analysed spectrophotometrically in PowerWave XS plate reader (BioTek 188

Instruments Inc.) or mixed with equal volume of acetonitrile, centrifuged at 16000 g for 189

5 min and analysed by HPLC/MS. 190

Oxygen consumption and anaerobic assay 191

The measurement of oxygen consumption was performed with a homemade 192

computer-assisted membrane oxygen electrode and 10.0 ml glass cell. The concentration 193

of oxygen was assumed to be 0.25 mM in air-saturated 50 mM Tris-HCl, pH 7.5, buffer 194

solution at 25 °C. Different concentrations of 3-hydroxyindolin-2-one (82, 136, and 273 195

μM) were used and reactions were initiated by adding 3 μg of IifA. 196


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

11

Anaerobic conditions were generated in an air-restricted cell by argon bubbling of 197

Tris-HCl buffer solution, pH 7.5, at 25 °C for 10 min. Prior to bubbling, traces of oxygen 198

were eliminated from argon gas by passing through the solution of alkaline pyrogallol 199

(benzene-1,2,3-triol). 200

HPLC-MS 201

HPLC/MS analyses were performed using high performance liquid 202

chromatography system (CBM-20A controller, two LC-2020AD pumps, SIL-30AC auto 203

sampler and CTO-20AC column oven; Shimadzu, Japan) equipped with photodiode 204

array (PDA) detector (Shimadzu, Japan) and mass spectrometer (LCMS-2020, 205

Shimadzu, Japan) equipped with an ESI source. The chromatographic separation was 206

conducted using a YMC Pack Pro column, 3 × 150 mm (YMC, Japan) at 40 °C and a 207

mobile phase that consisted of 0.1% formic acid water solution (solvent A), and 208

acetonitrile (solvent B) delivered in the 0 → 60% gradient elution mode. Mass scans 209

were measured from m/z 10 up to m/z 700, at 350 °C interface temperature, 250 °C DL 210

temperature, ±4,500 V interface voltage, neutral DL/Qarray, using N2 as nebulizing and 211

drying gas. Mass spectrometry data was acquired in both positive and negative ionization 212

mode. The data was analysed using the LabSolutions LCMS software. 213

Chemical synthesis of 3-hydroxyindolin-2-one 214

Reduction of isatin to 3-hydroxyindolin-2-one was performed according to (35). 215

Isatin (1.5 mmol) was added in small portions to a stirred suspension of sodium 216

borohydride (0.75 mmol, 2 eq) in 20 mL of a 1:1 water/ethanol mixture at room 217

temperature. The mixture was vigorously stirred until the suspension became colourless 218

(about 10 min). The mixture was extracted with chloroform (3 x 10 mL). The combined 219


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

12

organic extracts were dried (MgSO4) and the solvent evaporated under reduced pressure. 220

The residual material was dissolved in 5 mL deionized water and was purified by reverse 221

phase chromatography (12 g C-18 cartridge) to separate the 3-hydroxyindolin-2-one 222

from the pigments formed during the extraction and evaporation procedures. Prior the 223

purification the column was equilibrated with water. A mobile phase that consisted of 224

water and methanol was delivered in the gradient elution mode. The collected fractions 225

were analysed by HPLC/MS. The fractions containing a pure product were combined 226

and the solvent was removed under reduced pressure. 227

The structures of the bioconversion products were determined using 1H nuclear 228

magnetic resonance (NMR) and 13

C NMR. 1H NMR spectra were recorded in DMSO-d6 229

or CDCl3 on Bruker Ascend 400, 400 MHz, and 13

C NMR were recorded on Bruker 230

Ascend 400, 100 MHz. All products were dissolved in deuterated dimethyl sulfoxide. 231

Spectra were calibrated with respect to the solvent signal (CDCl3, 1H δ =7.26,

13C δ = 232

77.2; DMSO-d6, 1H δ = 2.50,

13C δ = 39.5). 233

Sequence alignments and structure modelling 234

Genome sequences containing genes with high sequence similarity to iif genes 235

were identified with blastn suite (https://blast.ncbi.nlm.nih.gov) by using each of the five 236

iif genes individually. Hits with E-value less than 5e-10 were pooled and used as 237

database in MultiGeneBlast (36). Homology search was performed using an iif locus of 238

A. guillouiae genomic DNA (ranging from nucleotide 1661941 to 1671563) as query 239

with default parameters except that maximum distance between genes in locus was 240

increased to 100 kb. Positive variants were manually proofread with respect to structural 241


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

13

organization of iif and ant genes as well as possible orientation in separate DNA 242

fragments. 243

The model of tertiary structures of N-terminal (amino acids 1–233) and C-244

terminal (amino acids 252–374) domains of IifA protein was obtained using I-TASSER 245

platform (http://zhanglab.ccmb.med.umich.edu/I-TASSER) (37). Structures of 246

dienolactone hydrolases (PDB 1DIN and 1ZI8) were used as threading templates for 247

modelling of N-terminal domain and structures of putative polyketide cyclases (PDB 248

4LGQ and 3F9S) – as templates for C-terminal domain. Models with the highest C-score 249

(1.42 and 0.26 for N- and C-terminal domains, respectively) were selected for further 250

structural analysis and comparison with structures of cofactor-independent oxygenases. 251

Nucleotide sequence and bacterial strain accession numbers 252

Sequence data described in this paper have been submitted to GenBank database 253

under the following accession numbers: 16S rDNA of strain Acinetobacter sp. O153 - 254

KX955254, iifA - KX955255, iifB - KX955256, iifC - KX955257, iifD - KX955258, iifE 255

- KY700688. Strain Acinetobacter sp. O153 has been deposited to DSMZ under 256

accession number DSM 103907. 257


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

14

RESULTS 258

259

Screening for indole-degrading bacteria 260

Numerous microbiome samples obtained from invertebrates as well as soil 261

samples were used for the screening of indole-degrading bacteria as these environments 262

potentially contain indole. Due to the known toxicity of indole, this compound was not 263

used as a sole carbon source for selection of indole-mineralizing bacteria in this study. 264

Instead, a derivative of indole was hypothesized to form a dead-end pigment in the 265

indole-degrading microorganisms. Such strategy enabled the selection of desirable 266

bacteria on the nutrient rich media supplemented with chromogenic substrate 5-267

bromoindoline. 268

A bacterial colony, isolated from the intestine of crustacean Orconectes limosus, 269

which is a widespread invasive species in Europe, was able to convert 5-bromoindoline 270

to insoluble indigoid pigment. The sequence of 16S rRNA gene of this strain showed 99 271

% similarity to 16S rRNA gene sequence of Acinetobacter guillouiae strain NBRC 272

110550 and therefore strain O153 was designated as Acinetobacter sp. O153. Notably, 273

this strain did not produce indigoid pigment when grown on LB agar plates with indole 274

(data not shown). 275

To test the ability of Acinetobacter sp. O153 to assimilate indole as carbon (C) 276

and/or nitrogen (N) source, cells of the strain O153 were cultured in minimal medium 277

with succinate or indole as C sources and NH4Cl or indole as N sources. No growth was 278

observed with indole as the only C source or the only source for both N and C (Fig. 1A). 279

However, moderate growth (up to 0.3 OD600 in 12 h) was achieved with indole (1 mM) 280


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

15

as N source and succinate as sole carbon source. While this effect was observed with 281

indole concentrations ranging from 0.5 mM to 1.5 mM, no growth was recorded with 282

concentrations 0.1 mM and 2 mM (Fig. 1B), which were most likely insufficient and 283

toxic, respectively. 284

Figure 1 285

Whole-cell experiments were performed to determine whether the expression of 286

enzymes involved in indole metabolism are inducible or constitutive. After overnight 287

growth in a minimal medium with succinate and either with or without indole, cells of 288

the strain O153 were re-suspended in buffer containing 1 mM indole. Indole was 289

transformed immediately by indole-induced O153 cells (Fig 2). In contrast, uninduced 290

cells consumed indole significantly slower and with a lag period. These results indicated 291

that indole mineralization (biodegradation) was an inducible process. 292

Figure 2 293

Identification and characterization of genes involved in indole degradation 294

Screening of Acinetobacter sp. O153 genomic library using E. coli DH5α as a 295

host strain revealed one clone (O153H14) which was able to convert 5-bromoindoline to 296

a purple pigment, a characteristic feature of the wild-type strain O153. The clone 297

O153H14 was bearing a pUC19 vector with 12-kb genomic DNA fragment. The DNA 298

sequencing of this fragment revealed the presence of nine open reading frames (ORFs, 299

depicted in Fig. 3). Bioinformatic analysis of ORFs in this fragment using NCBI’s blastn 300

algorithm and Conserved Domain Database (38) allowed the identification of two 301

different sets of genes (Table 2). The iif cluster comprised the first set and the second set 302

encoded a multi-subunit anthranilate dioxygenase. The two sets were separated by a 303


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

16

putative araC transcription regulator. Analysis of iif cluster suggested both high 304

sequence identity and structural similarity to iif genes, which were shown to comprise a 305

functional operon induced by indole in A. baumannii ATCC19606 (23). Hence, genes 306

and proteins presented here were given the same nomenclature and were called Iif 307

homologues. Five genes of the iif operon encoded putative enzymes as described by 308

conserved domain analysis: iifA – dienolactone hydrolase family protein, iifB – short-309

chain dehydrogenase, iifC – oxygenase, iifD – flavin reductase, iifE – putative phenol 310

degradation protein. The ant cluster was composed of three genes encoding different 311

subunits of the anthranilate dioxygenase and appeared to be of typical composition: antA 312

and antB encoded large and small subunits of anthranilate dioxygenase oxygenase 313

component, respectively, while antC coded for the electron transfer component protein. 314

Table 2 315

Distribution of iif homologs among bacterial genomes 316

The prevalence of iif operon genes as well as genes of anthranilate dioxygenase 317

among available microbial genomes was analysed. Mainly organisms from genus 318

Acinetobacter, Pseudomonas and Burkholderia were identified, including some 319

notoriously pathogenic strains of A. baumannii, P. fluorescens and P. syringiae (Fig. 3). 320

Spatial separation of the two operons was found to be a common indication outside 321

genus Acinetobacter, stretching to as long as 200 kb (B. cepacia ATCC 25416 and 322

Alcaligenes faecalis ZD02) or even separate replicons (B. contaminans MS14, 323

Cupriavidus metallidurans CH34 and C. basilensis 4G11). Also, aberrant composition of 324

the iif operon was predicted in several cases with four genomes (P. fluorescens NCIMB 325


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

17

11764, C. metallidurans CH34, C. basilensis 4G11 and Ralstonia solanacearum PSI07) 326

lacking the iifE homolog. 327

Figure 3 328

Enzyme activity of recombinant Iif proteins 329

To identify the enzymatic functions of Iif proteins, iifA, iifB, iifC, iifD and iifE 330

genes were expressed in E. coli BL21 (DE3) with N-terminal His-tag, purified and tested 331

for activity towards indole, which was monitored by HPLC/MS. Molecular masses of the 332

purified proteins observed in SDS-PAGE corresponded well to the theoretical masses (46 333

kDa of IifA, 28.1 kDa for IifB, 46.3 kDa for IifC and 19.9 kDa for IifD, Fig. S1). 334

IifC was found to be capable of using indole as a substrate only in the presence of 335

IifD flavin reductase, FAD cofactor and NAD(P)H (Fig. 4, peak 3). The product of this 336

reaction was the blue insoluble indigoid pigment (Fig. S2). Next, when IifB was added to 337

the reaction mixture (IifC, IifD, FAD, NADPH, indole), an indigo formation was 338

abolished and a product with identical retention time (4.75 min) as 3-hydroxyindolin-2-339

one was observed (Fig. 4, peak 1). The UV-Vis absorption spectra of this compound and 340

3-hydroxyindolin-2-one were very similar with peaks at 211 nm, 253 and 291 nm (Fig.S 341

3, E and F). Also, both these compounds demonstrated identical molecular masses: 150 342

(3-hydroxyindolin-2-one + H+) and 132 (3-hydroxyindolin-2-one – H2O + H

+) (Fig. S3, 343

E and F). Moreover, 3-hydroxyindolin-2-one was consumed by wild-type indole-induced 344

Acinetobacter sp. O153 cells in a similar way to indole (Fig. 2). 3-hydroxyindolin-2-one 345

was rapidly transformed into anthranilic acid, which was then slowly consumed by 346

indole-induced cells. Meanwhile, no consumption was observed with uninduced cells. 347


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

18

These results indicated that 3-hydroxyindolin-2-one was the reaction product of IifB-348

catalysed reaction and did not act as an inducer for indole-degrading proteins. 349

Figure 4 350

When four Iif proteins (IifC, IifD, IifB and IifA) were used in reaction with 351

indole, a compound with m/z 138 [M+H+] was identified, corresponding to [137+H

+] – a 352

molecular mass of anthranilic acid (Fig. S3, A and B). In addition, this reaction product 353

and anthranilic acid shared identical retention times (Fig. 4, peak 2) and UV-Vis 354

absorption spectra (Fig. S3, A and B). Importantly, IifA protein was also capable of 355

using 3-hydroxyindolin-2-one as substrate to form anthranilic acid (Fig. 4, bottom 356

curve). Notably, conversion of 3-hydroxyindolin-2-one to anthranilic acid by IifA did not 357

require any cofactor or metal ion and did not occur with other substrates of similar 358

structure (isatin, N-formyl-anthranilic acid). The presence of IifE protein in any above-359

mentioned reaction mixtures did not change the outcomes of the reactions. Thus, analysis 360

of reaction products formed by IifA both supported the involvement of 3-361

hydroxyindolin-2-one as an intermediate in indole degradation and showed the formation 362

of anthranilic acid, a possible end-product of IifCDBA-catalyzed indole biodegradation. 363

Table 3 364

The kinetic parameters of IifA, IifC and IifD proteins were determined (Table 3). 365

IifD flavin reductase showed the preference for FMN and NADH. In spite of that, FAD, 366

but not FMN or riboflavin was identified as the only flavin cofactor suitable for indole 367

oxidation performed by IifC (data not shown). 368

Identification of IifA as a possible cofactor-independent oxygenase 369


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

19

Structural and functional approaches were used to analyse the enzymatic 370

mechanism of IifA. The conversion of 3-hydroxyindolin-2-one to anthranilic acid by 371

purified recombinant IifA did not require the addition of any cofactor or metal ions. No 372

cofactor – indicating peaks were observed in the UV-Vis spectrum of the purified IifA 373

protein (Fig. S4). Addition of 1 mM PMSF, 0.5 mM HgCl2 or 3 mM EDTA did not 374

inhibited the reaction suggesting a non-hydrolytic metal-ion-independent enzymatic 375

conversion. Moreover, oxygen was consumed in the abovementioned reaction in a 376

substrate-depending manner (Fig. 5A), i.e. an addition of 3-hydroxyindolin-2-one 377

equivalent to oxygen concentration resulted in a complete consumption of oxygen, while 378

1:2 molar ratio of substrate:oxygen consumed half of the oxygen present in air-restricted 379

reaction cell. Notably, the reaction did not occur in the absence of dioxygen (Fig. S5). 380

Oxidation of 3-hydroxyindolin-2-one to anthranilic acid by IifA was monitored 381

spectrophotometrically and a decrease in absorbance at 260 nm as well as an increase in 382

absorbance at 225 nm and 315 nm were observed (Fig. 5B). The presence of two 383

isosbestic points indicated that no intermediates were formed during this reaction. 384

Figure 5 385

Protein sequence analysis of IifA performed using CDD database indicated the 386

presence of two domains: N-terminal DLH-like domain and C-terminal SnoaL-like 387

domain (Fig. S6B). Attempts to obtain separate recombinant domains were unsuccessful 388

due to insolubility suggesting a major structural role of both domains during protein 389

folding. A three-dimensional model of IifA was generated with I-TASSER platform. A 390

standard α/β hydrolase fold was located in the N-terminal domain, composed of a β-sheet 391

of seven strands with the first strand antiparallel to the others. A typical catalytic triad, 392


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

20

common to the majority of hydrolases, was located in this domain and was composed of 393

Cys124, Asp173 and His204 (Fig. S6A). Residues of this putative catalytic triad were 394

located close to each other in the three-dimensional model. Although the overall 395

sequence identity between the N-terminal domain of IifA and well-described cofactor-396

independent dioxygenases Hod and Qdo was low (17.9 % with Hod and 19.1 % with 397

Qdo), the structural resemblance was clearly evident (Fig. S7). 398


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

21

DISCUSSION 399

The present article deals with identification of genes in Acinetobacter sp. strain 400

O153, required for degradation of N-heterocyclic compound, indole. These genes are 401

clustered into an Iif operon with five genes coding for potential enzymes. The initial 402

description of proteins encoded by genes of Iif operon clearly showed the ability of IifC 403

to oxidize indole leading to formation of indigo pigment (23). Here, the ability of IifC to 404

oxidize indole to indigo was confirmed, but no appearance of indigo was observed when 405

three proteins, namely IifC, IifD and IifB, were incubated with indole in vitro, though the 406

concentration of indole readily decreased. Incorporation of all four proteins (IifC, IifD, 407

IifB and IifA) into the reaction mixture resulted in the formation of anthranilic acid. 408

Importantly, genes encoding a multi-subunit anthranilate dioxygenase are located close 409

to the iif operon in most of the organisms, potentially capable of degrading indole, or 410

located in separate chromosomes, as in the case of Cupriavidus metallidurans CH34 and 411

C. basilensis 4G11 (Fig. 3). Anthranilate dioxygenase converts anthranilic acid to 412

catechol (42) which is then catabolized through a well-established β-ketoadipate pathway 413

(43). Such degradation pathway where indole is oxidized to metabolites, directly 414

reaching tricarboxylic acid cycle (TCA) might enable microorganisms to both counteract 415

the toxic effect of indole and use it as a carbon and energy source. Although this may be 416

true for some other microorganisms with reported indole utilization as sole carbon source 417

and iif-ant combination identified, the strain O153 did not grow with indole as the only 418

carbon source. This suggests difficulties in coping with toxic effects of indole (see 419

references in Introduction section) or insufficient metabolic activity to shuttle the indole 420

degradation products into TCA, for example, low expression levels or relatively poor 421


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

22

catalytic efficiency of catechol dioxygenase (44, 45). Still, anthranilic acid was 422

consumed by the cells of the strain O153 with no product-indicating spectra suggesting 423

utilization of anthranilate in other cellular processes, possibly as a substrate for 424

anthranilate phosphoribosyltransferase during the synthesis of tryptophan (46). The strain 425

O153 used indole (ranging from 0.5 to 1.5 mM) as the sole nitrogen source indicating a 426

physiological benefit when occupying indole-containing environments. 427

Based on the results presented above, a scheme for indole biodegradation in 428

Acinetobacter sp. strain O153 is proposed (Fig. 6). Degradation starts with indole 429

oxidation at C2 and C3 positions, forming indole-2,3-dihydrodiol. This compound is 430

known to be rather unstable (22) and therefore was not detected. A spontaneous 431

dehydration of indole-2,3-dihydrodiol results in the formation of indoxyl, which is prone 432

to auto-oxidation and forms an insoluble indigo pigment. However, the loss of water 433

molecule could be prevented by IifB, forming a stable intermediate. The hypothetical 434

short-chain dehydrogenase IifB performs oxidation at C2 position to obtain 3-435

hydroxyindolin-2-one. Anthranilic acid, formed by IifA, is then the end product of 436

IifCDBA-catalysed indole biodegradation. 437

Figure 6 438

Proteins with notable sequence similarity to Iif proteins were described earlier 439

leading to coherent concepts and hypotheses. Firstly, MoxY (65 % sequence identity to 440

IifC) and MoxZ (38 % sequence identity to IifD) proteins with indole oxidation activity 441

were suggested to be involved in the production of quorum-sensing inducing compound 442

(47). Later, a genomic fragment of R. opacus 1CP containing several genes with high 443

structural similarity to Iif operon was published (48) emphasizing its role in styrene 444


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

23

biodegradation. Monooxygenase activity of this fragment was detected by indole 445

oxidation to indigo and was attributed specifically to StyA2B, styrene-epoxidizing fusion 446

protein containing both oxidation and flavin-reduction activities (47 % sequence identity 447

between N-terminal segment of StyA2B and IifC, 52 % sequence identity between IifD 448

and C-terminal segment of StyA2B). ORFs 6 and 9, composing a possible structural 449

homologue of IifA of this fragment and forming a hypothetical dienolactone hydrolase, 450

were interrupted by transposase most likely rendering this protein inactive. A complete 451

set of Iif-homologous genes was then found in R. opacus MR11 including an adjacent 452

multi-subunit anthranilate dioxygenase leading to hypothesis that the locus described 453

therein might be involved in the degradation of heteroaromatic compounds (49). Finally, 454

indole-detoxification ability of IifC-IifD system as well as flavin-oxidoreductase activity 455

of IifD were demonstrated in representatives of genus Acinetobacter (23, 50). From 456

current perspective, it appears that Iif cluster was en route to the notion of a link between 457

indole as substrate for Iif proteins, high metabolic versatility of acinetobacters and 458

biodegradation. 459

In the proposed model of indole biodegradation, IifC should act as a dioxygenase, 460

incorporating oxygen atoms at both C2 and C3 positions. However, IifC appears to have 461

typical structural elements of flavin-containing monooxygenases (23). Although difficult 462

to detect experimentally, indole dioxygenation was reported for a number of bacterial 463

dioxygenases and monooxygenases (25, 51). Indole-2,3-dihydrodiol, a product of 464

possible dioxygenase attack was observed in the biotransformation of indole by 465

Cupriavidus sp. strain KK10 (52). Notably, several species of Cupriavidus were 466

identified to possess the iif-ant cluster (Fig. 3). Indole-2,3-dihydrodiol was not observed 467


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

24

directly as a reaction intermediate during the indole degradation described here which 468

might be attributed to the instability of this compound (22). Importantly, the formation of 469

indigo from indole-2,3-dihydrodiol was declared in indole oxidation reaction catalysed 470

by naphthalene dioxygenase (22). A possible mechanism of indole-2,3-dihydrodiol 471

formation might be hydrolysis of indole 2,3-epoxide, which was identified as 472

intermediate during indole epoxidation performed by a styrene monooxygenase (53) and 473

was suggested to form 2,3-trans diol spontaneously or enzymatically (54). The opening 474

of the epoxide to a diol was presumed as plausible pathway for indole-2,3-dihydrodiol 475

formation (55). Moreover, the oxidation of several N-heterocyclic compounds catalysed 476

by monooxygenases when insertion of two oxygen atoms (one from oxygen, another 477

from water) took place was described recently (56-58). A similar mechanism for 478

bacterial degradation of indole acetic acid was described (59) involving the intermediate 479

dioxindole-3-acetic acid (DOAA), a structural analogue of 3-hydroxyindolin-2-one in 480

indole degradation. Formation of DOAA was not attributed to a single enzymatic step 481

and either second hydroxylation or hydroxy/keto oxidoreduction mechanisms were 482

suggested. Given these points, deciphering the mechanism of IifC requires further 483

structural studies. 484

The role of IifE in the degradation of indole remains poorly understood and might 485

even be ruled out based on several experimental evidence. First, no changes were 486

observed when recombinant IifE protein was added into reaction mixture consisting of 487

indole and other Iif proteins, i.e. such reaction still yielded anthranilic acid with complete 488

substrate consumption. Next, the expression levels of IifE did not change upon addition 489

of indole according to qRT-PCR results (23). Finally, the gene coding for IifE appears to 490


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

25

be absent in genomes of several microorganisms that possess the iif operon. Interestingly, 491

the presence of a putative signal sequence was detected in this protein with cleavage site 492

between residues 24 and 25 (AQA-YD) using SignalP (60). Also, this protein showed 493

low sequence identity to Pput2725 membrane channel from P. putida F1. Taken 494

together, such inconsistent insights provide no precise functional description for this 495

protein; yet possible functions as facilitation of indole uptake or other metabolic 496

activities are suggested and worth exploring. 497

As already pointed out, a distinct group of extraordinary dioxygenases catalyses 498

the incorporation of oxygen atoms into organic substrates with no requirements for 499

cofactors. Structural and functional properties of IifA appear to be very similar to those 500

of the best described cofactor-independent dioxygenases such as 1H-3-hydroxy-4-501

oxoquinoline 2,4-dioxygenase (Qdo) from Pseudomonas putida 33/1 and 1H-3-hydroxy-502

4-oxoquinaldine 2,4-dioxygenase (Hod) from Arthrobacter ilicis Rü61a (61). All these 503

enzymes share an α/β structural fold and a speculative catalytic triad, which was 504

demonstrated to rather act as a dyad as mutants of catalytic Ser retained substantial 505

activity (18, 61). Catalytic properties of IifA also resemble those of cofactor-free 506

dioxygenase from an aerobic Gram-positive coccus participating in indole 507

biodegradation described by Fujioka and Wada (62). This cofactor-free dioxygenase was 508

able to convert 2-oxo-3-hydroxyinoline to stoichiometric amounts of anthranilic acid and 509

CO2 with the consumption of equivalent amounts of dioxygen (62). As it stands, the 510

establishment of IifA as oxygenase catalysing the ring-opening reaction requires 511

additional experiments in elucidation of the fate of C2 carbon atom of 3-hydroxyindolin-512


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

26

2-one during oxidation process as well as site-directed mutagenesis to prove the role of 513

putative catalytic amino acid residues, which are currently under way. 514

Notably, a number of bacterial genera with iif and ant operons identified in this 515

work have already been described as indole degrading microorganisms. B. unamae strain 516

CK43B was found to degrade indole under aerobic conditions when supplemented with 517

gallic acid or pyrogallol (63) showing a similar cometabolic effect of indole degradation 518

as in the case of strain O153. Importantly, indoxyl was detected as the reaction 519

intermediate as well as compounds of β-ketoadipate pathway, anthranilic acid and 520

catechol, signifying the possible relationship between Iif proteins and indole 521

biodegradation in genus Burkholderia. Cupriavidus sp. strain SHE was also reported to 522

be able to perform indole biodegradation (28); however, no intermediates were 523

identified, except for isatin. A compound with m/z corresponding to isatin was also 524

observed during Iif-catalysed indole biodegradation. Nonetheless, based on results 525

presented here indicating that (i) in contrary to indole, isatin was not consumed by 526

resting cells during an uptake assay and (ii) isatin was not a substrate for any of the Iif 527

proteins described here, we suggest that isatin might not be an intermediate during Iif-528

catalysed indole degradation, but rather appeared as a dead-end product of spontaneous 529

oxidation or an experimental artefact. While indole biodegradation characteristics were 530

also evaluated for representatives of genus Pseudomonas (P. aeruginosa strain Gs) and 531

Alcaligenes (Alcaligenes sp. strain In 3) (26, 64), no data is available regarding the 532

biodegradation of indole in genus Acinetobacter to date. Such high prevalence of iif 533

operon might be explained by a dual beneficial effect of indole degradation. Indole, 534

produced mainly by E. coli in the intestine, can decrease virulence of P. aeruginosa (65). 535


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

27

This effect was later attributed to the indole-caused inhibition of AHL-based quorum-536

sensing signalling by altering the folding of AqsR regulator (14, 66). Such effect was 537

reported for a number of Gram-negative bacteria, including Chromobacterium 538

violaceum, P. chlororaphis, Serratia marcescens (67) and A. oleivorans DR1 (14), a 539

strain which was identified here to possess the iif-ant operon combination (Fig. 3). In a 540

complex and competition-prone environment such as gastrointestinal tract, indole 541

production might become an advantage if the producer does not utilize AHL-based 542

signalling, which is the case for E. coli (68). The degradation of indole and utilization as 543

additional carbon and energy source using the Iif-AntABC enzymatic system described 544

here might be a possible solution for AHL-producers, including genus Acinetobacter 545

(69), to counteract the toxic indole effect and retain fitness. Taken together, the 546

accordance between de facto indole degrading microbial genera and the prevalence of iif 547

and ant operon combination suggests that proteins encoded by the iif operon might be 548

responsible for indole biodegradation in the majority of microorganisms, described to 549

date as indole-degraders. 550


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

28

ACKNOWLEDGMENTS 551

The authors are grateful to dr. Regina Vidziunaite and I. Bratkovskaja for 552

technical assistance with oxygen consumption measurements and A. Laurynenas for 553

generation of anaerobic conditions. 554

Conflict of interest statement: none declared. 555

556

FUNDING INFORMATION 557

This work was supported by the Research Council of Lithuania (project No. MIP-558

042/2012). 559


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

29

REFERENCES 560

1. Deeley MC, Yanofsky C. 1981. Nucleotide sequence of the structural gene for 561

tryptophanase of Escherichia coli K-12. J. Bacteriol. 147:787–796. 562

2. Hirakawa H, Inazumi Y, Masaki T, Hirata T, Yamaguchi A. 2005. Indole induces 563

the expression of multidrug exporter genes in Escherichia coli. Mol. Microbiol. 564

55:1113–1126. 565

3. Mueller RS, Beyhan S, Saini SG, Yildiz FH, Bartlett DH. 2009. Indole acts as an 566

extracellular cue regulating gene expression in Vibrio cholerae. J. Bacteriol. 567

191:3504–3516. 568

4. Yang Q, Pande GSJ, Lin B, Rubin RA, Vora GJ, Defoirdt T. 2017. Indole signaling 569

and (micro)algal auxins decrease the virulence of Vibrio campbellii, a major 570

pathogen of aquatic organisms. Environ. Microbiol. doi: 10.1111/1462-2920.13714. 571

5. Martino PD, Fursy R, Bret L, Sundararaju B, Phillips RS. 2003. Indole can act as an 572

extracellular signal to regulate biofilm formation of Escherichia coli and other 573

indole-producing bacteria. Can. J. Microbiol. 49:443–449. 574

6. Sasaki-Imamura T, Yano A, Yoshida Y. 2010. Production of indole from l-575

tryptophan and effects of these compounds on biofilm formation by Fusobacterium 576

nucleatum ATCC 25586. Appl. Environ. Microbiol. 76:4260–4268. 577

7. Kim D, Sitepu IR, Hashidoko Y. 2013. Induction of biofilm formation in the 578

Betaproteobacterium Burkholderia unamae CK43B exposed to exogenous indole 579

and gallic acid. Appl. Environ. Microbiol. 79:4845–4852. 580


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

30

8. Erb M, Veyrat M, Robert CAM, Xu H, Frey M, Ton J, Turlings TCJ. 2015. Indole is 581

an essential herbivore-induced volatile priming signal in maize. Nat. Commun. 582

6:6273. 583

9. Lee J-H, Kim Y-G, Kim M, Kim E, Choi H, Kim Y, Lee J. 2017. Indole-associated 584

predator–prey interactions between the nematode Caenorhabditis elegans and 585

bacteria. Environ. Microbiol. doi:10.1111/1462-2920.13649. 586

10. Ochiai M, Wakabayashi K, Sugimura T, Nagao M. 1986. Mutagenicities of indole 587

and 30 derivatives after nitrite treatment. Mutat. Res. 172:189–197. 588

11. Lee JH, Lee J. 2010. Indole as an intercellular signal in microbial communities. 589

FEMS Microbiol. Rev. 34:426–444. 590

12. Chimerel C, Field CM, Pinero-Fernandez S, Keyser UF, Summers DK. 2012. Indole 591

prevents Escherichia coli cell division by modulating membrane potential. Biochim. 592

Biophys. Acta. 1818:1590–1594. 593

13. Kim J, Hong H, Heo A, Park W. 2013. Indole toxicity involves the inhibition of 594

adenosine triphosphate production and protein folding in Pseudomonas putida. 595

FEMS Microbiol. Lett. 343:89–99. 596

14. Kim J, Park W. 2013. Indole inhibits bacterial quorum sensing signal transmission 597

by interfering with quorum sensing regulator folding. Microbiology 159:2616–2625. 598

15. Fuchs G, Boll M, Heider J. 2011. Microbial degradation of aromatic compounds – 599

from one strategy to four. Nat. Rev. Microbiol. 9:803–816. 600

16. Sawyer DT. 1991. Oxygen Chemistry. International Series of Monographs on 601

Chemistry, Oxford University Press, Inc./ New York, U.S.A. 602


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

31

17. Kovaleva EG, Lipscomb JD. 2008. Versatility of biological non-heme Fe(II) centers 603

in oxygen activation reactions. Nat. Chem. Biol. 4:186–193. 604

18. Steiner RA, Janssen HJ, Roversi P, Oakley AJ, Fetzner S. 2009. Structural basis for 605

cofactor-independent dioxygenation of N-heteroaromatic compounds at the α/β-606

hydrolase fold. PNAS 107:657–662. 607

19. Fetzner S, Steiner RA. 2010. Cofactor-independent oxidases and oxygenases. Appl. 608

Microbiol. Biotechnol. 3:791–804. 609

20. Thierbach S, Bui N, Zapp J, Chhabra SR, Kappl R, Fetzner S. 2014. Substrate-610

assisted O2 activation in a cofactor-independent dioxygenase. Chem. Biol. 2:217–611

225. 612

21. Hernandez-Ortega A, Quesne MG, Bui S, Heyes DJ, Steiner RA, Scrutton NA, de 613

Visser SP. 2015. Catalytic mechanism of cofactor-free dioxygenases and how they 614

circumvent spin-forbidden oxygenation of their substrates. J. Am. Chem. Soc. 615

137:7474–7487. 616

22. Ensley BD, Ratzkin BJ, Osslund TD, Simon MJ, Wackett LP, Gibson DT. 1983. 617

Expression of naphthalene oxidation genes in Escherichia coli results in the 618

biosynthesis of indigo. Science 222:167–169. 619

23. Lin GH, Chen HP, Shu HY. 2015. Detoxification of indole by an indole-induced 620

flavoprotein oxygenase from Acinetobacter baumannii. Plos ONE 10:e0138798. 621

24. Fetzner S. 1998. Bacterial degradation of pyridine, indole, quinoline, and their 622

derivatives under different redox conditions. Appl. Microbiol. Biotechnol. 49:237–623

250. 624


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

32

25. Arora PK, Sharma A, Bae H. 2015. Microbial degradation of indole and its 625

derivatives. J. Chem. 2015:1–13. doi:10.1155/2015/129159. 626

26. Yin B, Gu JD, Wan N. 2005. Degradation of indole by enrichment culture and 627

Pseudomonas aeruginosa Gs isolated from mangrove sediment. Int. Biodeter. 628

Biodegr. 56:243–248. 629

27. Kim D, Rahman A, Sitepu IR, Hashidoko Y. 2014. Accelerated degradation of 630

exogenous indole by Burkholderia unamae strain CK43B exposed to pyrogallol-type 631

polyphenols. Biosci. Biotech. Biochem. 77:1722–1727. 632

28. Qu Y, Shen E, Ma Q, Zhang Z, Liu Z, Shen W, Wang J, Li D, Li H, Zhou J. 2015. 633

Biodegradation of indole by a newly isolated Cupriavidus sp. SHE. J. Environ. Sci. 634

34:162–132. 635

29. Gu JD, Berry DF. 1991. Degradation of substituted indoles by an indole-degrading 636

methanogenic consortium. Appl. Environ. Microbiol. 57:2622–2627. 637

30. Frank JA, Reich CI, Sharma S, Weisbaum JS, Wilson BA, Olsen GJ. 2008. Critical 638

evaluation of two primers commonly used for amplification of bacterial 16s rRNA 639

genes. Appl. Environ. Microbiol. 74:2461–2470. 640

31. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment 641

search tool. J. Mol. Biol. 215:403-410. 642

32. Sambrook J. 2001. Molecular Cloning: A Laboratory Manual, 3rd

edition. Cold 643

Spring Harbor Laboratory Press. 644

33. Vaitekunas J, Gasparaviciute R, Rutkiene R, Tauraite D, Meskys R. 2015. A novel 645

2-hydroxypyridine catabolic pathway in Rhodococcus rhodochrous PY11. Appl. 646

Environ. Microbiol. 82:1264–1273. 647


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

33

34. De Melo JS, Moura AP, Melo MJ. 2004. Photophysical and spectroscopic studies of 648

indigo derivatives in their keto and leuco forms. J. Phys. Chem. 108:6975–6981. 649

35. Bergonzini G, Melchiorre P. 2012. Dioxindole in asymmetric catalytic synthesis: 650

routes to enantioenriched 3-substituted 3-hydroxyoxindoles and the preparation of 651

maremycin A. Angew. Chem. Int. Ed. 51:971–974. 652

36. Medema MH, Takano E, Breitling R. 2013. Detecting sequence homology at the 653

gene cluster level with MultiGeneBlast. Mol. Biol. Evol. 30:1218–1223. 654

37. Yang Y, Yan R, Roy A, Xu D, Poisson J, Zhang Y. 2015. The I-TASSER Suite: 655

Protein structure and function prediction. Nat. Methods 12:7–8. 656

38. Marchler-Bauer A, Derbyshire MK, Gonzales NR, Lu S, Chitsaz F, Geer LY, Geer 657

RC, He J, Gwadz M, Hurwitz DI, Lanczycki CJ, Lu F, Marchler GH, Song JS, 658

Thanki N, Wang Z, Yamashita RA, Zhang D, Zheng C, Bryant SH. 2015. CDD: 659

NCBI's conserved domain database. Nucleic Acids Res. 43:D222–D226. 660

39. Pathak D, Ollis D. 1990. Refined structure of dienolactone hydrolase at 1.8 Å. J. 661

Mol. Biol. 214:497-525. 662

40. Hou J, Zheng H, Chruszcz M, Zimmerman MD, Shumilin IA, Osinski T, Demas M, 663

Grimshaw S, Minor W. 2016. Dissecting the structural elements for the activation of 664

β-ketoacyl-(acyl carrier protein) reductase from Vibrio cholerae. J. Bacteriol. 665

198:463-476. 666

41. van den Berg B, Bhamidimarri SP, Winterhalter M. 2015. Crystal structure of a 667

COG4313 outer membrane channel. Sci. Rep. 5:11927. 668


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

34

42. Bundy BM, Cambell AL, Neidle EL. 1998. Similarities between the antABC-669

encoded anthranilate dioxygenase and the benABC-encoded benzoate dioxygenase 670

of Acinetobacter sp. strain ADP1. J. Bacteriol. 180:4466–4474. 671

43. Harwood CS, Parales RE. 1996. The beta-ketoadipate pathway and the biology of 672

self-identity. Annu. Rev. Microbiol. 50:553–590. 673

44. Neidle, EL, Hartnett C, Bonitz S, Ornston LN. 1988. DNA sequence of the 674

Acinetobacter calcoaceticus catechol 1,2-dioxygenase I structural gene catA: 675

evidence for evolutionary divergence of intradiol dioxygenases by acquisition of 676

DNA sequence repetitions. J. Bacteriol. 170:4874-4880. 677

45. Suzuki K, Ichimura A, Ogawa N, Hasebe A, Miyashita K. 2002. Differential 678

Expression of Two Catechol 1,2-Dioxygenases in Burkholderia sp. Strain TH2. J. 679

Bacteriol. 184:5714-5722. 680

46. Cohn W, Crawford IP. 1976. Regulation of enzyme synthesis in the tryptophan 681

pathway of Acinetobacter calcoaceticus. J. Bacteriol. 127:367-379. 682

47. Guan C, Ju J, Borlee BR, Williamson LL, Shen B, Raffa KF, Handelsman J. 2007. 683

Signal Mimics Derived from a Metagenomic Analysis of the Gypsy Moth Gut 684

Microbiota. Appl. Environ. Microbiol. 73:3669-3676. 685

48. Tischler D, Eulberg D, Lakner S, Kaschabek SR, van Berkel WJH, Schlömann M. 686

2009. Identification of a Novel Self-Sufficient Styrene Monooxygenase from 687

Rhodococcus opacus 1CP. J. Bacteriol. 191:4996-5009. 688

49. Tischler D, Gröning JAD, Kaschabek SR, Schlömann M. 2012. One-component 689

styrene monooxygenase: an evolutionary view on a rare class of flavoproteins. Appl. 690

Biochem. Biotechnol. 167:931-944. 691


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

35

50. Gröning JAD, Kaschabek SR, Schlömann M, Tischler D. 2014. A mechanistic study 692

on SMOB-ADP1: an NADH:flavin oxidoreductase of the two-component styrene 693

monooxygenase of Acinetobacter baylyi ADP1. Arch. Microbiol. 196: 829-845. 694

51. Han X, Wang W, Xiao X. 2008. Microbial biosynthesis and biotransformation of 695

indigo and indigo-like pigments. Chin. J. Biotech. 24:921–926. 696

52. Fukuoka K, Tanaka K, Ozeki Y, Kanaly RA. 2015. Biotransformation of indole by 697

Cupriavidus sp. KK10 proceeds through N-heterocyclic and carbocyclic-aromatic 698

ring cleavage and production of indigoids. Int. Biodeter. Biodegr. 97:13–24. 699

53. O’Connor KE, Dobson ADW, Hartmans S. 1997. Indigo formation by 700

microorganisms expressing styrene monooxygenase activity. Appl. Environ. 701

Microbiol. 63:4287–4291. 702

54. Allen CCR, Boyd DR, Larkin MJ, Reid KA, Sharma ND, Wilson K. 1997. 703

Metabolism of naphthalene, 1-naphtol, indene, and indole by Rhodococcus sp. strain 704

NCIMB 12038. Appl. Environ. Microbiol. 63:151–155. 705

55. Linhares M, Rebelo SLH, Simoes MMQ, Silva AMS, Neves MGPMS, Cavaleiro 706

JAS, Freire C. 2014. Biomimetic oxidation of indole by Mn(III)porphyrins. Appl. 707

Catal. A-Gen. 470:427–433. 708

56. Chaiyen P. 2010. Flavoenzymes catalyzing oxidative aromatic ring-cleavage 709

reactions. Arch. Biochem. Biophys. 493:62–70. 710

57. Stanislauskienė R, Gasparaviciute R, Vaitekunas J, Meskiene R, Rutkiene R, Casaite 711

V, Meskys R. 2012. Construction of Escherichia coli-Arthrobacter-Rhodococcus 712

shuttle vectors based on a cryptic plasmid from Arthrobacter rhombi and 713


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

36

investigation of their application for functional screening. FEMS Microbiol. Lett. 714

327:78–86. 715

58. Kutanovas S, Stankeviciute J, Urbelis G, Tauraite D, Rutkiene R, Meskys R. 2013. 716

Identification and characterization of tetramethylpyrazine catabolic pathway in 717

Rhodococcus jostii TMP1. Appl. Environ. Microbiol. 79:3649–3657. 718

59. Donoso R, Leiva-Novoa P, Zúñiga A, Timmermann T, Recabarren-Gajardo G, 719

González B. 2016. Biochemical and genetic bases of indole-3-acetic acid (auxin 720

phytohormone) degradation by the plant-growth-promoting rhizobacterium 721

Paraburkholderia phytofirmans PsJN. Appl. Environ. Microbiol. 722

83:10.1128/AEM.01991-16. 723

60. Petersen TN, Brunak S, von Heijne G, Nielsen H. 2011. SignalP 4.0: discriminating 724

signal peptides from transmembrane regions. Nat. Methods 8:785–786. 725

61. Fischer F, Kunne S, Fetzner S. 1999. Bacterial 2,4-Dioxygenases: New Members of 726

the α/β Hydrolase-Fold Superfamily of Enzymes Functionally Related to Serine 727

Hydrolases. J. Bacteriol. 18:5725–5733. 728

62. Fujioka M, Wada H. 1968. The bacterial oxidation of indole. Biochim. Biophys. 729

Acta 158:70–78. 730

63. Kim D, Rahman A, Sitepu IR, Hashidoko Y. 2014. Accelerated degradation of 731

exogenous indole by Burkholderia unamae strain CK43B exposed to pyrogallol-type 732

polyphenols. Biosci. Biotech. Biochem. 77:1722–1727. 733

64. Claus G, Kutzner HJ. .1983. Degradation of indole by Alcaligenes spec. Syst. Appl. 734

Microbiol. 4:169–180. 735


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

37

65. Lee J, Attila C, Cirillo SLG, Cirillo JD, Wood TK. 2009. Indole and 7-736

hydroxyindole diminish Pseudomonas aeruginosa virulence. Microb. Biotechnol. 737

2:75–90. 738

66. Chu W, Zere TR, Weber MW, Wood TK, Whiteley M, Hidalgo-Romano B, 739

Valenzuela E, McLean RJC. 2011. Indole production promotes Escherichia coli 740

mixed-culture growth with Pseudomonas aeruginosa by inhibiting quorum 741

signaling. Appl. Environ. Microbiol. 78:411–419. 742

67. Hidalgo-Romano B, Gollihar J, Brown SA, Whiteley M, Valenzuela Jr.E, Kaplan 743

HB, Wood TK, McLean RJC. 2014. Indole inhibition of N-acylated homoserine 744

lactone-mediated quorum signaling is widespread in Gram-negative bacteria. 745

Microbiology 160:2464–2473. 746

68. Ahmer BM. 2004. Cell-to-cell signaling in Escherichia coli and Salmonella 747

enterica. Mol. Microbiol. 52:933–945. 748

69. Chan KG, Atkinson S, Mathee K, Sam C-K, Chhabra SR, Camara M, Koh C-L, 749

Williams P. 2011. Characterization of N-acetylhomoserine lactone-degrading 750

bacteria associated with the Zingiber officinale (ginger) rhizosphere: Co-existence of 751

quorum quenching and quorum sensing in Acinetobacter and Burkholderia. BMC 752

Microbiology 11:51. doi:10.1186/1471-2180-11-51. 753


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

38

TABLE AND FIGURE LEGENDS 754

755

Table 1. Primers and plasmids used in this study. Underlined nucleotide sequences 756

are introduced sequences for recognition of restriction endonucleases. 757

Table 2. Predicted conserved domains and putative functions of proteins encoded by 758

genes identified in a 12-kb genomic fragment of Acinetobacter sp. O153. 759

Table 3. Kinetic parameters of IifD, IifC and IifA proteins. Presented are mean values ± 760

S.D. 761

Fig. 1. Growth kinetics of Acinetobacter sp. strain O153. A – growth in minimal medium with 762

different carbon and nitrogen sources, B – growth in minimal medium supplemented with 763

different concentrations of indole as nitrogen source and succinate as carbon source. Filled 764

squares – NH4Cl (5 g/L) and succinate (5 mM) (positive control), filled triangles – indole (1 mM) 765

and succinate, filled rhombus – NH4Cl and indole (1 mM), filled circles – indole (1 mM), squares 766

- no N source and succinate (negative control), empty circles – 0.1 mM indole, crosses – 0.5 mM 767

indole, triangles – 0.75 mM indole, rhombus – 1.5 mM indole, line-filled squares – 2 mM indole. 768

Dashed lines represent trendlines using moving average data approximation (period = 2). 769

Fig. 2. Whole-cell bioconversion assays using different substrates and cells of 770

Acinetobacter sp. O153. A – substrates without cells (negative control), B – 771

bioconversion with uninduced (overnight culture grown without indole) cells, C – 772

bioconversion with induced (overnight culture grown in the presence of 1 mM indole) 773

cells. Solid lines indicate spectra of initial and final products, dashed lines – spectra of 774

intermediate products during 6-hour bioconversion cycle. 775

Fig. 3. Organization and distribution of iif and ant genes in different microbial genomes. 776

Genes are represented by arrows (drawn to scale as indicated). Homologous genes are 777


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

39

highlighted in the same pattern: rhombus grid – homologues of iifA, simple grid – iifB, 778

zigzag – iifC, horizontal lines – iifD, oblique bricks – iifE, vertical lines – araC, dotted 779

fill – antA, grey fill – araB, light grey fill – araC, white fill – indole degradation 780

unrelated / unknown. Strains and genomic fragments highlighted in solid lines indicate 781

reported activity of certain Iif-homologous proteins, dashed lines highlight strains for 782

which indole biodegradation activity was reported in genus level. Identities (%) of amino 783

acid sequence between Iif proteins of strain O153 and homologues are indicated under 784

the corresponding ORFs. 785

Fig. 4. Stacked HPLC chromatograms (211 nm) of enzymatic reaction products and 786

standards. Top three curves – standards, middle four curves – reaction products of indole 787

and Iif proteins as indicated at the right side, bottom curve – reaction product of 3-788

hydroxyindolin-2-one and IifA. Numbers indicate peaks of three major compounds – 3-789

hydroxyindolin-2-one (1), anthranilic acid (2) and indole (3). 790

Fig. 5. Functional characterization of IifA. A – oxygen consumption by IifA, red, green 791

and blue colours indicate different substrate concentrations as depicted, reactions were 792

initiated at 90 s; B – UV spectra of transition between 3-hydroxyindolin-2-one and 793

anthranilic acid, catalysed by IifA. Inset shows spectral difference between the substrate 794

and the product. 795

Fig. 6. Proposed indole biodegradation pathway in Acinetobacter sp. O153. 1 – indole, 2 796

– indole-2,3-dihydrodiol, 3 – 3-hydroxyindolin-2-one, 4 – anthranilic acid, 5 – isatin, 6 – 797

1H-indol-3-ol (indoxyl), 7 – indigo. Brackets indicate experimentally non-detected 798

intermediate. 799


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

Primer name Sequence (5‘-3‘) Purpose Reference

CMBFNdeI GATCATATGTCAGGCCAAGATATTGAA Amplification

and cloning

of iifA gene

This work

CMBRXhoI CTCTCGAGTTAAAACGATTTGCCTTCA

SCDFNdeI GAGTGGCATATGGATATTGAATTGAATCAG Amplification

and cloning

of iifB gene

This work

SCDRXhoI ATCTCGAGTCACGCTTCATCGGCTA

APRLF GATCATATGCGTCGTATCGCTATAG Amplification

and cloning

of iifC gene

This work

APRLR CTACTCGAGTTAAGCCACTTTTTGAC

iifDFNheI TGGCTAGCATGAATATCAACACATC Amplification

and cloning

of iifD gene

This work

iifDRXhoI CTGCTCGAGTTAAATACTCAGTTC

MetAFNcoI CTCCATGGCCAATAATGTGATCAAAAG Amplification

and cloning

of iifE gene

This work

MetARHindIII GAAGCTTTCAGAAGTGATGAATATAAC

27F AGAGTTTGATCMTGGCTCAG Amplification

and

sequencing

of 16S rRNA

gene

(30)

1492R TACGGYTACCTTGTTACGACTT

Plasmid Description / purpose Source

pTZ57R/T TA cloning of PCR products ThermoFisher

Scientific

(Lithuania)

pUC19 Construction of genomic library ThermoFisher

Scientific

(Lithuania)

pET28-c(+) Expression of recombinant proteins Novagen

(Germany)

pET28-iifA iifA gene, amplificated by PCR with CMBFNdeI and

CMBRXhoI primers, digested with NdeI/XhoI and cloned

into pET28-c(+) for expression of recombinant Nterminally

6x His-tagged IifA

This work

pET28-iifB iifB gene, amplificated by PCR with SCDFNdeI and

SCDRXhoI primers, digested with NdeI/XhoI and cloned


6x His-tagged IifB

This work

pET28-iifC iifC gene, amplificated by PCR with CMBFNdeI and

CMBRXhoI primers, digested with NdeI/XhoI and cloned

This work


6x His-tagged IifC


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

pET28-iifD iifD gene, amplificated by PCR with iifDFNheI and

iifDRXhoI primers, digested with NheI/XhoI and cloned


6x His-tagged IifD

This work

pET21-iifE iifE gene, amplificated by PCR with MetAFNcoI and

MetARHindIII primers, digested with NcoI/HindIII and

cloned into pET28-c(+) for expression of recombinant IifE

This work


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

Protein

Conserved domain

(family accession

number)

E-value

Closest homolog with known function

Protein

Locus tag or

protein ID

Function

Identity

(%)

Reference

IifA

α/β hydrolase

(COG0412)

2.3e-53

ClcD from P.

knackmussii

B13

AAB71539.1

Dienolactone

hydrolase

34 (39)

SnoaL-like

polyketide cyclase

(pfam07366)

0.04

IifB

Short-chain

dehydrogenase

(cd05233)

1.2e-56

FabG from

Vibrio

cholerae

N16961

VC2021

Reduction of β-

ketoacyl-ACP to 3-

hydroxyacyl-ACP

33 (40)

IifC - -

IifC from A.

baumannii

ATCC19606

F911_02004 Monooxygenase 82 (23)

IifD

Flavin reductase

(COG1853)

6.8e-40

IifD from A.

baumannii

ATCC19606

F911_02003 Flavin reductase 81 (23)

IifE

MetA-pathway of

phenol degradation

(cl01768)

1.3e-57

Pput2725

from P.

putida F1

4RL8

Outer membrane

channel of unknown

function

21 (41)


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

IifR

AraC-binding-like

domain (pfam14525)

4e-39

IifR from A.

baumannii

ATCC19606

F911_02001

Transcriptional

regulator

74 (23)

AntA

Rieske non-heme iron

oxygenase (cd03469)

9e-46

AntA from

Acinetobacter

sp. ADP1

AAC34813.1

Oxygenase

component of

anthranilate

dioxygenase

93 (42) C-terminal catalytic

domain of the

oxygenase alpha

subunit (cd08879)

9e-83

AntB

Ring hydroxylating

beta subunit

(cd00667)

2e-51

AntB from

Acinetobacter

sp. ADP1

AAC34814.1

Oxygenase

component of

anthranilate

dioxygenase

94 (42)

AntC

Benzoate

dioxygenase

reductase FAD/NAD

binding domain

(cd06209)

3e-107 AntC from

Acinetobacter

sp. ADP1

AAC34815.1

Reductase

component of

anthranilate

dioxygenase

87 (42)

2Fe-2S cluster

(cd00207)

3e-21


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

Protein / substrate or

cofactor

Km, μM Kcat, min-1

Kcat/Km,

min-1 μM-1

IifD

NADH 29 ± 0.1 1.21 ± 0.15 0.041

NADPH 7.9 ± 0.4 0.13 0.017

FMN 2.85 ± 0.19 2.7 ± 0.45 0.94

FAD 7.07 ± 0.12 7.02 ± 0.64 0.99

Riboflavin 8.35 ± 0.83 3.1 ± 0.43 0.38

IifC Indole 250 ± 13 0.11 ± 0.01 0.00047

IifA 3-hydroxyindolin-

2-one

281.7 ± 13.4 2476 ± 310 17.52


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

Downloaded from //aem.asm.org/content/aem/early/2017/07/31/... · 22 Indole is a molecule of...

Documents

Transcript of Downloaded from //aem.asm.org/content/aem/early/2017/07/31/... · 22 Indole is a molecule of...