DNA ( Deoxyribonucleic acid ) 1 DNA structure DNA replication DNA repair.
DNA
-
Upload
nasim-rich -
Category
Documents
-
view
17 -
download
1
description
Transcript of DNA
![Page 1: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/1.jpg)
DNA
![Page 2: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/2.jpg)
DNA
• must carry information• must be replicatable (inheritance)• must be changeable (mutation)
![Page 3: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/3.jpg)
DNA
![Page 4: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/4.jpg)
DNA structure
deoxyribonucleic acid - two directional polynucleotide strands in a double helix
![Page 5: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/5.jpg)
A brief digression for terminology:
O
C
CC
C4 1
23
Carbon moleculesin rings are numbered….
C5
![Page 6: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/6.jpg)
two directional polynucleotide strands in double helix
start with a ribosesugar…
![Page 7: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/7.jpg)
two directional polynucleotide strands in double helix
start with a ribosesugar…
remove an oxygen atcarbon 2’….
![Page 8: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/8.jpg)
two directional polynucleotide strands in double helix
start with a ribosesugar…
remove an oxygen atcarbon 2’…. add a phosphate group at 5’ side
add a nitrogenous base at 1’ side= a nucleotide
![Page 9: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/9.jpg)
two directional polynucleotide strands in double helix
A nucleotide, or base
![Page 10: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/10.jpg)
Bases = purines (adenine, guanine) and pyrimidines (cytosine, thymine)
![Page 11: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/11.jpg)
5’ end
3’ end
nucleotides are linked in chains with a phosphodiester bondfree ends of chain will have 5’ phosphate at one end,
3’ hydroxyl at the other end
two directional polynucleotide strands in double helix
phosphodiesterbond
![Page 12: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/12.jpg)
5’ end
3’ end
nucleotides are linked in chains with a phosphodiester bondfree ends of chain will have 5’ phosphate at one end,
3’ hydroxyl at the other end
two directional polynucleotide strands in double helix
![Page 13: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/13.jpg)
two directional polynucleotide strands in double helixHydrogen bonds
![Page 14: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/14.jpg)
Two strands pair up, nucleotides linked with hydrogen bondsadenosine pairs with thyminecytosine pairs with guanine
two directional polynucleotide strands in double helix
![Page 15: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/15.jpg)
Two strands pair up, nucleotides linked with hydrogen bondsadenosine pairs with thyminecytosine pairs with guanine
- abbreviated as “base pairs”
two directional polynucleotide strands in double helix
![Page 16: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/16.jpg)
two directional polynucleotide strands in double helix
Strands have polarity - 5'-hydroxyl group of first nucleotide at one end, 3'-hydroxyl group at other end (5’ to 3’ strand)
Strands run antiparallel: (5' -> 3') ATGGAATTCTCGCTC (3' <- 5') TACCTTAAGAGCGAG
![Page 17: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/17.jpg)
DNA replication: two strands are both available as templates for new strand result is doubling (2 complete new double helices)
![Page 18: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/18.jpg)
DNA replication: is semiconservative always occurs in 5’ to 3’ direction
![Page 19: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/19.jpg)
DNA replication: occurs at multiple replication forks (bubbles) along the DNA strand
![Page 20: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/20.jpg)
Important:
there are several DNA polymerases involved in replication DNA polymerases have a proof-reading and editing function
(exonuclease activity)
![Page 21: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/21.jpg)
TRANSCRIPTION
![Page 22: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/22.jpg)
Consider:
if all DNA was actively used:- most mutations would be lethal- there would be no ‘raw material’ for evolutionary change- what would happen to genes de-activated by mutation?
In fact, many errors and duplications leave ‘extra’ DNA
![Page 23: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/23.jpg)
Consider:
If there is excess DNA, it may be- only between genes- also interspersed within genes
![Page 24: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/24.jpg)
Consider:
If there is excess DNA, it may be- only between genes- also interspersed within genes
![Page 25: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/25.jpg)
Consider:
Not all gene products are required simultaneously; needs for proteins change or differ
- during development (e.g., milk digesting enzymes)- over time (e.g., digestive enzymes)- among organs (e.g., liver enzymes not used in muscle)- in response to stimuli (e.g., melanin, adrenalin)
therefore regulation of gene activity is needed
![Page 26: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/26.jpg)
Transcription:
Uses RNA as an intermediary - to assemble genes - to transmit the right information when/where it is needed
(regulation)
![Page 27: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/27.jpg)
Transcription:
Uses RNA as an intermediary - to assemble genes - to transmit the right information when/where it is needed
(regulation)
RNA is ribonucleic acid- has uracil instead of thymine- sugar is ribose instead of deoxyribose
![Page 28: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/28.jpg)
There are three types of RNA:
mRNA: messenger RNA – carries the code for a gene
rRNA: ribosomal RNA – used to construct ribosomes
tRNA: transfer RNA – short adapters to carry amino acid and its anti-codon
![Page 29: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/29.jpg)
DNA strand (double, helical) - permanent(5' -> 3') ATGGAATTCTCGCTC (coding, sense strand)
(3' <- 5') TACCTTAAGAGCGAG (template, antisense strand)
![Page 30: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/30.jpg)
DNA strand (double, helical) - permanent(5' -> 3') ATGGAATTCTCGCTC (coding, sense strand)
(3' <- 5') TACCTTAAGAGCGAG (template, antisense strand)
mRNA strand (single, linear) – temporary, as needed(5' -> 3') AUGGAAUUCUCGCUC (from template strand)
![Page 31: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/31.jpg)
DNA strand (double, helical) - permanent(5' -> 3') ATGGAATTCTCGCTC (coding, sense strand)
(3' <- 5') TACCTTAAGAGCGAG (template, antisense strand)
mRNA strand (single, linear) – temporary, as needed(5' -> 3') AUGGAAUUCUCGCUC (from template strand)
note: by taking information from the template (antisense) strand
of DNA, mRNA becomes the coding sequence
![Page 32: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/32.jpg)
DNA strand (double, helical) - permanent(5' -> 3') ATGGAATTCTCGCTC (coding, sense strand)
(3' <- 5') TACCTTAAGAGCGAG (template, antisense strand)
mRNA strand (single, linear) – temporary, as needed(5' -> 3') AUGGAAUUCUCGCUC (from template strand)
protein sequence (single, with 1, 2, 3, 4 structure) Met-Glu-Phe-Ser-Leu...
![Page 33: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/33.jpg)
promoter region: immediately upstream (5’ end) of its gene
Gene structure
![Page 34: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/34.jpg)
Steps in transcription:
1. initiation RNA polymerase recognizes and binds to promoter sequence - these contain TATAAA and TTGACA or CCAAT codes
![Page 35: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/35.jpg)
Steps in transcription:
1. initiation RNA polymerase recognizes and binds to promoter sequence - these contain TATAAA and TTGACA or CCAAT codes
2. elongation - similar to DNA replication - only one strand (template) is used
![Page 36: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/36.jpg)
Steps in transcription:
1. initiation RNA polymerase recognizes and binds to promoter sequence - these contain TATAAA and TTGACA or CCAAT codes 2. elongation - similar to DNA replication - only one strand (template) is used
3. termination - transcription keeps going for 1000-2000 bases beyond
end of ‘gene’
![Page 37: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/37.jpg)
After transcription: RNA processing
capping polyadenylation intron removal
UTR= untranslated region
promoter elements
![Page 38: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/38.jpg)
TRANSLATION:
The Genetic Code
![Page 39: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/39.jpg)
The genetic code
DNA and RNA have 4 types of basesproteins are composed of amino acids, of which there are 20
- so how do 4 bases encode 20 amino acids?
![Page 40: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/40.jpg)
The genetic code
“words” with a single base allow no combinations (4 words)
“words” with two bases allow 16 combinations (42)
“words” with three bases allow 64 combinations (43)= more than enough combinations for 20 amino acids
![Page 41: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/41.jpg)
The genetic code
• composed of nucleotide triplets (codons)
mRNA AUG GAA UUC UCG CUC
protein sequence Met Glu Phe Ser Leu
![Page 42: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/42.jpg)
The genetic code
• composed of nucleotide triplets (codons)• non-overlapping
mRNA AUG GAA UUC UCG CUC
protein sequence Met Glu Phe Ser Leu
NOT AUGGAAUUCUCGCUC
![Page 43: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/43.jpg)
The genetic code
• composed of nucleotide triplets (codons)• non-overlapping• unambiguous – each codon only specifies one amino acid• degenerate – most amino acids specified by several codons
![Page 44: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/44.jpg)
firs
t pos
itio
n
second position
third position
![Page 45: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/45.jpg)
Reading frame must be uniquely specified:
theredfoxatethehotdog
t her edf oxa tet heh otd og
th ere dfo xat eth eho tdo g
the red fox ate the hot dog
![Page 46: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/46.jpg)
start codon
![Page 47: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/47.jpg)
Reading frame must be uniquely specified:
mRNA code begins with start codon (AUG)
protein is constructed along open reading frame
translation stops at stop codon (UAA, UAG, or UGA)(only in frame: sequence out of frame does not work)
![Page 48: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/48.jpg)
Reading frame must be uniquely specified:
mRNA code begins with start codon (AUG)
protein is constructed along open reading frame
translation stops at stop codon (UAA, UAG, or UGA)(only in frame: sequence out of frame does not work)
GUCCCGUGAUGCCGAGUUGGAGUAAGUAACCU met pro ser trp ser lys stop
5’ 3’
![Page 49: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/49.jpg)
The genetic code
• composed of nucleotide triplets (codons)
• non-overlapping
• unambiguous
• degenerate
• nearly universal – except for portions of mitochondrial
DNA and a few procaryotes
![Page 50: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/50.jpg)
TRANSLATION:
assembling proteins
![Page 51: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/51.jpg)
Three types of RNA:
mRNA: messenger RNA – carries the code for a gene
GUCCCGUGAUGCCGAGUUGGAGUAGAUAACCU5’ 3’
![Page 52: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/52.jpg)
Three types of RNA:
mRNA: messenger RNA – carries the code for a generRNA: ribosomal RNA – used to construct ribosomes
- four types, used to make two-unit ribsome
(30 S)
(60 S)
![Page 53: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/53.jpg)
Three types of RNA:
mRNA: messenger RNA – carries the code for a generRNA: ribosomal RNA – used to construct ribosomestRNA: transfer RNA – short adapters to carry amino acid and its anti-codon
anticodon
![Page 54: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/54.jpg)
Steps in translation:
1. initiation ribosomal subunits recognize, bind to 5’ cap on mRNA initiator tRNA (with UAC anticodon) binds to AUG start codon
![Page 55: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/55.jpg)
Steps in translation:
1. initiation2. elongation next tRNA pairs with its codon peptidyl transferase
1. catalyzes formation of peptide bond between amino acids
![Page 56: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/56.jpg)
Steps in translation:
1. initiation2. elongation next tRNA pairs with its codon peptidyl transferase
1. catalyzes formation of peptide bond between amino acids2. breaks amino acid bond with previous tRNA
ribosome shifts over one codon
![Page 57: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/57.jpg)
Steps in translation:
1. initiation2. elongation3. termination stop codon is recognized, bound to by release factor, polypeptide
is freed
![Page 58: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/58.jpg)
Protein structureprimary: amino acid sequencesecondary: helix or pleated sheet, held with hydrogen bondstertiary: collapsed molecule with internal bondsquaternary: protein subunits combine to form functional protein
![Page 59: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/59.jpg)
Protein structure
quaternary: protein subunits combine to form functional protein
subunits may be from same gene, or differentmay need two (dimers), three (trimers), or more
![Page 60: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/60.jpg)
Protein function
enzymes – catalyze chemical reactions; most common proteinsusually have active sites (tertiary structure) that mediate function
structural proteinscollagen, keratin
transportershemoglobin
contractile – tissue and muscle movementactin, myosin
intercellular communicationinsulin, other hormones
![Page 61: DNA](https://reader034.fdocuments.in/reader034/viewer/2022042822/56812fe8550346895d955fde/html5/thumbnails/61.jpg)
Fig. 9-20