Dna

www.promega.com • [email protected]

Genomic DNA Purification 2OverviewWizard® Genomic DNA Purification KitWizard® SV and SV 96 Genomic DNA

Purification SystemsMagneSil® Blood Genomic, Max Yield SystemMagneSil® ONE, Fixed Yield Blood Genomic SystemMagneSil® Genomic, Fixed Tissue SystemMagneSil® KF, Genomic SystemWizard® Magnetic 96 DNA Plant SystemOrdering Information

Amplifying DNA 13OverviewOptimization of PCRRoutine PCRProofreading PolymerasesHot Start MethodologydNTPsOrdering Information

PCR Clean-Up 28OverviewWizard® SV Gel and PCR Clean-Up SystemWizard® SV 96 PCR Clean-Up SystemWizard® MagneSil® PCR Clean-Up SystemWizard® PCR Preps DNA Purification SystemOrdering Information

Cloning PCR DNA 34OverviewBasic Subcloning Direct Mammalian ExpressionDirect Bacterial ExpressionPCR Cloning TechniquesOrdering Information

DNA Analysis Tools 43Benchtop DNA MarkersLadders and Digest Markers

DNA AnalysisNotebook

Table of Contents

Promega DNA Analysis Notebook2

Genomic DNA PurificationPromega has a variety of solutions for your genomicDNA (gDNA) purification needs. Promega hasautomated methods for blood, cultured cells,mammalian tissue and plant purifications. All systemsproduce high-quality DNA ready for amplification. Mostautomated systems use magnetic particle-basedtechnologies. The Wizard® SV technologies introducemembrane-based purification for manual or automatedpurifications. The Wizard Genomic DNA Purification Kitis a truly versatile solution-based system to manuallyisolate high molecular weight gDNA from a variety ofstarting materials. This gentle solution-based methodproduces gDNA suitable for amplification, Southernblotting and genomic cloning.

Look for these symbols to find the system rightfor your application.

Blood

Cultured Cells

Animal Tissue

Plant Tissue

Bacteria

Yeast

Fixed Tissue

0.05–0.2ml 0.2–10ml

Manual

3981

MA

02_3

A

Automated

Wizard®

Genomic DNAPurification Kit

MagneSil®KF, Genomic

System

MagneSil® ONE,Fixed Yield BloodGenomic System

MagneSil® BloodGenomic, MaxYield System

Blood

Please note, in the flow charts that follow, Promega systems are listed by which protocolscome in the Technical Literature sent with the

system. Other applications to other gDNA sourcesmay exist (e.g., Blood protocols for the

Wizard SV Genomic System).

Please contact Promega Technical Services if you have questions.

[email protected]

Buffy coat or white blood cells? Use cultured cells protocols.

Solution-based, totally

scalable system. Uses

centrifugation. Can handle

any volume of blood. Specific

protocols provided for

300µl, 3ml and 10ml of

fresh whole blood.

Designed for automation on the KingFisher® mL.

Handles up to 200µl ofblood. Will purify 4-6µg of gDNA from 1–15 samples

in 25 minutes.

Requires automation,magnetics-based system.Will capture >_11µg ofgDNA from a 200µlblood sample.

Requires automation,magnetics-based

system. Specificallydesigned to capturejust ~1µg gDNA from 50–60µl ofblood. Eliminatesneed to quantitateafter purification.

NEW

www.promega.com • [email protected] 3

Genomic DNA Purification

Manual

Wizard® SV 96 Genomic DNA

Purification System 3982

MA

02_3

A

Automated

Wizard® GenomicDNA Purification Kit

Wizard® SVGenomic DNA

Purification System

3985

MA

02_3

A

Manual


Manual

You supplylyticase and50mM EDTA

You supplylysozyme and/or

lysostaphin

Gram-negative

Gram-positive

CulturedCells

Yeast Bacteria

Solution-based

, totally

scalable system

. Uses

centrifugation

. Produces

high molecular

weight

(>50kb) gDNA sui

table

for any applica

tion,

including PCR and

Southern blot

ting.

Use with amicrocentrifug

e or

vacuum manifold. Purify

PCR-ready gDNA in

20 minutes after lysis.

Can process up to

5 x 106 cells/prep.

Perform 96 gDNA prepsat once. Requires a vacuummanifold. Can be used onbenchtop or automated.

Comprised of SVmembranes arrayed in a96-well format. Canhandle up to 5 x 106

cells/well.

Genome Size Molecules/µgHuman 2.9Gb 3.13 ! 105

Mouse 2.7Gb 3.35 ! 105

Rat 2.8Gb 3.26 ! 105

Arabidopsis 3.0Gb 3.04 ! 105

Tobacco 4.4Gb 2.07 ! 105

Corn 2.5Gb 3.65 ! 105

Wheat 16.0Gb 5.70 ! 104

Yeast (S. cerevisiae) 13.5Mb 6.75 ! 107

Bacteria (E. coli) 4.7Mb 1.94 ! 108

Gb = Gigabases (1 ! 109). Mb = Megabases (1 ! 106).



Manual

Wizard® Magnetic96 DNA

Plant System 3984

MA

02_3

A

Automated


Requires a 96-wellgrinding apparatus

Requires liquidnitrogen, mortar & pestle

PlantTissue

Solution-based, totally

scalable system for fresh

plant leaf tissue. Uses

centrifugation. Produces

high molecular weight

(>50kb) gDNA suitable

for any application,

including PCR and

Southern blotting.

Magnetic-based system that canbe used in manual or automatedformat. Purifies gDNA fromseeds, leaf or tissues for PCRor other amplification basedgenotyping methods.

Don’t see your DNA sampletype in these flowcharts?Contact Promega TechnicalServices for advice at:[email protected]



Manual

Wizard® SV 96 Genomic DNA

Purification System 3983

MA

02_3

A

Automated


Wizard® SVGenomic DNA

Purification System

Overnightproteinase K

digestion(you supply the enzyme)


digestion(you supply the enzyme)

AnimalTissue

Performs 96 gDNApreps at once. Uses avacuum manifold. Canbe used on thebenchtop or automated.Comprised of SVmembranes arrayed ina 96-well format.Processes up to 20mgtissue/well.Use with a

microcentrifuge or vacuummanifold with vacuum

adapters. Get PCR-readygDNA in 20 minutes

after lysis. Can process upto 20mg tissue/prep.

Solution-based, totally scala

ble

system. Uses centrifugation.

Produces high molecular weight

(>50kb) gDNA suitable for any

application, including PCR and

Southern blotting.

Manual

3983

MA

02_3

BMagneSil®Genomic, FixedTissue System


FixedTissue

Magnetics-based

system works

with 10µm thin s

ections.

Purifies amplificat

ion-qualified

gDNA allowing amplimers as

large as 1.8kb. Works in

multiplex amplificat

ions.

No Xylene

required for

deparaffinization!


Genomic DNA PurificationWizard® Genomic DNAPurification KitNeed a versatile genomic DNA purification system? Get it all with the Wizard Genomic DNA Purification Kit.This solution-based system uses a simple, gentle“salting out” method to isolate genomic DNA from awide variety of starting materials. The standard protocolallows isolation of gDNA from blood or cultured cells.Simple modifications to the protocol (involving theaddition of reagents common to most molecularbiology laboratories) allow you to isolate gDNA frombacteria, yeast, plant or animal tissues, includingmouse tails. The system isolates high molecular weightDNA (>50kb) with an A260/A280 greater than 1.7.

Protocols provided for:Whole Blood(300µl, 3ml, 10ml, and 50µl ! 96-wells)

Cultured Cells

Animal Tissue

Plant Tissue

Gram-Negative BacteriaGram-Positive Bacteria

Yeast

DNA Yields from Various Starting Materials.Amount of Typical

Source Starting Material DNA YieldWhole Blood 300µl 5–15µg

3ml 25–50µg10ml 250–500µg

96-well plate, 50µl/well 0.2–0.7µgTissue Culture Cells 106–107 cells 5–30µgAnimal Tissue

Mouse Liver 11mg 15–20µgMouse Tail 0.5–1cm of tail 10–30µg

Insect Cells 5 ! 106 cells 16µgPlant Leaf Tissue 40mg 7–12µgBacterial Culture* 108–1010 cells 5–20µgYeast* 1.9 ! 108 cells 4.5–6.5µg*Overnight culture.

Genomic DNA isolated using the Wizard Genomic DNA Purification Kit.Genomic DNA was isolated from fresh rat brain or PC12 cells according to the protocolprovided in the Wizard® Genomic DNA Purification Kit Technical Manual #TM050. DNAfrom the indicated sources (0.5µg/lane) was separated on a 0.7% agarose gel.

Wizard® Genomic DNA Purification Kit

Cat.#: A1120 (100 isolations, 300µl blood)A1125 (500 isolations, 300µl blood)A1620 (100 isolations, 10ml blood)

Protocol:www.promega.com/tbs/tm050/tm050.html

Customizable Protocol:www.promega.com/tbscustom/tm050c/promega.asp

Citations detailing use of this kit: www.promega.com/citations/

The Wizard Genomic DNA Purification Kit has beencited for purification of gDNA from the followingbacterial sources:Bordetella, Borrelia, Campylobacter, Desulfovibrio,Escherichia, Flavobacterium, Haemophilus,Helicobacter, Leptospira, Methanococcus,Mycobacterium, Mycoplasma, Paracoccus,Prevotella, Proteus, Rickettsia, Salmonella,Serratia, Sphingomonas, Staphylococcus,Streptococcus, Treponema and Vibrio.

Citations describing isolation from these and othersources, including yeast, fungi and virus-infectedcells, are available online at:www.promega.com/citations/10

10M

A04

_5B

Lambda DNA, uncut

Lambda DNA

PC12 cell DNA, uncut

Rat brain DNA, uncut

The Wizard Genomic

DNA Purification Kit

provides protocols

for the

easy, solution-base

d, manual

purification of gD

NA from

many different sour

ces.


Genomic DNA PurificationWizard® SV and SV 96Genomic DNA PurificationSystemsThe Wizard SV and SV 96 Genomic DNA PurificationSystems provide a fast, simple technique for thepreparation of genomic DNA from cultured cells andtissue, including mouse tails. The SV system isdesigned for single-prep manual applications usingeither a microcentrifuge or vacuum manifold. GenomicDNA is obtained in 20 minutes after cell or tissue lysis.The SV 96 system was developed to meet high-throughput needs. You can use this system on thebenchtop for manual 96-well purifications or automateon a liquid-handling platform like the Beckman CoulterBiomek® FX or Biomek® 2000 with a suitable vacuummanifold. Both systems provide similar yields of highquality, PCR-ready genomic DNA. Isolation of DNA fromtissue requires the additional purchase of DNase-freeProteinase K (e.g., Promega Cat.# V3021).

M –C +C Spin Ta

il

Spin Liv

er

Spin Hea

rt

Spin Bra

in

Vacuu

m Tail

Vacuu

m Live

r

Vacuu

m Hea

rt

Vacuu

m Bra

in

3710

TA

04_2

A

Amplification of genomic DNA isolated from various mouse tissue sourcesusing the Wizard SV Genomic DNA Purification System. Genomic DNA wasisolated from the tissues listed using either the vacuum or spin protocols provided in theWizard SV Genomic DNA Purification System Technical Bulletin #TB302. One microliter ofthe eluate from the column was amplified for a mouse IL-1! (1.2kb) product. The positivecontrol (+C) was Mouse Genomic DNA (Cat.# G3091) and the negative control (–C)contained no DNA. Further details are provided in Grunst, T. and Worzella, T. (2002)Introducing the Wizard SV and SV 96 Genomic DNA Purification Systems. Promega Notes81, 9–13.

Want to use the SV Genomic Systems for manualgDNA purification from blood?

Request Genomic DNA Purification from Blood:Wizard® SV Genomic DNA Purification Systems.Application Note #AN101:

Overview of the Wizard SV Genomic DNA Purification System spin andvacuum protocols. *Vacuum Adaptor, Vacuum Manifold and Proteinase K must bepurchased separately.

3643

MA

02_2

A

Add Wizard®

SV Lysis Buffer.

Centrifuge.

Bind DNA.

Wash, removingsolution bycentrifugationor vacuum.

Transfer spincolumn to a 1.5ml microcentrifugetube (not provided).Centrifuge.

Mouse tail clippingor tissue sampleProteinase K (Cat.# V3021)*digestion inDigestion Solution.

Genomic DNAPurification fromMouse Tail Clippingor Tissue Sample

Genomic DNAPurification fromTissue Culture Cells

Wash tissueculture cellswith 1X PBS.

Incubate at 55°Covernight(16–18 hours).

Add Wizard®

SV Lysis Buffer.

Transfer lystate to minicolumn.

Elute genomic DNA.

Vacuum Adapter(Cat.# A1331)*

Vac-Man®

LaboratoryVacuum Manifold

(Cat.# A7231)*

Wizard® SV Genomic DNA Purification System

Cat.#: A2360 (50 preps)A2361 (250 preps)

Protocol:www.promega.com/tbs/tb302/tb302.html


Genomic DNA PurificationAverage Yield of Genomic DNA Purified from VariousSources Using the Wizard® SV and SV 96 Genomic DNAPurification Systems.

Sample Type Starting Amount Average YieldMouse Tail Clipping 20mg 20µgMouse Liver 20mg 15µgMouse Heart 20mg 10µgMouse Brain 20mg 6µgCHO Cells 1 ! 106 cells 5µgNIH3T3 Cells 1 ! 106 cells 9µg293 Cells 1 ! 106 cells 8µg

Comparison of DNA yields using the Wizard SV and SV 96 Genomic DNAPurification Systems. Average yield of genomic DNA (µg) purified from 20mg mousetail clippings (1.2cm tail tip portions). Average A260/A280 ratios are: SV 96, 1.7 ± 0.08; SV Vacuum, 1.7 ± 0.14; and SV Spin, 1.7 ± 0.14.

Cross-contamination assay. Genomic DNA was purified from mouse tail clippings orwater samples arrayed in adjacent wells of a 96-well plate using the Wizard SV 96 GenomicDNA Purification System. PCR products were amplified from 1µl of purified sample fromeach well for mouse IL-1" (1.2kb). No product is expected from wells containing water. Forfurther details, see Grunst, T. and Worzella, T. (2002) Introducing the Wizard SV and SV 96Genomic DNA Purification Systems. Promega Notes 81, 9–13.

0

5

10

15

20

25

30

35

0

5

10

15

20

25

30

35

Aver

age

Yiel

d (µ

g)

Method of Purification

SV 96 SV Vacuum SV Spin

M –C +C C4 C5 C6 C7 C8 D4 D5 D6 D7 D8 M E4 E5 E6 E7 E8

3712

TA

04_2

A

Mouse Tail Clippings

Water Only

1 2 3 4 5 6 7 8 9 10 11 12A

B

C

D

E

F

G

H

Wizard SV 96 Genomic DNAPurification System

Cat.#: A2370 (1 ! 96 preps)A2371 (4 ! 96 preps)


The Wizard SV 96 Genomic System is suitable formanual DNA purification at the benchtop or can beeasily automated on liquid handlers such as theBiomek® FX, Biomek® 2000, or MultiPROBE® II HT/EX.

For more information visit: www.promega.com/automethods/

34

46

CA

06

_1

A

Work with the terminal 2cm of mouse tails. Any higher up on the tailand you'll get more connective tissue,cartilage and bone than nucleated cells.This material not only clogs columns, but fewer cells means less gDNA.

Robot turns into

a genomic

DNA purification

machine!

MagneSil® Blood Genomic,Max Yield & MagneSil ONE,Fixed Yield Blood GenomicPromega has developed two genomic DNA isolationsystems to streamline your blood-to-analysis pathway—MagneSil Blood Genomic, Max Yield(a) and MagneSilONE, Fixed Yield Blood Genomic(a). Both systems aredesigned for automated gDNA purification on liquid-handling workstations such as the Beckman CourlterBiomek® FX. The Max Yield System purifies !4µg ofgDNA from 200µl of whole blood. The MagneSil ONESystem purifies 1µg gDNA (±50%) from 60µl wholeblood. Both systems produce gDNA that is ready for usein monoplex or multiplex PCR amplification reactions.

DNA Yields (ng) From 60µl Whole Blood Samples Usingthe MagneSil ONE, Fixed Yield Blood Genomic System.

Donor 1 Donor 2 Donor 3 Donor 4 Donor 5 Sample 1 1078 1078 1231 1451 1025Sample 2 990 1092 1256 1078 998Sample 3 970 1047 1315 990 994Sample 4 1209 1294 1047 970 967Sample 5 1105 1063 1388 1209 843Sample 6 839 843 1296 1105 797 Mean 1032 1070 1256 1134 937SD 128 143 116 178 94



MagneSil® ONE, Fixed Yield Blood Genomic System

Cat.#: MD1370 (1 " 96 preps)


For more information on automated methods visit: www.promega.com/automethods/

MagneSil® Blood Genomic, Max Yield System

Cat.#: MD1360 (1 " 96 preps)



Purify up to >_4µggDNA from 200µlwhole blood.

40

31

CA

03

_3

A

Analysis of DNA isolated using the MagneSil Blood Genomic, Max Yield System. DNA isolated from whole blood using the MagneSil Blood Genomic, Max Yield System wasused with the PowerPlex® 16 System (Cat.# DC6531), a multiplex STR amplification system for use in DNA typing. Results show successful coamplification and 3-color detection of the 16 loci(15 STR loci plus amelogenin) in the PowerPlex® 16 System(b,c,d). Amplification products were separated on an ABI PRISM® 310 Genetic Analyzer, and analyzed using GeneScan® Software.

Purify ~1µg gDNA

from 50–60µl

whole blood.

Fixed Yield means no morequantitation or normalization! Optimize the volume ofeluted DNA you needonce—use that sameamount each time.

Long-term storage of

gDNA? Elute gDNA

in a buffer solution like

TE buffer or DNA

Rehydration Solution

(Cat.# A7963).

Long-term storage in

water can lead to

autolytic degradation

of the gDNA.



MagneSil® Genomic, Fixed Tissue System

Cat.#: MD1490 (100 samples)


MagneSil® KF, Genomic SystemUse your Thermo Electron KingFisher® mL to the fullestwith the MagneSil KF, Genomic System. With thissystem, we provide optimized lysis and wash buffers toallow purification of high quality genomic DNA in thefixed number of steps required on the KingFisher®

instrument. The MagneSil KF, Genomic System purifies2–6µg DNA from 200µl blood. The isolated DNA is readyfor monoplex and multiplex analysis, STR analysis andSNP genotyping.

MagneSil® KF, Genomic System

Cat.#: MD1460 (200 preps)


Yield gel of gDNA isolated from 200µl of liquid blood. A single run of 15 samplesprified on the KingFisher® mL using the MagneSil KF, Genomic System. The microliters ofeach eluate were loaded on the gel and visualized by ethidium bromide staining. Lanes 6and 12 intentionally left blank.

4212

TA

06_3

A

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17

200µlsample

200µlMagneSil®,

KF PMPs

800µlLysis Buffer,

KF

1,000µlSalt Wash,

Blood

1,000µlAlcohol Wash,

Blood

1,000µlAlcohol Wash,

Blood

200µlNuclease-Free Water

4106

MA

04_3

A

Thermo Electron KingFisher® mL tube strips

MagneSil® Genomic, Fixed Tissue SystemDo you have archived samples of formalin-fixed,paraffin-embedded tissues that you’d like to genotype?We have developed a system that extracts amplifiablegDNA from 10µm sections without xylene extraction.The new MagneSil Genomic, Fixed Tissue System usesproteinase K digestion followed by a rapid one hourprocessing step to prepare samples for amplification.The purification process removes amplificationinhibitors such as small DNAs, and isolates gDNAfragments large enough to allow amplification targets upto 1.8kb. The highly pure gDNA can be used inmonoplex or multiplex amplification reactions.

25 minutes fromstart to finish for1–15 samples

3931

TC

12_2

A

Size MarkersAPC

1.8KbFragment

926 baseSize

Marker

972 baseAmelogenin

Fragment

A.

B.

C.

Multiplex-quality

gDNA from

fixed tissue Amplify targets

as large as 1.8Kb!

NEW

NEW


Genomic DNA PurificationWizard® Magnetic 96 DNAPlant SystemThe Wizard Magnetic 96 DNA Plant System(a) isdesigned for manual or automated 96-well purificationof genomic DNA from plant leaf and seed tissue. Thesystem was initially validated with corn and tomato leafas well as with canola and sunflower seeds. The DNApurified from these samples can be used in PCR as wellas more demanding applications such as RapidAmplification of Polymorphic DNA (RAPD) analysis. TheWizard Magnetic 96 DNA Plant System uses MagneSil®Paramagnetic Particles(a) (PMPs), considered a “mobilesolid phase”. The binding of nucleic acids to magneticparticles occurs in solution, resulting in increasedbinding kinetics and binding efficiency. Contact with thewash buffer is also enhanced, facilitating removal ofcontaminants and increasing nucleic acid purity.Automated methods for the Beckman Coulter Biomek®

2000, Biomek® FX and other robots are available.

The Wizard Magnetic 96 DNA Plant System produces PCR-quality DNA from avariety of plant species. One microliter of gDNA purified from the indicated materialswas used as template in PCR using a universal primer pair specific for the intron of theTrnL chloroplast gene. One or more bands are produced depending on the plant species.For more information, please see Koller, S. et al. (2001) Automated genomic DNApurification using the Wizard Magnetic 96 DNA Plant System. Promega Notes 79, 25–28.

Plant Sample Types Processed Using the WizardMagnetic 96 DNA Plant System.Arapidopsis Cotton seed SoybeanCabbage seed Grass seed SquashCanola leaf Green pepper seed Squash seedCanola seed Lettuce Strawberry leaf*Carrot seed Milkweed leaf Sunflower seedChicory leaf Potato tuber Tobacco seedlingChives Radish leaf Tomato leafCorn leaf Rice leaf Tomato seedCotton leaf* Sorghum Watermelon seed*These samples require addition of polyvinylpolypyrrolidone (PVPP) to the

lysis buffer to remove phenolic compounds that inhibit PCR.

Typical DNA Yield from Plant Species Using the WizardMagnetic 96 DNA Plant System.Arabidopsis tissue 10ng/mgCanola leaf punches* (12) 26ng/leaf punchCanola seeds (5) 343ng/seedCorn leaf punches* (12) 98ng/leaf punchCotton seed (1) 29ng/seedLettuce leaf punches* (8) 13ng/leaf punchMelon seed (1) 166ng/seedRadish leaf punches* (12) 89ng/leaf punchSoybean (10mg) 10ng/mg beanSquash seed (1) 279ng/seedSunflower seed (1) 405ng/seedTomato leaf punches* (12) 111ng/leaf punch*Leaf punches 6mm in diameter.

100 –

500 –

1,500 –

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

12345678

Tobacco seedlingSoybeanLettuce leafCorn leafPotatoArabidopsis leafCabbage seedGreen pepper seed

9101112131415

Prairie grass, seed headChivesTomato leafRiceCanola seedSunflower seedCarrot seed

bp

3315

TB

03_1

A

Wizard® Magnetic 96 DNA Plant System

Cat.#: FF3760 (2 ! 96 preps)FF3761 (4 ! 96 preps)



Want to use the Wizard Magnetic 96 DNA PlantSystem for high yield or fixed yield gDNApurification from plant tissue?

Request Application Note #AN105


Genomic DNA PurificationGenomic DNA Purification Systems and AccessoriesProduct Size Cat.#Wizard® Genomic DNA Purification Kit 100 isolations (300µl blood per isolation) A1120

500 isolations (300µl blood per isolation) A1125100 isolations (10ml blood per isolation) A1620

For Laboratory Use. Cat.# A1120 will give ~40 animal tissue preps, ~80 mouse tail preps, ~80 plant tissue preps, and ~80 cultured cell preps. Please see the Wizard® Genomic DNA Purification KitTechnical Manual #TM050 for more details and additional supplies necessary for the various preps.

Product Size Cat.#Wizard® SV Genomic DNA Purification System 50 preps (20mg tissue per prep) A2360

250 preps (20mg tissue per prep) A2361Vac-Man® Laboratory Vacuum Manifold, 20-sample capacity 1 each A7231Vacuum Adapters 20 each A1331The Wizard® SV Genomic DNA Purification System can be used in spin or vacuum format. The Vac-Man® Laboratory Vacuum Manifold can be used to process up to 20 samples at once. TheVacuum Adapters are required when using the the Vac-Man® Laboratory Vacuum Manifold with the Wizard® SV Genomic DNA Purification System.

Product Size Cat.#Wizard® SV 96 Genomic DNA Purification System 1 ! 96 preps (20mg tissue per prep) A2370

4 ! 96 preps (20mg tissue per prep) A2371Vac-Man® 96 Vacuum Manifold 1 each A2291The Vac-Man® 96 Vacuum Manifold is required for use with the Wizard® SV 96 Genomic DNA Purification System.

Product Size Cat.#MagneSil® ONE, Fixed Yield Blood Genomic System(a)* 1 ! 96 preps (50–60µl blood per prep) MD1370MagneSil® Blood Genomic, Max Yield System(a)* 1 ! 96 preps (200µl blood per prep) MD1360Deep Well MagnaBot® 96 Magnetic Separation Device* 1 each V3031MagnaBot® Spacer, 1/8 inch 1 each V8581 * For Laboratory Use. Both MagneSil® Blood Genomic Systems require use of an automated liquid handler such as the Beckman Coulter Biomek® FX. The Deep Well MagnaBot® 96 Magnetic

Separation Device and the MagnaBot® Spacer, 1/8 inch, are also required for use with these systems.

Product Size Cat.#MagneSil® Genomic, Fixed Tissue System 100 samples MD1490MagneSphere® Technology Magnetic Separation Stands 1.5ml (2 position) Z5332

1.5ml (12 position) Z5342One time purchase of a magnetic stand required to use product.

Product Size Cat.#MagneSil® KF, Genomic System 200 preps MD1460Designed for use with the Thermo Electron KingFisher® mL Instrument.

Product Size Cat.#Wizard® Magnetic 96 DNA Plant System(a) 2 ! 96 preps FF3760

4 ! 96 preps FF3761MagnaBot® 96 Magnetic Separation Device 1 each V8151MagnaBot® Spacer 1 each V8381The Wizard® Magnetic DNA Plant System requires use of the MagnaBot® 96 Magnetic Separation Device and the MagnaBot® Spacer for manual or automated DNA purification.

Related ProductsProduct Size Cat.#Proteinase K 100mg V3021RNase A Solution, 4mg/ml 1ml A7973For Laboratory Use. Proteinase K is required for tissue preparations. RNase A is certified DNase-free and is used to remove RNA from gDNA preps.


Amplifying DNA

4375

MA

11_3

A

PCR CoreSystems

Taq DNAPolymerase

Pfu DNAPolymerase

Tli DNAPolymerase

GoTaq® DNAPolymerase

PCR Master Mix

Higher Performance Taq DNA Polymerase

DifficultAmplification

Standard TaqDNA Polymerase

RoutineAmplification

High-fidelityAmplifications

Greater performance than standard Taq Polymerase with convenience of direct gel loading.

Everything for PCRincluding dNTPs.Available with controls.Great for beginners!

Promega offers serveral options for routine, difficult andhigh-fidelity PCR.

Greaterperformance

than standard

Taq Polymerase

plus convenience

of a master mix.

Can also be

stored at 4°C.


Amplifying DNAOverviewDenature… Anneal… Extend… PCR amplification led to arevolution in molecular biology in the 1980’s. PCR is arelatively simple technique by which a DNA or cDNAtemplate is amplified many thousand- or millionfoldquickly and reliably, generating sufficient material forsubsequent analyses.

The PCR process is exquisitely sensitive. While mostbiochemical analyses—including nucleic acid detectionwith radioisotopes—require the input of significantamounts of biological material, the PCR processrequires very little starting material. This feature makesthe technique extremely useful, not only in basicresearch, but also for applications such as geneticidentity testing, forensic analysis, industrial qualitycontrol and in vitro diagnostics.

The availability of such a powerful tool has led tosignificant developments in answering biologicalquestions. Many adaptations of the original PCR methodhave been published, and numerous factors that arecritical for accurate amplification have been identified.

How Much Enzyme is Needed in a Reaction?

Promega recommends using 1.25 units ofthermostable DNA polymerase per 50µl amplificationreaction. For most applications, the enzyme will be inexcess. The inclusion of more enzyme will notsignificantly increase yield. Increased amounts ofenzyme and excessively long extension times willincrease the likelihood of artifacts due to the intrinsic5!"3! exonuclease activity of Taq DNA Polymerase(e)

and other non-proofreading DNA polymerases.Artifacts are generally seen as smeared bands inethidium bromide-stained agarose gels.

The most frequent cause of excessive enzyme levelsis pipetting error. Accurate dispensing ofsubmicroliter (<1µl) volumes of enzyme solutions in50% glycerol is nearly impossible. We stronglyrecommend making reaction master mixes sufficientfor the number of reactions being performed. Amaster mix increases the volume of pipettedreagents and reduces pipetting errors.

Typical Reaction with Taq DNA Polymerase.Nuclease-Free Water to 50µl finalReaction Buffer(10X or 5X) 1XdNTPs 0.2mM eachTaq DNA Polymerase 1.25uMgCl2* 0.5–4.0mMDownstream primer 1µM (50pmol)Upstream primer 1µM (50pmol)Template 104 copies*Some reaction buffers contain Mg2+, and additional MgCl2 may not be required. The optimal Mg2+ concentration depends on the template but is typically in the range0.5–4mM.

Assemble reactions on ice in the order listed. Be sure to vortex the MgCl2 solution,primers, dNTPs and Reaction Buffer prior to addition. When using a thermal cycler withouta heated lid, overlay the reaction with 1–2 drops of mineral oil to prevent evaporation.

Setting up reactions with aproofreading polymerase?Proofreading enzymes like to digestfree primers due to their 3'"5'exonuclease activity. Always assemblethe reaction on ice and add theproofreading polymerase last, just prior to placing the tubes in apreheated 94–95°C thermal cycler. See p. 23 for more information.

For moreinformation on

reactionoptimization,

see pp. 16–19.

Vortex all MgCl2-containin

g

solutions thoroughly prior t

o use!

MgCl2 solutions can form a

concentration gradient upo

n

thawing. Failure to vortex is a

common source of PCR failure!


Amplifying DNAExample Cycling Conditions for Taq DNA Polymerase.

TimeStep Temperature (minutes) CyclesInitialDenaturation(a) 95°C 2 1Denaturation 95°C 0.5–1Annealing 42–65°C(b) 0.5–1 25–35Extension 72°C 1 min/kb(b,c)

Final Extension 72°C 5 1Soak 4°C indefinite 1(a) Reactions are placed in a thermal cycler that has been preheated to 95°C. The thermal

cycling protocol has an initial denaturation step where samples are heated at 95°C for 2 minutes to ensure that the target DNA is completely denatured. Initial denaturation oflonger than 2 minutes at 95°C is usually unnecessary and may reduce yield. (Some hotstart polymerases require pre-incubation at 95°C to activate the polymerase prior to the2-minute denaturation step.)

(b) Annealing temperature should be optimized for each primer set based on the primermelting temperature (Tm). See section on primer design (p. 16).

(c) The extension time should be at least 1 minute/kilobase of target. Typically, anythingsmaller than 1kb uses a 1-minute extension, 2 minutes for >1kb, 3 minutes for >2kb, 4minutes for >3kb, etc.

Comparison of Properties for Some Commonly-Used Thermostable DNA Polymerases.Thermostable DNA Polymerase

Taq/ AmpliTaq Gold® Vent® DeepCharacteristic AmpliTaq® Platinum® Taq Tfl Tth (Tli) Vent® Pfu

>95% >95% Resulting DNA ends 3! A 3! A 3! A 3! A Blunt Blunt Blunt5!"3! exonuclease activity Yes Yes Yes Yes No No No3!"5! exonuclease activity No No No No Yes Yes Yes

Want to explore the enzymology of ThermostableDNA Polymerases more thoroughly?

Go to our online Polymerase Guide at:www.promega.com/guides/

}

Using a Proofreading

Polymerase?

Proofreadingpolymerases

work a little slower

than non-proofreading

polymerases. Be sure to

increase the extension

time to at least 2

minutes per kilobase.

Also, you may need

2-3 more cycles.

44

31

CA

Optimization of PCRMagnesium ConcentrationMagnesium concentration is an important factor tooptimize when performing PCR. The optimal Mg2+

concentration varies depending on the primers,template, DNA polymerase, dNTP concentration andother factors. Taq DNA polymerase is the most commonpolymerase used for PCR. Taq has an optimal Mg2+

range of 1–4mM MgCl2. Other polymerases may havedifferent optimal ranges. For example, Tth DNApolymerase has a narrower optimal range (1.5–2.5mMMgCl2), Tli DNA Polymerase displays optimal activity at2–6mM MgCl2, and Pfu DNA Polymerase has an optimalrange of 2–6mM MgSO4. Tfl DNA Polymerase has anoptimal range of 1–4mM Mg2+ but performs better withMgSO4 than with MgCl2.

When using a pair of PCR primers for the first time, it isadvisable to perform a magnesium titration in 0.5 or1.0mM increments to determine the optimal Mg2+

concentration. Some primers will amplify equally well ata number of Mg2+ concentrations, while others mayhave very specific Mg2+ concentration requirements.

With too little Mg2+, the polymerase will have pooractivity. With too much Mg2+, nonspecific amplificationcan become a problem. Nonspecific PCR products canappear as a smear on a gel or as distinct bands ofinappropriate size. Too much Mg2+ can also reduce thefidelity of the DNA polymerase and lead to a highererror rate.

Taq DNA polymerase is commonly supplied with bufferscontaining a fixed concentration of Mg2+ (giving a finalconcentration of 1.5mM in the final reaction). Most TaqDNA polymerase amplifications work well at this Mg2+

concentration, and the reaction can still be optimized byadding more Mg2+. Pfu DNA polymerase does not haveas great a dependence upon Mg2+ and is most oftensupplied with a buffer containing a final concentration of2mM Mg2+. However, this does not mean thatoptimization is unnecessary, and the final concentrationof Mg2+ can be adjusted up to 6mM as needed.

Primer DesignPCR primers generally range from 15–30 bases longand are designed to flank the DNA region of interest.Primers should have 40–60% GC content, and careshould be taken to avoid sequences that might produceintermolecular or intramolecular secondary structure. Toavoid the production of primer-dimers, the 3!-ends ofthe primers should not be complementary. Primer-dimers unnecessarily sequester primers away from thereaction and result in an unwanted polymerase reactionthat competes with the desired PCR product. Avoidthree G or C nucleotides in a row near the 3!-end of theprimer, as this may result in nonspecific primerannealing, increasing the synthesis of undesirableproducts. Ideally, both primers should have nearlyidentical melting temperatures (Tm), allowing bothprimers to anneal roughly at the same temperature. Theannealing temperature of the reaction is dependent uponthe primer with the lowest melting temperature. Forassistance with calculating the Tm of any primer, a Tm

calculator is provided on the Promega web site at:www.promega.com/biomath


Amplifying DNAVortex all MgCl2-containing solutions

thoroughly prior to use! MgCl2 solutions can form a

concentration gradient upon thawing.Failure to vortex is a common source

of PCR failure!

Need to calculate your Tm?

Go to Promega's BioMath page at:

www.promega.com/biomath

The program returns results

from three different

published methods for Tm

calculation. You can also

select

Promega primers to examine

their Tm and determine the

Tm of your own primers in

different reaction buffe

rs.


Amplifying DNAOptimization of PCR (continued)Annealing TemperatureAnnealing temperature is another factor that may need tobe optimized in PCR. The melting temperature (Tm) ofthe PCR primers should be in the range 42–65°C, unlessthe primers fall into a special class, such as degenerateprimers, which have lower Tm. Typically the optimalannealing temperature is ±5°C of the primer with thelowest Tm. Ideally the Tm of both primers will be similarso that the optimal annealing temperatures are close. Ifthe melting temperatures are more than a few degreesapart, one primer may need to be redesigned so that theTm is closer to that of the other primer. A good startingpoint is to set the annealing temperature equal to the Tm

of the primers. If nonspecific amplification occurs, this isa good indication that the annealing temperature needsto be raised a few degrees. If the PCR reaction yields noproduct, this may indicate that the annealing temperatureis too high and should be reduced by several degrees.

Template QuantityThe amount of template required for successfulamplification is dependent upon the complexity of theDNA sample. For example, in a 4kb plasmid containing a 1kb insert, 25% of the input DNA is the target ofinterest. Conversely, a 1kb gene in the human genome(3.3 ! 109bp) represents approximately 0.00003% ofthe input DNA. Approximately 1,000,000-fold morehuman genomic DNA is required to maintain the samenumber of target copies per reaction. Two commonmistakes are the use of too much plasmid DNA or toolittle genomic DNA. If possible, start with up to 104 copies of the target sequence to obtain a signal in 25–30 cycles, but do not exceed 10ng/µl (i.e., 500ng/50µl reaction).

Template QualityThe purity and integrity of the DNA template can also becritical. Obviously there are numerous inhibitors that caninterfere with amplification. These may be copurifiedfrom the original source of the nucleic acid (e.g., thetissue from which the DNA was isolated). Contaminantscan also be introduced during the purification process.Examples of common contaminants that can inhibit PCRare phenol, ethanol, as little as 0.01% SDS or otherdetergents, heparin and salts. These contaminants canusually be removed by a simple phenol:chloroformextraction followed by ethanol precipitation, or by use ofa PCR clean-up system (see Chapter 3). Some sampletypes, such as blood, soil, fungus, plants with highphenolic content, and fecal samples, are problematicbecause they contain strong PCR inhibitors that can becopurified with the DNA. An easy way to identifyinhibitors in your template nucleic acid is to add analiquot of template to the positive control reaction. Ifthis “spiked” control reaction fails, the template needs tobe further purified before amplification.

Test template quality by adding a control template thatyou know amplifies easily and reliably. Combine yourproblematic template with 100–1,000 copies of thecontrol template, and amplify the control template.Perform the same amplification with the controltemplate alone. If amplification of the control templatefails only when the problematic template is present,inhibitors in the problematic template may be to blame.

Reaction annealing

temperature should be

±5°C of the Tm of

the PCR primer that

has the lowest Tm.

How Many Molecules in Your DNA Template?1µg of 1kb dsDNA = 9.12 x 1011 molecules 1µg of pGEM® Vector DNA = 2.85 x 1011 molecules

1µg of lambda DNA = 1.9 x 1010 molecules 1µg of E. coli genomic DNA = 2 x 108 molecules

1µg of human genomic DNA = 3.04 x 105 molecules


Amplifying DNAOptimization of PCR (continued)PCR EnhancersIn some cases it may be helpful to add certain enhancingagents to a PCR, despite all other attempts to optimizeconditions. Two good examples are the amplification ofGC-rich templates and amplification of templates thatform strong secondary structures, which can cause DNApolymerases to stall. GC-rich templates can beproblematic due to inefficient separation of the two DNAstrands or because of the tendency of GC-rich primers toform intermolecular and intramolecular secondarystructures that compete with template annealing. Thereare many PCR-enhancing agents that act through anumber of different mechanisms. PCR-enhancingreagents will not work with all reactions; the beneficialeffects are often template- and primer-specific.

Betaine, DMSO and formamide can be helpful whenamplifying GC-rich templates. Betaine reduces theamount of energy required to separate the strands of aGC-rich DNA template (1). Dimethylsulfoxide (DMSO)and formamide are thought to aid in the amplification ofGC-rich templates in a similar manner by interferingwith the formation of hydrogen bonds between the twostrands of DNA (2). Some reactions that amplify poorlyin the absence of enhancers will give a strong PCRproduct when betaine (1M), DMSO (1–10%), orformamide (1–5%) are added to the reaction. DMSOconcentrations greater than 10%, and formamideconcentrations greater than 5% will cause inhibition ofTaq DNA polymerase and, presumably, other DNApolymerases as well (3).

In some cases, general stabilizing agents such as BSA(0.1mg/ml), gelatin (0.1–1.0%), and nonionic detergents(0–0.5%) can overcome failure to amplify a region ofDNA. These additives can increase the stability of theDNA polymerase and may also coat the sides of the PCRtubes so that reagents are not lost through adsorptionto the tube walls. BSA has also been shown toovercome the inhibitory effects of melanin on RT-PCR(4). Nonionic detergents, such as Tween®-20, NP-40,and Triton® X-100, have the additional benefit of beingable to overcome the inhibitory effects of trace amountsof strong ionic detergents, such as 0.01% SDS (5).

Ammonium ions can make a PCR reaction more tolerantof nonoptimal conditions. For this reason, some PCRreagents include 10–20mM (NH4)2SO4. Other PCRenhancers include glycerol (5–20%), polyethylene glycol(5–15%), and tetramethyl ammonium chloride (TMAC;60mM). The effects of these enhancers are verytemplate- and primer-specific. It may be easier to designnew primers and determine the optimal conditions forthe new primer pair than to do multiple experimentswith some of these less useful enhancers.

References1. Rees, W., Yager, T.D., Korte, J. and von Hippel, P.H. (1993) Betaine can

eliminate the base pair composition dependence of DNA melting.Biochemistry 32,137–44.

2. Geiduschek, E.P. and Herskovitz, T.T. (1961) Nonaqueous solutions of DNA.Reversible and irreversible denaturation in methanol. Arch. Biochem.Biophys. 95, 114–29.

3. Varadaraj, K. and Skinner, D. (1994) Denaturants or cosolvents improve thespecificity of PCR amplification of a GC-rich DNA using geneticallyengineered DNA polymerases. Gene 140, 1–5.

4. Giambernardi, T.A., Rodeck, U. and Klebe, R.J. (1998) Bovine serumalbumin reverses inhibition of RT-PCR by melanin. BioTechniques 25,564–66.

5. Gelfand, D.H. and White, T.J. (1990) Thermostable DNA polymerase. In:PCR Protocols: A Guide to Methods and Applications. Innis, M.A., Gelfang,D.H., Sninsky, J.J., and T.J. White (eds.) Academic Press, San Diego, CA.pp. 129–41.

bp

1,198 –

350 –222 –

ColorlessGoTaq® Buffer

GreenGoTaq® Buffer

3825

TA

08_2

A

Non

e

DM

SO

beta

ine

beta

ine

DM

SO +

be

tain

e

DM

SO +

be

tain

e

No

tem

plat

e

Non

e

DM

SO

No

tem

plat

e

Amplification of a fragment of the human retinoblastoma gene using GoTaqDNA Polymerase with Colorless GoTaq Reaction Buffer or Green GoTaqReaction Buffer with and without the addition of enhancing agents DMSO andbetaine. Amplification reactions contained 500ng human genomic DNA, 0.8µM of eachprimer and 1.25u GoTaq DNA Polymerase in a final volume of 50µl. Reactions contained no additives, 5% DMSO, 1M betaine or 5% DMSO + 1M betaine as indicated. No-templatecontrol reactions were included. Amplification primers and cycling conditions are aspublished in Frackman, S. et al. (1998) Betaine and DMSO: Enhancing agents for PCR.Promega Notes 65, 27–29.

Optimization of PCR (continued)TroubleshootingMost troubleshooting of PCR involves evaluating thepossible areas of optimization. Promega has anextensive PCR troubleshooting guide included in thePCR Core Systems Technical Bulletin #TB254.


Amplifying DNA

RT-PCR

Looking for information, tips and techniques for RT-PCR? Request the free RNA Analysis Notebook.Ask for literature #BR120 from your local Promegadistributor or Promega Representative. Also availableonline at: www.promega.com/guides/

Have more questions?

Contact Promega

Technical Services:

[email protected]

Scientists serving

scientists.

Need a guide to general PCR optimization and troubleshooting?

Get PCR Core Systems TechnicalBulletin #TB254 online at:

www.promega.com/tbs/tb254/tb254.htmlor request a printed copy from your

local Promega representative.


Amplifying DNARoutine PCRPCR Master Mix: Robust, Convenient AmplificationPromega’s PCR Master Mix(f,g) is designed for the rapidand convenient amplification of many common genomicand cDNA templates (1). PCR Master Mix, formulated asa 2X solution, offers a single-tube format for PCR setup,reducing pipetting times, steps and errors as well asgreatly reducing reagent waste. All necessary PCRcomponents, except for primers and template DNA, arecontained in the Master Mix. Stability is also a keyfeature of PCR Master Mix, which can be stored for up to24 months at 4°C or be put through as many as 20freeze-thaw cycles without loss of performance. PCRMaster Mix provides 1.25u of Taq DNA Polymerase,Reaction Buffer, 200µM of each dNTP, and 1.5mM Mg2+

in the final reaction.

Reference1. Denhart, M. and Doraiswamy, V. (2001) Performance advantages designed

into Promega’s PCR Master Mix. Promega Notes 78, 9–12.

M M

3063

TA

09_0

A

1,0001001020

Template Copies per Reaction

3986

MA

02_3

A

PCR Master MixReaction

Buffer

dNTPs

PrimerTemplate

Mg2+

Taq DNAPolymerase

Typical Reaction Set-Up with PCR Master Mix.Template (up to 104 copies of target) XµlPrimers (50pmol each or 1µM final conc.) YµlNuclease-Free Water (provided) ZµlPCR Master Mix* 25µlTotal Volume 50µl* Provides dNTPs (200µM each), Mg2+(1.5mM), and Taq DNA Polymerase (1.25u) at the

final 1X concentration.

Detection of low copy number templates using PCR Master MIx. A 360bpportion of the single-copy !1-antitrypsin gene was amplified from the indicated amounts ofHuman Genomic DNA (Cat.# G3041). Lane M, 100bp DNA Ladder (Cat.# G2101).

Scalability of PCR Master Mix. The 360bp !1-antitrypsin message was amplified from10 or 100 copies of Human Genomic DNA (Cat.# G3041) in 10, 25 and 50µl reactionvolumes as indicated.

PCR Master Mix in two-step RT-PCR. Amplification of a 533bp portion of thecaspase-3 cDNA from 20µl reverse transcription reaction. Reverse transcription wasperformed using the ImProm-II™ Reverse Transcription System (Cat.# A3800) and theindicated amount of total RNA. The cDNA in the entire 20µl reaction was amplified byadding 15µl of PCR Master Mix, 2µl of gene-specific primers and 13µl of Nuclease-FreeWater (Cat.# P1195). Further details of the experiment may be found in Miller, K., Moravec,R. and Riss, T. (2001) An integrated approach to studying apoptosis: From gene expressionto cellular events. Cell Notes 2, 4–6.

M

10µl 25µl 50µl

Reaction Volume

3278

TA

03_1

A

10 100 10 100 10 100

– 360bp

100n

g

10ng

1ng

100p

g

10pg

1pg

3441

TA

06_1

B

PCR Master Mix

Cat.#: M7501 (10 reactions)M7502 (100 reactions)M7505 (1,000 reactions)

Protocol:www.promega.com/tbs/9pim750/9pim750.html

Citations detailing use of PCR Master Mix online at:www.promega.com/citations/

Cell Notes and Promega Notes are available online at:www.promega.comor upon request.


Amplifying DNARoutine PCR (continued)GoTaq® DNA Polymerase: Direct-to-Gel AmplificationGoTaq DNA Polymerase(e,g) contains native Taq DNAPolymerase in a proprietary formulation. The GoTaqenzyme is supplied with 5X Green and 5X Colorless GoTaqReaction Buffers. The Green Reaction Buffer contains acompound that increases sample density so that samplessink easily into the wells of an agarose gel. The GreenReaction Buffer also contains two dyes (a blue dye and ayellow dye) that separate during electrophoresis and canbe used to monitor migration progress. This allowsreactions to be directly loaded onto agarose gels withoutthe need for loading dye. The blue dye migrates at thesame rate as 3–5kb DNA fragments in a 1% agarose gel.The yellow dye migrates at a rate faster than primers(<50bp) in a 1% agarose gel. The Colorless GoTaqReaction Buffer has the same formulation as the GreenReaction Buffer but does not contain dyes. The ColorlessReaction Buffer is recommended for any application whereabsorbance or fluorescence measurements of the PCRamplimer are necessary before clean-up. Both 5X buffersare supplied at pH 8.5 and contain MgCl2 at aconcentration of 7.5mM, giving a final concentration of1.5mM in the reaction.

Compatibility of GoTaq DNA Polymerase with Upstream and Downstream Applications.Product Cat.# Green Reaction Buffer Colorless Reaction BufferT-Vector Cloning

pGEM®-T & pGEM®-T Easy Systems(h,i) A1360, A1380, A3600, A3610 Yes YespTARGET™ Mammalian Expression Vector System(i,j) A1410 Yes Yes

PCR Clean-UpWizard® MagneSil® PCR Clean-Up System(a) A1930 Yes YesWizard® SV 96 PCR Clean-Up System A9340 Yes YesWizard® SV Gel and PCR Clean-Up System A9281 Yes YesWizard® PCR Preps DNA Purification System(k) A7170 Yes Yes

Two-Step RT-PCRReverse Transcription System(l,m) A3500 Yes YesImProm-II™ Reverse Transcription System(l,m) A3800 Yes Yes

Transcription/TranslationTNT® T7 Quick for PCR DNA(l,m,n) L5540 Yes Yes

Separation of the components of the GoTaq Green Reaction Buffer duringelectrophoresis. PCR samples amplified using GoTaq DNA Polymerase and GoTaq GreenReaction Buffer were loaded onto an agarose gel. Samples are shown before (A) and after (B)electrophoresis. Volumes indicate the amount of amplification reaction loaded on the gel.

Amplification of various templates with GoTaq DNA Polymerase and otherPromega Taq DNA Polymerase formulations. The reactions for each template areloaded in this order: Taq DNA Polymerase in Storage Buffer B (Cat.# M1661); Taq DNAPolymerase in Storage Buffer A (Cat.# M1861); GoTaq DNA Polymerase in ColorlessReaction Buffer; GoTaq DNA Polymerase in Green Reaction Buffer. Reactions without theGreen GoTaq Reaction Buffer require the addition of loading dye prior to electrophoresis.

GoTaq® DNA Polymerase

Cat.#: M3001 (100u; 80 reactions)M3005 (500u; 400 reactions)M3008 (2,500u; 2,000 reactions)

Supplied with enzyme (5u/µl), 5X Green GoTaqReaction Buffer and 5X Colorless GoTaq ReactionBuffer. Sufficient to give the indicated number of 50µlreactions using 1.25u of enzyme per reaction.


bp

4,000 –

2,000 –1,500 –1,000 –

500 –250 –

3,000 ––––––

360bp 1.1kb 1.8kb 2.4kb 3.1kbM M

3824

TA

08_2

A

2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 1718 19 201


Amplifying DNARoutine PCR (continued)Taq DNA Polymerase & PCR Core Systems:Value and QualityPromega is a premier supplier of native Taq DNAPolymerase. We offer many options for your needs. Youcan assemble your own reagents from separate TaqDNA Polymerase and dNTPs, or purchase the PCR CoreSystems to get everything together in one package. ThePCR Core Systems(f) are supplied with a TechnicalBulletin that contains thorough coverage ofconsiderations involved in routine PCR amplification andextensive troubleshooting information.

Taq DNA Polymerase in Storage Buffer A & BPromega first offered Taq DNA Polymerase stabilizedwith Triton® X-100 (Taq DNA Polymerase in StorageBuffer A). Later we developed Taq DNA Polymerasestabilized with Tween®-20 and NP-40 (Taq DNAPolymerase in Storage Buffer B). In most cases there isno difference in performance. One key distinctionbetween the two products is compatibility with othersuppliers reaction buffers. Taq DNA Polymerase inStorage Buffer A must be used with the suppliedReaction Buffer, which contains 0.1% Triton® X-100 atthe 1X concentration. Taq DNA Polymerase in StorageBuffer B does not have this requirement and can beused either with the supplied Promega Reaction Bufferor with other Taq DNA polymerase reaction buffers.

PCR Core System ICat.#: M7660 (200 ! 50µl reactions; 1.25u Taq DNA

Polymerase/reaction)

Comes with 250u Taq DNA Polymerase in StorageBuffer B, Taq DNA Polymerase 10X Reaction Bufferwithout MgCl2, Taq DNA Polymerase 10X ReactionBuffer with MgCl2 (1.5mM at 1X), 25mM MgCl2, PCRNucleotide Mix.

PCR Core System IICat.#: M7665 (200 reactions; 1.25u Taq

Polymerase/50µl reaction)

Same components as M7660 plus Positive ControlPlasmid DNA template and Upstream and DownstreamControl Primers.


Taq DNA Polymerase in Storage Buffer ACat.#: M1861 (100u; 80 reactions)

M1865 (500u; 400 reactions)M1868 (2,500u; 2,000 reactions)

Supplied with Taq DNA Polymerase 10X ReactionBuffer, 25mM MgCl2. One reaction uses 1.25u ofenzyme.

Taq DNA Polymerase in Storage Buffer BCat.#: M1661 (100u; 80 reactions)

M1665 (500u; 400 reactions)M1668 (2,500u; 2,000 reactions)

Supplied with Taq DNA Polymerase 10X ReactionBuffer, 25mM MgCl2. One reaction uses 1.25u ofenzyme.

Citations for use of Taq DNA Polymerase online at:www.promega.com/citations/

3987

MA

02_3

A

PrimersTemplate

All components supplied in

PCR Core Systems

Taq DNAPolymerase

dNTPs

10X Thermophilic Reaction Buffer

MgCl2

The PCR CoreSystems are great forresearchers justlearning PCR

See p. 14 fortypical reaction

set-up.

See p. 25 for dNTPs.


Amplifying DNAProofreading PolymerasesIncorporation fidelity can be an important considerationfor cloning projects. Thermostable enzymes with a3!"5! exonuclease activity, commonly known asproofreading activity, offer the highest fidelity inamplification reactions. Proofreading enzymes like Pfu and Tli DNA Polymerase(e) offer three- to sixfoldhigher fidelity than standard Taq DNA Polymerase. Ingeneral, proofreading enzymes extend primers a littleslower than Taq DNA Polymerase and thus typicallyrequire longer extension times and a few more cycles.Assume 2 minutes per kilobase of amplimer, and add2–3 cycles to your reaction when using a proofreadingenzyme. With Pfu DNA Polymerase(e), it is important touse the Reaction Buffer supplied with the enzyme formaximum fidelity. Pfu Reaction Buffer is formulated togive maximum fidelity, not maximum yield. After all, youuse Pfu for fidelity not yield. If you need greater yield,use more template DNA.

Reference1. Cline, J., Braman, J.C. and Hogrefe, H.H. (1996) PCR fidelity of Pfu DNA

polymerase and other thermostable DNA polymerases. Nucl. Acids Res. 24,3546–51.

Comparison of sources of native Pfu DNA Polymerase. A 1.2kb fragment of human#1-antitrypsin gene was amplified using Pfu DNA Polymerase from Promega (Panel A) andfrom another supplier (Panel B). The target was amplified from decreasing amounts of HumanGenomic DNA (Cat.# G3041) as indicated. Lane M, 100bp DNA Ladder (Cat.# G2101).

Accuracy of thermostable polymerases. The accuracy of Pfu DNA Polymerase hasbeen reported by Cline et al. as 7.7 $ 105. Using the PCR-based forward mutation assay,they reported the accuracy of Pfu as approximately two-fold higher than Vent® (Tli DNAPolymerase) and approximately sixfold higher than Taq DNA Polymerase (1).

Pfu DNA Polymerase

Cat.#: M7741 (100u; 80 reactions)M7745 (500u; 400 reactions)

Each provided with enzyme (5u/µl), Pfu DNAPolymerase 10X Reaction Buffer (2mM MgSO4 @ 1X)sufficient to give the indicated number of 50µlreactions using 1.25u of enzyme.


Citations for use of Pfu DNA Polymerase online at:www.promega.com/citations/

Not available in North America.

Tli DNA Polymerase

Cat.#: M7101 (50u; 40 reactions)

Supplied with enzyme (5u/µl), Thermophilic DNAPolymerase 10X Reaction Buffer and 25mM MgCl2.Sufficient to give the indicated number of 50µlreactions using 1.25u of enzyme/reaction.

Citations for use of Tli DNA Polymerase online at:www.promega.com/citations/

3973

MA

02_3

A

Pfu Tli Taq0

1

2

3

4

5

6

7

8

Accu

racy

$ 10

5

DNA Polymerase

M 30 3 0.3 0.03 0.0Promega

M 30 3 0.3 0.03 0.0Supplier A

bp

1,500 –1,000 –

500 –

100 –

– 1.2kb product

2355

TA

08_8

A

A. B. Proofreaders have a 3!"5!

exonuclease activity that is lacking in

non-proofreading enzymes like Taq

DNA Polymerase. Proofreading enzymes

can degrade primers if the reaction is

allowed to sit for too long prior to

amplification. We recommend setting up

reactions on ice and adding the

proofreading polymerase just prior to

placing the reaction into a preheated

thermal cycler.

Usage Hint: Increase

amplification extension

times 2X over standard

Taq DNA Polymerase

(e.g., 2min/kb)

and add 2–3 cycles.


Amplifying DNAHot Start MethodologyHot start PCR is a commonly used technique to reducenonspecific amplification. One cause of nonspecificamplification is the assembly of PCR reactions at roomtemperature or on ice. Under these conditions, the PCRprimers may be able to anneal to various non-complementary positions on the template. Althoughactivity of thermostable DNA polymerases at roomtemperature or 4°C is usually less than 25%, they canextend nonspecifically annealed primers at thesetemperatures. Any newly synthesized product iscompletely complementary to the PCR primer, allowingthe primer to anneal specifically to this region duringPCR, resulting in an undesired amplification product.

Hot start PCR can also reduce the amount of primer-dimer formed. Primer-dimers result fromcomplementarity between the 3! ends of the PCR primers.At room temperature or on ice, these complementaryregions anneal and the polymerase extends the ends toproduce a primer-dimer. Primer-dimers often appear as adiffuse band at ~50–100bp on ethidium bromide-stainedgels. Both nonspecific products and primer-dimers cancompete with the desired amplification reaction forreagents. By avoiding the conditions that lead tononspecific amplification, hot start PCR can improve theyield of the desired PCR product.

There are several ways to perform hot start PCR. Thereaction can be assembled on ice or at roomtemperature, omitting the DNA polymerase until thereaction has been placed in the thermal cycler andheated to 60–65°C. Once the reaction has reached60–65°C the desired amount of polymerase can beadded. This prevents the polymerase from extendingprimers until the higher temperature is reached andprimer annealing is more specific. The method is quiteeffective but can be labor-intensive, particularly ifdozens of amplification reactions are involved.

Another approach to hot start PCR involves the use ofwax to physically sequester one or more critical reaction

components until the appropriate temperature isreached. Wax beads can be added to a PCR before theaddition of the DNA polymerase. Heating the PCR to60°C melts the wax, which forms a liquid layer over thesurface of the reaction, eliminating the need for mineraloil. Upon cooling to 4°C, the wax solidifies. The DNApolymerase is added onto this wax layer and, as thePCR is heated during the first denaturation step, the waxmelts and the polymerase can access the other PCRreagents. This method is labor intensive—requiring anadditional heating and cooling step to prepare the waxlayer. Also, opening the PCR tube to add the polymeraseincreases the risk of contamination. Additionally, thesolid wax layer that forms upon cooling to 4°C will clogpipet tips when attempting to break through the wax topipet the PCR. Thus, it is often necessary to use onepipet tip to puncture the wax layer and a second pipettip to remove the PCR products.

TaqBead Hot Start PolymeraseEnter Promega’s TaqBead Hot Start Polymerase(f). Byimpregnating a wax bead with Taq DNA Polymerase, theadditional heating and cooling steps to form the waxlayer are eliminated. A single bead is added to each 50µlreaction, and as the reaction is heated, the wax meltsand releases the polymerase. The molten wax rises tothe surface of the PCR where it forms an incompletebarrier. In thermal cyclers with heated lids, a holeremains above the reaction to ease pipetting. To preventevaporation in thermal cyclers without heated lids, werecommend adding mineral oil to each PCR. The moltenwax and mineral oil will mix during the thermal cyclingto form a single layer, which solidifies when the reactionis cooled to 4°C and can clog pipet tips.

TaqBead™ Hot Start Polymerase

Cat.#: M5661 (100 reactions)

Supplied with 100 beads (1.25u Taq DNA Polymerasein Storage Buffer B/bead), Thermophilic DNAPolymerase 10X Reaction Buffer, and 25mM MgCl2.


Citations for use of TaqBead Polymerase online at:www.promega.com/citations/

Hot start amplification reduces the yield of nonspecific amplification products.Aliquots of 10, 1 or 0.1pg pGEM®-luc Vector(h,o) (Cat.# E1541) were diluted in 30ng ofHuman Genomic DNA (Cat.# G3041). A 1.8kb luciferase gene product was amplified byPCR using Taq DNA Polymerase (Storage Buffer B) or TaqBead Hot Start Polymerase inPromega Reaction Buffer supplemented with 2mM MgCl2. Details are provided in Miller, K.,Smith, R. and Storts, D. (1996) Improved PCR amplification using TaqBead Hot StartPolymerase. Promega Notes 60, 2–6.

bp

2,645 –

1,605 –1,198 –

676 –517 –396 –

– primer- dimer

– 1.8kb

M 10 1 0.1 10 1 0.1

TaqCold Start

TaqBead™Hot Start

pg oftarget

1586

TA

09_6

A


Amplifying DNAdNTPsPromega is a premier supplier of high-quality dNTPs(f)

in bulk form or premixed in the PCR Nucleotide Mix(f).Promega’s dNTPs are >99% triphosphate with verifiedconcentrations. All dNTPs, whether bulk or premixed,are DNase- and RNase-free, and are functionally testedin amplification reactions. The PCR Nucleotide Mix isalso functionally tested in RT-PCR.

PCR Nucleotide Mix

Cat.#: C1141 (200µl; 200 reactions)C1145 (1,000µl; 1,000 reactions)

The PCR Nucleotide Mix supplies a single solutioncontaining each dNTP (dATP, dTTP, dGTP, dCTP) at10mM. Reaction size is considered to be 200µM ofeach dNTP in a 50µl reaction. Each reaction uses 1µlof PCR Nucleotide Mix.

Custom and bulk PCR Nucleotide Mix sizes areavailable.

Protocol:www.promega.com/tbs/9pic114/9pic114.html

Set of dATP, dCTP, dGTP and dTTPCat.#: U1330 (10µmol each; 1,000 reactions)

U1420 (25µmol each; 2,500 reactions)U1240 (40µmol each; 4,000 reactions)U1410 (200µmol each; 20,000 reactions)

Set of dUTP, dATP, dCTP and dGTPCat.#: U1335 (10µmol each; 1,000 reactions)

U1245 (40µmol each; 4,000 reactions)

Each dNTP is supplied at 100mM. Reaction size isconsidered to be 200µM each dNTP in a 50µl PCRreaction.

Custom and bulk dNTP sizes are available.

RT-PCR functional assay using PCR Nucleotide Mix. The dNTPs were used following50 freeze-thaw cycles. Amounts of template RNA: lane 1, 25fmol; lane 2, 2.5fmol; lane 3,250amol; lane 4, 25amol; lane 5, 2.5amol; lane 6, 250zmol; lane 7, no template control.

Stability of dNTPs. The integrity of the RT-PCR products on the gel demonstrates thestability of the dNTPs after storage under the conditions listed. The dNTPs used in each RT-PCR were stored as follows prior to use: Lane 2, 1 freeze-thaw cycle; lane 3, 50 freeze-thaw cycles; lane 4, 1 year at –20°C; lane 5, negative PCR control; lanes 1 and 6, 100bpDNA Ladder (Cat.# G2101).

1 2 3 4 5 6

3527

TA08

_1A

bp1,500–

1,000–

500–

1 2 3 4 5 6 7

3528

TA08

_1A

Promega’s dNTPs and

PCR Nucleotide Mix

can go through at least

50 freeze/thaws.


Amplifying DNARoutine PCRProduct Size Cat.#PCR Master Mix(f,g) 100 reactions M7502

1,000 reactions M7505For Laboratory Use. A reaction consists of 25µl of the 2X PCR Master Mix in a 50µl total volume. Supplied with Nuclease-Free Water.

Product Size Cat.#GoTaq® DNA Polymerase(e,g) 100u M3001

500u M30052,500u M3008

For Laboratory Use. Supplied with 5X Green GoTaq® Reaction Buffer and 5X Colorless GoTaq® Reaction Buffer. Both buffers contain 1.5mM Mg2+ at the 1X concentration.

Product Size Cat.#PCR Core System I(f) 200 reactions M7660PCR Core System II(f) 200 reactions M7665For Laboratory Use. PCR Core Systems provide Taq DNA Polymerase in Storage Buffer B, PCR Nucleotide Mix, Taq DNA Polymerase 10X Reaction Buffers with and without MgCl2, and 25mMMgCl2 sufficient for 200 ! 50µl reactions containing 1.25u of Taq DNA Polymerase. PCR Core System II also contains Positive Control Plasmid DNA template, and Upstream and DownstreamControl Primers.

Product Size Cat.#Taq DNA Polymerase in Storage Buffer A(e) 100u M1861(Supplied with Taq DNA Polymerase 10X Reaction Buffer without MgCl2, and 25mM MgCl2.) 500u M1865

2,500u M1868Taq DNA Polymerase in Storage Buffer A(e) 100u M2861(Supplied with Taq DNA Polymerase 10X Reaction Buffer with MgCl2, giving 1.5mM Mg2+ at the 1X concentration.) 500u M2865

2,500u M2868Taq DNA Polymerase in Storage Buffer B(e) 100u M1661(Supplied with Taq DNA Polymerase 10X Reaction Buffer without MgCl2, and 25mM MgCl2 Solution.) 500u M1665

2,500u M1668Taq DNA Polymerase in Storage Buffer B(e) 100u M2661(Supplied with Taq DNA Polymerase 10X Reaction Buffer with MgCl2, giving 1.5mM Mg2+ at the 1X concentration.) 500u M2665

2,500u M2668For Laboratory Use.

Proofreading PolymerasesProduct Size Cat.#Pfu DNA Polymerase(e)* 100u M7741(Supplied with Pfu DNA Polymerase 10X Reaction Buffer with MgSO4, giving 2mM Mg2+ at the 1X concentration.) 500u M7745Tli DNA Polymerase(e)**

(Supplied with Thermophilic DNA Polymerase 10X Reaction Buffer and 25mM MgCl2.) 50u M7101*Not Available in North America. **For Laboratory Use.


Amplifying DNAHot Start PolymeraseProduct Size Cat.#TaqBead™ Hot Start Polymerase(f)

(Supplied with Thermophilic DNA Polymerase 10X Reaction Buffer and 25mM MgCl2.) 100 reactions M5661For Laboratory Use. One bead per reaction; 1.25u Taq DNA Polymerase per bead.

dNTPsProduct Size Cat.#PCR Nucleotide Mix(f) 200µl C1141(Contains 10mM each dNTP; use 1µl per 50µl reaction.) 1,000µl C1145Set of dATP, dCTP, dGTP, and dTTP(f) 10µmol U1330

25µmol U1420(100mM each dNTP. Individual tubes available.) 40µmol U1240

200µmol U1410Set of dUTP, dCTP, dGTP, and dATP(f,p) 10µmol U1335(100mM each dNTP.) 40µmol U1245For Laboratory Use.

AccessoriesProduct Size Cat.#Promega 10 Barrier Tips, 960/pk 0.5–10µl A1491Promega 10E Barrier Tips, 960/pk 0.5–10µl A1501Promega 10F Barrier Tips, 960/pk 0.5–10µl A1511Promega 20 Barrier Tips, 960/pk 2–20µl A1521Promega 100 Barrier Tips, 960/pk 10–100µl A1541Promega 200 Barrier Tips, 960/pk 50–200µl A1551Promega 1000 Barrier Tips, 480/pk 100–1,000µl A1561Mineral Oil* 12ml DY1151Nuclease-Free Water* 150ml P1195*For Laboratory Use.

Tip and Pipette Compatibility GuideOxford

Size Pipetman® Eppendorf® Benchmate® Finnpipette®Promega 10 0.5–10µl P-2; P-10 0.5–10µl 0.5–10µl DigitalPromega 10E 0.5–10µl P-2; P-10 0.5–10µl 0.5–10µlPromega 10F 0.5–10µl 0.5–10µlPromega 20 2–20µl P-20 2–20µlPromega 100 10–100µl P-100 10–100µl 10–50µl 5–40µlPromega 200 50–200µl P-200 EDP–250µl 40–200µl 40–200µlPromega 1000 100–1,000µl P-1000 200–1,000µl 200–1,000µl


PCR Clean-UpOverviewDownstream applications such as T-Vector cloning,restriction digestion and direct sequencing benefit fromclean-up of PCR amplimers. T-vector cloning has atremendous dependence upon PCR product purity.Although unpurified amplification reactions can be usedfor T-vector cloning, more screening of the resultingcolonies is generally necessary to find the specific cloneof interest. This is because unpurified PCR amplificationreactions can contain primer-dimers and nonspecificamplimers in much higher molar quantities than the PCRproduct of interest. These nonspecific products competefor ligation with the amplimer of interest. Typically, anexperiment with unpurified products will produce a largenumber of colonies, many of which contain small,nonspecific PCR products as inserts. Thus, the efficiencyof the cloning experiment is reduced. In one case thepercentage of colonies containing the correct insert was67% using unpurified PCR products. In contrast, whenpurified PCR products were used >90% of coloniescontained the correct insert (1).

Gel IsolationGel isolation is the most effective way to isolate the PCRproduct you need for your downstream applications.Agarose gel electophoresis allows you to separate thedesired amplimer from any nonspecific bands, primersand primer-dimers. You visualize your gel quickly on aUV lightbox, using 10mg wavelength UV light, cut outthe band of interest and then purify the product. Gelisolation is typically used if the downstream applicationis cloning and additional bands, representingnonspecific amplimers or primer-dimer, are present onthe gel. The agarose is melted and combined with achaotrope like guanidine, and the DNA is then bound tosilica. Agarose and guanidine are quickly and efficientlyremoved by an alcohol wash, and the purified DNA iseluted in water.

Direct IsolationMany downstream applications such as DNA sequencingand single nucleotide polymorphism (SNP) analysisrequire that salts, dNTPs, proteins and primers beremoved from the amplification product as they caninterfere with further enzymatic reactions. Manyresearchers use a simple ethanol precipitation prior tosequencing. This removes most dNTPs and salts butleaves behind protein and may also leave primers.Phenol:chloroform extraction can remove proteincontaminants but recovery rates can be low, and the useof organics is undesirable. Use of silica technologysimplifies the whole process. The amplification reactionproducts are bound to silica in the presence of achaotrope like guanidine. Salts, dNTPs and primers passby the silica. Primer-dimers and nonspecific amplimerssmaller than 70bp are not bound efficiently. A simplealcohol wash removes the guanidine and protein whilematerial >70bp is retained. The purified DNA is eluted inwater or another low-ionic strength solution. Thesuccess of the downstream application is dependentupon the specificity of the amplification reaction, as anynonspecific amplimers will be copurified with thespecific product of interest.

Reference1. Buros, M. and Betz, N. (2002) Removal of ethidium bromide and calf

intestinal alkaline phosphatase using the Wizard® SV Gel and PCR Clean-Up System. eNotes:www.promega.com/enotes/applications/ap0045_tabs.htm

Gel Purification40

20M

A03

_3A

PCR Reaction

Wizard® SVGel & PCR

Clean-Up System

Wizard® PCRPreps DNA Purification

System

Wizard® SV 96PCR Clean-Up

System

Wizard®MagneSil® PCRClean-Up System

Direct Purification


PCR Clean-UpWizard® SV Gel and PCRClean-Up SystemThe Wizard SV Gel and PCR Clean-Up System isdesigned to extract and purify DNA fragments directlyfrom PCR reactions or from agarose gels. Fragments of100bp–10kb can be recovered from standard or low-melt agarose gels in either Tris acetate (TAE) or Trisborate (TBE) buffer. Up to 95% recovery is achieved,depending upon the DNA fragment size. Thismembrane-based system, which can bind up to 40µg ofDNA, allows recovery of isolated DNA fragments or PCRproducts in as little as 15 minutes, depending on thenumber of samples processed and the protocol used.Samples can be eluted in as little as 15µl of Nuclease-Free Water. The purified DNA can be used for automatedfluorescent sequencing, cloning, labeling, restrictionenzyme digestion or in vitro transcription/translationwithout further manipulation.

Gel analysis of PCR products before and after gel extraction using the WizardSV Gel and PCR Clean-Up System. Recovery of various sizes of unpurified (U) andpurified (P) PCR products. Purified products were extracted from a 1% agarose gel run withTAE buffer. Lane M, 1kb DNA Ladder (Cat.# G5711).

U

U: Unpurified P: Purified

100bp 500bp 1,000bp 3,199bpM

3,000bp –

1,000bp –

P U P U P U P

3789

TA

07_2

A

3790

TB

08_2

A

U

100bp 200bp 500bp

P P P U P P P U P P P

U P P P U P P P

1,000bp 1,500bp

Gel analysis of PCR products before and after direct purification using theWizard SV Gel and PCR Clean-Up System. DNA fragments of the sizes indicatedwere analyzed before (U) and after (P) direct purification from amplification reactions.

Elution volume versus recovery for a 700bp PCR product purified directlyfrom an amplification reaction using the Wizard SV Gel and PCR Clean-UpSystem. One hundred percent represents recovery with 50µl elution volume. Adaptedfrom Table 4 in Betz, N. and Strader, T. (2002) Clean up with Wizard SV for Gel and PCR.Promega Notes 82, 2–5.

Wizard® SV Gel and PCR Clean-Up System



Effect of Various PCR Additives on Recovery of a 1,000bpPCR Product Using the Wizard SV Gel and PCR Clean-UpSystem Direct Purification Method.

Percent Recovery PCR Additive Relative to “No Additive”No Additive 100%1M Betaine 94%1M Q-Solution 97%0.1% Triton® X-100 92%0.1% Tween® 20 87%0.1% NP-40 82%5% Glycerol 87%5% Formamide 90%5% DMSO 87%0.5M Tetramethylene Sulfoxide 94%0.4M Sulfolane 94%0.4M 2-Pyrolidene 95%1mM Tartrazine 100%1% Ficoll®-400 100%

3972

MA

02_3

A

10 15 25 50 75 1000

102030405060708090

100Pe

rcen

t Rec

over

y

Elution Volume (µl)

Linear DNA as

big

as 10kb can be

purified with up

to

95% recover

y.


PCR Clean-UpWizard® SV 96 PCR Clean-Up SystemThe Wizard SV 96 PCR Clean-Up System provides afast, simple technique for the efficient isolation ofpurified DNA fragments generated by PCR amplification.Walkaway automation is easily achieved on any 96-wellliquid handling workstation equipped with a gripper andvacuum apparatus. Double-stranded DNA fragments canbe purified from 96 samples in less than 20 minutes.Purification is achieved without phenol:choroformextraction or ethanol precipitation. Optimized methodsare available for the Beckman Coulter Biomek® 2000 and FX instruments.

Microarray of purified PCR products. Representative microarray blocks of PCRproduct purified using the Wizard SV 96 PCR Clean-Up System and hybridized tocomplementary Cy®3-labeled cDNA. PCR DNA was isolated from a standard amplificationreaction or from a reaction containing 1M betaine. No effect of betaine is observed.

Agarose gel analysis of PCR fragments purified on the Beckman CoulterBiomek® 2000 liquid handler. PCR fragments of 100, 200, 300, 500 and 1,000bp werepurified using the Wizard SV 96 PCR Clean-Up System on the Beckman Coulter Biomek®

2000 robotic workstation. Both purified (P) and unpurified (U) fragments were separated onan ethidium bromide-stained 2% agarose gel. Percent recovery ranged from 71 ± 3% forthe 100bp fragment to 100 ± 1% for the 1,000bp fragment. Lane M, 100bp DNA Ladder(Cat.# G2101).

Wizard® SV 96 PCR Clean-Up System

Cat.#: A9340 (1 ! 96 preps)A9341 (4 ! 96 preps)A9342 (8 ! 96 preps)


For information on automated methods, visit:www.promega.com/automethods/

1M Betaine Standard PCR

3796

TB

09_2

A

100bp 200bp 300bp 500bp 1,000bp

3801

TA

08_2

A

PM U P U P U P U P U

34

45

CA

06

_1

AWant to do 96-well agarose gel isolations?

Request Application Note #AN096.

Recommendedautomated system

for reactions preparedin the presence ofPCR enhancers likebetaine, DMSO, etc.Just like the SV

system, SV 96 workswith a wide variety of PCR additives.

If it works in SV,it’ll work in SV 96.

Manual or automated 96-well PCRpurification.


PCR Clean-UpWizard® MagneSil®PCR Clean-Up SystemThe Wizard MagneSil PCR Clean-Up System(a) removesimpurities from PCR reactions, giving high quality andyield of double-stranded amplicons. The systemremoves excess nucleotides, primers and smallamplification products such as primer-dimers from PCRreactions. The system is designed for automation onlaboratory robotic systems for unattended 96- to 384-well purification.

PCR clean-up is performed using Promega’s uniqueMagneSil Paramagnetic Particles(a) and the MagnaBot® 96Magnetic Separation Device (Cat.# V8151) fitted with a3/16" MagnaBot Spacer (Cat.# V8381). The MagnaBot 96Magnetic Separation Device is designed to work withmost robotic platforms. A MagnaBot 384 MagneticSeparation Device is also available (Cat.# V8241).

The MagneSil PCR Clean-Up procedure is fast andreliable. PCR products bind to MagneSil particles in thepresence of guanidine hydrochloride and remain tightlybound during washing. Purified DNA is eluted in waterand may be used for automated fluorescent sequencingand microarray spotting. The MagneSil PCR Clean-UpSystem is ideally suited for reactions prepared usingPCR Master Mix and GoTaq® DNA Polymerase. It alsoworks well with reactions prepared using AmpliTaq® andAmpliTaq Gold® DNA Polymerase.

Array images after hybridization with Cy3 and Cy5 fluorescent control E. coli targets. E. coli genomic DNA was amplified using 96 unique primer pairs. TheWizard MagneSil PCR Clean-Up System-purified PCR products were printed onto a poly-L-lysine-coated slide and hybridized to Cy3- or Cy5-labeled E. coli cDNA. For furtherdetails, see Splinter BonDurant, S. et al. (2002) MagneSil Paramagnetic Particles: A high-throughput PCR purification system for microarrays. Promega Notes 80, 14–16.

Percent recovery of PCR products purified using the Wizard MagneSil PCRClean-Up System. PCR amplimers were purified from standard amplification reactionsperformed using either PCR Master Mix or AmpliTaq® DNA Polymerase.

Wizard® MagneSil® PCR Clean-Up System

Cat.#: A1930 (4 ! 96 preps)A1931 (8 ! 96 preps)A1935 (100 ! 96 preps)

Protocols:Automated 96-well plate protocolwww.promega.com/tbs/tb290/tb290.htmlAutomated 384-well plate protocolwww.promega.com/tbs/ep009/ep009.html

For information on automated methods visit:www.promega.com/automethods/

% R

ecov

ery

PCR Product Size (bp) 3289

MA

03_1

A0

20

40

60

80

100

0 200 400 600 800 1,000

PCR Master Mix

AmpliTaq® DNAPolymerase

3578

TA

11_1

A

E. coli Control Array

Cy®3 Cy®5

Quality tested forsuccess in fluorescentBigDye® Sequencingwith >98% accuracyover 600 bases read.

This system is

capable of

384-well

purifications.


PCR Clean-UpWizard® PCR Preps DNA Purification SystemThe Wizard PCR Preps DNA Purification System(k)

provides a simple, reliable way to purify double-stranded,PCR-amplified DNA. PCR products are effectivelyseparated from contaminants, including primer-dimersand amplification primers. This system can also be usedto purify DNA fragments from agarose gels. The DNAcan be eluted from the Wizard PCR Preps DNAPurification Resin in water or TE buffer, with little salt ormacromolecular contamination. A unique feature of thisresin-based method is it’s size cutoff capability. The resindoes not appreciably bind double-stranded DNA smallerthan 200bp, virtually assuring the removal of primer-dimers from the reaction. Multiple PCR preps can beeasily processed at one time using the Vac-Man®

Laboratory Vacuum Manifold (Cat.# A7231).

Recovery of PCR products using the Wizard PCR Preps DNA PurificationSystem. Equivalent amounts of a PCR reaction taken before and after purification wereseparated on a 1% agarose gel and stained with ethidium bromide.

Purification and analysis of PCR products from low-melting agarose using theWizard PCR Preps System. Reactions are shown before (lanes 2 and 4) and after (lanes3 and 5) purification.

1,000 –

bpM M

500 –200 –50 –––––

Before Purification After Purification

0935

TA

11_4

A

1 2 3 4 5

0348

TA

08_3

A

Wizard® PCR Preps DNA Purification System



Citations for use available at:www.promega.com/citations/

Centrifuge to elute DNA.

Add resin/DNA mix to syringe barrel and apply vacuum.

Resin/DNA mix

Add isopropanol, removing solutionby vacuum.

TransferMinicolumn to microcentrifuge tube.

Centrifuge.

Transfer Minicolumnto new tube. Add water.

2819

MB

04_1

A

Overview of PCR product purification using the Wizard PCR Preps DNAPurification System and the Vac-Man Laboratory Vacuum Manifold.

Syringe-based protocol

also provided (where

no vacuum is required).


PCR Clean-UpPCR Clean-Up Systems and AccessoriesProduct Size Cat.#Wizard® SV Gel and PCR Clean-Up System(k) 50 preps A9281

250 preps A9282For Laboratory Use. Manual spin-basket system for direct PCR purification and gel isolation from standard agarose gels.

Product Size Cat.#Wizard® SV 96 PCR Clean-Up System* 1 ! 96 preps A9340

4 ! 96 preps A93418 ! 96 preps A9342

Vac-Man® 96 Vacuum Manifold 1 each A2291* For Laboratory Use. The Wizard® SV 96 PCR Clean-Up System provides a manual or automated system for 96-well direct PCR purification by vacuum. Compatible with a wide variety of PCR

additives and all Promega amplification reaction buffers.

Product Size Cat.#Wizard® MagneSil® PCR Clean-Up System(a)* 4 ! 96 preps A1930

8 ! 96 preps A1931Wizard® MagneSil® PCR Clean-Up System, HTP1(a)* 100 ! 96 preps A1935MagnaBot® 96 Magnetic Separation Device 1 each V8151MagnaBot® 384 Magnetic Separation Device 1 each V8241MagnaBot® Spacer (3/16”) 1 each V8381384-Well Plate, Flat 10 pack V5291* For Laboratory Use. The Wizard® MagneSil® PCR Clean-Up System provides an automated 96- or 384-well system for direct purification of PCR products. Compatible with standard reactions

using Promega's PCR Master Mix or GoTaq® DNA Polymerase.

Product Size Cat.#Wizard® PCR Preps DNA Purification System(k)* 50 preps A7170

250 preps A2180Vac-Man® Laboratory Vacuum Manifold, 20-sample capacity 1 each A7231* For Laboratory Use. The Wizard® PCR Preps DNA Purification System is a manual, resin-based vacuum system for direct purification or isolation from agarose gels.

Related ProductsProduct Size Cat.#Agarose, LE, Analytical Grade 100g V3121

500g V3125Agarose, Low Melting Point, Analytical Grade 25g V2111Blue/Orange Loading Dye, 6X* 3ml (3 ! 1ml) G1881TAE Buffer, 10X 1,000ml V4271TAE Buffer, 40X 1,000ml V4281TBE Buffer, 10X 1,000ml V4251*For Laboratory Use.


Cloning PCR DNAOverviewCloning PCR products into plasmid vectors is acommon downstream application of PCR. When PCRwas in its infancy, researchers found that it was not easyto clone PCR products by simple blunt-end ligation intoblunt-ended plasmid vectors because somethermostable DNA polymerases, including Taq DNAPolymerase, add a single nucleotide base extension tothe 3!-end of blunt DNA in a template-independentfashion (1,2). Most commonly the base added isadenine, leaving what is called an “A overhang.” Toovercome this, researchers had to treat PCR products toblunt-end the PCR fragments prior to cloning. Suchexperiments often suffered from low cloning efficiencies.

Another commonly used strategy for PCR cloning is toadd restriction enzyme recognition sites to the ends ofPCR primers (3). The PCR product is then digested andcloned into the desired vector. When using this method,care must be exercised in primer design because not allenzymes cleave efficiently at the ends of DNA fragments,and you may not be able to use every enzyme youdesire (4,5). Some enzymes require extra bases outsidethe restriction enzyme recognition site, adding furtherexpense to the PCR primers as well as increasing therisk of annealing to unrelated sequences in the genome.

The fact that amplicons generated with Taq DNAPolymerase typically have A overhangs led to themethod referred to as T-vector cloning. In essence, theplasmid cloning vector is engineered to contain 3!-Toverhangs that match the 3!-A overhang of the amplicon(6). The A-tailed amplicon is directly ligated to the T-tailed plasmid vector, and there is no need for furtherenzymatic treatment of the amplicon other than theaction of T4 DNA Ligase. Promega has systems basedon this technology for routine subcloning and directmammalian expression.

References1. Clark, J.M. (1988) Novel non-template nucleotide addition reactions

catalyzed by procaryotic and eucaryotic DNA polymerases. Nucl. Acids Res.16, 9677–86.

2. Mole, S.E., Iggo, R.D. and Lane, D.P. (1989) Using the polymerase chainreaction to modify expression plasmids for epitope mapping. Nucl. AcidsRes. 17, 3319.

3. Scharf, S.J., Horn, G.T. and Erlich, H.A. (1986) Direct cloning and sequenceanalysis of enzymatically amplified genomic sequences. Science 233,1076–78.

4. Kaufman, D.L. and Evans, G.A. (1990) Restriction endonuclease cleavage atthe termini of PCR products. BioTechniques 9, 304–6.

5. Digestion of restriction sites close to the end of linear DNA. In: RestrictionEnzyme Resource Guide. Promega Corporation.www.promega.com/guides/re_guide/chaptwo/2_6.htm

6. Mezei, L.M. and Storts, D.R. (1994) Cloning PCR Products. In: PCRTechnology Current Innovations. Griffin, H.G. and Griffin, A.M. (eds). CRC Press, pp. 21–7.

pGEM®-T Vector

pGEM®-T Easy Vector

pTARGET™ MammalianExpression Vector

T

A

A

TT

T

TT

For cloning PCR products, the choice is yours37

79M

A07

_2A

BasicSubcloning Basic

Subcloning

Direct MammalianExpression

• Great for sequencing!• Drop out insert with single BstZ I digest

• Great for sequencing!• Drop out insert with single EcoR I, Not I or BstZ I digest

• CMV promoter

• NeoR gene for

G-418 Selection

• Drop out insert with

single EcoR I digest


Cloning PCR DNABasic SubcloningpGEM®-T and pGEM®-T Easy Vector SystemsThe most basic need in PCR cloning is for simple, generalcloning vectors. The pGEM-T and pGEM-T Easy VectorSystems(h,i) were designed for just that purpose. Thevectors are based on the pGEM-5Zf(+) Vector(h) backbone.The pGEM-T and -T Easy Vectors provide convenient T7and SP6 promoters that serve as sequencing primerbinding sites and also allow in vitro transcription of eitherstrand of the insert with the appropriate RNA polymerase.The vectors also have the lacZ! coding region, allowingeasy blue/white screening of recombinants. The pGEM-Tand -T Easy Vectors are provided with 2X Rapid LigationBuffer, which allows efficient ligation in just 1 hour with thesupplied T4 DNA Ligase. You can either supply your ownfavorite E. coli competent cells or purchase the system withPromega’s high-efficiency JM109 Competent Cells. Thechoice is yours.

pGEM®-T Vector System I(you supply the competent cells)Cat.#: A3600 (20 reactions)

pGEM®-T Vector System II(supplied with High Efficiency JM109 Competent Cells)Cat.#: A3610 (20 reactions)


Citations for use of the pGEM®-T System online at:www.promega.com/citations/

Need sequencing-grade plasmid DNA? Promega has the system.

Wizard® Plus SV Minipreps DNA Purification System(q,r)

Simple spin preps for plasmid DNA. Guaranteed forfluorescent sequencing.

Cat.#: A1330 (50 preps)Cat.#: A1460 (250 preps)


What is Blue/White Selection?

The enzyme "-galactosidase, the product of thebacterial lacZ gene, can be separated into twodomains—the !-fragment and the #-fragment. The twofragments interact to form a functional "-galactosidase.For blue/white selection, the #-fragment is expressedby the E. coli host strain, and the !-fragment isprovided by the cloning vector. An intact, in-frame !-fragment will interact with the host strain #-fragment, creating functional "-galactosidase. This isknown as !-complementation. Bacteria capable ofproducing functional "-galactosidase will cleave thesubstrate X-Gal (5-bromo-4-chloro-3-indolyl-"-D-galactopyranoside), creating blue colonies when grownon indicator plates containing IPTG and X-Gal (seerecipe on p. 40). Blue/white-capable cloning vectorshave a multiple cloning site within the !-fragmentcoding sequence. When your sequence of interest isinserted within this region, the !-fragment is disrupted,!-complementation does not occur, and the colony iswhite. E. coli (e.g., JM109, DH5!™ or XL1-Blue)transformed with an insert-containing plasmid producewhite colonies, while those containing empty orreligated vector produce blue colonies.

Sca I1875

ori

Ampr

Apa IAat IISph IBstZ INco ISac II

Spe INot IBstZ IPst ISal INde ISac IBstX INsi I

T7

!

Xmn I 1994Nae I 2692

lacZ

f1 ori 1 start 14 20 26 31 37 46

55 62 62 73 75 82 94103112126

SP6!

T TpGEM®-T

Vector(3000bp)

0356

VA

04_3

ASelect recombinants byblue/white selection.

Drop out yourinsert with asingle Bst Z I

digest.Sequence

inserts with:

SP6 Promoter Prim

er

T7 Promoter Primer

pUC/M13 Forward Prim

er

pUC/M13 Reverse Prim

er


Cloning PCR DNA

For maximum subcloning efficiency, purify the PCRproduct before subcloning. The presence of PCRprimers and primer-dimers can reduce subcloningefficiency. See Chapter 3 for more information.

If you do not purify your PCR product, at least makethe amplification as specific as possible. The cleanerthe product, the better the ligation efficiency. Try toavoid production of primer-dimers by optimizing theamplification reaction conditions. See Chapter 2 formore information on optimizing PCR.

Example of Transformation Efficiency Calculation:

After 100µl competent cells are transformed with0.1ng uncut plasmid DNA, the transformationreaction is added to 900µl of SOC medium (0.1ng DNA/ml). A 1:10 dilution with SOC medium(0.01ng DNA/ml) is made, and 100µl is plated oneach of two plates (0.001ng DNA/100µl). If 200colonies are obtained (average of two plates), what isthe transformation efficiency?

200cfu ! 1ng = 2 ! 108 cfu/µg DNA0.001ng 10–3µg

pGEM®-T Easy Vector System I(you supply the competent cells)Cat.#: A1360 (20 reactions)

pGEM®-T Easy Vector System II(supplied with High Efficiency JM109 Competent Cells)Cat.#: A1380 (20 reactions)


Citations for use of the pGEM-T Easy System online at:www.promega.com/citations/

Relationship between incubation time and cloning efficiency using the 2XRapid Ligation Buffer and the pGEM-T Easy Vector. The Control Insert DNAsupplied with the pGEM-T Easy Vector was ligated into the vector using a 1:1 vector:insertmolar ratio. The Rapid Ligation Buffer and T4 DNA Ligase were used in ligation reactions,which were set up at room temperature (24°C) and allowed to proceed from 0.25 to 16hours. Number of white colonies (transformants) versus time of ligation are shown. Thisgraph was adapted from Table 2 in Frackman, S. and Kephart, D. (1999) Rapid Ligation forthe pGEM-T and pGEM-T Easy Vector Systems. Promega Notes 71, 8–10.

Sca I 1890

ori

pGEM"-T EasyVector

(3015bp)

Ampr

Apa IAat IISph IBstZ INco IBstZ INot ISac IIEcoR I

Spe IEcoR INot IBstZ IPst ISal INde ISac IBstX INsi I

T7

!Xmn I 2009

Nae I 2707

lacZ

f1 ori

1 start 14 20 26 31 37 43 43 49

64 70 77 77 88 90 97109118127141

SP6!

T T

1473

VA05

_6A

Drop out yourinsert with asingle Bst Z I,EcoR I or

Not I digest.Sequence inserts with:SP6 Promoter PrimerT7 Promoter PrimerpUC/M13 Forward PrimerpUC/M13 Reverse Primer

For maximum efficiency,use competent cellscapable of at least 1 x 108cfu/µg DNA.

4019

MA

03_3

A0

50

100

150

200

250

300

350

400

450

0 4 8 10 12 14 16

Num

ber o

f Whi

te C

olon

ies

Hours2 6


Cloning PCR DNADirect Mammalian ExpressionpTARGET™ Mammalian Expression Vector SystemThe pTARGET Mammalian Expression Vector(i,j) isdesigned to streamline your experiments, allowing youto go from PCR and T-vector cloning directly toexpression analysis in a mammalian system. ThepTARGET Vector is based on the popular pCI-neoVector(h,j) (Cat.# E1841) and delivers powerfulmammalian expression through the CMV promoter. Thevector also has the neomycin resistance necessary forG-418 Sulfate selection of stable transformants.

The pTARGET Vector is the only mammalian expressionT-vector offering blue/white selection of recombinants.The vector contains the lacZ !-peptide fragment tocomplement the "-fragment of lacZ that is expressed incommon E. coli strains like JM109, DH5!™ and XL-1Blue. See page 35 for more explanation of blue/whiteselection.

pTARGET™ Mammalian Expression Vector SystemCat.#: A1410 (20 reactions and 20 transformations

with high-efficiency JM109 Competent Cells)


Citations for use of the pTARGET System online at:www.promega.com/citations/

The pTARGET Vector contains the simian virus 40(SV40) enhancer and early promoter regionupstream of the neomycin phosphotransferase gene.The SV40 early promoter contains the SV40 origin ofreplication, which will induce transient, episomalreplication of the pTARGET Vector in cells expressingthe SV40 large T antigen such as COS-1 or COS-7cells (1). Consequently, the copy number of thevector will increase in these SV40-transformed celllines and give higher transient expression than inother cell types.

1. Gluzman, Y. (1981) SV40-transformed simian cells support thereplication of early SV40 mutants. Cell 23, 175–82.

pTARGET Mammalian Expression Vector has been usedfor transient expression in many cell lines including:

COS-1 SV40-transformed monkey kidneyCOS-7 SV40-transformed monkey kidneyH9c2 rat myoblastMcA-RH7777 rat hepatomaPrimary human melanoma

The pTARGET Mammalian Expression Vector has beenused to create stable transfectants by G-418 Sulfateselection in many cell lines including:

1376 TCC human bladder transitional cell carcinoma 293 human embryonic kidney cellA549 human adenocarcinomaCHO Chinese hamster ovaryNIH/3T3 mouse fibroblastJ82 human bladder transitional cell carcinomaPS120 Chinese hamster lung fibroblastRAW264.7 mouse monocyte/macrophage cell lineT24 human bladder transitional cell carcinomaU937 human leukemic cells

See Promega’s online citation database for furtherexamples and details: www.promega.com/citations/

Sgf I 664

I-Ppo I851

Bgl II 5665

SV40 Enhancer/EarlyPromoter

SV40 Latepoly (A)

fl oriSyntheticpoly(A)

Ampr

ori

CMVEnhancer/Promoter

Intron

Neo

pTARGET™Vector

(5670bp)

TT

EcoR IBamH INhe IXho IMlu I

lacZ

lacZ

Sma IKpn ISal IAcc INot IEcoR I

T7

!

12501256126412701276

129313011303130413111318

T overhangs

1505

VA

07_6

A

Sequence inserts with:

T7 Promoter Primer

pTARGETSequencing Primer

The only mammalian

expression T-vector

capable of blue/white

screening.

Drop out your insertwith a single

EcoR I digest.


Cloning PCR DNADirect Mammalian Expression (continued)pTARGET™ Mammalian Expression Vector System

Expression of various reporter proteins using either the pTARGET Mammalian Expression Vector or the pCI-neo Mammalian Expression Vector. The pTARGET Vector wasdesigned from the pCI-neo Vector (Cat.# E1841). Vector sequences for blue/white selection do not interfere with expression. T.U. = Turner light units. Details of this experiment may be foundin Brondyk, B. (1996) pTARGET Vector: A new mammalian expression T-Vector. Promega Notes 58, 2–7.

Need transfection grade plasmid DNA? Promega has the system.

Wizard MagneSil Tfx™ System(s)

For automated 96-well transfection-grade plasmid DNA purification.

Cat.#: A2380 (4 ! 96 preps)A2381 (8 ! 96 preps)


For information on automated methods visit:www.promega.com/automethods/

For expression in mammalian systems, your ampliconshould contain an initiation AUG codon and a stopcodon. Ideally the AUG codon is in the context of aKozak consensus sequence: (A or G)CCAUGG (1). Be sure the initiation codon is the first AUG codonencountered in the sequence.

1. Kozak, M. (1987) At least six nucleotides preceding the AUG initiatorcodon enhance translation in mammalian cells. J. Mol. Biol. 196, 947–50.

2040

6080

100120140

0Hum

an G

row

th H

orm

one

Activ

ity (n

g/m

l con

d. m

ediu

m)

Fire

fly L

ucife

rase

Act

ivity

(T

.U./p

late

! 10

6 )

Cells Transfected

CAT

Activ

ity

(CPM

/pla

te!

106 )

"-ga

lact

osid

ase

Activ

ity

(uni

ts/p

late

! 10

-3)

12345678

0

pCI-neopTARGET™

pCI-neopTARGET™

pCI-neopTARGET™

pCI-neopTARGET™

pCI-neopTARGET™

Reni

lla L

ucife

rase

Act

ivity

(T

.U./p

late

! 10

6 )

HeLa NIH3T3

Cells TransfectedHeLa NIH3T3




2.5

2

3.5

3

1.5

0.5

1

0

10

20

30

40

50

60

0

05

10152025303540

A. C.B.

D. E.

1539

MA

07_6

A

Learn about transfection and tools available fromPromega in the Transfection Guide available online at:www.promega.com/guides/, or request literature#BR041 from your local Promega representative.

Experimental detailsavailable at:

www.promega.com/pnotes/58/5189a/5189a.html

44

32

CA


Cloning PCR DNAPCR Cloning TechniquesRapid PCR-Based Screen for Orientation of InsertAll Promega PCR cloning vectors have some uniquelandmarks, including RNA promoter primer binding sitesallowing easy sequencing of inserts. The primer bindingsites can also be used to rapidly screen for insertorientation. For example, we cloned a 1.8kb insert intothe pGEM®-T Easy Vector System (1). The insert couldbe oriented in one of two ways—toward the T7promoter or toward the SP6 promoter:

To check for orientation, we performed colony PCR withthe T7 Promoter Primer and either the gene-specificforward PCR primer or reverse PCR primer. Eight whitecolonies with inserts were chosen from the cloningexperiment for orientation analysis. Clones with the T7orientation will produce the fragment with only thereverse PCR primer, and clones in the opposite (SP6)orientation will only produce a product with the forwardPCR primer as illustrated below.

Reference1. Knoche, K. and Kephart, D. (1999) Cloning blunt-end Pfu DNA polymerase-

generated PCR fragments into pGEM-T Vector Systems. Promega Notes 71,10–13.

Giving Blunt-Ended DNA an A-Tail for T-VectorSubcloningPCR amplicons generated with proofreadingpolymerases like Pfu or Tli DNA Polymerase are blunt-ended. Promega has developed an easy method to addan A-tail to PCR products generated using thesepolymerases so that they will become suitablesubstrates for T-vector cloning. Full details of theprotocol are available in the pGEM-T and pGEM-T EasyVector Systems Technical Manual #TM042.

Ends Left by Various Thermostable Polymerases.Taq DNA Polymerase 3!A overhang*GoTaq® DNA Polymerase 3!A overhang*Tfl DNA Polymerase 3!A overhang*Tth DNA Polymerase 3!A overhang*Pfu DNA Polymerase BluntTli DNA Polymerase BluntLong PCR mixes BluntProofreading Polymerases Blunt* All bases may be found at 3! overhang. A tends to occur most often.

T7 OrientationForward Primer

Reverse Primer SP6 Primer

T7 Primer

T7 1.8kb fragment SP6

SP6 OrientationReverse Primer

Forward Primer SP6 Primer

T7 Primer

T7 1.8kb fragment SP6

2574

MB

02_9

A

Start with 1–7µl of purified PCR fragment generated by aproofreading polymerase (e.g., Pfu DNA Polymerase).

Add 1µl Taq DNA Polymerase 10X Reaction Buffer with MgCl2.

Add dATP to a final concentration of 0.2mM.

Add 5 units of Taq DNA Polymerase.

Add deionized water to a final reaction volume of 10µl.

Incubate at 70°C for 15–30 minutes.

Use 1–2µl in a ligation reaction with Promega’s pGEM®-T and pGEM®-T Easy Vector. 23

57M

A02

_9A

An A-tailing procedure for blunt-ended PCR fragments.

Colony PCR. Colonies were suspended in 50µl sterile water, boiled for 10 minutes,centrifuged at 16,000 " g for 5 minutes, and 5µl of the supernatant was used in eachamplification. The DNA was amplified by PCR in 50µl volumes with 50pmol of each primerand 1.25 units of Promega’s Taq DNA Polymerase (Cat.# M1661). After an initialdenaturation of 2 minutes at 94°C, the amplification profile was 35 cycles of denaturation(94°C for 30 seconds), annealing (55°C for 1 minute) and extension (72°C for 2.5minutes); PCR was concluded with 1 cycle of 72°C for 10 minutes. Amplification products(8µl) were analyzed on a 1% agarose gel containing ethidium bromide.

M 1 2 3 4

2575

TA

02_9

A

T7 + For.

bp

2,645–

1,605–1,198–

676–517–

222–

T7 + Rev.1 2 3 4

For more information and techniquesfor cloning PCR DNA, check out

Promega's Frequently Asked Questionson the T-vector cloning systems at:

www.promega.com/faq/


Cloning PCR DNAPCRCloning Techniques (continued)What PCR Cloning Controls Can Do For YouEach Promega PCR cloning system is provided with aControl Insert. The ligation and subsequent transformationof the Control Insert can give you a lot of informationabout your ligation and transformation reactions.

The total number of blue colonies in Control Insert andno-insert controls should be approximately equal. Thenegative control may have some white colonies.

Bacterial Plates for Blue/White SelectionLB medium (per liter)10g Bacto®-tryptone5g Bacto®-yeast extract5g NaClAdjust pH to 7.0 with NaOH.

Ampicillin Stock SolutionDissolve at 50mg/ml in water. Filter sterilize. Store inaliquots at –20°C

IPTG stock solution (0.1M)1.2g IPTG (Cat.# V3951)Add water to 50ml final volume. Filter-sterilize andstore at 4°C.

X-Gal (2ml)100mg X-Gal (Cat.# V3941)Dissolve in 2ml N,N!-dimethyl-formamide. Cover withaluminum foil and store at –20°C.

LB plates with ampicillin/IPTG/X-GalAdd 15g agar to 1 liter of LB medium. Autoclave.Allow the medium to cool to 50°C before addingampicillin to a final concentration of 100µg/ml, thensupplement with 0.5mM IPTG and 80µg/ml X-Gal andpour the plates. Pour 30–35ml of medium into 85mmpetri dishes. Let the agar harden. Store at 4°C for upto 1 month or at room temperature for up to 1 week.

Interpreting ResultsResults with the experimental insert look like thosewith the Control Insert in terms of efficiency and %white colonies.Successful experiment. Greater than 80% of the whitecolonies should contain inserts.

Results with the experimental insert and ControlInsert look like the negative control.Ligation has failed. Avoid multiple freeze/thaws of theligation buffer. Ligase buffer contains ATP and couldbe damaged by freeze-thaws. You may need to aliquotthe ligase buffer into useful portions for yourexperimental needs.

Few/No colonies with experimental insert, ControlInsert or negative control.Transformation has failed. Reassess the competentcells with an intact, supercoiled plasmid anddetermine the transformation efficiency. Use cells >1 " 108cfu/µg to insure >100 colonies from theControl Insert ligation.

Experimental insert gives more blue colonies thanthe Control Insert or negative control and less whitecolonies than the Control Insert.In-frame insertion with no interruption of the #-fragment. Although the pGEM-T Vector ControlInsert will produce recombinants that generate whitecolonies, the insertion of other DNA fragments into thelacZ coding sequence may not result in white coloniesunless the fragments disrupt the lacZ reading frame.Although this tends to occur most frequently with PCRproducts of 500bp or less, inserts of up to 2kb havebeen reported to result in blue colonies. Moreover,some insert DNAs can also give pale blue colonies or“bull’s eye” colonies that have a blue center and awhite perimeter. In one case, we found that a 1.8kbinsert produced white colonies when oriented in onedirection and bull’s eye colonies when oriented in theopposite direction (1).

1. Knoche, K. and Kephart, D. (1999) Cloning blunt-end Pfu DNApolymerase-generated PCR fragments into pGEM-T Vector Systems.Promega Notes 71, 10–13.

Typical PCR Cloning Results Using pGEM®-TEasy Vector and JM109 Competent Cells (1.5 " 108 cfu/ng DNA).

Efficiency % White(cfu/ng DNA) Colonies

Control Insert 1,110 92%Control Insert 1,125 92%No insert 92 0%No insert 109 0%Ligations performed at room temperature for 1 hour.


Cloning PCR DNABasic SubcloningProduct Size Cat.#pGEM®-T Vector System I(h,i) 20 reactions A3600pGEM®-T Vector System II(h,i) 20 reactions A3610pGEM®-T Easy Vector System I(h,i) 20 reactions A1360pGEM®-T Easy Vector System II(h,i) 20 reactions A1380For Laboratory Use. pGEM®-T and pGEM®-T Easy Vector Systems I do not include competent cells. With System II, competent cells are provided.

Direct Mammalian ExpressionProduct Size Cat.#pTARGET™ Mammalian Expression Vector System(i,j) 20 reactions A1410Competent Cells provided.

PrimersProduct Size Cat.#T7 Promoter Primer (10µg/ml)[5!-d(TAATACGACTCACTATAGGG)-3!] 2µg Q5021SP6 Promoter Primer (10µg/ml) [5!-d(TATTTAGGTGACACTATAG)-3!] 2µg Q5011pUC/M13 Forward Primer (10µg/ml) [5!-d(CGCCAGGGTTTTCCCAGTCACGAC)-3!] 2µg Q5601pUC/M13 Reverse Primer (10µg/ml) [5!-d(TCACACAGGAAACAGCTATGAC)-3!] 2µg Q5421pTARGET™ Sequencing Primer (10µg/ml) [5!-d(TTACGCCAAGTTATTTAGGTGACA)-3!] 2µg Q4461PinPoint™ Vector Sequencing Primer [5!-d(CGTGACGCGGTGCAGGGCG)-3!] 2µg V4211

DNA Purification SystemsProduct Size Cat.#Wizard® Plus SV Minipreps DNA Purification System(q,r)* 50 preps A1330

250 preps A1460Wizard MagneSil Tfx™ System(s) 4 " 96 preps A2380(Automated transfection-grade plasmid purification.) 8 " 96 preps A2381*For Laboratory Use.


Cloning PCR DNAAccessory ProductsProduct Size Cat.#Select96™ Competent Cells (Single aliquot competent cells, use 1 to 96 at a time, >1 ! 108 cfu/µg DNA) 1 ! 96 preps L3300JM109 High Efficiency Competent Cells (108cfu/µg)* (Packaged 5 ! 200µl; use 50µl per transformation >1 ! 108 cfu/µg DNA) 1ml L2001IPTG, Dioxane-Free 5g V3951

50g V3953X-Gal (50mg/ml) 100mg V3941Antibiotic G-418 Sulfate (potency >500µg/mg) 100mg V7981

1g V79825g V7983

Antibiotic G-418 Sulfate Solution (potency 40–60mg/ml) 20ml V8091*For Laboratory Use.

Transfection ReagentsProduct Size Cat.#TransFast™ Transfection Reagent(t) 1.2mg E2431Tfx™-10 Reagent(u) 9.3mg E2381Tfx™-20 Reagent(u) 4.8mg E2391Tfx™-50 Reagent(u) 2.1mg E1811


DNA Analysis Tools

– 1,353

bp

– 1,078

– 872

– 603

– 310– 281/271– 234– 194

– 118

– 72

2% agarose

BenchTop !X174DNA/Hae III Markers

Cat.# G7511 Load 5µl/lane

– 2,645

bp

– 1,605

– 1,198

– 676

2% agarose

– 517– 460– 396– 350

– 222– 179

– 126

– 75/65 [51,36]

BenchTop pGEM®

DNA Markers Cat.# G7521 Load 5µl/lane

bp

– 1,000– 750

– 500

– 300

– 150– 50

2% agarose

BenchTop PCR Markers Cat.# G7531 Load 6µl/lane

bp

– 250,253

– 500

– 750

– 1,000

– 1,500

– 2,000– 2,500– 3,000

– 4,000– 5,000– 6,000–––––––– 8,000– 10,000

0.7% agarose

BenchTop 1kb DNA Ladder Cat.# G7541 Load 6µl/lane

bp

– 300

– 200– 175– 150– 125– 100– 75– 50

– 25

– 250––––– 275––––– 225

2% agarose/TAE

2054

TA

02_8

A

25bp DNA Step Ladder Cat.# G4511 Load 5µl/lane

bp

2% agarose/TAE

– 800

– 500– 450– 400– 350– 300– 250– 200

– 150

– 100

– 50

– 600– 700––––– 750––––– 650––––– 550

2053

TA

02_8

A

50bp DNA Step Ladder Cat.# G4521 Load 5µl/lane

bp

– 1,500

– 1,000– 900– 800– 700

– 600

– 500

– 400

– 300

– 200

– 100

2% agarose

0973

TC

03_5

A

100bp DNA Ladder Cat.# G2101 Load 5µl/lane

bp

– 250,253

– 500

– 750

– 1,000

– 1,500

– 2,000– 2,500– 3,000

– 4,000– 5,000– 6,000–––––––– 8,000– 10,000

0.7% agarose

1kb DNA Ladder Cat.# G5711 Load 5µl/lane

bp

– 23,130

– 9,416– 6,557

– 4,361

– 2,322– 2,027

[564, 125]

0.7% agarose

1258

TB

09_5

A

Lambda DNA/Hind III Markers

Cat.# G1711 Load 1µl/lane

bp

– 1,353

– 1,078– 872

– 603

– 310– 281––––– 271

– 234

– 194

– 118

[72]

8% acrylamide

1238

TA

09_5

A

!X174 DNA/Hae III Markers Cat.# G1761 Load 1µl/lane

Benchtop DNA MarkersReady-to-load markers premixedwith Promega’s Blue/OrangeLoading Dye. The markers arestable at room temperature soyou can store them on yourbench top!

Ladders and Digest MarkersPromega’s ladders and digest markers allow you tochoose the markers you want, mix and load as much asyou wish. Each marker comes with a tube of Blue/OrangeLoading Dye, 6X for both the marker and your samples.

Ready-to-loadmarkers you storeon your bench top

Dna

Documents

Transcript of Dna