DNA Structure, Replication, and Organization
description
Transcript of DNA Structure, Replication, and Organization
DNA Structure, Replication, and OrganizationChapter 14
Discovery of DNA
Nucleic Acids were discovered in 1869 by Friedrich Mieschner as a substance contained within nuclei
1929 Phoebus Levene discovered that DNA was a polymer of nucleotides
During the ’30s & 40’s proteins rather than DNA was thought to hold genetic information
Griffith Discovers Transformation 1928 Attempting to develop a vaccine Isolated two strains of Streptococcus
pneumoniaeRough (R) strain was harmlessSmooth (S) strain was pathogenic
1. Mice injected with live cells of harmless strain R.
2. Mice injected with live cells of killer strain S.
3. Mice injected with heat-killed S cells.
4. Mice injected with live R cells plus heat-killed S cells.
Mice die. Live S cells in their blood.
Mice live. No live R cells in their blood.
Mice die. Live S cells in their blood.
Mice live. No live S cells in their blood.
Transformation
Transformation
What happened in the fourth experiment? The harmless R cells had been
transformed by material from the dead S cells
Descendents of the transformed cells were also pathogenic
Why?
Oswald & Avery
What is the transforming material? Cell extracts treated with protein-digesting
enzymes could still transform bacteria Cell extracts treated with DNA-digesting
enzymes lost their transforming ability Concluded that DNA, not protein,
transforms bacteria
Bacteriophages Viruses that infect
bacteria Consist of protein and
DNA Inject their hereditary
material into bacteria cytoplasm
bacterial cell wall plasma
membrane
Figure 13.4bPage 219
Hershey & Chase’s Experiments
Created labeled bacteriophagesRadioactive sulfur – Labels ProteinsRadioactive phosphorus – Labels Nucleic Acids
Allowed labeled viruses to infect bacteria Asked: Where are the radioactive labels after
infection?
Hershey – Chase Experiment
What is DNA?
DNA is a Nucleic Acid Polymer of Nucleotides Each nucleotide consists of
Deoxyribose (5-carbon sugar) Phosphate groupA nitrogen-containing base
Four basesAdenine, Guanine, Thymine, Cytosine
Nucleotide Structure
Composition of DNA
Chargaff showed:Amount of adenine relative to guanine differs
among speciesAmount of adenine always equals amount of
thymine and amount of guanine always equals amount of cytosine
A=T and G=C
Rosalind Franklin’s Work
Was an expert in X-ray crystallography Used this technique to examine DNA fibers Concluded that DNA was some sort of helix
Watson-Crick Model DNA consists of two nucleotide strands:
Double Helix Strands run in opposite directions - Antiparallel Strands are held together by hydrogen bonds between
bases A binds with T and C with G The sides of the ladder are a sugar-phosphate
backbone, while the “rungs” of the ladder are the bases
DNA is antiparallel
The four bases of DNA are:
Adenine (A) Guanine (G) Thymine (T) Cytosine (C)
Adenine always hydrogen bonds with Thymine (A-T)
Guanine always hydrogen bonds with Cytosine (G-C)
These bonding patterns are called base pairings (bp)
Base-pairing rule
The pattern of base pairing is the mechanism by which DNA holds information.
Humans have a > 6 billion of these base pairings
Less than 5% of our DNA actually forms genes
There about 30,000 genes encoded in our DNA, nearly half of these genes either have yet to be discovered or their function is unknown
DNA is written out like this:
CTCGAGGGGCCTAGACATTGCCCTCCAGAGAGAGCACCCAACACCCTCCAGGCTTGACCGGCCAGGGTGTCCCCTTCCTACCTTGGAGAGAGCAGCCCCAGGGCATCCTGCAGGGGGTGCTGGGACACCAGCTGGCCTTCAAGGTCTCTGCCTCCCTCCAGCCACCCCACTACACGCTGCTGGGATCCTGGA
DNA replication
Before mitosis and meiosis, all of the DNA in the cell must be copied or replicated
How does this happen?
How does DNA replicate? Possibilities:
DNA Replication The mechanism by which DNA is replicated is
considered semi-conservative Semi-conservative replication: Half of the
original parent DNA molecule is conserved in each of the daughter molecules.
This allows for the parent DNA to serve as a template for generating the daughter DNA molecules
Half of the replicated DNA strand is “old” and the other half is “new”
newnew old old
DNA Replication Semi-
Conservative
Basepairing During Replication
• Each old strand serves as a template for the new complementary strand
Enzymes Required for Replication
Helicase: “Melts” or opens up the double strand so that the DNA is single stranded
DNA polymerase: multiple types, responsible for the actual synthesis of DNA
Ligase: Joins together small newly synthesized pieces of DNA called Okazaki fragments
Primase: Adds an RNA primer so that DNA synthesis can begin
• DNA is synthesized 5’ to 3’
• Energy for synthesis comes from the removal of the two phosphates of the in coming nucleotide
DNA Replication
DNA Replication
DNA Replication
Since DNA is antiparallel, synthesis occurs in opposite directions
One strand in continuously synthesized - leading strand (5’3’)
The other is synthesized in short discontinuous strands - lagging strand (3’5’)
Because of this DNA synthesis is called Semidiscontinuous
Fig. 14-12a, p. 290
Unwinding enzyme(helicase)
PrimaseRNA primers
Replication fork
Overall direction of replication
RNA
Leading strand
Lagging strandDNA polymerase
DNA polymerase
RNADNA
RNA primers are used as starting points for the addition of DNA nucleotides by DNA polymerases.
1
2
Helicase unwinds the DNA, and primases synthesize short RNA primers.
Fig. 14-12b, p. 290
Primer being extendedby DNA polymerase
DNA polymerase
Newly synthesized primer
DNApolymerase
Nick Another type of DNA polymerase removes the RNA primer, replacing it with DNA, leaving a nick between the newly synthesized segments.
DNA unwinds further, and leading strand synthesis proceeds continuously, while a new primer is synthesized on the lagging strand template and extended by DNA polymerase.
3
4
Fig. 14-12c, p. 290
DNA ligase
Lagging strandLeading strand
Newly synthesizedprimer
DNA polymerase
Primer being extendedby DNA polymerase
6
Nick is closedby DNA ligase.
DNA continues to unwind, and the synthesis cycle repeats as before: continuous synthesis of leading strand and synthesis of a new segment to be added to the lagging strand.
5
DNA Synthesis
Begins at sites that act as replication origins
Proceeds from the origins as two replication forks moving in opposite directions
Replication From Multiple Origins
DNA Replication: Fast & Accurate!
It takes E. coli <1 hour to copy 5 million base pairs in its single chromosome & divide to form 2 identical daughter cells
Human cell copies its 6 billion bases & divide into daughter cells in only few hours
Remarkably accurateonly ~1 error per 100 million bases~30 errors per cell cycle
DNA Repair
DNA polymerase enzymes Recognize distorted regions caused by
mispaired base pairs Remove DNA section with mispaired base
from the newly synthesized nucleotide chainResynthesize the section correctly, using
original template chain as a guide
DNA Repair