DNA Structure and DNA Replication - Maricopa Community Colleges
Transcript of DNA Structure and DNA Replication - Maricopa Community Colleges
![Page 1: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/1.jpg)
DNA Structure and DNA Replication
![Page 2: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/2.jpg)
Why Do Cells Divide?
• Reproduction• Growth and Development• Tissue Renewal
![Page 3: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/3.jpg)
What Structures Do Divide When The Cell Divides?
![Page 4: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/4.jpg)
What is a Chromosome?
![Page 5: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/5.jpg)
How many chromosomes do humans have?
46
46 pa
irs 23
23 pa
irs
1 an
d 4
20% 20% 20%20%20%
1. 462. 46 pairs3. 234. 23 pairs5. 1 and 4
![Page 6: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/6.jpg)
DNA Replication: When Does It Happen?
![Page 7: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/7.jpg)
How Are Features Passed Along?
![Page 8: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/8.jpg)
Mendel and The Idea of Gene
![Page 9: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/9.jpg)
Where Are Genes Located?
![Page 10: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/10.jpg)
Genes Are Stretches of DNA (deoxyribonucleic acid)
• Genes are instructions for producing a trait• Locus is the spot each genes has on a
chromosome• A gene is a stretch of DNA
![Page 11: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/11.jpg)
DNA Structure: The Double Helix
![Page 12: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/12.jpg)
DNA as Hereditary Material
![Page 13: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/13.jpg)
DNA is a Nucleic Acid: Nucleic Acids Are Made of Nucleotides
RNA is a single-stranded molecule DNA is a double-stranded molecule
![Page 14: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/14.jpg)
DNA Structure
• DNA is a stretch of nucleotides made each of a deoxyribose, a nitrogen containing base (A, T, G, C), and a phosphate group
• The molecule is structured as a double helix constituted by twostrands.
![Page 15: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/15.jpg)
A nucleotide is made of:
phos
phate
grou
p + n.
..
phos
phate
grou
p + n.
..
nitro
geno
us ba
se +
...
33% 33%33%
1. phosphate group + nitrogenous base
2. phosphate group + nitrogenous base + sugar
3. nitrogenous base + sugar
![Page 16: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/16.jpg)
How Is the Helix Held?
• Hydrogen bonds establish between complementary nitrogen containing bases (A-T, C-G)
• Purines (A, G) bond to pyrimidines (T, C)
• A establishes two hydrogen bonds with T
• G establishes three hydrogen bonds with C
![Page 17: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/17.jpg)
The Structure of DNA Is Revealed
Rosalind Franklin
James Watson and Francis Crick
![Page 18: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/18.jpg)
DNA Structure: The Double Helix
![Page 19: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/19.jpg)
Let’s Do the Complementary Strand To:
5’ AATCGTAGTGCCATTAGTGTACACT 3’
A – T
G – C
![Page 20: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/20.jpg)
Adenine establishes two hydrogen bonds with thymine. Do you agree?
Yes
No
50%50%
1. Yes2. No
![Page 21: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/21.jpg)
Guanine establishes three hydrogen bonds with thymine. Do you agree?
Yes
No
50%50%
1. Yes2. No
![Page 22: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/22.jpg)
How many cytosines will be found in a molecule of DNA that has 422 guanines?
422
211
844
1688
25% 25%25%25%
1. 4222. 2113. 8444. 1,688
![Page 23: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/23.jpg)
DNA Replication
![Page 24: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/24.jpg)
DNA Replication: When Does It Happen?
![Page 25: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/25.jpg)
During S Phase Chromosomes Duplicate (DNA Replication)
![Page 26: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/26.jpg)
DNA Replication
![Page 27: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/27.jpg)
DNA Replication
![Page 28: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/28.jpg)
Let’s Replicate DNA
5’ AATCGTAGTGCCATTAGTGTACACT 3’
![Page 29: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/29.jpg)
DNA Replication: Replication Forks
![Page 30: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/30.jpg)
DNA Replication: How Does It Happen?
![Page 31: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/31.jpg)
Enzymes and Proteins Involved in DNA Replication
• Helicase: unwind double helix
• Single-strand binding proteins
• Primase: adds RNA primer
• DNA Polymerase: adds nucleotides 5’ to 3’
• DNA Ligase: joints Okazaki fragments
![Page 32: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/32.jpg)
Replication of The Leading Strand
• DNA polymerase copy the leading strand in a 5’ to 3’direction
• The elongation of the leading strand is continuous, and towards the direction of opening of the replication fork
![Page 33: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/33.jpg)
Replication of The Lagging Strand
• Primase initiates multiple RNA primers in order to duplicate the entire lagging strand
• The replication of the lagging strand is discontinuous, through multiple segments (Okazaki fragments). It proceeds away from the direction of opening of the replication fork
• DNA ligase joints Okazaki fragments
![Page 34: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/34.jpg)
continuous replication : 5’ to 3’: DNA
DNA laggin
g stra
nd
DNA leadin
g stra
nd RNA
33% 33%33%1. DNA lagging
strand2. DNA leading
strand3. RNA
![Page 35: DNA Structure and DNA Replication - Maricopa Community Colleges](https://reader035.fdocuments.in/reader035/viewer/2022071602/613d68fb736caf36b75d004b/html5/thumbnails/35.jpg)
discontinuous replication : 3’ to 5’: DNA: Okazaki fragments
DNA laggin
g stra
nd
DNA leadin
g stra
nd
Replica
tion d
oes n
ot...
33% 33%33%1. DNA lagging
strand2. DNA leading
strand3. Replication does
not occur 3’ to 5’