DNA Structure

1950s – James Watson & Francis Crick use molecular modeling to determine that DNA is a double helix

DNA Structure Each strand of DNA is made of linked

nucleotides Each nucleotide contains:

• a phosphate group• a five-carbon sugar (deoxyribose) • a nitrogen- containing base

Nitrogen-containing Bases

Adenine Guanine

Thymine Cytosine

Purines(double ring)

Pyrimidines(single ring)

What would happen if G paired up with A on the double helix?

Lumpy DNA! The G and A are larger than the T

and C because they are both double ring structures. A purine and a pyrimidine bond to one another for a uniform connection between the two strands of DNA.

What is the complement to the sequence below:

ATTCGCTAATATATACCGCCG TAAGCGATTATATATGGCGGC

DNA Replication One strand serves as a template, or

pattern, on which the other strand is built