DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic...
-
Upload
kadin-bridgers -
Category
Documents
-
view
216 -
download
0
Transcript of DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic...
![Page 1: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/1.jpg)
DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental
Carcinogenic Mixtures
Casey KernanMentor: Dr. Andrew BuermeyerDepartment: Environmental & Molecular ToxicologyOregon State University
![Page 2: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/2.jpg)
Colorectal Cancer (CRC)• 2nd leading cause of cancer deaths worldwide• CRC claims nearly 50,000 lives/year in U.S.• American Cancer Society estimates 147,000
new cases by 2011
20%
80%
Hereditary Sporadic
![Page 3: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/3.jpg)
Lynch Syndrome (HNPCC)• Autosomal dominant genetic condition• Mutation in one or more of the 4 MMR genes:
MLH1 & PMS2 (MutLα) and MSH2 & MSH6 (MutSα)
MSH2MSH6/3
PMS2MLH1
![Page 4: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/4.jpg)
Mismatch Repair
Apoptosis
A number of cellular pathways, processes and environmental genotoxins interact to influence an individual’s susceptibility and risk for developing cancer.
![Page 5: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/5.jpg)
Recognition of Mismatch
MSH2 MSH6/3
ATP ADP
•DNA replication error rate = 1 mispairing / 104-105 basepairs
•MutS heterodimer locates and binds mismatch
•MutL heterodimer recruited and endonuclease activated
MSH2MSH6/3
PMS2MLH1
![Page 6: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/6.jpg)
Excision of Mismatch
MSH2MSH6/3
PMS2MLH1
RPA
hEXO1
hEXO1
•RPA (Replication Protein A)• Binds ssDNA, prevents degradation, promotes Polymerase δ,
•Exonuclease1 Activity: 5’ 3’ directed
![Page 7: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/7.jpg)
Correction of Mismatch
c
c
RPA
Pol δ/ε
RFC
PCNA
DNALigase
NickPCNA = Proliferating Cell Nuclear AntigenRFC = Replication Factor CPol δ/ε = DNA Polymerase Delta/Epsilon
![Page 8: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/8.jpg)
Mutator PhenotypeMutations are a driving force behind cancer development
Mutated MMR genes
MLH1
AberrantMMR proteins
Replication errors bypass defective MMR systems
Mutations inactivate tumor suppressor genes and enable onco-genes (APC gene)
Enhanced proliferation
Mutated cells divide
•unchecked growth•loss of apoptotic ability•acquisition of metastic ability•resistance to chemotherapeutic agents (6-TG, MNNG, 5-FU)
![Page 9: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/9.jpg)
PAHs – The Environmental Influence• Mutagenic and carcinogenic - large nonpolar compounds • Exposure: diet, smoking, grilling food, fossil fuel processing• Metabolized forming highly reactive diol epoxides (DE) • Benzo[a]pyrene is metabolically activated to benzo[a]pyrene diol
epoxide (BPDE) which binds to DNA forming bulky DNA adducts
![Page 10: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/10.jpg)
Big QuestionGlobal HypothesisSpecific combinations of environmental exposures and cellular deficiencies interact to influence cancer risk in individuals
Specific HypothesisMMR is a key pathway for reducing deleterious consequences (mutations) from PAH exposure
PredictionCells lacking MMR will show increased PAH-induced mutation
![Page 11: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/11.jpg)
3 Questions:
1.) General phenomena of MMR-deficiency?2.) What are the extra mutations induced?3.) General phenomena of PAH’s, in complex mixtures?
![Page 12: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/12.jpg)
Hypothesis
•We hypothesize that results seen with HCT 116 lines do reflect differences in MMR status rather than other potential known or unknown differences in the cell lines.
-Verify using DLD1 cell lines proficient and deficient in MSH6
•We hypothesize that MMR-dependent suppression of BPDE-induced mutations represent a phenomenon generalizable to other PAH’s, including environmentally relevant complex mixtures.
![Page 13: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/13.jpg)
BPDE-Induced MutationForward mutations induced by exposure to PAH’s are measured using the reporter gene hypoxanthine-guanine phosphoribosyl transferase (HPRT) 657bp
HAT media – 5 passages 1 hour BPDE exposure
Doses: 0, 25, 50, 100 nM
Bulky PAH-DNA adducts
Gene HPRT-Protein HPRT+/-
Grown 8 days to insure no HPRT+ protein present
HPRT+ HPRT-
Clear pre-existing mutants
HPRT- mutant cells survive in 6-Thioguanine selective media
HPRT+ HPRT-
![Page 14: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/14.jpg)
Cell Lines
HCT 116 + Ch3
WTMLH1+
HCT 116 + Ch2
MLH1-
MMR Proficient MMR Deficient
WTMSH6+
MSH6-
DLD1+Ch2 DLD1
![Page 15: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/15.jpg)
Mutant Frequency Calculation
MF=6-TG resistant colonies formed/(PE x # of plates)MF=mutant frequencyPE = plating efficiency
MMR Proficient
MLH1
MMR Deficient
MLH1
135,000 cells 300 cells
6-TG selective media Non-selective media
135,000 cells 300 cells
6-TG selective media Non-selective media
few colonies ~150 colonies more colonies ~150 colonies
![Page 16: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/16.jpg)
Results: PAH-induced mutation in MSH6- deficient cells, similar to previous MMR+ proficient cells
•Technical issue with low plating efficiency in MSH6+
![Page 17: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/17.jpg)
vMutation Identification
trypsinized cloning disc
1 2 3 45 6 7 89 10 11 12
1 2 3
4 5 6
Total RNA Purification
Centrifuge
![Page 18: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/18.jpg)
agarose gel electrophoresis
RNA cDNA PCR sequence
PrimersP3: -36 to -17 5’ CCTGAGCAGTCAGCCCGCGC 3’P4: 701 to 682 5’ CAATAGGACTCCAGATGTTT 3’
Reverse Transcriptase - PCR
cDNA
PCR – amplify HPRT gene
Sequencing
![Page 19: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/19.jpg)
Agarose Gel Electrophoresis
Mutant: 45 18 44 6 13 22 24 26 27 49 50 80 81
CONTROLS
Batch 3 PCR Products – HCT 116+2 HPRT Mutants
HPRT product657bp
![Page 20: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/20.jpg)
Spectrum of HPRT Mutations
Deletion of one nucleotide base
AT → GC transition
Insertion of one nucleotide baseGC → CG transversionGC → TA transversion
GC → AT transition
Spectrum Key58.3%
12.5%25.0%
4.2%
![Page 21: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/21.jpg)
ConclusionPreliminary data suggest:
•BPDE-induced spectra in MLH1 deficient cells different from spontaneous mutations
•Too soon to tell if induced spectra differs in MMR proficient vs. deficient cell lines
![Page 22: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/22.jpg)
Future InvestigationsContinue mutant analysis on remaining clones:
•HCT 116+Ch2•HCT 116+Ch3•DLD1•DLD1+Ch2
Complex environmental mixtures
•Mutant frequency•Individual mutation analysis
![Page 23: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/23.jpg)
GoalsResearch Goals & Significance •Understand MMR functions as well as genetic influences and their combined role in normal responses to carcinogens•Accurate evaluation of an individuals susceptibility and risk to developing CRC•Provide insight for more effective and practical CRC screening methods•Develop novel models for studying other genetic and environmentally linked diseases
![Page 24: DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:](https://reader036.fdocuments.in/reader036/viewer/2022062511/5519d116550346695e8b4cb5/html5/thumbnails/24.jpg)
Acknowledgements
• Howard Hughes Medical Institute• Environmental Health Sciences Center• Dr. Andrew Buermeyer– Jacki Coburn– Fatimah Almousawi– Kimberly Sarver
• Dr. Vidya Schalk• Dr. Kevin Ahern, program coordinator