Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of...

41
Divisions of Class Aves superorder Palaeognathae superorder Neognathae

Transcript of Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of...

Page 1: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Divisions of Class Aves superorder Palaeognathae superorder Neognathae

Page 2: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Divisions of Class Aves superorder Palaeognathae

tinamous and “ratites”

Page 3: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Divisions of Class Aves superorder Neognathae

cohort Galloanserae fowl and waterfowl

cohort Neoaves all others

Page 4: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Divisions within Neoaves

UNKNOWN

Page 5: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

A funny thing happened on the way to the Order Gruiformes

Gruidae - cranesRallidae - rails

Page 6: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

“other Gruiformes”Aramidae - LimpkinHeliornithidae -finfootsPsophiidae -trumpetersCariamidae - seriemasOtididae - bustardsTurnicidae -buttonquailsMesitornithidaeEurypygidae - sunbitternRhynochetidae -kagu

Page 7: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

ß-fibrinogen intron 7

CATTTTCTCCCTGCAAGATACCAACCAAATATCCACATCATTTCCTTGGTGTAGCCAAAGGCAGAATTGGCATAGCCAAGGGCAAATGAAACTATATGCTAGCATTTTCTCCCTGCAAGTTACCAGAGAAATATCCACATCATTTCCTTGGTGTAGCCAAAGGCAGAATTGGCATAGCCAAGGGCAAGGAAAACAATATGCTAGCATTTTCTCCCTGCAAGTTACCAGCCAAATATCCACATCATTTCCTTGGTGTAGCCAAAGGCAGAATTGGCATAGCCAAGGGCAAATAAAACAATATGCAAGTGTTTTCTCCCTGCAAGTTACCAGCCAAATGTCCATGTCATGTCCTTGGNGTAGCCAAAGGCAGAATTGGCATAGCCAAGGGCAGGTAAAACTGTATGTTAGTGTTTTCTCCCTGCAAGTTACCGGCCAATTGTCCAGGTTGTTTCCTTGGCACAGCCAAGGGCAGAATTGTCACAGTTAAGGGCAGGTAGAACTATGTGTTAGTGTTTTCTCCCTKCAAGTTACCAGCCAATTGTCTGTGTTGTTTCCTTGGCACAGCCAAGAGCACAATTGGCATTGTCAAGGGCAGGTAAAACTGTATGTTAGTGTTTTCTCCCTGCAAGTTAC-AGCCAAATGTCTATGCCATTTCCTTGGCATAGCCAAAGGCAGAATTCGCATAGCCAAGGGCAGGTAAAACTATATGTTAG

Struthio_camelus -CGTTTTCT---CCTTGCAATTTACCAGCCAAATGTTCATGCTGTTCCATT----------------------GACAT-AGCC-AA--GGGCAGAGTTTTCCCAGGTGAAACTAT--GT-------Aythya_collaris -AGTTT-CT---CACTGCAAGTTACTAGCCAAGTGTTCACGCTGTCCCACT-GGTGTAGCCAATGGCAGAACTGACAT-AGCT-AAA-GGGC-----------AGGTAAAACTAT--ATTAT----Anhima_cornuta -TGTTTTCT---CACTGCAAGTTACTAGCCAAGTGTTCACACTGTCCCATT-GGTGTAGCCAAGGGCAGAACTGGCAT-AGTC-AAAAGGAC-----------AGGTAAAACTGT--ATATTAC--Chauna_torquatus -TGTTTTCT---CACTGCAAGTTACTAGCCAAGTGTTCATGCTGTCCCATT-GGTGTAGCTAAGGGCAGAACTGGCAT-AGTC-AAAAGGAC-----------AGGTAAAACTGT--ATATTAC--Crax_blumenbachii -TGTTTACT---CACTGTAAGTTATTAGCCAGATGTTCCTGCTGTCCTTTT-GGTGCAGCCTAGGGCAAAACTGGCAT-AGCC-GAA-GAAC-----------AAGTAAACCTAT--ATTAT----Gallus_gallus -TGTTTTCT---TACTGTAAGTTACTAGCCAAGCCCCAATTCATCCTGTTCTGGTGCAGCTTAGGGCATAATGGGCAT-AGCC-AAA-G--------------AGTTAAAACTAT--ACT------Megapodius_reinwardt -TGTTTTCT---CTCTGCAAGTTACTAGCCAAGTGTTCATGCTGTCCCATT-GGTGCAGCCTAGGGCAGAACTGGCAT-AGCC-AAA-GAGC-----------AGGTAAAACTAT--ATCGTAT--Opisthocomus_hoazin -TGTTTTCC---TCTTGCAAGTTACTAGCCAAATGTCCACGTTATTTCCTT-GGTGTAG-CAAAGGCAGAACTGGCAT-AGCC-AG--GGGC-----------AGATAAAACCAC--ATGTCAG--Podargus_strigoides ------------------------------------------------------------------------------------------------------------------------------Caprimulgus_vociferus -CATTTTTT-TTCCTTGCAAGTTACCAGCCAAATGTCCATGTCATTTCCTT-GGTGTAGCCAAAGGCAGAATTGGCAT-AACC-AA--GGGC-----------AGGTAAAACTAT----GTTAG--Aegotheles_cristatus -CATTTTCT---CCGTGTAAGTTACCAGCCAAATGTCCACGTTGTTTCCTT-GGCATAGTCAAAGGCA---------T-AGCC-AA--GGGC-----------AAGTAAATCTAT--ATGTTAG--Columba_livia -CATTTTCT---CCCTGCAAGTTACCAGCCAAATATCCTTCTCATTTCCTT-GGTGTAGCCAAAGGCAGAATTGGCAT-AGCC-AA--GGGC-----------AAATAAAACTAT--ATGCTA---Zenaida_macroura -CATTTTCT---CCCTGCAAGATACCAACCAAATATCCACATCATTTCCTT-GGTGTAGCCAAAGGCAGAATTGGCAT-AGCC-AA--GGGC-----------AAATGAAACTAT--ATGCTAG--Columbina_passerina -CATTTTCT---CCCTGCAAGTTACCAGAGAAATATCCACATCATTTCCTT-GGTGTAGCCAAAGGCAGAATTGGCAT-AGCC-AA--GGGC-----------AAGGAAAACAAT--ATGCTAG--Ducula_bicolor -CATTTTCT---CCCTGCAAGTTACCAGCCAAATATCCACATCATTTCCTT-GGTGTAGCCAAAGGCAGAATTGGCAT-AGCC-AA--GGGC-----------AAATAAAACAAT--ATGCAAG--Phoenicopterus_ruber -TGTTTTCT---CCCTGCAAGTTACCAGCCAAATGTCCATGTCATGTCCTT-GGNGTAGCCAAAGGCAGAATTGGCAT-AGCC-AA--GGGC-----------AGGTAAAACTGT--ATGTTAG--Rhynochetos_jubata -TGTTTTCT---CCCTGCAAGTTACCGGCCAATTGTCCAGGTTGTTTCCTT-GGCACAGCCAAGGGCAGAATTGTCAC-AGTT-AA--GGGC-----------AGGTAGAACTAT--GTGTTAG--Eurypyga_helias -TGTTTTCT---CCCTKCAAGTTACCAGCCAATTGTCTGTGTTGTTTCCTT-GGCACAGCCAAGAGCACAATTGGCAT-TGTC-AA--GGGC-----------AGGTAAAACTGT--ATGTTAG--Phaethon_aethereus -TGTTTTCT---CCCTGCAAGTTAC-AGCCAAATGTCTATGCCATTTCCTT-GGCATAGCCAAAGGCAGAATTCGCAT-AGCC-AA--GGGC-----------AGGTAAAACTAT--ATGTTAG--Aerodramus_salanganus -TGTTTTGT---CCCTGCAGTTTACCAGCCAAATGTCTGTGTCATTTCCTT-GGCATAGACAAAGGCAGAATTGACAT-AACC-AAG-GGGT-----------AGGTAAATCTAT--AGGATAG--Amazilia_tobaci -TGTTTTCT---CCCTGGAAGTTGCAAGCTAAATGTCTGTGTCATTTCCTT-GGCATAGCCAAAGGCAGAATTGACAA-AGCC-AA--GGGC-----------AGGTAAAACTCT--CTGTTAC--Mesitornis_unicolor -TGTTTTCT---CCGTGCAAGTTACAAGCCAAATGTCCATGTGGTTTCCTT-GGGGTAGCAAAAGGCAGAATTGACAT-AGCC-AA--GGGC-----------AAGTAAAACTGT--AT-------Podilymbus_podiceps -TGTTTTG----CCTGGCAAGTTACCAGCCAAATGTCCATGTTGTTTCCTT-GGCATAGTCAAAAGCAGAATTGGCAT-AGCC-AA--GGGC-----------AGGTAAAACTAT--ATCTTAG--Aechmophorus_clarkii -TGTTTTG----TCTGGCAAGTTACCAGCCAAATGTCCATGTTGTTTCCTT-GGCATAGCCAAAAGCAGAATTGGCAT-AGCC-AA--GGGC-----------AGGTAAAACTAT--ATGTTAG--Syrrhaptes_paradoxus -TGCTTTCT---CCCTGCAAGTTACCAGCCAAATGTCCATKKTGTTTCCTT-GGTGTAGCCAAAGGCAGAATTGGCAT-AGCY-GA--GGGC-----------AGACAAAACTAT--ATGTTAA--Afrotis_atra -CATTTTAT---CCGTGCAAGTGACCAGCCAAATGTCCATGCAGTTCCTCT----------------------GATGT-AGCC-AT--GGGC-----------AGGTAAAACTGT--GTATTAG--Ardeotis_kori -CATTTTAT---CCATGCAATTGACCAGCCAAATGTCCATGCAGTTCCTCT----------------------GATGT-AGCC-AT--GGGC-----------AGGTAAAACTAT--GTATTAG--Otus_flammeolus -TGTTTTAT---CCCTGCAAGTTACCAGCCAAATGTCCCTGCAGTTCTCTT----------------------GTCAT-AGCC-AA--GAGC-----------AGGTAAAACGAT--AGTTATG-TSurnia_ulula -TGTTTTAT---CCCTGCAAGTTAC-AGCCAAATGTCCCTGCAGTTCTCTT----------------------GTCAT-AGCC-AA--GAGC-----------AGGTAAAACTAT--AATTATG-TTyto_alba -TGTTTTAT---CCCTGCAAGTTACCAGCCAAAAGTCCCTACAGTTCTCTT----------------------GGCAT-AGCC-AA--GAAA-----------AGGTAAAACTAT--A-ATTAG--Phodilus_badius -TGTTTTAT---CCCTGCAAGATACCAGCCAGAAGTCCCTACAGTTCTCTT----------------------G-CAT-AGCC-AA--GAAA-----------AGGTAAAACTAT--A-ATTAG--Certhia_americana -TGTTATGT---CCCTGCAAGTTGCCAGCTAAATGTCTATGCAGTTCTCTT----------------------GGCAT-AGCC-GA--GGAC-----------AAATAGAACTAT--ATATTAG--Seiurus_aurocapillus -TGTTATGT---CCCTGCAAGTTACCAGCTAAATGTCTATGGAGTTCTCTT----------------------GGCAT-AGCCCAA--GGCC-----------AGGTAAAACTAT--ATGTTAG--Catharus_guttatus -TGTTATAT---ACCTGCAAGTTACCAGATAAATGTCTACACAGTTCTCTT----------------------GGCAT-AGCC-AA--GGAC-----------AGGTAAAACTAG--GTATTAG--Cyanocitta_cristata -TGTTATAT---CCCTGCAAATTGCCAGCTAGATGTCTATGCAGTTCTCTT----------------------GGCAC-AGCC-AA--GGAG-----------AGGTAAAACTAT--GAATTAG--Contopus_virens -TGNTTTAT---CCCTGTAAGCTACCAGCCAAATGTCCACGCAATTCTCTT----------------------GGTGT-AGCC-AA--GGAC-----------AGGTAAAACTAT--GTATTAG--Pteroglossus_azara ---------------TGTGAGTTATCAGCTGAACATTCATGCAGGTCTCCT----------------------GGCAG-TTCC-AA--GGGC-----------AGGTAAAA--A---ATATGAG--Capito_niger ---------------TGTGAGTTACCAGCTGAACATCTATGCAGGTCTCCT----------------------GGCAG-TTCC-AA--GGGC-----------AGGTAAAA--A---ATATAAG--Indicator_variegatus -TGTTTTAT---CCCTGTGAGTTGCCAGCCAAACATCCATGCAGTTCTCAT----------------------GGCAG-TTTC-AA--GGGC-----------AGGTAAAACTCT--ATGTGAG--Jynx_torquilla -TGCTTTAT---CTCTGTGAGTTGCCAGCCATACATCCATGCAGTTCTCCT----------------------GACAA-TTCC-AA--GTGC-----------AGGTAAAAGTGC--GTATGAG--Colaptes_auratus -TGCTCTTT---CTCTGTGAGTTGCCAGCTAAACATCCATGCAGTTCT-------------------------GGCAA-TTCC-AA--GTGC-----------AGGTAAAACTGC--ATATGAG--Picoides_sp -TGCTTTAT---CTCTGTGAGTTGCCAGCCAAACATCCATGCAGTTCT-------------------------GGCAA-TTCC-AA--GTGC-----------AGGTAAAACTGC--ATATGAG--Galbula_ruficauda -TGGTTTTC---CCCTGCAAGTTACTAGCCAAATGACTACGAAGTTCTGCT----------------------GGCAT-TTCT-AG--GGGC-----------AGGTACAACTAT--ATATTAG--Coracias_caudatus -YGTTTTAT---CCCTGCAAGTTACCAGCCAAATGTCCATGCAGTTCT-------------------------GGCAT-TTCC-AA--GGGC-----------AGGTAAAACTAC--RTATTAG--Ceryle_halcyon -CAGTTTAT---CCCTGCAAGTTCTCAGCCAAATGTCCATGCATGTCTCTT----------------------GGTGC-TTTC-AA--GGAC-----------AGGTAATACTAC--TTATTAG--Momotus_momota -CGTTTTAT---CCCTGCAAGTTATCAGCCAAATGTCCATGCAGTTCTTCT----------------------GGCAC-TTCC-AA--GGGA-----------AGGTAGAACTAT--ATATTAG--Tockus_flavirostris -TCTTTTAT---CCCTGCAAGTTACCAGACGAATGTCTAGGCAGT------------------------------YAT-AGCC-AA--GGGC-----------AGGTAAAACTAT--ATATTAG--Trogon_viridis -TGTCTTAA---CC-TGCAAGCTACCAACCGAATGCCTGCG----------------------------------------CC-AA--GGGC-----------AGGTAAAACTAT--ATATTGG--Falco_sparverius -TGTTTTAT---CCCTGCAAGTTACCAGTCAAATGTCCAGGCAGTTCTCTT----------------------AGTGT-AGCC-AA--GGGT-----------GGGCGAAACTAT--ATATCAG--Colius_striatus -TGTTTTRT---CCCTGCAAGTTACCAGCCAAATGTCCTTGCTATTCTCTC----------------------GGTGT-AGCT-AA--GAGC-----------AGGTAAAATTAC--ATATTGG--Amazona_autumnalis -TGCTTTAT---CCCTGCAAGTTGCCAGCCAAATGTCCATGCATTTCTTTT----------------------GCCRT-AGCC-AA--GTGC-----------AGGTAAAACTAT--ATAAAAT--Psittacus_erithacus -TGCTTTAT---CCCTGCAAGTTACCAGCCAAATTTCCATGCAGTTCTTTT----------------------GGCAC-AGCC-AA--GGGC-----------AGGTAAAACTAT--ATAAAAT--Calyptorhynchus_funereus -TGCTTTAT---CTCTACAAGTTACCAGCCAAATGTCCATGCAGTTCTTTT----------------------GACAT-AGCC-AA--GGGC-----------AGGTAAAACTAT--ATAATAT--Cariama_cristata -CGTTTTAT---CCCTGCAAGTTATGAGCCAAACGTCCGTGCAGTTCTCCT----------------------GATGT-AGCC-AA--GGGC-----------AGGTAAAACTAT--AGATCAG--Sagittarius_serpentarius -CGTTTTAT---CCCTGCAAGTTACCAGCCAGATGTCCACGCAGTTCTCTT----------------------GGCGT-AGCC-AA--GGGC-----------AGGTAAAGCTAT--AGGTTAG--Cathartes_aura -TGTTTTAT---CCCTGCAAGTTACCAGCCACATGTCCATGCAGTTCTCTT----------------------GGCGT-AGAC-AA--GGGC-----------AGGTAAAACTAT--ATATTAG--Pandion_haliaetus -CGTTTTAT---CCCTGCAAGTTACCAGCCAAATGTCCATGCAGTTCTCTT----------------------GGCAT-AGCC-AA--GGGA-----------AGGTAAAACTAT--ATATTAG--Buteo_jaimaicensis -GGTTTTAT---CCCTGCAAGTTACCAGCCAAATGTCCATGCAGTTCTTTT----------------------GGTGT-AGCC-AA--GGGC-----------AGGTAAAACTAT--ATATTAG--Pedionomus_torquatus -TGGTTTAT---CCATACAA--TACCAGCCAAATGTCCATGCAGTTTCCTT----------------------GGCTT-AGCC-AA--GGGC-----------AGGTAAACCTAT--ATATTCAC-Attagis_gayi -TGTTTTAT---CCCTGCAAGTTACCAGCCAAATGTCCATGCAGTTCTCTT----------------------GGCTT-GAAT-AA--GGGC-----------ACGTAAAACTAT--ATATTAG--Thinocorus_orbignyianus -GGTTTTAT---CCCTGCAAGTTACCAGCCAAATGTCCATGCAGTTCTCTT----------------------GGCTT-AACC-AA--GGGC-----------AGGTAAAACTAT--ATATTGT--Rostratula_behghalensis ---------------TGCAAATTACCAGCCAAATGTCCATGCAGTTCTCTT----------------------GGCTT-AGCC-AA--GGTC-----------TGGTAAAACTAT--ATATTAG--Actophilornis_africana -TGTTTTAT---CCCTGCAAGTTACCAGCCAAATGTCCATGCAGTTCTCTT----------------------GGCTTTAGCC-AG--GGGC-----------AGCTAAAACTAT--ATATTAG--Jacana_spinosa -------AT---CCCTGCAAGTTACCAGCCAAATGTCCATGCAGTTCTCTT----------------------GGCTT-AGCC-AA--GTGC-----------AGCTAARACTAT--ATATTAG--Limosa_fedoa -TGTTTTAT---CCCTGCAAGTTACCAGCCAAATGKCCATGCAGTTCTCTT----------------------GGCTT-AGCC-AA--GGGC-----------AGGTAAAACTGT--ATATTAG--Tringa_melanoleuca ------TATT--CCCTGMAAGTTACCAGCCAAATGTCCATGCAGTTCTCTT----------------------GGTTT-AGCC-AA--GGGC-----------AGGTAAAATTAY--ATATTAG--Phalaropus_tricolor ------TATT--CCCTGCAAGTTACCAGCCAAATGTCCATGCAGTTCTCTT----------------------GGCTT-AGCC-AA--GGGC-----------AGGTAAAACTAT--ATATTAG--Burhinus_bistriatus -TGTTTTAT---CCCTGCAAATTTCCAACCAAATGCCCATCCAGTTCTCTT----------------------GGCTT-AGCC-AA--GGGC-----------AGGTAAAACTAT--ATATTAG--Turnix_varia -TATTTTAT---CCCAGCAAGTT--------------TATGACATCCTTTT----------------------GGCTT-AGCC-AA--GGAC-----------AGGTAAAACTAT------TAG--Rynchops_niger -TGTTTTAA---CCCTGCAAGTTACCAGCCAAATGTCCATGCAGTTCTCTT----------------------GCCTT-AGGC-AA--GGGC-----------AGGTAAAACTAT--TTATTAG--Sterna_forsteri -TGTTTTAT---CCCTGCAAGTTACCAGCCAAATGTCCATGCAGTTCTCTT----------------------GCCTT-AGCC-AA--GGGC-----------AGGTAAAACTGT--TTATTAS--Sterna_caspia -TGTTTTAT---CCCTGCAAGTTACCAGCCAAATGTCCATGCAGTTCTCTT----------------------GCCTT-AGCC-AA--GGGC-----------AGGTAAAACTGT--TTATTGG--Stercorarius_pomarinus -TGTTTTAT---CCCTGCAAGTTACCAGCCAAATGTCCATGCAGTTCTCCT----------------------GCCTT-AGCC-AA--GGGC-----------AGGTAAAACTAT--TGATTAG--Cerorhinca_monocerata -TGTTTGAT---CCCTCCAAGTTACCAGCCAAATGTCCATGCAATTCTCTT----------------------GCCTT-AGCC-AA--GGGC-----------AGGTAAAACTAT--TTATTAG--Cepphus_columba -TGTTTTAT---CCCTGCAAGTTACCAGCCAAATGTCCATGCAGTTCTCTT----------------------GCCTT-AGCC-AA--GGGC-----------AGGTAAAACTAT--TTATTAG--Pluvianus_aegyptius -TGTTTTAT---CTCTGCAAGTTACCAGCCAAATGTCCACGCAGCTCTTTT----------------------GGCTT-GGCC-AA--GGGC-----------AGGTAAAACTAT--GTATTAG--Recurvirostra_americana -TGTTTTAT---CCCTGCAAGTTACCAGCCAAATGTCCATGCAGTTCTTTT----------------------GGCTT-AGCC-AA--GGGC-----------AGGTAAAACTAT--ATATTAG--Charadrius_vociferus -CGTTTTAT---CCCTGCAAGTTACCAGCCAAATGTCCATGCAGTTCTTCT----------------------GGCTT-AGCC-AA--GG-C-----------AGGTAAAACTAT--ATATTAG--Vanellus_resplendens -TGTTTTAT---CCCTGCAAGTTACCAGCCAAATGTCCATGTAGTTCTTCT----------------------GGCTT-AGCC-AA--GG-C-----------AGGTAAAACTAT--ATATTAG--

Page 8: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Struthio camelus

Aythya collarisAnhima cornutaChauna torquatus

Crax blumenbachiiGallus gallusMegapodius reinwardt

Opisthocomus hoazinPodargus strigoidesCaprimulgus vociferus

Aegotheles cristatus

Columba liviaZenaida macroura

Columbina passerinaDucula bicolor

Phoenicopterus ruberRhynochetos jubataEurypyga helias

Phaethon aethereusAerodramus salanganusAmazilia tobaci

Mesitornis unicolor

Podilymbus podicepsAechmophorus clarkii

Syrrhaptes paradoxus

Afrotis atraArdeotis kori

Otus flammeolusSurnia ululaTyto albaPhodilus badius

Certhia americanaSeiurus aurocapillus

Catharus guttatusCyanocitta cristata

Contopus virens

Pteroglossus azaraCapito nigerIndicator variegatus

Jynx torquillaColaptes auratusPicoides sp

Coracias caudatusCeryle halcyon

Momotus momota

Tockus flavirostrisTrogon viridis

Falco sparveriusColius striatus

Amazona autumnalisPsittacus erithacus

Calyptorhynchus funereus

Cariama cristata

Sagittarius serpentarius

Cathartes aura

Pandion haliaetusButeo jaimaicensis

Pedionomus torquatusAttagis gayiThinocorus orbignyianus

Rostratula behghalensisActophilornis africanaJacana spinosa

Limosa fedoaTringa melanoleucaPhalaropus tricolor

Burhinus bistriatusTurnix varia

Rynchops nigerSterna forsteriSterna caspiaCerorhinca monocerataCepphus columba

Pluvianus aegyptius

Recurvirostra americanaCharadrius vociferusVanellus resplendens

Musophaga rossae

Anhinga anhingaPhalacrocorax auritus

Sula dactylatraMorus bassanus

Ajaia ajajaPlegadis chihi

Fregata minor

Pelecanus erythrorhynchusBalaeniceps rexScopus umbrettaPuffinus tenuirostris

Eudyptyla minor

Gavia immer

Geococcyx californianusCoccyzus americanusChrysococcyx lucida

Mycteria americanaCiconia maguariArdea herodiasArdea albaEgretta tricolorEgretta thula

Laterallus albigularisLaterallus melanophaius

Porphyrio porphyrio

Gallirallus philippensisRallus limicolaRallus longirostris

Fulica americanaGallinula chloropus

Heliornis fulicaPodica senegalensis

Psophia crepitansPsophia viridisAramus guarauna

Balearica regulorumBalearica pavonina

Anthropoides paradisaeaAnthropoides virgoGrus americanaGrus grus

Coronaves

Metaves

Galloanserae

Neoaves

Page 9: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Metaves

Rhynochetidae - kagu

Page 10: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Metaves

Rhynochetidae - kaguEurypygidae - sunbittern

Page 11: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Metaves

Rhynochetidae - kaguEurypygidae - sunbitternMesitornithidae - mesites

Page 12: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Metaves

Rhynochetidae - kaguEurypygidae - sunbitternMesitornithidae - mesitesOpisthocomidae - hoatzin

Page 13: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Metaves

Rhynochetidae - kaguEurypygidae - sunbitternMesitornithidae - mesitesOpisthocomidae - hoatzinPodicipedidae - grebes

Page 14: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Metaves

Rhynochetidae - kaguEurypygidae - sunbitternMesitornithidae - mesitesOpisthocomidae - hoatzinPodicipedidae - grebesPteroclididae - sandgrouse

Page 15: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Metaves

Rhynochetidae - kaguEurypygidae - sunbitternMesitornithidae - mesitesOpisthocomidae - hoatzinPodicipedidae - grebesPteroclididae - sandgrouseColumbidae - doves

Page 16: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Metaves

Rhynochetidae - kaguEurypygidae - sunbitternMesitornithidae - mesitesOpisthocomidae - hoatzinPodicipedidae - grebesPteroclididae - sandgrouseColumbidae - dovesPhaethontidae - tropicbirds

Page 17: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Metaves

Rhynochetidae - kaguEurypygidae - sunbitternMesitornithidae - mesitesOpisthocomidae - hoatzinPodicipedidae - grebesPteroclididae - sandgrouseColumbidae - dovesPhaethontidae - tropicbirdsPhoenicopteridae - flamingos

Page 18: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Metaves

Rhynochetidae - kaguEurypygidae - sunbitternMesitornithidae - mesitesOpisthocomidae - hoatzinPodicipedidae - grebesPteroclididae - sandgrouseColumbidae - dovesPhaethontidae - tropicbirdsPhoenicopteridae - flamingos Caprimulgidae - nighthawks

Page 19: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Metaves

Rhynochetidae - kaguEurypygidae - sunbitternMesitornithidae - mesitesOpisthocomidae - hoatzinPodicipedidae - grebesPteroclididae - sandgrouseColumbidae - dovesPhaethontidae - tropicbirdsPhoenicopteridae - flamingos Caprimulgidae - nighthawks Nyctibiidae - Potoos

Page 20: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Metaves

Rhynochetidae - kaguEurypygidae - sunbitternMesitornithidae - mesitesOpisthocomidae - hoatzinPodicipedidae - grebesPteroclididae - sandgrouseColumbidae - dovesPhaethontidae - tropicbirdsPhoenicopteridae - flamingosCaprimulgidae - nighthawks Nyctibiidae - potoosSteatornithidae - oilbird

Page 21: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Metaves

Rhynochetidae - kaguEurypygidae - sunbitternMesitornithidae - mesitesOpisthocomidae - hoatzinPodicipedidae - grebesPteroclididae - sandgrouseColumbidae - dovesPhaethontidae - tropicbirdsPhoenicopteridae - flamingosCaprimulgidae - nighthawksNyctibiidae - potoosSteatornithidae - oilbird Podargidae - frogmouths

Page 22: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Metaves

Rhynochetidae - kaguEurypygidae - sunbitternMesitornithidae - mesitesOpisthocomidae - hoatzinPodicipedidae - grebesPteroclididae - sandgrouseColumbidae - dovesPhaethontidae - tropicbirdsPhoenicopteridae - flamingosCaprimulgidae - nighthawksNyctibiidae - potoosSteatornithidae - oilbirdPodargidae - frogmouthsAegothelidae - owlet nightjars

Page 23: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Metaves

Rhynochetidae - kaguEurypygidae - sunbitternMesitornithidae - mesitesOpisthocomidae - hoatzinPodicipedidae - grebesPteroclididae - sandgrouseColumbidae - dovesPhaethontidae - tropicbirdsPhoenicopteridae - flamingosCaprimulgidae - nighthawksNyctibiidae - potoosSteatornithidae - oilbirdPodargidae - frogmouthsAegothelidae - owlet nightjarsHemiprocnidae - crested swifts

Page 24: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Metaves

Rhynochetidae - kaguEurypygidae - sunbitternMesitornithidae - mesitesOpisthocomidae - hoatzinPodicipedidae - grebesPteroclididae - sandgrouseColumbidae - dovesPhaethontidae - tropicbirdsPhoenicopteridae - flamingosCaprimulgidae - nighthawksNyctibiidae - potoosSteatornithidae - oilbirdPodargidae - frogmouthsAegothelidae - owlet nightjarsHemiprocnidae - crested swiftsApodidae - swifts

Page 25: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Metaves

Rhynochetidae - kaguEurypygidae - sunbitternMesitornithidae - mesitesOpisthocomidae - hoatzinPodicipedidae - grebesPteroclididae - sandgrouseColumbidae - dovesPhaethontidae - tropicbirdsPhoenicopteridae - flamingosCaprimulgidae - nighthawksNyctibiidae - potoosSteatornithidae - oilbirdPodargidae - frogmouthsAegothelidae - owlet nightjarsHemiprocnidae - crested swiftsApodidae - swiftsTrochilidae - hummingbirds

Page 26: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Characteristics of Metaves

Four distinguishing indels (generally similar to Galloanserae outgroups, i.e., primitive)

Not much else … … except for a long reputation of being taxonomically problematic

Some, but not all possess: foregut specializations drink by suction, esophageal secretion, crop fermentation, no crop integumentary peculiarities nasal operculum, powder-down tracts, reduced uropygial gland

Page 27: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

5 Polyphyletic Orders of Birds in Current Classification

Metaves Coronaves

“Gruiformes”kagu, sunbittern, mesites cranes, limpkin, trumpeters,

rails, seriemas, bustards, buttonquails, finfoots

“Pelecaniformes”tropicbirds pelicans, boobies, cormorants,

darters, frigatebirds

“Cuculiformes”hoatzin cuckoos, turacos

“Ciconiiformes”flamingos storks, herons, ibises,

hammerkop

“Charadriiformes”sandgrouse gulls, plovers, sandpipers, etc.

Page 28: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Parallel Radiations

Arboreal specialistsAerial insectivoresNocturnal predatorsGround litter foragersPlunge diversFoot-propelled divers Stealth piscivoresRitualized danceWading filter feedersNectivoresTerrestrial granivoresLekkingColoniality

Page 29: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Parallel Radiations

Arboreal specialistsAerial insectivoresNocturnal predatorsGround litter foragersPlunge diversFoot-propelled divers Stealth piscivoresRitualized danceWading filter feedersNectivoresTerrestrial granivoresLekkingColoniality

Page 30: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Parallel Radiations

Arboreal specialistsAerial insectivoresNocturnal predatorsGround litter foragersPlunge diversFoot-propelled divers Stealth piscivoresRitualized danceWading filter feedersNectivoresTerrestrial granivoresLekkingColoniality

Page 31: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Parallel Radiations

Arboreal specialistsAerial insectivoresNocturnal predatorsGround litter foragersPlunge diversFoot-propelled divers Stealth piscivoresRitualized danceWading filter feedersNectivoresTerrestrial granivoresLekkingColoniality

Page 32: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Parallel Radiations

Arboreal specialistsAerial insectivoresNocturnal predatorsGround litter foragersPlunge diversFoot-propelled divers Stealth piscivoresRitualized danceWading filter feedersNectivoresTerrestrial granivoresLekkingColoniality

Page 33: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Parallel Radiations

Arboreal specialistsAerial insectivoresNocturnal predatorsGround litter foragersPlunge diversFoot-propelled divers Stealth piscivoresRitualized danceWading filter feedersNectivoresTerrestrial granivoresLekkingColoniality

Page 34: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Parallel Radiations

Arboreal specialistsAerial insectivoresNocturnal predatorsGround litter foragersPlunge diversFoot-propelled divers Stealth piscivoresRitualized danceWading filter feedersNectivoresTerrestrial granivoresLekkingColoniality

Page 35: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Parallel Radiations

Arboreal specialistsAerial insectivoresNocturnal predatorsGround litter foragersPlunge diversFoot-propelled divers Stealth piscivoresRitualized danceWading filter feedersNectivoresTerrestrial granivoresLekkingColoniality

Page 36: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Parallel Radiations

Arboreal specialistsAerial insectivoresNocturnal predatorsGround litter foragersPlunge diversFoot-propelled divers Stealth piscivoresRitualized danceWading filter feedersNectivoresTerrestrial granivoresLekkingColoniality

Page 37: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Parallel Radiations

Arboreal specialistsAerial insectivoresNocturnal predatorsGround litter foragersPlunge diversFoot-propelled divers Stealth piscivoresRitualized danceWading filter feedersNectivoresTerrestrial granivoresLekkingColoniality

Page 38: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Parallel Radiations

Arboreal specialistsAerial insectivoresNocturnal predatorsGround litter foragersPlunge diversFoot-propelled diversStealth piscivoresRitualized danceWading filter feedersNectivoresTerrestrial granivoresLekkingColoniality

Page 39: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Parallel Radiations

Arboreal specialistsAerial insectivoresNocturnal predatorsGround litter foragersPlunge diversFoot-propelled diversStealth piscivoresRitualized danceWading filter feedersNectivoresTerrestrial granivoresLekkingColoniality

Page 40: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Parallel Radiations

Arboreal specialistsAerial insectivoresNocturnal predatorsGround litter foragersPlunge diversFoot-propelled divers Stealth piscivoresRitualized danceWading filter feedersNectivoresTerrestrial granivoresLekkingColoniality

Page 41: Divisions of Class Aves - Department of Biologybiology-web.nmsu.edu/~houde/Metaves.pdfDivisions of Class Aves superorder Neognathae cohort Galloanserae fowl and waterfowl cohort Neoaves

Analogous Parallelism in Theria: Marsupials and PlacentalsAfrotheria and LaurasiatheriaBiogeographic Implications for Birds?