Diverse Biological Effect and Smad Signaling of Bone ... · Diverse Biological Effect and Smad...

Diverse Biological Effect and Smad Signaling of Bone

Morphogenetic Protein 7 in Prostate Tumor Cells

Shangxin Yang,1Chen Zhong,

2Baruch Frenkel,

1A. Hari Reddi,

3and Pradip Roy-Burman

1,2

Departments of 1Biochemistry and Molecular Biology and 2Pathology, Keck School of Medicine, University of Southern California,Los Angeles, California and 3Center for Tissue Regeneration and Repair, Department of Orthopedic Surgery, School of Medicine,University of California at Davis, Sacramento, California

Abstract

We found that bone morphogenetic protein (BMP) 7, a memberof the BMP family, was strikingly up-regulated during the deve-lopment of primary prostatic adenocarcinoma in the condi-tional Pten deletion mouse model. To determine the relevanceof this finding to human prostate cancer, we examined theexpression of BMPs and BMP receptors (BMPR) as well as theresponsiveness to recombinant human BMP7 in a series ofhuman prostate tumor cell lines. All prostatic cell lines testedexpressed variable levels of BMP2, BMP4, andBMP7 and at leasttwo of each type I and II BMPRs. In all cases, BMP7 inducedSmad phosphorylation in a dose-dependent manner, withSmad5 activation clearly demonstrable. However, the biologi-cal responses to BMP7 were cell type specific. BPH-1, a cell linerepresenting benign prostatic epithelial hyperplasia, wasgrowth arrested at G1. In the bone metastasis-derived PC-3prostate cancer cells, BMP7 induced epithelial-mesenchymaltransdifferentiation with classic changes in morphology,motility, invasiveness, and molecular markers. Finally, BMP7inhibited serum starvation–induced apoptosis in the LNCaPprostate cancer cell line and more remarkably in its bonemetastatic variant C4-2B line. Each of the cell lines influencedby BMP7 was also responsive to BMP2 in a correspondingmanner. The antiapoptotic activity of BMP7 in the LNCaP andC4-2B cell lines was not associated with a significant alterationin the levels of the proapoptotic protein Bax or the anti-apoptotic proteins Bcl-2, Bcl-xl, and X-linked inhibitor ofapoptosis. However, in C4-2B cells but not in LNCaP cells, astarvation-induced decrease in the level of survivin wascounteracted by BMP7. Taken together, these findings suggestthat BMPs are able to modulate the biological behavior ofprostate tumor cells in diverse and cell type–specific mannerand point to certain mechanisms by which these secretedsignaling molecules may contribute to prostate cancer growthand metastasis. (Cancer Res 2005; 65(13): 5769-77)

Introduction

Bone morphogenetic proteins (BMPs) are secreted signalingmolecules belonging to the transforming growth factor-h (TGF-h)superfamily. They were originally isolated from bone matrix (1).Although BMPs function as osteogenic factors, they also have pleio-trophic roles in cell growth, differentiation, migration, and apo-ptosis and are critical in embryogenesis and organogenesis (1, 2).They are unique among osteogenic factors, as they can induce

osteoblast differentiation and bone formation by uncommittedprogenitors in vitro and in vivo (3–5). BMP7 (also called osteogenicprotein-1) can induce osteogenic differentiation of newborn ratcalvarial cells and rat osteosarcoma cells (6–8). It is also reportedthat BMP7 could induce osteoblastic cell differentiation of thepluripotent mesenchymal cell line C2C12 (9). Expression of severalBMPs (BMP2, BMP3, BMP4, and BMP6) was detected in normaland malignant prostate tissues, and a role of BMP4 and BMP7 wasshown in prostate development (10–12). Moreover, BMP4, BMP6,and BMP7 were detected in prostate skeletal metastasis (13, 14),implying that these BMPs could play a role in the formation ofosteoblastic lesions. It is noteworthy that BMP7 mRNA levels werefound to be higher in prostate cancer skeletal metastases than inbone itself (15). The demonstration of BMP receptors (BMPR) inprostate tissues and cell lines further supports the possibility thatBMPs expressed by tumor or bone cells affect the behavior ofthe prostate cancer cells (16). However, only a limited amount ofinformation is available on the effect of specific BMPs on prostatecell lines, although it seems that their activity may vary from onecell line to the other. For example, although BMP2 did not have anyeffect on the proliferation of androgen-insensitive PC-3 and DU145prostate cancer cell lines, it inhibited the growth of the androgen-sensitive LNCaP cells (17). Similarly, BMP4 inhibited LNCaP butnot PC-3, whereas BMP2 treatment of PC-3 cells resulted inincrease in osteoproteogerin, a factor that inhibits osteoclasto-genesis (16). It was also reported recently that vascular endothelialgrowth factor might act downstream of BMPs in prostate cancercells to promote osteoblastic activity (18). Of the three type IBMPRs (BMPRIA, BMPRIB, and ActRI) and three type II BMPRs(BMPRII, ActRII, and ActRIIB), expression of BMPRIA, BMPRIB,and BMPRII in human prostate cancer tissues was examined inrelation to tumor grade. The work based on mostly immunohis-tochemistry and partly Western blot analysis described frequentloss of expression of these three receptors in high-grade prostatecancer, although only loss of expression of BMPRII correlated withpoor prognosis in prostate cancer patients (19, 20).We initiated the studies described in this report to better

understand the mechanisms of BMP action in the context ofprostate tumor cells. Of f20 BMP family members, which havebeen characterized to date, we were motivated to place emphasison BMP7 because of two major findings: (a) as stated above, itsassociation with skeletal metastases of human prostate cancer, and(b), our own observation, which is also described here, that BMP7protein expression is strikingly increased with the growth of theprostatic adenocarcinoma in the Pten conditional deletion mousemodel of prostate cancer (21–23).

Materials and Methods

Cell lines and bone morphogenetic protein treatment. The

immortalized human prostate epithelial cell line MLC SV40 (24) and the

Requests for reprints: Pradip Roy-Burman, Department of Pathology, Keck Schoolof Medicine, University of Southern California, 2011 Zonal Avenue, Los Angeles, CA90033. Phone: 323-442-1184; Fax: 323-442-3049; E-mail: [email protected].

I2005 American Association for Cancer Research.

www.aacrjournals.org 5769 Cancer Res 2005; 65: (13). July 1, 2005

Research Article

Research. on November 27, 2020. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

prostate cancer cell lines PC-3, DU145, LAPC-4, LNCaP, and CWR22R werecultured as described previously (25, 26). The benign prostatic epithelial

hyperplasia cell line (BPH-1; ref. 27) and two prostatic stromal cell lines,

HTS-4OC and HPS-40F (28), were cultured in the RPMI 1640 with 10% fetal

bovine serum (FBS) and 1% penicillin/streptomycin antibiotics. C4-2B, avariant LNCaP with propensity for bone metastasis (29, 30), was cultured in

DMEM/Ham’s F-12 (4:1) supplemented with 10% FBS, 1% penicillin/

streptomycin antibiotics, 5.0 Ag/mL insulin, 13.7 pg/mL triiodothyronine,

4.4 Ag/mL apotransferrin, 0.2 Ag/mL D-biotin, and 12.5 Ag/mL adenine.Human recombinant BMP2 protein (BMP2) and TGF-h1 protein were

purchased from R&D Systems, Inc. (Minneapolis, MN), and human

recombinant BMP7 protein (BMP7) was provided by A. Hari Reddi. For

determining the effect of BMP7, BMP2, or TGF-h1 on cell proliferation,BPH-1, PC-3, and DU145 were grown in 0.5% serum medium. In wound

healing assay, Matrigel invasion chamber assay, and all other treatments for

BPH-1 or PC-3, 0.5% serum medium was used. For serum starvation analysisof LNCaP and C4-2B cells, 0.1% serum medium was used. In all of these

assays, no attempts were made to start with a cell cycle–synchronized

cellular population.

Cell proliferation assay. Cells (0.5 � 105) were plated in each well of thesix-well plate in triplicates in the absence or presence of 50 ng/mL BMP7.

Cells were counted using a Coulter counter (Beckman Coulter, Inc., Miami,

FL) every 2 days. The culture medium was changed and BMP7 replenished

every 2 days.RNA preparation and semiquantitative reverse transcription-PCR.

Total RNAs were extracted by TRIzol reagent (Invitrogen, Inc., San Diego,

CA) following the protocol recommended by the manufacturer. The RNA(5 Ag) was reverse transcribed by oligo(dT)20 and SuperScript III reverse

transcriptase (Invitrogen) in a volume of 21 AL. The synthesized cDNA was

subjected to PCR with the primers described in Table 1. The optimal cycle

that can reflect the amount of original template was determined and usedin the semiquantitative PCR experiment.

Cell cycle assay. Cells were suspended in 1% (w/v) paraformaldehyde

in PBS on ice for 30 minutes and then fixed in 70% ethanol at �20jCovernight. After cells were stained with propidium iodide/RNase Asolution (Phoenix Flow Systems, Inc., San Diego, CA) in the dark for

30 minutes at room temperature, samples were then analyzed by a flow

cytometry system.Apoptosis analysis (terminal deoxynucleotidyl transferase–mediated

dUTP nick end labeling). Cellular apoptosis was assayed using APO-BRDU

kit (Phoenix Flow Systems) following the instructions of the manufacturer.

Wound healing assay. After PC-3 cells were treated with 50 ng/mLBMP7 for 6 days and reached 90% to 100% confluency, the wound line was

made with a microtip on the monolayer cultures of the cells. Cells were

washed with PBS twice, fresh medium was added, and photographs were

taken at indicated time points.Matrigel invasion chamber assay. Inserts of 8 Am pore-sized

membranes for 24-well plates were prepared by coating with 100 AL of

1:8 diluted Matrigel basement membrane matrix (Becton DickinsonLabware, Bedford, MA) following the manufacturer’s protocol. PC-3 cells

(1 � 105) untreated or treated with BMP7 for 6 days were seeded in

triplicates into inserts. The conditioned medium obtained by incubating

NIH-3T3 cells for 24 hours in serum-free DMEM in the presence of 50 Ag/mL ascorbic acid was added to the bottom chamber to serve as a

chemoattractant. After 24 hours of incubation, cells that migrated through

the Matrigel were counted as described before (26).

Preparation of tissue lysates, whole cell lysates, nuclear extracts,and conditioned medium and Western blot analysis. To prepare the

whole cell lysates, cells were lysed in ice-cold buffer containing 1% Triton

X-100, 150 mmol/L NaCl, 10 mmol/L Tris-HCl (pH 7.4), 1 mmol/L EGTA,

1 mmol/L EDTA, and 0.5% NP40 with freshly added proteinase inhibitor(Roche, Mannheim, Germany) and phosphatase inhibitor cocktails (Sigma-

Aldrich Co., St. Louis, MO). After 30 minutes on ice, cell debris was

removed by centrifugation at 14,000 � g for 10 minutes. To prepare themouse prostate lysates, tissues were homogenized in the same ice-cold

buffer described above by using Pellet Pestle cordless motor (Kontes,

Vineland, NJ) and following the same steps as for the whole cell lysates.

The nuclear extracts of the cells were prepared using Active Motif NuclearExtraction kit (Calsbad, CA) following the manufacturer’s instruction. To

prepare the cell culture conditioned medium, 80% to 90% confluent cells

cultured in T-75 flask were washed with PBS and serum-free medium

(10 mL) was added. After 24 hours, medium was collected into a 15 mLtube, centrifuged to remove the cell debris, and then concentrated by

centrifuge at 7,000 � g at 4jC for 30 minutes using a 20 mL Centrifugal

Spin Concentrator (Apollo, Continental Lab Products, San Diego, CA). Theantibodies used in the Western blot experiments were goat anti-BMP7

(R&D Systems), rabbit anti-Smad1, rabbit anti-Smad5, rabbit anti–

phospho-Smad1,5,8, rabbit anti–X-linked inhibitor of apoptosis (XIAP),

rabbit anti-Bcl-2, rabbit anti-Bcl-xl, rabbit anti-Bax (Cell SignalingTechnology, Beverly, MA), and goat anti-actin (Santa Cruz Biotechnology,

Santa Cruz, CA). Rabbit anti-survivin antibody was a generous gift from

Dr. Dario Altieri (University of Massachusetts, Worcester, MA).

Immunostaining. Cells cultured on the 24-well plate were washed byPBS twice, fixed with 4% (w/v) paraformaldehyde in PBS for 15 minutes, and

permeabilized by 0.2% Triton X-100 for 2 minutes. Endogenous peroxidase

was quenched by 1% H2O2 (v/v) in methanol for 30 minutes. After blockingin the TBS buffer containing 0.1% gelatin, 5% normal horse serum, and 0.5%

Triton X-100, primary antibody was added and allowed to bind at 4jCovernight. Cells were washed in TBS with 1% Tween 20 thrice and incubated

with secondary antibody for 60 minutes before reacting with avidin-biotincomplex (Vectastain ABC kit, Vector Laboratories, Burlingame, CA) for

45 minutes. Color was developed by using DAKO liquid 3,3V-diaminobenzi-

dine substrate-chromogen system (DAKO Co., Carpinteria, CA). The

antibodies used in the experiment were mouse anti–smooth muscle actin(SMA; DAKO) and mouse anti-E-cadherin (Zymed Laboratories, Inc., South

San Francisco, CA).

Table 1. Primer sequences for PCR

Forward primer Reverse primer PCR

product (bp)

Annealing

temperature (jC)

Origin

hBMP2 CCTACATGCTAGACCTGTATCGCA CACCAACCTGGTGTCCAAAAGT 362 53 This study

hBMP4 CAGCACTGGTCTTGAGTATCCTGA CGTGTCCAGTAGTCGTGTGATGA 307 53 This study

hBMP7 ACGCTTCGACAATGAGACGTTC TGGCGTTCATGTAGGAGTTCAG 572 60 Paralkar et al. (52)hBMPRIA GCATAACTAATGGACATTGCT TAGAGTTTCTCCTCCGATGG 1401 60 Ide et al. (17)

hBMPRIB GCAGCACAGACGGATATTGT TTTCATGCCTCATCAACACT 630 60 Ide et al. (53)

hActRI GCATTCCCAGAGCACCAATC CTGTGAGTCTTGCGGATGGA 383 58 Vanttinen et al. (54)hBMPRII ACGGGAGAGAAGACGAGCCT CTAGATCAAGAGAGGGTTCG 694 60 Ide et al. (17)

hActRII ATGGCTAGAGGATTGGCATATT TCTTCAATGGTTTCACAGAGCA 495 58 This study

hActRIIB ACAGGTAGGCACGAGACGGT GTAGTGCCGTTGACCGACCT 396 59 Vanttinen et al. (54)

hSMA AGGAAGGACCTCTATGCTAACAAT AACACATAGGTAACGAGTCAGAGC 355 59 Jester et al. (55)hE-cadherin GAACGCATTGCCACATACACT CTGTGGAGGTGGTGAGAGAGA 745 60 This study

Cancer Research

Cancer Res 2005; 65: (13). July 1, 2005 5770 www.aacrjournals.org



Immunoprecipitation. Whole cell lysates (600 Ag) were precleared byincubating with 0.25 Ag normal goat IgG and 20 AL resuspended volume of

the Protein A/G Plus-Agarose (Santa Cruz Biotechnology) at 4jC for

30 minutes. The beads were pelleted by centrifugation and the supernatant

fluid was transferred into two fresh 1.5 mL microcentrifuge tubes in equalparts. To one of the tubes, 1 Ag normal goat IgG was added and to the other

tube 1 Ag goat anti-Smad5 antibody (Santa Cruz Biotechnology) was added.

After 1 hour of incubation at 4jC, suspended volume (20 AL) of the ProteinA/G Plus-Agarose was added into each sample. The tubes were incubated at4jC overnight. The pellet was collected by centrifugation at 3,000 � g for

5 minutes at 4jC and the supernatant was removed. After the pellet was

washed with PBS for 4 times, 1� electrophoresis loading buffer (40 AL)was added to release the bound protein from the pellet. Each sample(10 AL) was boiled for 2 to 3 minutes and subjected to Western blot by

using rabbit anti–phospho-Smad1,5,8 antibody (Cell Signaling Technology).

Statistical analysis. All experiments were done in triplicates andrepeated at least twice. Statistical comparisons were made using an

unpaired, two-tailed t test.

Results

Bone morphogenetic protein 7 expression increases withthe growth of primary prostate tumors. Prostate-specificknockout of Pten was found to cause prostatic adenocarcinomain all of the lobes of the mouse prostate (21–23). Because thetumors in the anterior lobe (AP) are generally most prominent andvisible, we first compared BMP7 expression levels in the AP lobebetween Pten knockout mice and littermate controls of differentages. As shown by Western blot analysis, the development ofprimary prostate tumors in the Pten null prostate mice was

associated with progressively increased expression of BMP7 over anage range of 1.5 to 7.5 months (Fig. 1A). From an 11-month-oldPten knockout mouse and its littermate control, we extractedproteins from different lobes, including AP, ventral lobe (VP), anddorsolateral lobe (DLP). The Western blot analysis showed that inall these lobes there was overexpression of BMP7 in the prostatetumor compared with the normal tissue (Fig. 1B).Prostatic cell lines constitutively express bone morphoge-

netic proteins and bone morphogenetic protein receptors.Expression of three BMP family members (BMP2, BMP4, andBMP7) and that of the three type I and three type II receptorsubtypes was determined by using reverse transcription-PCR (RT-PCR). A representative pattern of expression is shown in Fig. 1C . Ofthe three BMPs tested, BMP4 exhibited a relatively consistentexpression profile in all of the cell lines, including nonneoplasticprostatic epithelial cell lines (MLC and BPH-1), prostate cancer celllines (PC-3, LAPC-4, DU145, LNCaP, C4-2B, and CWR22R), andprostatic stromal cell lines (HPS-40F and HTS-40C). BMP2 andBMP7 expression was variable, although all of the cell lines testedpositive (Fig. 1C). Accumulation of BMP7 protein was evaluated infive of the cell lines by Western analysis (Fig. 1D). The relative levelsof secreted BMP7 generally followed the respective mRNA results,with PC-3 and DU145 cells displaying the lowest and the highestlevels, respectively. The variant cell line C4-2B, derived from LNCaP,exhibited a pattern of expression very similar to LNCaP cells interms of both RT-PCR and Western blot assays (data not shown).By RT-PCR, most of the cell lines tested were positive for theexpression of both type I and II BMPRs. There were, however, two

Figure 1. Detection of BMP7 expression in mouse prostate adenocarcinoma and analysis of expression of BMPs and BMPRs in human prostatic cell lines. A, themouse urogenital system was surgically isolated, and the individual prostatic lobes were dissected out under a dissecting microscope (50, 51). Protein was extractedfrom the AP of the Pten conditional knockout mice and their littermate controls at different ages as indicated in months (M). Protein (25 Ag) was loaded into each lanefor Western blot in which the top band (55 kDa) corresponded to the size of BMP7. B, protein from individual lobes, AP, VP, and DLP, from an 11-month-old Ptenconditional knockout mouse and its littermate control was used for Western blot. A or B, c, littermate control, homozygous for the floxed Pten allele; p�/�, homozygousdeletion of the floxed Pten allele. C, RT-PCR assays for BMP2, BMP4, and BMP7, and each of the six known BMPRs, including three type I (BMPRIA, BMPRIB,and ActRI) and three type II (BMPRII, ActRII, and ActRIIB) in the cell lines. D, conditioned medium from cells serum starved for 24 hours was concentrated and protein(25 Ag) was subjected to Western blot to examine the level of secreted BMP7 protein in five selected cell lines.

Bone Morphogenetic Proteins and Prostate Cancer




exceptions. Although BPH-1 cells produced detectable levels of twoof the type I receptors (BMPRIA and BMPRIB) and two of thetype II receptors (BMPRII and ActRIIB), they had undetectablelevels for the remaining type I (ActRI) and type II (ActRII)receptors. PC-3 cells, which were tested positive for all three type Iand two type II receptors, had, however, the relatively lowest levelof expression for BMPRII (Fig. 1C), although its presence could bedetected by increasing the PCR cycle from 30 to 35 (data notshown). Overall, all prostatic cell lines of nontumorigenic epithelialor tumorigenic epithelial or stromal origin displayed two or moreof each of the type I and II receptors. This is noteworthy becausetype I and II receptors are both indispensable for BMP signaltransduction. Although not shown, the RT-PCR receptor expressionpattern in C4-2B cells was comparable with LNCaP cells. In thiswork, we did not study BMPR protein expression. A previousreport, however, described detection of BMPRIA, BMPRIB, andBMPRII by Western blot analysis in all four human prostate cancercell lines (LNCaP, DU145, PC-3, and PC-3M) that were tested (20).Bone morphogenetic proteins induce G0-G1 arrest in BPH-1

cells. We examined the effect of BMP7 on the growth of prostatecells in culture. Three cell lines, BPH-1, PC-3, and DU145, wereselected for the study because they could sustain growth inmedium with reduced amount of serum (0.5%) for a reasonableperiod of time. BMP7 (50 ng/mL) did not affect the growth of eitherPC-3 or DU145 cells. In contrast, the growth of BPH-1 cells wassignificantly inhibited, up to 44% on day 8 of treatment (Fig. 2A).The growth inhibitory activity of BMP7 in BPH-1 cell cultures wasdose dependent at the range of 25 to 200 ng/mL (Fig. 2B). Thus, itwas not inconsistent to find an effect of exogenous BMP7 when thefactor was already produced constitutively in BPH-1 cells. To testwhether this growth inhibition reflected attenuation of the cellcycle, BPH-1 cells treated with 50 ng/mL BMP7 for 4 days weresubjected to cell cycle analysis. As shown in Fig. 2C , BMP7significantly reduced the percentage of cells in the S-G2-M phasesof the cell cycle, indicating inhibition at the G0-G1 phase. BMP2inhibited the growth of BPH-1 cells to an extent very similar toBMP7 (data not shown).Bone morphogenetic proteins induce epithelial-mesenchymal

transdifferentiation in PC-3 cells. Although the growth rateof the PC-3 cells was not significantly affected by exposure toBMP7, we observed a remarkable morphologic change in thesecells as shown by the micrograph of cells treated with 50 ng/mLBMP7 for 4 days (Fig. 3A). The treated cells appeared to lose theirpolygonal shape, which is distinctive of epithelial cells, and toacquire an elongated spindle-shaped morphology, a phenotypemore similar to fibroblastic cells. This switch was prolongedbecause the fibroblastic morphology persisted for a few days evenafter BMP7 withdrawal. Like BMP7, BMP2 (100 ng/mL) could alsoinduce a similar morphologic change in PC-3 cells, but this was notthe case for TGF-h1 at a concentration of 5 to 100 ng/mL (Fig. 3A).Furthermore, TGF-h1 did not counteract the morphologic changesinduced by either BMP2 or BMP7 (data not shown). We then testedby semiquantitative RT-PCR whether alterations occurred in theexpression of SMA and E-cadherin during the BMP7-inducedmorphologic changes in PC-3 cells. As shown in Fig. 3B , SMAmRNA was strikingly up-regulated as early as the second day ofBMP7 treatment, whereas the opposite effect was observed withrespect to E-cadherin mRNA. The results of immunohistochemicalanalyses of SMA and E-cadherin were consistent with the results ofthe RT-PCR analysis (Fig. 3C). Because SMA is a marker formyofibroblast and E-cadherin is a cell adhesion molecular marker

for epithelial cells, the results were indicative of a phenomenoncommonly called epithelial-mesenchymal transdifferentiation(EMT). BMP-induced EMT was, however, unique to PC-3 cells,because several other prostate tumor cell lines (BPH-1, DU145,LAPC-4, LNCaP, and C4-2B), which were also treated similarly toPC-3 cells, did not exhibit the morphologic or molecular character-istics of EMT.The transdifferentiated PC-3 cells were examined for their

mobility and invasive ability. PC-3 cells, treated with BMP7 (50 ng/mL) for 6 days, were subjected to wound healing and Matrigelchamber invasion assays. As illustrated in Fig. 3D , movement of thetransdifferentiated cells into the wound line was found to be clearlyfaster than the control PC-3 cells. By 36 hours after wounding,BMP7-treated cells could move in to fill up the space by f50%,

Figure 2. Inhibition of BPH-1 proliferation by BMP7 in a dose-dependentmanner. A, BPH-1 cell growth in medium containing 0.5% serum was determinedby counting the cell number every 2 days in the absence (n) or presence (y)of 50 ng/mL BMP7 recombinant protein. B, effect of exposure to various levels ofBMP7 (25, 50, 100, and 200 ng/mL) at the fourth day of treatment wasdetermined. C, cell cycle assay was done to examine the percentage of cellfraction at S-G2-M phases in BPH-1 cells treated with 50 ng/mL BMP7 for 4 daysrelative to the control untreated cells.

Cancer Research




whereas only a few scattered cells were detected in the woundmade in the control cultures. Similarly, in Matrigel chamber assays,penetration of the treated cells through the basement membranematerial barrier was found to be 70% more efficient than thecontrol cells during the overnight incubation period (Fig. 3E).Bone morphogenetic proteins protect LNCaP and C4-2B

cells against serum deprivation–induced apoptosis. BecauseLNCaP and its variant C4-2B are most sensitive to serum starvationcompared with BPH-1 and other prostate cancer cell lines, thesetwo cell lines were selected for the analysis of the effect of BMPs onserum deprivation–induced apoptosis. These cells were cultured inmedium containing 0.1% serum in the absence or presence of50 ng/mL BMP7 for 6 days. As illustrated in Fig. 4A , serum-starvedC4-2B cells appeared mostly rounded up and feeble. In contrast,the BMP7-treated, serum-starved cells appeared fairly robust(Fig. 4A). The same protective effect was observed with 100 ng/mL BMP2 but not with 10 ng/mL TGF-h1. To test whether thehealthy morphology of the BMP7-treated, serum-starved cellsreflected protection from apoptosis, terminal deoxynucleotidyltransferase–mediated dUTP nick end labeling assays were done. Asshown in Fig. 4B , the survival effect of BMPs was significantly highas determined by the measurement of the cell death from apop-tosis. For example, at the sixth day of serum starvation, 34% ofLNCaP cells were apoptotic and C4-2B, being more sensitive thanLNCaP, displayed 96% of cells being apoptotic. However, in thepresence of BMP7, the percentage of apoptotic cells was reduced to

15% for LNCaP and 21% for C4-2B. C4-2B cells were also analyzedfor the expression of a panel of proapoptotic and antiapoptoticfactors. Of the Bcl-2 family members, we examined Bcl-2, Bcl-xl,and Bax, and from the IAP family, XIAP and survivin. Whereas Bcl-2protein expression was not detected in the C4-2B cells, Bcl-xl, Bax,and XIAP, which were expressed, appeared not to undergo anymajor changes in expression levels when cultured in the absence orpresence of BMP7 (Fig. 4C). In contrast, whereas there was aprogressive decline in the level of survivin in the serum-starvedcontrol C4-2B cells to a value of 20% at the sixth day, the level wassustained to 60% at this end point in the presence of BMP7 (Fig. 4Cand D). When serum-starved LNCaP cells were subjected tosuch analyses, no remarkable changes in the levels of survivin,XIAP, Bcl-xl, or Bax were observed in serum-starved cells with orwithout the presence of BMP7 (Fig. 4E and F). Like C4-2B, LNCaPcells did not produce detectable Bcl-2.Bone morphogenetic protein treatment affects Smad

signaling in prostate tumor cell lines. The kinetic and qualityof Smad activation were determined in BPH-1, PC-3, LNCaP, andC4-2B, the prostate tumor cell lines in which we showed adefinitive but variable biological effect of BMP7. Because BMPsignaling is largely mediated by three specific regulatory Smads(i.e., Smad1, Smad5, and Smad8), we limited the analysis of Smadactivation in prostate tumor cell lines only to these Smads. InBPH-1 cells, the analysis was further simplified because BPH-1 didnot have detectable levels of Smad1 expression. Using an antibody

Figure 3. Changes in morphology and behavior of PC-3 cells by BMPs. A, light microscopy pictures illustrate the morphology of PC-3 cells after treatment with BMP7,BMP2, or TGF-h1 for 6 days at the indicated concentrations in medium containing 0.5% serum. B, semiquantitative RT-PCR was used to compare the RNA levelsof SMA and E-cadherin between the control (�) PC-3 cells and those (+) treated with 50 ng/mL BMP7 for different time periods from 2 to 6 days. C, PC-3 cells wereimmunostained for SMA and E-cadherin after culturing for 6 days in the absence (Control ) or presence of 50 ng/mL BMP7. D, representative light microscopy picturesto indicate increased motility into a wound line of PC-3 cells, which were exposed to 50 ng/mL BMP7 relative to the control cells. E, in Matrigel chamber invasiveassay, PC-3 cells grown in the absence (Control ) or presence of 50 ng/mL BMP7 for 6 days were seeded into the inserts coated with a layer of Matrigel basementmembrane matrix. After 24 hours, the cells on the top chamber were removed and the cells that invaded to the bottom chamber were stained and counted.





that could react with phospho-Smad1 (Ser463/Ser465)/phospho-Smad5 (Ser463/Ser465)/phospho-Smad8 (Ser426/Ser468), we showedSmad activation by BMP7 in each of the cell lines tested. Twocharacteristics were obvious: (a) Smad phosphorylation, althoughvariable in strength (strong in BPH-1 and PC-3 cells and weaker inLNCaP and C4-2B cells), was dependent on the dose of BMP7, and(b) whereas Smad phosphorylation induced by BMP7 in BPH-1,LNCaP, or C4-2B persisted for at least 24 hours after exposure, thestrong induction noted at 1 hour in PC-3 cells was followed by fairlyrapid decline in signal intensity (Fig. 5A-D).By comparing phospho-Smad reactivity in the Western blots of

whole cell lysates and nuclear extracts of BMP7-treated BPH-1 orPC-3 cells, we determined that phospho-Smad was efficientlytransported to the nucleus in these cells (Fig. 5E). As Westernanalyses for the two cell types were done on the same blot, it wascurious to find each time that the electrophoretic mobility ofphospho-Smad or Smad5 was slightly slower in extracts of BPH-1cells compared with the corresponding band from the PC-3 cells(Fig. 5E and F). Because BPH-1 did not contain a detectable level ofSmad1 expression, it could be assumed that phospho-Smad inBPH-1 might be activated Smad5, Smad8, or both. However, Smad8(48.6 kDa), being smaller than Smad5 (52.1 kDa), would have beenresolved in the gels if it was present. Thus, the observation withBPH-1 cells suggested that Smad5 might be the primary Smadactivated by BMP7 in these cells. However, the altered mobility ofSmad5 from this cell type relative to PC-3 or in this regard toLNCaP or C4-2B (data not shown) also might indicate some sort

of molecular aberration, such as mutation or abnormal post-translational modification in Smad5 derived from BPH-1 cells. Toconfirm the speculation of Smad5 being the major target ofactivation, we conducted immunoprecipitation assays. Immuno-precipitates collected with anti-Smad5 antibody, when Westernblotted for phospho-Smad reactivity, showed that Smad5 wasindeed phosphorylated in response to BMP7 exposure in bothBPH-1 and PC-3 cells (Fig. 5G). Because Smad1 and Smad5 are ofequal molecular weights, and due to the lack of a good antibody forSmad1 immunoprecipitation, the possibility that Smad1 along withSmad5 might also be activated in PC-3 cells could not be ruled out.

Discussion

Although much remains to be understood about the complexityof BMP signaling in cancer, there is, however, emerging evidencefrom a variety of tumor systems that the effects of BMPs are cellspecific and could be either protumorigenic or antitumorigenic(31, 32). Consequently, results derived from the study of a cellsystem frequently could not be applied to other systems of thesame cancer type. This contention is further affirmed by the resultsof our study. Although it is clearly documented that the expressionof BMP7 increases with the growth of prostate cancer in the Ptenconditional null model and that BMP7 is widely expressed inhuman prostatic cells, including epithelial, stromal, and cancer, thebiological effect induced by BMP7 is varied and both dosedependent and cell type dependent. In addition to validating the

Figure 4. BMP7 inhibited serum starvation–induced apoptosis in LNCaP and C4-2B cells. A, phenotypic change noted in C4-2B cells cultured in medium with 0.1%serum for 6 days in the absence or presence of the indicated factors (10 ng/mL TGF-h1, 50 ng/mL BMP7, or 100 ng/mL BMP2). The complete culture medium waschanged every 2 days. B, after 6 days of either 0.1% serum medium only or plus 50 ng/mL BMP7 treatment, LNCaP and C4-2B cells were collected and the cellapoptotic percentage was determined. C, levels of expression of survivin, XIAP, Bcl-xl, and Bax were determined by Western blotting of C4-2B lysates at different timepoints after serum starvation of the cells in absence or presence of 50 ng/mL BMP7. D and F, determination of the ratio of survivin and Bax expression in C4-2B orLNCaP cells from (C or E ), respectively. The value for control cells was adjusted to 1. Columns, mean obtained from three independent experiments; bars, SD.E, Western blot analysis showed that unlike C4-2B cells survivin levels were not protected by exposure to BMP7 in LNCaP cells. The level of survivin relative to Bax incells grown in 10% serum medium (left ) is compared with cells grown in 0.1% serum for 6 days in the absence (middle ) or presence (right ) of 50 ng/mL BMP7.

Cancer Research




biological relevance for the study of BMP7 or other BMPs in thecontext of prostate tumorigenesis, the data presented here describethree different types of response that can be manifested in prostatetumor cells from exposure to BMP7 or BMP2.The first type of response is growth inhibition noted in BPH-1, a

benign prostatic hyperplasia cell line. This inhibition of prolifer-ation was not seen on two prostate tumor cell lines, PC-3 andDU145, which were also tested. A previous report, however,described BMP7-induced inhibition of PC-3 and DU145 growth ina medium containing 1% serum (33). Besides the level of serum,which was 0.5% in our study, that study also used a 10-foldincreased concentration of BMP7 (500 ng/mL) compared withwhat we tested. The degree of inhibition of BPH-1 growth was BMPdose dependent and was determined to be largely from G1 cell

cycle arrest. In the absence of detection of Smad1 and Smad8, andwith direct evidence from the immunoprecipitation experiment, wesuggest that Smad5 phosphorylation may be responsible, at leastpartially, for the observed effect on BPH-1 cells. However, there aretwo anomalies in BPH-1 cells that remain to be addressed. First,although BPH-1 expresses two type I and two type II BMPRs, itlacks expression of one major BMP type I receptor (ActRI or Alk-2)and a type II receptor (ActRII). Second, the electrophoretic mobilityof either Smad5 or phospho-Smad is different from the counter-parts in several other prostate cancer cell lines examined. Thesetwo properties, whether separate or connected, may be acontributing factor in cell cycle arrest of the BPH-1 cells.Antiproliferative effect of TGF-h on nonmalignant prostateepithelial cells but not prostate cancer cells has been reported

Figure 5. Time course and the dose-dependent Smad activation by BMP7 in different prostate tumor cell lines (A ) PC-3, (B ) BPH-1, (C ) C4-2B, and (D ) LNCaP. Cellswere treated with 50 ng/mL BMP7 for different time periods from 1 to 24 hours as indicated or treated for a fixed time (1 hour) at variable BMP7 concentrationsup to 100 ng/mL. Cell lysates were subjected to Western blot analysis for phospho-Smad1,5,8 (p-Smad1,5,8 ), Smad1, and Smad5. In BPH-1 cells, Smad1 was notdetected. E, nuclear translocation of phosphorylated Smad in BPH-1 and PC-3 cells. Cells were treated with 50 ng/mL BMP7 for 1 hour and the whole cell lysates(WCL) or nuclear extracts (NE ) were obtained for Western blot analysis for phospho-Smad1,5,8. The absence (�) or presence (+) of BMP7 is indicated. F,electrophoretic mobility of both phospo-Smad1,5,8 and Smad5 bands was different between BPH-1 and PC-3 cells. The Western blot analysis was done in the sameblot from a 4% to 12% gradient gel, so that the exact position can be compared by overlapping the films. G, Smad5 was identified as a Smad that is phosphorylatedin BPH-1 and PC-3 treated with BMP7 by immunoprecipitation. For the negative control, the normal goat IgG was added instead of goat anti-Smad5 antibody thatwas used to pull down the Smad5 protein.





earlier (34, 35), and in this regard, the similarity between BMPs andTGF-h is noteworthy, although limited to a single cell line at thistime.The second response relates to induction of EMT to PC-3 cells by

BMP7 or BMP2. EMT was originally defined as a morphologicconversion occurring at specific sites in embryonic epithelia to giverise to individual migratory cells (36). Subsequently, it was shownthat EMT could contribute to tumor progression, such as that ofskin carcinoma and breast cancer (37). During EMT, epithelial cellslose their polygonal morphology and adhesive cell contactmolecules (e.g., E-cadherin) and acquire fibroblast-like character-istics, including elongated shape, expression of mesenchymalmarkers (e.g., SMA), and increased motility and invasiveness (38).TGF-h is a well-characterized inducer of EMT in renal tubular andmammary ductal epithelial cells (39, 40), and it is reported thatBMP7 can counteract TGF-h-induced EMT in mouse renal injury,implying a potential cross-talk between BMP7 and TGF-h in theregulation of EMT (41). In the present work, we show that EMT canalso be induced by BMPs in prostate cancer cells, at least in thePC-3 cell line with all of the expected phenotypic and biologicalattributes. It is also shown, however, that TGF-h, which couldnot induce EMT to PC-3, could neither counteract BMP-inducedEMT in these cells. In terms of BMP signaling, we detected astrong activation of Smad5, but the possibility of Smad1activation as well could not be ruled out. Because BMP7 andBMP2 both could induce EMT, the ligand specificity for EMT inPC-3 is not strictly limited.Finally, by using LNCaP and its variant C4-2B, we show another

distinctive effect of BMPs, which is to render protection to stress-induced apoptosis. The C4-2B is an aggressive androgen-insensitivesubline selected for propensity for metastases to the bone (42–44).We used serum starvation to induce apoptosis, which wasextensive at day 6 of culture. The antiapoptotic effect of BMPs(BMP7 or BMP2) was more pronounced in C4-2B cells (96% incontrols versus 21% with BMP) than in LNCaP cells (34% versus15%). Besides confirming BMP-induced activation of Smad, we alsoattempted to detect the expression pattern of a series ofproapoptotic and antiapoptotic proteins as that may be alteredby exposure to BMPs. Among the factors tested, survivin, a uniquemember of the IAP family (45, 46), could be a player in theprotection. Although the protein expression levels for Bcl-xl, Bax, or

XIAP remained comparatively even at corresponding time pointsbetween serum starved with or without BMP C4-2B or LNCaPcultures, there was a remarkable conservation of survivin level atthe end point (day 6) in the presence of BMP7 in the C4-2B cellsbut not in the LNCaP cells. Recognizing that survivin is cell cycleregulated and mostly expressed at mitosis (47, 48), the decline ofsurvivin level in the control cultures was likely to be caused by G1

arrest from serum starvation. Although the underlying mechanismfor the rescue of survivin in C4-2B by BMP7 is currently unknown,there are two possibilities. First, BMP7 signaling may activate somepathways, Smad dependent or Smad independent, which cantranscriptionally up-regulate survivin expression despite the cellcycle arrest. Second, because survivin is a relatively short-livedprotein (t1/2 = 30 minutes) and phosphorylation on Thr34 has beenreported to increase protein stability (49), a post-translationalstabilization of survivin by BMP7 signaling is also possible.However, survivin may only explain a part of the variables, becauseexpression of survivin is not sustained in LNCaP cells, which arealso protected from serum deprivation–related apoptosis by BMPs.In summary, our results suggest that BMPs, specifically BMP7

and BMP2, may be critical molecules in determining the fate ofprostate cancer cells, thereby playing a significant role in prostatecancer progression. BMP signaling in prostate epithelial cells isfound to be associated with Smad activation, although it is likelythat Smad-independent BMP signaling may also be operative.Furthermore, findings with bone-derived prostate cancer cell lines,such as EMT induction in PC-3 cells and strong inhibition of stress-induced apoptosis in C4-2B cells, suggest that up-regulation ofBMPs in prostate cancer cells or, by extension, presence of BMPs inthe bone microenvironment may be significant contributors for thehoming and survival of the cancer cells in the bone tissues.

Acknowledgments

Received 1/31/2005; revised 3/17/2005; accepted 4/19/2005.Grant support: NIH grant R01 CA59705.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Simon Hayward, Ming-Fong Lin, and David R. Rowley for providing usthe BPH-1, C4-2B, and HPS-40F and HTS-40C cell lines, respectively; Janet Plascia andDario Altieri for the gift of survivin antibody; and all members of the Roy-Burmanlaboratory for assistance in various aspects of the work.

Cancer Research


References

1. Celeste AJ, Iannazzi JA, Taylor RC, et al. Identificationof transforming growth factor h family memberspresent in bone-inductive protein purified from bovinebone. Proc Natl Acad Sci U S A 1990;87:9843–7.

2. Ducy P, Karsenty G. The family of bone morphogeneticproteins. Kidney Int 2000;57:2207–14.

3. Reddi AH. Role of morphogenetic proteins in skeletaltissue engineering and regeneration. Nat Biotechnol1998;16:247–52.

4. Hogan BL. Bone morphogenetic proteins: multifunc-tional regulators of vertebrate development. Genes Dev1996;10:1580–94.

5. Urist MR. Bone morphogenetic protein: the molecula-rization of skeletal system development. J Bone MinerRes 1997;12:343–6.

6. Asahina I, Sampath TK, Nishimura I, Hauschka PV.Human osteogenic protein-1 induces both chondroblas-tic and osteoblastic differentiation of osteoprogenitorcells derived from newborn rat calvaria. J Cell Biol1993;123:921–33.

7. Maliakal JC, Asahina I, Hauschka PV, Sampath TK.Osteogenic protein-1 (BMP-7) inhibits cell proliferationand stimulates the expression of markers characteristicof osteoblast phenotype in rat osteosarcoma (17/2.8)cells. Growth Factors 1994;11:227–34.

8. Asahina I, Sampath TK, Hauschka PV. Humanosteogenic protein-1 induces chondroblastic, osteoblas-tic, and/or adipocytic differentiation of clonal murinetarget cells. Exp Cell Res 1996;222:38–47.

9. Yeh LC, Tsai AD, Lee JC. Osteogenic protein-1 (OP-1,BMP-7) induces osteoblastic cell differentiation of thepluripotent mesenchymal cell line C2C12. J CellBiochem 2002;87:292–304.

10. Harris SE, Harris MA, Mahy P, Wozney J, Feng JQ,Mundy GR. Expression of bone morphogenetic proteinmessenger RNAs by normal rat and human prostate andprostate cancer cells. Prostate 1994;24:204–11.

11. Bentley H, Hamdy FC, Hart KA, et al. Expression ofbone morphogenetic proteins in human prostaticadenocarcinoma and benign prostatic hyperplasia. Br JCancer 1992;66:1159–63.

12. Lamm ML, Podlasek CA, Barnett DH, et al.

Mesenchymal factor bone morphogenetic protein 4restricts ductal budding and branching morphogen-esis in the developing prostate. Dev Biol 2001;232:301–14.

13. Thomas BG, Hamdy FC. Bone morphogeneticprotein-6: potential mediator of osteoblastic metastasesin prostate cancer. Prostate Cancer Prostatic Dis2000;3:283–5.

14. Autzen P, Robson CN, Bjartell A, et al. Bonemorphogenetic protein 6 in skeletal metastases fromprostate cancer and other common human malignan-cies. Br J Cancer 1998;78:1219–23.

15. Masuda H, Fukabori Y, Nakano K, Takezawa Y,CSuzuki T, Yamanaka H. Increased expression of bonemorphogenetic protein-7 in bone metastatic prostatecancer. Prostate 2003;54:268–74.

16. Brubaker KD, Corey E, Brown LG, Vessella RL. Bonemorphogenetic protein signaling in prostate cancer celllines. J Cell Biochem 2004;91:151–60.

17. Ide H, Yoshida T, Matsumoto N, et al. Growthregulation of human prostate cancer cells by bonemorphogenetic protein-2. Cancer Res 1997;57:5022–7.





18. Dai J, Kitagawa Y, Zhang J, et al. Vascular endothelialgrowth factor contributes to the prostate cancer-induced osteoblast differentiation mediated by bonemorphogenetic protein. Cancer Res 2004;64:994–9.

19. Kim IY, Lee DH, Ahn HJ, et al. Expression of bonemorphogenetic protein receptors type-IA, -IB and -IIcorrelates with tumor grade in human prostate cancertissues. Cancer Res 2000;60:2840–4.

20. Kim IY, Lee DH, Lee DK, et al. Loss of expression ofbone morphogenetic protein receptor type II in humanprostate cancer cells. Oncogene 2004;23:7651–9.

21. Wang S, Gao J, Lei Q, et al. Prostate-specific deletionof the murine Pten tumor suppressor gene leads tometastatic prostate cancer. Cancer Cell 2003;4:209–21.

22. Trotman LC, Niki M, Dotan ZA, et al. Pten dosedictates cancer progression in the prostate. PLoS Biol2003;1:E59.

23. Roy-Burman P, Wu H, Powell WC, Hagenkord J,Cohen MB. Genetically defined mouse models thatmimic natural aspects of human prostate cancerdevelopment. Endocr Relat Cancer 2004;11:225–54.

24. Lee MS, Garkovenko E, Yun JS, et al. Characterizationof adult human prostatic epithelial cells immortalizedby polybrene-induced DNA transfection with plasmidcontaining an origin defective SV40 genome. Int J Oncol1994;4:821–30.

25. Zhong C, Yang S, Huang J, Cohen MB, Roy-BurmanP. Aberration in the expression of the retinoidreceptor, RXRa, in prostate cancer. Cancer Biol Ther2003;2:179–84.

26. Song Z, Powell WC, Kasahara N, van Bokhoven A,Miller GJ, Roy-Burman P. The effect of fibroblast growthfactor 8, isoform b, on the biology of prostate carcinomacells and their interaction with stromal cells. Cancer Res2000;60:6730–6.

27. Hayward SW, Dahiya R, Cunha GR, Bartek J,Deshpande N, Narayan P. Establishment and character-ization of an immortalized but non-transformed humanprostate epithelial cell line: BPH-1. In Vitro Cell Dev BiolAnim 1995;31:14–24.

28. Tuxhorn JA, McAlhany SJ, Dang TD, Ayala GE, RowleyDR. Stromal cells promote angiogenesis and growth ofhuman prostate tumors in a differential reactive stroma(DRS) xenograft model. Cancer Res 2002;62:3298–307.

29. Wu TT, Sikes RA, Cui Q, et al. Establishing humanprostate cancer cell xenografts in bone: induction ofosteoblastic reaction by prostate-specific antigen-producing tumors in athymic and SCID/bg mice

using LNCaP and lineage-derived metastatic sublines.Int J Cancer 1998;77:887–94.

30. Thalmann GN, Sikes RA, Wu TT, et al. LNCaPprogression model of human prostate cancer: androgen-independence and osseous metastasis. Prostate 2000;44:91–103.

31. Waite KA, Eng C. From developmental disorder toheritable cancer: it’s all in the BMP/TGF-h family. NatRev Genet 2003;4:763–73.

32. ten Dijke P, Korchynskyi O, Valdimarsdottir G,Goumans MJ. Controlling cell fate by bone morphoge-netic protein receptors. Mol Cell Endocrinol 2003;211:105–13.

33. Miyazaki H, Watabe T, Kitamura T, Miyazono K. BMPsignals inhibit proliferation and in vivo tumor growth ofandrogen-insensitive prostate carcinoma cells. Onco-gene 2004;23:9326–35.

34. Wikstrom P, Damber J, Bergh A. Role of transforminggrowth factor-h1 in prostate cancer. Microsc Res Tech2001;52:411–9.

35. Barrack ER. TGF h in prostate cancer: a growthinhibitor that can enhance tumorigenicity. Prostate1997;31:61–70.

36. Vincent-Salomon A, Thiery JP. Host microenviron-ment in breast cancer development: epithelial-mesen-chymal transition in breast cancer development. BreastCancer Res 2003;5:101–6.

37. Tang B, Vu M, Booker T, et al. TGF-h switches fromtumor suppressor to prometastatic factor in a model ofbreast cancer progression. J Clin Invest 2003;112:1116–24.

38. Masszi A, Di Ciano C, Sirokmany G, et al. Central rolefor Rho in TGF-h1-induced a-smooth muscle actinexpression during epithelial-mesenchymal transition.Am J Physiol Renal Physiol 2003;284:F911–24.

39. Bhowmick NA, Ghiassi M, Bakin A, et al. Trans-forming growth factor-h1 mediates epithelial to mesen-chymal transdifferentiation through a RhoA-dependentmechanism. Mol Biol Cell 2001;12:27–36.

40. Bakin AV, Rinehart C, Tomlinson AK, Arteaga CL. p38mitogen-activated protein kinase is required for TGFh-mediated fibroblastic transdifferentiation and cellmigration. J Cell Sci 2002;115:3193–206.

41. Zeisberg M, Hanai J, Sugimoto H, et al. BMP-7counteracts TGF-h1-induced epithelial-to-mesenchymaltransition and reverses chronic renal injury. Nat Med2003;9:964–8.

42. Koeneman KS, Yeung F, Chung LW. Osteomimeticproperties of prostate cancer cells: a hypothesis

supporting the predilection of prostate cancer metasta-sis and growth in the bone environment. Prostate1999;39:246–61.

43. Lin DL, Tarnowski CP, Zhang J, et al. Bone metastaticLNCaP-derivative C4-2B prostate cancer cell linemineralizes in vitro . Prostate 2001;47:212–21.

44. Liu AY, Brubaker KD, Goo YA, et al. Lineagerelationship between LNCaP and LNCaP-derived pros-tate cancer cell lines. Prostate 2004;60:98–108.

45. Schimmer AD. Inhibitor of apoptosis proteins:translating basic knowledge into clinical practice.Cancer Res 2004;64:7183–90.

46. Kaur P, Kallakury BS, Sheehan CE, Fisher HA,Kaufman RP Jr, Ross JS. Survivin and Bcl-2 expressionin prostatic adenocarcinomas. Arch Pathol Lab Med2004;128:39–43.

47. Li F, Ambrosini G, Chu EY, et al. Control of apoptosisand mitotic spindle checkpoint by survivin. Nature1998;396:580–4.

48. Altieri DC. Validating survivin as a cancer therapeu-tic target. Nat Rev Cancer 2003;3:46–54.

49. Altieri DC. Survivin, versatile modulation of celldivision and apoptosis in cancer. Oncogene 2003;22:8581–9.

50. Song Z, Wu X, Powell WC, et al. Fibroblast growthfactor 8 isoform B overexpression in prostate epithe-lium: a new mouse model for prostatic intraepithelialneoplasia. Cancer Res 2002;62:5096–105.

51. Huang J, Powell WC, Khodavirdi AC, et al. Prostaticintraepithelial neoplasia in mice with conditionaldisruption of the retinoid X receptor a allele in theprostate epithelium. Cancer Res 2002;62:4812–9.

52. Paralkar VM, Grasser WA, Mansolf AL, et al.Regulation of BMP-7 expression by retinoic acid andprostaglandin E(2). J Cell Physiol 2002;190:207–17.

53. Ide H, Katoh M, Sasaki H, et al. Cloning of humanbone morphogenetic protein type IB receptor (BMPR-IB) and its expression in prostate cancer in comparisonwith other BMPRs. Oncogene 1997;14:1377–82.

54. Vanttinen T, Kuulasmaa T, Liu J, Voutilainen R.Expression of activin/inhibin receptor and bindingprotein genes and regulation of activin/inhibin peptidesecretion in human adrenocortical cells. J Clin Endo-crinol Metab 2002;87:4257–63.

55. Jester JV, Huang J, Fisher S, et al. Myofibroblastdifferentiation of normal human keratocytes andhTERT, extended-life human corneal fibroblasts. InvestOphthalmol Vis Sci 2003;44:1850–8.



2005;65:5769-5777. Cancer Res Shangxin Yang, Chen Zhong, Baruch Frenkel, et al. Morphogenetic Protein 7 in Prostate Tumor CellsDiverse Biological Effect and Smad Signaling of Bone

Updated version

http://cancerres.aacrjournals.org/content/65/13/5769

Access the most recent version of this article at:

Cited articles

http://cancerres.aacrjournals.org/content/65/13/5769.full#ref-list-1

This article cites 55 articles, 15 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/65/13/5769.full#related-urls

This article has been cited by 20 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://cancerres.aacrjournals.org/content/65/13/5769To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/content/65/13/5769.full#ref-list-1

http://cancerres.aacrjournals.org/content/65/13/5769.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]



Diverse Biological Effect and Smad Signaling of Bone ... · Diverse Biological Effect and Smad...

Documents

Transcript of Diverse Biological Effect and Smad Signaling of Bone ... · Diverse Biological Effect and Smad...