3291Development 121, 3291-3301 (1995)Printed in Great Britain © The Company of Biologists Limited 1995

Disruption of the mouse RBP-Jκ gene results in early embryonic death

Chio Oka1,*, Toru Nakano1,*, Andrew Wakeham2,*, Jose Luis de la Pompa2,*, Chisato Mori3, Takashi Sakai1,Saeko Okazaki1, Masashi Kawaichi1, Kohei Shiota3, Tak W. Mak2 and Tasuku Honjo1

1Department of Medical Chemistry and 3Department of Anatomy, Faculty of Medicine, Kyoto University, Kyoto 606, Japan2Ontario Cancer Institute, Amgen Institute, Toronto M4X 1K9, Canada

*First four authors equally contributed to this work

The RBP-Jκ protein is a transcription factor that recog-nizes the sequence C(T)GTGGGGA. The RBP-Jκ gene ishighly conserved in a wide variety of species and theDrosophila homologue has been shown to be identical toSuppressor of Hairless [Su(H)] which plays important rolesin the development of the peripheral nervous system. Toexplore the function of the RBP-Jκ gene in mouse embryo-genesis, a mutation was introduced into the functionalRBP-Jκ gene in embryonic stem (ES) cells by homologousrecombination. Null mutant ES cells survived but nullmutant mice showed embryonic lethality before 10.5 daysof gestation. The mutant mice showed severe growth retar-dation as early as 8.5 days of gestation. Developmental

abnormalities, including incomplete turning of the bodyaxis, microencephaly, abnormal placental development,anterior neuropore opening and defective somitogenesis,were observed in the mutant mice at 9.5 days of gestation.RBP-Jκ mutant embryos expressed a posterior mesoder-mal marker FGFR1. Their irregularly shaped somitesexpressed a somite marker gene Mox 1 but failed to expressmyogenin. The RBP-Jκ gene was revealed to be essentialfor postimplantation development of mice.

Key words: RBP-Jκ, somite defect, neural tube defect, in situhybridization, homologous recombination, mouse

SUMMARY

INTRODUCTION

RBP-Jκ is a unique transcription factor that does not containany of the known DNA-binding protein motifs such as zincfinger, helix turn helix, helix loop helix and leucine zipper(Matsunami et al., 1989; Hamaguchi et al., 1989). Series ofreplacement mutations have shown that there are at least twofunctionally important regions, mutations that reduce theDNA-binding ability of the RBP-Jκ protein. These two regionsare mapped upstream and downstream of the integrase-relatedmotif that is located in the middle of the region coding theprotein and is shared by a group of site-specific recombinase(Chung et al., 1994). The mouse RBP-Jκ protein recognizes aconsensus sequence C(T)GTGGGAA (Tun et al. 1994).Recently, RBP-Jκ was shown to play important roles in regu-lation of viral gene transcription. The RBP-Jκ protein repressesthe transcription of the adenovirus pIX gene by binding imme-diately upstream of the TATA sequence in the promoter region(Dou et al. 1994). One of Epstein-Barr virus (EBV) transacti-vator proteins, EBNA2, which plays a crucial role in theimmortalization of EBV-infected B cells, requires the RBP-Jκprotein for its transactivation of viral genes. RBP-Jκ associatesdirectly with cis-responsive DNA elements in EBV genepromoters and transactivates the genes by subsequent interac-tion with EBNA2 (Henkel et al., 1994; Grossman et al., 1994;Zimber-Strobl et al., 1994). Not only viral genes but alsocellular genes appear to be regulated by RBP-Jκ because theRBP-Jκ-binding motif or EBNA2-responsive element exist in

the promoter of the CD23 gene, which is upregulated byEBNA2.

The RBP-Jκ protein is highly conserved from human toDrosophila (Furukawa et al., 1991; Amakawa et al., 1993).The Drosophila homologue of the RBP-Jκ gene turned out tobe the Suppressor of Hairless [Su(H)] gene, which is involvedin the peripheral nervous system (PNS) development inDrosophila (Furukawa et al., 1992; Schweisguth andPosakony, 1992). The activity of Su(H) is required at two stepsof cell fate decision during the development of the PNS; thesensory organ precursor versus epidermal cell fate and thetrichogen (shaft) versus tormogen (socket) cell fate decision(Furukawa et al., 1994; Schweisguth and Posakony, 1994).Su(H) was shown to interact genetically with a number ofDrosophila neurogenic genes, including Notch (de la Conchaet al., 1988). Recently, Su(H) has been reported to be a keydownstream element in the Notch receptor signaling pathway(Fortini and Artavanis-Tsakonas, 1994). The Su(H) protein,which also recognizes the sequence TGTGGGAA, has beenshown to stimulate the transcription of another neurogenicgene Enhancer of split m8 [Tun et al., 1994; Furukawa and T.H., unpublished data]. These results indicate that Su(H) playsan essential regulatory role in the process of cell fate determi-nation in Drosophila.

To understand the role of RBP-Jκ in vertebrate embryogen-esis, mice mutated in the RBP-Jκ gene were produced byhomologous recombination. Homozygous RBP-Jκ−/− mutantsshowed severe developmental delay as compared to their het-

3292 C. Oka and others

erozygous littermates as early as day 8.5 of embryogenesis.The allantois of homozygous RBP-Jκ−/− embryos failed to fuseto the chorion at day 8.5 and resulted in abnormal placentaldevelopment. Histological and molecular analysis of homozy-gous RBP-Jκ−/− embryos revealed specific defects in neuraland somitic development, associated to lethality before day10.5 of embryogenesis. Although the precise role of this genewas not revealed, the RBP-Jκ protein was found to playessential roles in early phases of mouse development.

MATERIALS AND METHODS

Targeting vector constructionThe 15 kb EcoRI fragment containing exon 4-11 of the RBP-Jκ genewas cloned from BALB/c and 129/Sv genomic DNA (Kawaichi et al.1992) (Fig. 1A). The 3′ 7.5 kb BamH-EcoRI fragment of these clonesand the neo expression cassette PGKneobpa were utilized to constructpCO3B series of targeting vectors (Soriano et al., 1991). The HindIIIsite in exon 7 was blunt-ended and SalI linkers were added. The XhoI-SalI fragment of PGKneobpa was ligated into the SalI site in theopposite transcriptional orientation to the RBP-Jκ gene and thisplasmid was named pRBP-Jκ4-11neo. Two kinds of vectors, whichcontained the thymidine kinase gene of herpes simplex virus (HSVtk)for negative selection, were constructed and designated as pCO3B-tk/BALB and pCO3B-tk/129 according to strains of their genomicDNA used (Fig. 1B). To generate the targeting vectors pCO3B-tk’s,the KpnI-EcoRI fragment of pRBP-Jκ4-11neo and the EcoRI-BamHIfragment of PGK-HSVtk cassette were ligated into KpnI-BamHI-digested pBSKS(+). pMC1-DT-A cassette was used for constructinganother targeting vector pCO3B-DT/129 for negative selection byusing diphtheria toxin A (DT-A) gene without GANC or FIAU (Yagiet al., 1990). The KpnI-SmaI fragment of pRBP-Jκ4-11neo, which hadbeen constructed with 129/sv genomic DNA and the SalI-SmaIfragment of pMC1-DT-A, were ligated into KpnI-SmaI-digestedBSKS(+) to generate the targeting vector pCO3B-DT/129. Thesetargeting vectors pCO3B’s contained 290-bp and 7.5-kb homologoussequences at the 5′ and 3′ sides, respectively.

Another targeting vector PCO5/129 containing a hygromycinexpression cassette from pPGKhygro (kindly provided by Dr R.Mortensen, Simon et al. 1992) was used to produce double knock outof the RBP-Jκ gene in ES cells. The 3′ 7.5-kb BamHI-EcoRI fragmentof the RBP-Jκ gene (15 kb EcoRI fragment) derived from 129/svgenomic DNA was partially digested with PvuII. The fragment thatwas obtained by digestion of only the 3′-most PvuII site was againpartially digested with HindIII. The expected fragment was isolated,blunt-ended, ligated with SalI linkers and then digested with SalI. Thisfragment, the SalI-BamHI fragment of pPGKhygro, and the 5′ 7.5 kbEcoRI-BamHI fragment were ligated into SalI-EcoRI-digestedpBSKS(+). The SalI-SmaI fragment of the pENL containing the lacZgene under the EF1a promoter (Hanaoka et al., 1991) was blunt-endedand ligated into the SmaI site of polylinkers at the upstream of thePGKhygro gene, although β-galactosidase was not used as a cyto-logical marker in this study. PCO5/129 contains 7.5 kb and 7.0 kbhomologous sequences at the 5′ and 3′ ends of the hygromycinexpression cassette, respectively (Fig. 1E). All vectors (pCO3B-tk/Balb, pCO3B-tk/129, pCO3B-DT/129, pCO5/129) were linearizedby a unique KpnI site at the 5′ end of the RBP-Jκ gene before elec-troporation.

Electroporation, selection and screening of ES cellsD3 cells were electroporated as described (Joyner et al., 1989). Drugselection was done using 400 µg/ml of G418 (Waken, Kyoto), 150µg/ml of hygromycin (Waken, Kyoto), or 2 µM of GANC (Kindlyprovided by Syntex). After 9 days selection, halves of individual

colonies were reseeded and the other halves of colonies were used forscreening by PCR or Southern blotting. PCR was carried out for 35cycles of 94°C for 30 seconds, 64°C for 30 seconds, and 72°C for 1.5minutes and the product was confirmed by filter hybridization.Primers for PCR were RBP-Jκ-sense, TGGCACTGTTCAATCGC-CTT, which was derived from genomic sequence upstream of theKpnI site in exon 7, and neo, GAGGAAATTGCATCGCATTGTCT-GAG, which was derived from pPGKneobpa cassette.

To analyze the genotype of the RBP-Jκ targeted mice at day 8.5,the third primer RBP-Jκ-reverse, AATCTTGGGAGTGCCATGCCA,was mixed with two above-mentioned primers. RBP-Jκ-reverseprimer was derived from the sequence in exon 7 at downstream of theHindIII site. The wild-type allele should give rise to the 376 bpfragment by primers of RBP-Jκ-sense and RBP-Jκ-reverse. Incontrast, the disrupted allele should give rise to the 590 bp fragmentby primers of RBP-Jκ-sense and neo (Fig. 1C,D). A combination ofRBP-Jκ-sense and RBP-Jκ-reverse primers did not make anydetectable bands from the disrupted alleles because the amplified bandis too large (data not shown).

Genotyping ES cell lines and mice by Southern blotanalysis DNA was isolated from the mutant ES cell lines and tail clip samplesusing standard procedures (Sambrook et al., 1989). For genotyping ofembryos, DNA was extracted from embryos or yolk sacs isolated at8.5-12.5 dpc and analyzed by PCR or Southern blot hybridization.DNAs from yolk sacs, embryos, ES cells or adult mouse tail weredigested with EcoRI. cDNA probe of exons 4 and 5 (probe 1 in Fig.1C) was used for genotyping mutant mice. Another probe (probe 2 inFig. 1F), the PvuII-EcoRI fragment located at the 3′ end of the 15 kbEcoRI fragment of the RBP-Jκ gene was used for analyzing doubleknock-out ES cell clones.

Blastocyst injection and animal breedingChimeras were generated as described (Bradley, 1987). ES cell clonespositive for the homologous recombination were injected into blasto-cysts of C57BL/6 mice at 3.5 dpc. The midpoint of dark interval ofthe day that vaginal plug was detected was considered as 0.0 dpc.Male chimeras with extensive ES cell contribution to the coat colorwere mated with C57BL/6 female to test for germ-line transmission.

Western blottingWestern blotting analysis was performed as described (Hamaguchi etal., 1992). 600 µg of crude nuclear extract from ES clones were usedfor electrophoresis. The blot was stained with a primary monoclonalantibody (1:1,000 dilution) against the RBP-Jκ protein (Hamaguchiet al., 1992) and secondary 125I-labeled anti-rat IgG antibodies(Amersham) (1:100 dilution).

Morphological and histological analysisEmbryos were collected at various times of gestation and stagedaccording to morphological criteria (Kaufman, 1992). For histologi-cal analysis, procured embryos were rinsed with PBS and fixedovernight at 4°C in 4% paraformaldehyde or Bouin’s solution, dehy-drated through graded alcohols and embedded in paraffin or wax(Kaufman 1992). Embryos were sectioned at 5 µm thickness andstained with hematoxylin and eosin. Embryos were photographed ina Wild Leitz M3 microscope. Sectioned embryos were photographedusing a Leitz Orthoplan compound microscope. The somite numbersof 8.5 dpc embryos were counted under a dissection microscope afterfixation.

RT-PCREmbryos from 7.5 dpc to 10.5 dpc were separated under a dissectingmicroscope. RNA was prepared with Isogen (Nippon Gene) andsamples of 1 µg RNA were used for reverse transcription (Sambrooket al., 1989). Samples without the addition of reverse transcriptase

3293RBP-Jκ gene knock-out mice

Table 1. Efficiency of targeting integration with variouskinds of vectors in D3 ES cells

Ratio ofVector Selection positive clones

pCO3B-TK/BALB G418 + GANC 1/600pCO3B-TK/129 G418 + GANC 3/120pCO3B-TK/129 G418 5/700pCO3B-DT/129 G418 1/120

were used to confirm that PCR product is derived from cDNA. PCRwas carried out for 25 cycles of 94°C for 1 minute, 55°C for 30seconds, 72°C for 30 seconds. RBP-Jκ-sense and RBP-Jκ-antisenseprimers were used to detect the expression of RBP-Jκ mRNA. β-actinmRNA expression was used as a control for the reactions (Weiss etal., 1994).

Whole-mount in situ hybridization of mouse embryosWhole-mount in situ hybridization was performed according to themethod of Wilkinson and Nieto (1993), with the following modifica-tions. For the 8.5 dpc embryos, the proteinase K (20 µg/ml) treatmentwas 3 minutes. Embryos were prehybridized for 3.5 hours at 65°C.Ribonuclease treatment was excluded. Embryos were preblocked for3 hours with goat serum. Anti-digoxigenin antibody was preabsorbedfor 3 hours and used at a final concentration of 1:2,000. The hybrid-ization probes used were: A 600-bp fragment corresponding to the 3′end of the RBP-Jκ gene (Kawaichi et al., 1992); FGFR1 full-lengthcDNA (Yamaguchi et al., 1994); a 550 bp fragment corresponding tothe 3′ end of the mouse Mox 1 cDNA (Candia et al., 1992) and themyogenin poly(A) region (provided by Dr A Schuh). After in situhybridization, embryos were postfixed overnight in 4% paraformalde-hyde, dehydrated through methanol series to intensify the pink-to-purple reaction product to dark blue and rehydrated again (Conlon andHermann, 1993).

RESULTS

Targeted disruption of the RBP-Jκ gene and germ-line transmission of the mutated alleleThere are four RBP-Jκ-related genes whose sequences areidentical or highly homologous to that of RBP-Jκ cDNA(Kawaichi et al., 1992). Two of them are apparent pseudogenesof processed type because their sequences contain scattered stopcodons in coding regions. The other two genes, however, containsequences identical to that of RBP-Jκ cDNA. Because one of

vector for producing double knock-out ES cells. Hygro and lacZ genesvectors and were in the same and opposite transcriptional orientation togenerated by homologous recombination with pCO5. Solid and open re

them is a processed gene, we assumed that the other one, whichconsists of 11 exons scattered over 50 kb, is the functional RBP-Jκ gene and decided to disrupt it (Fig. 1A). To construct thereplacement type targeting vectors pCO3B’s, a PGKneobpacassette was inserted into the HindIII site of exon 7 with theopposite transcriptional orientation. The regions surrounding theintegrase motif, which had been shown to be important for thesequence-specific DNA-binding capacity of RBP-Jκ by site-directed mutagenesis analysis (Chung et al., 1994), should bedisrupted by these targeting constructs (Fig. 1B). pCO3B seriesof targeting vectors contained the HSVtk gene or diphtheria toxinA (DT-A) gene for negative selection. D3 ES cells electroporatedwith these vectors were selected in the presence of both G418and GANC, or G418 alone. GANC was used only in the initialexperiment because ES cell clones selected by GANC exhibiteda slightly differentiated morphology. G418-resistant clones wereinitially screened by PCR and positive clones were chosen forsubsequent confirmation of homologous recombination bySouthern blot analysis. EcoRI digests of genomic DNA ofhomologous recombination-positive clones should give rise tothe 9.5 kb band hybridized with probe 1. Such band wasconfirmed in 10 independent clones (Figs 1C, 2A). All of theclones with the homologous recombination showed a singleband with a neo probe (data not shown). Table 1 summarizestargeting efficiencies of the vectors with basically similar struc-

Fig. 1. Gene targeting at thefunctional RBP-Jκ gene. (A) Genomic organization ofthe RBP-Jκ gene. Putativenuclear localization signal(NLS) is located in exon 4 andintegrase motif is located inexons 6 and 7 as indicated.(B) Structure of targeting

vectors pCO3-tk and pCO3-DT. Both targetingvectors contain PGKneobpa cassette in theopposite transcriptional orientation to the RBP-Jκ gene. pCO3-tk and pCO3-DT have negativeselection markers of PGK-HSVtk and nc1-DT-A,respectively, at the 3′ end of the vectors in thesame orientation to the RBP-Jκ gene. (C) Structure of the RBP-Jκ locus resulting fromhomologous recombination between theendogenous locus and pCO3 targeting vectors.(D) PCR for detecting homologousrecombination caused by pCO3 targetingvectors. The PCR primers, RBP-Jκ reverse andneo, used for screening are indicated byarrowheads. (E) Structure of pCO5 targeting

were inserted at the same site of the neo gene of pCO3 targeting the RBP-Jκ gene, respectively. (F) Structure of the RBP-Jκ locusctangles show exons and introns of the RBP-Jκ gene, respectively.

3294 C. Oka and others

Fig. 2. Southern blot analysis of DNAs of ES cells and embryos. (A) Southern blot analysis of DNAs of ES cell clones transfectedwith pCO3B-tk/129 targeting vector. DNA samples from G418resistant clones were digested with EcoRI and hybridized with probe1. Arrowheads indicate the bands of pseudogenes. (B) Southern blotanalysis to determine the genotype of 10.5 dpc embryos fromheterozygous intercrosses of RBP-Jκ−/+ mice. Arrowheads indicatethe bands of pseudogenes.

tures under conditions with or without GANC. The frequenciesof homologous recombination by the vector constructed withisogenic genomic DNA (129/Sv) were 15 times more than thatwith non-isogenic DNA (BALB/c). Negative selection byGANC and DT-A gave threefold and no enrichment, respec-tively, over G418 selection alone.

Two D3 cell clones, named 3B-1 and 3B-6, in which oneallele of the gene had been disrupted with targeting vectorspCO3-tk/BALB and pCO3-tk/129, respectively, were injectedinto C57BL/6 blastocysts. The phenotypes of homozygousmutant mice derived from the two D3 clones were indistin-guishable, thus the data from the two have been combined. The

Fig. 3. Southern blot analysis and western blot analysis of doublytargeted ES cells. (A) Southern blot analysis of DNAs of ES cellclones transfected with the targeting vector pCO5. DNA fromhygromycin resistant clones were digested with EcoRI andhybridized with probe 2. An arrowhead indicates the pseudogenes.(B) Western blot analysis of RBP-Jκ+/− and RBP-Jκ−/− ES cells.Nuclear extracts from ES cell clones were fractionated in a 7%acrylamide gel and transferred to a membrane filter. The blot wasprobed with the monoclonal antibody against RBP-Jκ protein. Anarrowhead indicates the expected size of the RBP-Jκ protein.

mice with one disrupted allele showed no obvious abnormal-ity by either macroscopical or microscopical examination (datanot shown). Heterozygous animals were crossed into twoinbred backgrounds (129/Sv and C57BL/6) and one outbredbackground (CD1). The phenotype associated with the mutantRBP-Jκ gene was essentially the same in the different back-grounds and remained associated through as many as 4 gener-ations of outcrosses to wild-type mice.

Double knock out of the RBP-Jκ gene in ES cellsIt was essential to confirm that the homologous recombinationwith the targeting vector resulted in the loss of the functionalRBP-Jκ protein because of the presence of the four structurally

Fig. 4. Phenotypes of RBP-Jκ+/− or RBP-Jκ+/+ and RBP-Jκ−/−

embryos at 8.5 dpc. (A, B) Dorsal view of RBP-Jκ−/− mutant (A) andRBP-Jκ+/− or RBP-Jκ+/+ littermate (B). (A) Note the unsegmentedmesoderm at either side of the neural tube. (B) The wild-typeembryo shows 8 pairs of somites at this stage. (C,D) Histologicalsection (horizontal) of RBP-Jκ−/− embryo (C) and RBP-Jκ+/− or RBP-Jκ+/+ embryo (D). (C) Somites are loose and irregularly arranged.The neural tube has an irregular shape. (D) Somites are tightlypacked and the neural tube shows a normal straight shape. Anterioris to the top. Magnification: −25× in A, B; −90× in C,D.

3295RBP-Jκ gene knock-out mice

RBP-Jκ-related genes as described above. To produce D3 celllines in which both alleles of the RBP-Jκ gene were disrupted,another targeting vector pCO5/129 containing the insertion ofthe hygromycin-resistant gene (Hygro) and the lacZ gene inexon 7 was constructed and electroporated into 3B-6 ES cellclone (Fig. 1E). Both pCO3-tk/129 and pCO5/129 were con-structed from isogenic 129/Sv DNA and the locus of theinsertion of the drug resistance gene in pCO3-tk/129 wasidentical to that in pCO5/129. However, the lengths of the 5′homologous DNA of pCO3-tk/129 and pCO5/129 are 290 bpand 7.5 kb, respectively. Therefore, EcoRI digests of the intactgene, the disrupted gene with pCO3-tk/129 and the disruptedgene with pCO5/129 give rise to 15, 7.5 and 8.7 kb fragmentshybridized with probe 2, respectively (Fig. 3A). Consequently,the 7.5 and 8.7 kb recombinant fragments should be detectedwhen both alleles were disrupted, whereas the 15 kb intact andthe 8.7 kb recombinant fragments should be found when theallele already disrupted with pCO3-tk/129 was disrupted againwith pCO5/129 (Fig. 1C,F). As a whole, the frequency of homol-ogous recombination with pCO5/129 among hygromycin-resistant clones was 23/101, which is about 30 times higher than

that with pCO3-tk/129. In the majority (21 of 23) of targetedclones, the Hygro and lacZ genes were integrated in the wild-type RBP-Jκ allele, giving rise to cell lines in which both RBP-Jκ alleles were disrupted. In the remaining two recombinants,the Hygro and lacZ sequences had replaced the neo gene.

The homozygously RBP-Jκ-mutated ES cells were capableof extensive proliferation with no alterations in their growthcharacteristics. These cells were expanded to provide materialsfor the protein analysis. Three randomly chosen cell lines weretransferred several times without feeder cells and nuclearextracts were prepared for western blotting analysis. As shownin Fig. 3B, the RBP-Jκ protein was completely absent in theES cell line, both alleles of which had been targeted. But theprotein was synthesized in the cells in which one RBP-Jκ allelehad been disrupted. Thus the mutation that caused disruptionin exon 7 by the gene insertion appeared to be a null mutationof RBP-Jκ in ES cells as expected.

Embryonic lethality of the mice homozygous for thedisrupted RBP-Jκ alleleTo investigate the in vivo effect of null mutation of RBP-Jκ,

Fig. 5. Phenotypes of RBP-Jk−/− embryos at 9.5 dpc. (A) Lateral view of RBP-Jκ−/−

mutant embryo (left) andRBP-Jκ+/+ embryo (right). (B) Dorsal view of thecephalic region of thehomozygous mutant embryoshown in (A). RBP-Jκ−/−

mutant shows severe growthretardation, incompleterotation, microencephaly,opening of anterior neuropore(arrow), and tortuous neuraltube. (C-F) Histologicalsections of RBP-Jκ−/− embryo(C,E) and RBP-Jκ+/+ embryo(D,F). Neural tube is closed inthe RBP-Jκ+/+ embryo whileanterior neuropore ispersistently open in the RBP-Jκ−/− embryo (arrow). C, Dare transversal and E, F arelongitudinal sections.Magnification: ~10× in A;~40× in B; 860× (C,D) and330× (E,F).

3296 C. Oka and others

Fig. 6. RT-PCRanalysis of RBP-Jk

Table 2. Genotype frequency of progeny from intercrossesof RBP-Jκ heterozygous mice

Numbers of embryos or mice (%)

Stages +/+ +/− −/−8.5 days of gestation 17 (30) 27 (48) 12 (21)9.5 days of gestation 54 (25) 118 (55) 43 (20)

10.5 days of gestation 46 (30) 89 (57) 21 (13)12.5 days of gestation 14 (28) 36 (72) 0Newborn or Adult 50 (39) 78 (61) 0

Resorbed embryos are not included. Percentages of each viable class areincluded in parenthesis. Analysis performed by PCR. Data include only thoselitters where all embryos were analyzed.

RBP-Jκ+/− mice were intercrossed. Genotypes of the resultingoffspring were determined at 5 weeks of age by Southern blotanalysis of tail DNA using probe 1 (Fig. 2B). No micehomozygous for the null RBP-Jκ mutation were found, sug-gesting that the mutation may result in embryonic lethality.To determine the time of intrauterine death more precisely,RBP-Jκ+/− animals were intercrossed and pregnant femaleswere killed to examine embryos at different gestation timesfrom 7.5 to 12.5 dpc. We found that 10-25% of embryosbegan to be resorbed at 8.5 dpc. At 9.5 dpc empty yolk sacswere found in some cases, indicating that some of the mutantembryos were already resorbed. At 10.5 dpc, all of the RBP-Jκ−/− embryos identified were moribund or dead and in theprocess of resorption. At 12.5 dpc, no homozygous mutantembryos were found. As summarized in Table 2, these studiesdemonstrate that the ratio of wild-type, RBP-Jκ+/− and RBP-Jκ−/− embryos significantly deviated from the expected value(1:2:1) after 10.5 dpc although a slight deviation began at 8.5dpc. This analysis indicates that the absence of the functionalRBP-Jκ expression results in embryonic lethality at around8.5 dpc.

Developmental delay of the RBP-Jκ−/− embryosAt 8.5 dpc and 9.5 dpc, RBP-Jκ−/− embryos were always sub-stantially developmentally retarded and had reduced sizes ascompared with their RBP-Jκ+/− or RBP-Jκ+/+ littermates. Thedevelopmental delay of homozygous RBP-Jκ mutantembryos was determined by counting the number of somitepairs after genotyping embryos by PCR with yolk sac DNA(Table 3). Somites form in the embryo in a craniocaudaldirection as condensed blocks of mesoderm flanking on eachside of the neural tube. We found 4±1 (mean ± s. d.) somitepairs for the RBP-Jκ−/− embryos and 7±2 somite pairs for theRBP-Jκ+/− or RBP-Jκ+/+ embryos. The difference in thenumbers of somites was significant by Student t-test with Pvalue <0.01. None of the RBP-Jκ−/− embryos had 6 or moresomite pairs. The sizes of somites of RBP-Jκ−/− embryos (Fig.4A) were smaller than those of RBP-Jκ+/− or RBP-Jκ+/+

Table 3. Numbers of somites in 8.5 dpc embryosNumbers of somites

Genotype 4 5 6 7 8 9

−/− 4 2 0 0 0 0+/− or +/+ 2 5 3 4 3 3

Numbers of embryos having the somite numbers indicated.

embryos (Fig. 4B). Somites were poorly formed and irregu-larly arranged in RBP-Jκ−/− embryos (Fig. 4C) as comparedwith RBP-Jκ+/− or RBP-Jκ+/+ littermates (Fig. 4D). Theneural tube of RBP-Jκ−/− embryos is tortuous. Neuroepi-thelium is thinner and mesenchyme is less densely populatedin RBP-Jκ−/− embryos.

Developmental delay of RBP-Jκ−/− embryos was reflected intheir dramatic growth retardation at 9.5 dpc as compared withtheir heterozygous littermates (Fig. 5A). There was no apparentdifference in size between RBP-Jκ+/− and RBP-Jκ+/+ embryos.RBP-Jκ−/− embryos showed not only reduction in size, but alsoincomplete rotation of the body axis, microencephaly and per-sistent opening of the anterior neuropore (Fig. 5B). While theanterior neuropore closes between 8.5 and 9.5 dpc in RBP-Jκ+/+ and RBP-Jk+/− embryos, all the RBP-Jκ−/− embryos thatsurvived to 9.5 dpc had a patent anterior neuropore. Theanterior neuropore was still open in most RBP-Jκ−/− embryosat 10.5 dpc, although some embryos had a closed neural tube.Histological examination showed that neuroepithelium of 9.5dpc RBP-Jκ−/− embryos (Fig. 5C) was thinner than that ofnormal littermates (Fig. 5D) and showed some derangement inits histological architecture. Localized areas of cell death couldbe observed in 9.5 dpc RBP-Jκ−/− embryos. Pyknotic cellswere abundant in the neuroepithelial tissue of the CNS, ascompared with normal littermates. Cells in somites of RBP-Jκ−/− embryos (Fig. 5E) were poorly condensed and thesomites are somewhat disorganized as compared with those ofwild-type littermates (Fig. 5F).

Somitogenesis in RBP-Jκ−/− embryosExpression of RBP-Jκ was detected in ES cells and embryosfrom 7.5 dpc by RT-PCR (Fig. 6). Whole-mount in situ hybrid-ization revealed the expression pattern of the RBP-Jκ gene in8.5 dpc embryos (Fig. 7A). RBP-Jκ mRNA was detected in thelateral portions of the midbrain and hindbrain. The signal wasalso detected in the presomitic mesoderm and the somites. Atlater stages, RBP-Jκ expression was ubiquitous (data notshown). The expression profile of RBP-Jκ at 8.5 dpc is con-sistent with the defective somitic development observed inRBP-Jκ−/− embryos.

In order to obtain insights into the molecular mechanism ofthe defective somitic development in RBP-Jκ−/− embryos, weexamined the expression profile of several marker genesinvolved in different aspects of somitogenesis. The fibroblastgrowth factor receptor 1 gene (FGFR1) participates in thesignaling pathway that is essential for somites formation(Yamaguchi et al., 1994). In order to determine whetherFGFR1 and RBPJk genes are involved in the same signalingpathway, the expression of FGFR1 gene in RBP-Jκ−/− mutant

mRNA expressionin mouse embryosfrom 7.5 dpc to 10.5dpc. RT + and −show PCR productsfrom the RNAsamples treated withor without reversetranscriptase.

3297RBP-Jκ gene knock-out mice

Fig. 7. Expression of RBP-Jκ in normal embryos and defective somitogenesis in RBP-Jκ−/− embryos. (A) Whole-mount in situ hybridizationanalysis of RBP-Jκ expression. RBP-Jκ is expressed in presomitic mesoderm, somites and developing brain at 8.5 dpc embryo corresponding to10-somite stage. (B-D) In situ hybridization analysis of FGFR1 expression in RBP-Jκ+/+ and RBP-Jκ−/− mice at 8.5 dpc. FGFR1 is stronglyexpressed in the presomitic mesoderm of the RBP-Jκ+/+ (left side of the panel) embryo. Normal expression is detected in the RBP-Jκ−/− (rightside of the panel) embryos (B). Detail of FGFR1 expression pattern in RBP-Jκ+/+ (C) and RBP-Jκ−/− embryos (D). In RBP-Jκ+/+ embryo, thepresomitic mesoderm and the newly formed somites expressed FGFR1 (C). FGFR1 signal is detected in the presomitic mesoderm and in thepoorly segmented somites of theRBP-Jκ−/− embryo (D). (E-G) In situ hybridization analysis of Mox-1 expression in three RBP-Jκ−/− (left sideof the panel) and an RBP-Jκ+/+ (right side of the panel) embryos at 9.5 dpc (E). Details of Mox-1 expression pattern in RBP-Jκ+/+ (F) and RBP-Jκ−/− embryos (G). Mox-1 is expressed in presomite mesoderm and somites of RBP-Jκ−/−.embryo (F). Mox-1 signal is detected in the 3 pairs ofsomites developed in RBP-Jκ−/− embryo (G). And the number of somites is less in a RBP-Jκ−/− embryo than in a RBP-Jκ+/+ embryo. (H-K) Insitu hybridization analysis of myogenin expression in RBP-Jκ+/+ and RBP-Jκ−/− mice. Myogenin expression is evident in the anterior somites inRBP-Jκ+/+ embryos at 9.0 dpc (H) and 9.5 dpc (I, J). No myogenin expression is detected in a 9.0 dpc RBP-Jκ−/− embryo (K). Arrowheads andarrows point to the presomitic mesoderm and somites, respectively. Magnification; ~25× in A,B,E,H,I and K; ~40× in J; ~64× in C,D,F,G.

embryos was analyzed. The expression of the FGFR1 genemarked the anterior portion of the presomitic mesoderm innormal embryos (Yamaguchi et al., 1992; Fig. 7B,C). In 8.5

dpc RBP-Jκ−/− mutant embryos, FGFR1 was expressednormally in the presomitic mesoderm and the mesodermposterior to the unsegmented para-axial mesoderm (Fig. 7D),

3298 C. Oka and others

Fig. 8. Absence ofchorioallantoic fusion anddefective placentation inRBP-Jκ−/− embryos. (A-C) 8.5 dpc embryos. Theallantois (small arrowhead)is fused to the chorion inRBP-Jκ+/+ embryo (A) butis not in RBP-Jκ−/− embryos(B,C). (D-F) 9.5 dpcembryos. RBP-Jκ−/− (rightof D) embryo has smallersize, a distendedpericardium and a compactunfused allantois ascompared to RBP-Jκ+/+

embryos (left of D). Theumbilical vessels inside theallantoic stalk are fused tothe chorion in RBP-Jκ+/+

embryos (E). A distendedpericardium and a unfusedallantois are evident in RBP-Jκ−/− embryos (F). (G-I)RBP-Jκ+/+ (left of G,H) andRBP-Jκ−/− (right of G,I)embryos at 10.5 dpc. InRBP-Jκ−/− embryos, thepericardium is extremelydistended, allantois is verycompact and bloodaccumulated in the base ofthe allantois (G, I). Smallarrowheads, big arrowheadsand arrows point to theallantois, pericardium andumbilical vessels,respectively. Magnification;~40× in A,B,C,F; ~16× inD,E; ~25× in F,I; ~10× inG,H.

suggesting that the defective somitogenesis of RBP-Jκ−/−

mutant embryos is not due to the alteration of FGFR1expression.

Mox-1 is a homeobox-containing gene that is expressedstrongly in the presomitic mesoderm, in the forming somites,and to a lesser extent in the lateral and intermediate mesoderm(Candia et al., 1992; Fig. 7E, F). As shown in Fig. 7E and F,RBP-Jκ−/− embryos expressed Mox-1 mRNA very weakly inthe region corresponding to malformed somites and the pre-somitic mesoderm. Mox-1 expression confirmed the presenceof somites in mutant embryos, although fewer in number ascompared to heterozygous embryos (Fig. 7G). Interestingly,the expression levels of Mox-1 were reduced in phenotypicallynormal heterozygous RBP-Jκ+/− embryos as compared to wild-type RBP-Jκ+/+ embryos (data not shown). Thus, irregularlyshaped somites form in RBP-Jκ mutant embryos and theyexpress a somitic marker gene Mox 1.

Myogenin, a member of the myogenic basic-helix-loop-

helix family, which is involved in the myogenic lineage deter-mination and differentiation in the embryo (Sasson et al., 1989;reviewed by Olson and Klein, 1994), is expressed in the somitemyotome. RBP-Jκ−/− mutant embryos do not express themyogenin gene (compare Fig. 7H-J with Fig. 7K), indicatingthat myogenesis is arrested in RBP-Jκ mutant embryos.

Deficient chorioallantoic fusion in RBP-Jk−/− mutantembryosIn wild-type embryos, the allantois is formed by mesenchymederived from the posterior region of the primitive streak, growsfrom the hindgut, connects with the placenta by fusion with thechorion and forms the chorioallantois (Steven and Morris,1975). The exchange of materials between embryonic andmaternal circulation takes place after the umbilical artery andvein are formed in the chorioallantois. In embryos sufferingfrom hypogenesis or agenesis of the allantois, embryonic nutri-tional resources and oxygen are exhausted, resulting in the

3299RBP-Jκ gene knock-out mice

growth retardation of the embryos and subsequent death by10.5-11.5 dpc (Vickers, 1985).

The failure of fusion of the embryonic allantois to thechorion at 8.5 dpc was observed in RBP-Jκ−/− embryos(compare Fig. 8B,C with Fig. 8A). Subsequent turning of themutant embryos occurred normally. As shown in Fig. 8D andF, an expanded unfused allantois was clearly distinct at 9.5 dpc.In RBP-Jκ−/− embryos, the connection of allantois to the yolksac vasculature via vitelline vasculature was apparentlynormal. Vascularized yolk sac of RBP-Jκ−/− embryos at 10.5dpc showed that yolk sac blood vessel formation was normalin the mutant embryos (Fig. 8G). Compact allantois and severepericardial edema were observed in the mutant embryos thatsurvived until 10.5 dpc (Fig. 8G, I).

The formation of other organs such as optic vesicles,branchial arches, otocysts and limb buds appeared normal butwas delayed as compared to wild-type littermates.

DISCUSSION

RBP-Jκ is essential for mouse embryogenesisWe have mutated the functional RBP-Jκ gene in ES cells byusing gene targeting. The results presented here clearly demon-strate that the functional RBP-Jκ gene is essential for postim-plantation development in mice. Embryos homozygous for themutated RBP-Jκ allele died before 10.5 days of gestation.Although considerable postimplantation development occursin homozygous mutant embryos, they show a marked delay ascompared to wild-type embryos.

Morphological examination revealed that the RBP-Jκprotein is not required for early development until about day8.5 of gestation corresponding to the developmental stage with4 or 5 somites. At this stage, however, general growth retar-dation was observed, and the formation of brain vesicles,branchial arches and otocysts in RBP-Jκ−/− embryos wasslower than in normal littermates. Chorioallantoic fusion didnot occur in mutant embryos at 8.5 dpc and the allantoisremained as a compact mass until 10.5 dpc. Initial cell deathseems to occur preferentially in the neuroepithelium of theCNS and disorganization of the neuroepithelium was observedin 8.5 dpc RBP-Jκ−/− embryos. Persistent opening of theanterior neuropore was observed in 9.5 dpc RBP-Jκ−/−

embryos. It is unclear if the persistent opening was solely dueto general growth retardation or defective development of theanterior neural tube. These results suggest that the RBP-Jκprotein may be involved in the development of the mousenervous system as the Drosophila Su(H) protein.

ES cells with null mutation of RBP-Jκ grew as fast asparental ES cells, suggesting that the RBP-Jκ gene is notrequired for cell proliferation itself. Expression of the pheno-types of the null mutation of RBP-Jκ appears relatively late inspite of the continued expression of the protein from the stageof ES cells to adult. Recent studies have shown that the RBP-Jκ protein requires other proteins for the transcriptional regu-lation in human cells (Dou et al., 1994; Henkel et al., 1994;Zimber-Strobl et al., 1994; Grossman et al., 1994) and that theHairless protein functions antagonistically to the RBP-Jκprotein in Drosophila (Schweisguth and Posakony, 1994;Furukawa et al., unpublished data). Relatively late onset of theexpression of null mutant phenotypes and normal growth of

null-mutated ES cells could be explained by late expression ofsuch proteins that cooperate or antagonize RBP-Jκ for cell-type-specific regulation. As had been speculated by the ubiq-uitous RBP-Jk expression pattern during embryogenesis, thephenotype of RBP-Jκ−/− embryos was pleiotropic, indicatingthat RBP-Jκ per se is involved in the biochemical pathwaycommon to many cell types. Similarly, severe mutations of theDrosophila RBP-Jκ gene result in embryonic lethality (Nash,1970), suggesting that the Drosophila RBP-Jκ protein hasother functions than those in peripheral nervous system devel-opment.

The causes of the developmental delay and embryoniclethality of RBP-Jκ−/− embryos remain still unclear. Onepossible explanation is a defect in placentation which can causean impaired embryonic nutrition and oxygen exchange. Thisexplanation, however, should not be a sole reason because thegrowth retardation occurred prior to the initiation of the pla-centation defect. Abnormal placentation caused by the failedfusion of the allantois to the chorion was also observed invascular cell adhesion molecule-1 (VCAM-1) targeted mutantmice but VCAM-1−/− mutant mice showed embryonic death at12.5 dpc without severe growth retardation (Gurtner et al.,1995; Kwee et al., 1995). Inversely, although Notch-1−/−

mouse embryos display phenotypes similar to RBP-Jκ−/− miceas discussed below, abnormal chorioallantoic fusion has notbeen described in Notch-1−/− mutant mice (Swiatek et al.,1994). Further investigations into the causes of general growthretardation and placentation abnormality in RBP-Jκ−/− mutantembryos are required.

RBP-Jκ and somitogenesisRBP-Jκ is expressed in the presomitic mesoderm and in thedeveloping somites at 8.5 dpc, which suggests a role for thisgene in somitogenesis. A consistent defect in somite formationhas been found in RBP-Jκ−/− embryos, in which no more thanfive pairs of loosely packed somites form.

Yamaguchi et al. (1994) have recently shown that theFGFR1 gene is required for the initial formation of the somites.Normal expression of FGFR1 in RBP-Jκ−/− embryos suggeststhat FGFR1 and RBP-Jκ are involved in different pathways forsomitogenesis or that FGFR1 operates upstream of RBP-Jκ.The expression of a somitic marker gene Mox-1, which issuspected of being involved in cell type specification in thesomites (Candia et al., 1992), is normal, albeit weak, in RBP-Jκ−/− mutants indicating that RBP-Jκ is not involved in somitecell specification per se. In contrast, myogenin was notexpressed in somites of RBP-Jκ mutant embryos. Thedefective expression of myogenin suggests block of myogene-sis in RBP-Jκ−/− mutants. RBP-Jκ might be one of the controlfactors involved in the regulation of myogenin gene expression.

In Drosophila, RBP-Jκ is downstream of Notch in thesignaling cascade controlling cell fate determination duringPNS development (Fortini and Artavanis-Tsakonas, 1994).Three mouse homologues of the Notch gene, i.e. Notch 1,Notch 2 and Notch 3 were already cloned (Weinmaster et al.,1992; Lardelli et al., 1994). A more distantly related gene Int3 can be classified into the Notch gene family (Robbins et al.,1992). Notch 1−/− mice showed growth retardation at 9.5 dpcand died before 11.5 dpc with widespread cell death (Swiateket al., 1994). Interestingly, Notch 1 mutant mice showeddefects in somite development very similar to those reported

3300 C. Oka and others

here for RBP-Jκ mutants although the onset of the phenotypeand the lethality phase of RBP-Jκ−/− mice is earlier than thatof Notch 1−/− mice (Conlon et al., 1995). A certain degree ofredundancy of the Notch function during embryogenesis mayaccount for the difference in the lethality period of RBP-Jκ andNotch 1 mutants. The phenotypic similarity between RBP-Jκand Notch 1 mutants suggests that both genes may be involvedin the same developmental pathway that would be conservedfrom Drosophila to vertebrates.

CONCLUSION

The work described here demonstrates that the functional RBP-Jκ gene is required for normal postimplantation developmentin mice although it is not essential for the growth of ES cells.Mutant RBP-Jκ embryos showed general growth retardation,specific defects in neural tube formation, impaired somitogen-esis and absence of chorioallantoic fusion. We, however, couldnot ascertain the particular embryological function of the RBP-Jκ gene partly because the onset of the phenotype of RBP-Jκ−/−

mice occurred at relatively an early phase of postimplantation.Developmental stage-specific and/or organ-specific disruptionof the gene using Cre-loxP recombination system (Gu et al.,1994) should be useful to elucidate the precise functions of thegene in the development of mouse nervous system during laterstages of ontogeny.

This work was supported by grants from Ministry of Education,Science and Culture of Japan, Human Frontier Science Program andthe Naito Foundation. We thank Dr Janet Rossant for her support andDr Ronald A. Conlon for introducing us to the whole-mount in situhybridization technique.

REFERENCES

Amakawa, R., Wu, J., Ozawa, K., Matsunami, N., Hamaguchi, Y.,Matsuda, F., Kawaichi, M. and Honjo, T. (1993). Human Jκrecombination signal binding protein gene (IGKJRB): comparison with itsmouse homologue. Genomics 17, 306-315.

Bradley, A. (1987). Production and analysis of chimeric mice. InTeratocarcinomas and Embryonic Stem cells: A Practical Approach (ed, E.J.Robertson). pp.113-151. Oxford: IRL Press.

Candia, A. F., Hu, J., Crosby, J., Lalley, P. A., Noden, D., Nadeau, J. H. andWright, C. V. E. (1992). Mox-1 and Mox-2 define a novel homeobox genesubfamily and are differentially expressed during early mesodermalpatterning in mouse embryos. Development 116, 1123-1136.

Chung, C.-N, Hamaguchi, Y., Honjo, T. and Kawaichi M. (1994). Site-directed mutagenesis study on DNA binding regions of the mousehomologue of Suppressor of Hairless, RBP-Jκ. Nucleic Acids Res. 22, 2938-2944.

Conlon, R. A. and Herrmann, B. G. (1993). Detection of messenger RNA byin situ hybridization to postimplantation embryo whole mounts. Meth.Enzymol. 225, 373-383.

Conlon, R. A., Reaume, A. G. and Rossant, J. (1995). Notch 1 is required forthe coordinate segmentation of somites. Development 121, 1533-1545.

de la Concha A, Deitrich, U., Weigel, D. and Campos-Ortega J. A. (1988).Functional interactions of the neurogenic genes of Drosophila melanogaster.Genetics 118, 499-508.

Dou, S., Zeng, X., Cortes, P., Erdjument-Bromage, H., Tempst, P., Honjo,T. and Vales, L. D. (1994). The recombination signal sequence bindingprotein RBP-2N, function as a transcriptional repressor. Mol. Cell. Biol. 14,3310-3319.

Fortini, M. E. and Artavanas-Tsakonas, S. (1994). The Suppressor ofhairless protein participates in Notch receptor signaling. Cell 79, 273-282.

Furukawa, T., Kawaichi, M., Matsunami, N., Ryo, H., Nishida, Y. and T.

Honjo. (1991). The Drosophila RBP-Jκ gene encodes the binding protein forthe Immunoglobulin Jκ recombination signal sequence. J. Biol. Chem. 266,23334-23340.

Furukawa, T., Maruyama, S., Kawaichi, M. and Honjo T. (1992). TheDrosophila homolog of the immunoglobulin recombination signal-bindingprotein regulates peripheral nervous system development. Cell 69, 1191-1197.

Furukawa, T., Kimura, K., Kobayakawa, Y., Tamura, K., Kawaichi, M.,Tanimura, T. and Honjo T. (1994). Genetic characterization of DrosophilaRBP-Jκ (Suppressor of Hairless) as a neurogenic gene in adult PNSdevelopment. Jpn. J. Genet. 69, 701-711.

Grossman, S. R., Johannsen, E., Tong, X., Yalamanchili, R. and Kieff, E.(1994). The Epstein-Barr virus nuclear antigen 2 transactivator is directed toresponse elements by the Jκ recombination signal binding protein. Proc.Natl. Acad. Sci. USA 91, 7568-7572.

Gu, H., Marth, J. D., Orban, P. C., Mossmann, H. and Rajewsky, K. (1994).Deletion of a DNA polymerase β gene segment in T cells using cell type-specific gene targeting. Science 265, 103-107.

Gurtner, G. C., Davis, V., Li, H., McCoy, M. J., Sharpe, A. and Cybulski,M. I. (1995). Targeted disruption of the murine VCAM1 in chorioallantoicfusion and placentation. Genes Dev. 9, 1-14.

Hamaguchi, Y., Mastunami, N., Yamamoto, Y. and Honjo T. (1989).Purification and characterization of a protein that binds to recombinationsignal sequence of the immunoglobulin Jκ segment. Nucleic Acids Res. 17,9015-9025.

Hamaguchi, Y., Yamamoto, Y., Iwanari, H., Maruyama, S., Furukawa, T.,Matsunami, N. and Honjo T. (1992). Biochemical and immunologicalcharacterization of the DNA binding protein (RBP-Jκ) to mouse Jκrecombination signal sequence. J. Biochem. 112, 314-320.

Hanaoka, K., Hayasaka, M., Noguchi, T. and Kato, Y. (1991). The stem cellsof primordial germ cell derived teratocarcinoma have the ability to formviable mouse chimeras. Differentiation. 48, 183-189.

Henkel, T., Ling, P. D., Hayward, S. D. and Peterson M. G.. (1994).Mediation of Epstein-Barr virus EBNA2 transactivation by recombinationsignal-binding protein Jκ. Science 265, 92-95.

Joyner, A., Skarnes, W. C. and Rossant, J. (1989). Production of a mutationin mouse En-2 gene by homologous recombination in embryonic stem cells.Nature 338, 153-155.

Kawaichi M., Oka, C. Shibayama, S. Koromilas, A. E., Matsunami, N.,Hamaguchi, Y. and Honjo, T. (1992). Genomic organization of mouse Jκrecombination signal binding protein (RBP-Jκ) gene. J. Biol. Chem. 267,4016-4022.

Kaufman, M. H. (1992). The Atlas of Mouse Development. London: AcademicPress.

Kwee, L., Baldwin, H. S., Shen, H. M., Stewart, C. L., Buck, C. A. andLabow, M. A. (1995). Defective development of the embryonic andextraembryonic circulatory systems in vascular cell adhesion molecule(VCAM-1) deficient mice. Development 121, 489-503.

Matsunami, N., Hamaguchi, Y. Yamamoto, Y., Kuze, K., Kanagawa, K.Mastuo, H., Kawaichi, M. and Honjo, T. (1989). A protein binding to theJκ recombination sequence of immunoglobulin genes contains a sequencerelated to the integrase motif. Nature 342, 934-937.

Lardelli, M., Dahlstrand, J. and Lendahl, U. (1994). The novel Notchhomologue mouse Notch 3 lacks specific epidermal growth factor-repeatsand is expressed in proliferating neuroepithelium. Mech. Dev. 46, 123-136.

Nash, D. (1970). The mutational basis for the “allelic” modifier mutants,Enhancer and Suppressor of Hairless, of Drosophila melanogaster. Genetics64, 471-479.

Olson, E. N. and Klein, W. H. (1994). bHLH factors in muscle development:dead lines and commitments, what to leave in and what to leave out. GenesDev. 8, 1-8.

Robbins, J., Blondel, B. J., Gallahan, D. and Callahan, R. (1992). Mousemammary tumor Gene int-3: a member of the Notch gene family transformsmammary epithelial cells. J. Virol. 66, 2594-2599.

Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989) Molecular Cloning: ALaboratory Manual. Cold Spring Harbor: Cold Spring Harbor LaboratoryPress.

Sasson, D., Lyons, G., Wright, W. E., Lin, V., Lassar, A., Weintraub, H.and Buckingham, M. (1989) Expression of two myogenic regulatory factorsmyogenin and MyoD1 during mouse embryogenesis. Nature 341, 303-307.

Schweisguth, F. and Posakony, J. W. (1992). Suppressor of Hairless, theDrosophila homolog of the mouse recombination signal-binding proteingene, controls sensory organ cell fates. Cell 69, 1199-1212.

Schweisguth, F. and Posakony, J. W. (1994). Antagonistic activities of

3301RBP-Jκ gene knock-out mice

Suppressor of Hairless and Hairless control alternative cell fates in theDrosophila adult epidermis. Development 120, 1433-1441.

Simon, M. C., Pevny, L., Wiles, M. V., Keller, G., Costantini, F. and OrkinS. H. (1992). Rescue of erythroid development in gene targeted GATA-1−

mouse embryonic stem cells. Nature Genetics. 1, 92-98.Soriano, P., Montgomery, C. Geske, R. and Bradley A. (1991). Targeted

disruption of the c-src proto-oncogene leads to osteopetrosis in mice. Cell 64,693-702.

Steven, D. H. and Morris, G. H. (1975). Development of the fetal membranes.In Comparative Placentation. (ed. D. H. Steven). pp. 56-86. London:Academic Press.

Swiatek, P. J., Lindsell, C. E., del Amo, F. F., Weinmaster, G. and Gridley,T. (1994). Notch 1 is essential for postimplantation development in mice.Genes Dev. 8, 707-719.

Tun, T., Hamaguchi, Y., Matsunami, N., Furukawa, T., Honjo, T. andKawaichi, M. (1994). Recognition sequence of a highly conserved DNAbinding protein RBP-Jκ. Nucleic Acids Res. 22, 965-971.

Vickers, T. H. (1985) Embryolethality in rats caused by retinoic acid.Teratology 31, 19-33.

Weinmaster, G., Roberts, V. J. and Lemke, G. (1992). Notch 2: A secondmammalian Notch gene. Development 116, 931-941.

Weiss, M. J., Keller G. and Orkin S. H. (1994). Novel insights into erythroiddevelopment revealed through in vitro differentiation of GATA-1-

embryonic stem cells. Genes Dev. 8, 1184-1197.Wilkinson, D. G. and Nieto, M. A. (1993). Detection of messenger RNA by in

situ hybridization to tissue sections and whole mounts. Meth. Enzymol. 225,361-372.

Yagi, T., Ikawa, Y., Yoshida, K., Shigetani, Y., Takeda, N., Mabuchi, I.,Yamamoto, T. and Aizawa, S. (1990). Homologous recombination at c-fynlocus of mouse embryonic stem cells with use of diphtheria toxin A-fragmentgene in negative selection. Proc. Natl. Acad. Sci. USA 87, 9918-9922.

Yamaguchi, T. P., Harpel, K., Henkemeyer, M. and Rossant, J. (1994).FGFR1 is required for embryonic growth and mesodermal patterning duringmouse gastrulation. Genes Dev. 8, 3032-3044.

Zimber-Strobl, U., Strobl, L. J., Meitinger, C., Hinrichs, R., Sakai, T.,Furukawa, T., Honjo, T. and Bornkamm, G. W. (1994). Epstein-Barrvirus nuclear antigen 2 exerts its transactivating function through interactionwith recombination signal binding protein RBP-Jκ, the homologue ofDrosophila Suppressor of Hairless. EMBO J. 13, 4973-4982.

(Accepted 5 July 1995)