ORIGINAL ARTICLE

Meena Rai . Yanhua Xiong . Charles K. Singleton

Disruption of the ifkA and ifkB genes results in altered cell adhesion,morphological defects and a propensity to form pre-stalk O cells duringdevelopment of Dictyostelium

Received February 14, 2006; accepted in revised form May 10, 2006

Abstract IfkA and ifkB are two GCN2-like genespresent in Dictyostelium. Disruption of either genealone results in subtle developmental defects. However,disruption of ifkA and ifkB within the same strain re-sults in severe morphological and patterning defects inthe developing double null cells. The mutant cells ag-gregate in streams that give tightly clumped mounds.Fingers form from the mounds but remain attached toone another, especially at their bases. The fingers cul-minate to give fused and entangled structures lackingproper stalk but containing some spores. The morpho-logical defects are consistent with an enhanced cell–celland cell–substrate adhesiveness of the developing dou-ble null cells, which may result in inappropriate cellcontacts and altered cell motility and sorting properties.In ifkA/ifkB nulls, cell type proportioning and pattern-ing is altered in favor of ALC/pstO cell types. The biastoward the ALC/pstO cell types may be due, in part, tothe nuclear localization of the transcription factorSTATc in growing ifkA/ifkB null cells. STATc normal-ly becomes localized to the nucleus during fingerformation and only within the pre-stalk O zone. Theprecocious nuclear localization seen in the mutant cellsmay predispose the cells to a ALC/pstO cell fate. Thefindings indicate that IfkA and IfkB have redundantfunctions in Dictyostelium morphogenesis that involvemaintaining proper cell–cell and cell–substrate adhesionand the equilibrium between different cell types forproper spatial patterning.

Key words Dictyostelium � adhesion � patterning �pre-stalk cells � GCN2 � eIF2 a kinase � STAT

Introduction

Different aspects of cell behavior, such as growth, dif-ferentiation, polarity, and migration, are regulated byadhesion of cells to each other and to the extracellularmatrix (Braga and Harwood, 2001). During develop-ment, successful morphogenesis is a function of bothcell differentiation and directed cell migration. Directedcell migration involves modulation of cell–cell adhesionand adhesion to the substrate over which the cells mi-grate (Dimilla et al., 1993). In Dictyostelium, cell adhe-sion represents a crucial element of morphogenesis byregulating differential cell movements (Coates and Har-wood, 2001; Siu, 2004). Gp24 (Knecht et al., 1987; Se-saki and Siu, 1996), Gp80 (Siu et al., 1987; Kambojet al., 1990), Gp150 (Gao et al., 1992; Dynes et al.,1994), and AmpA (Casademunt et al., 2002; Varneyet al., 2002) are the known adhesion and anti-adhesionproteins involved in modulating cell–cell and cell–subst-rate adhesion during development.

There are three phases in the development ofDictyostelium where cell migrations are crucial. Thefirst is aggregation that occurs when starving cells mi-grate by directed chemotaxis to form mounds of about105 cells (Konijn et al., 1967). As the aggregation phasenears completion, cells randomly scattered throughoutthe mound differentiate and sort spatially by regulatedmigration (Thompson et al., 2004). Continued morpho-genesis caused by differential movement of cell types inthe mound results in the formation of a cylindrical fin-ger (Rietdorf et al., 1996) that may become a slug if itfalls to the substratum. A clear spatial arrangement ofthe pre-stalk (anterior 20%) and pre-spore cell types

Meena Rai � Yanhua Xiong � Charles K. Singleton ( .*)Department of Biological SciencesVanderbilt UniversityVU Station B 351634 Nashville,TN 37235-1634, U.S.A.Tel: 11 615 322 6516Fax: 11 615 343 6707E-mail: charles.k.singleton@vanderbilt.edu

U.S. Copyright Clearance Center Code Statement: 0301–4681/2006/7409–583 $ 15.00/0

Differentiation (2006) 74:583–595 DOI: 10.1111/j.1432-0436.2006.00085.xr 2006, Copyright the AuthorsJournal compilationr 2006, International Society of Differentiation

(posterior 80%) along the anterior–posterior axis oc-curs by the finger/slug stage. The anterior pre-stalk do-main can be further classified into pstA, pstO, andpstAB subtypes (Jermyn et al., 1989; Early et al., 1993).An additional population of stalk cell precursorstermed anterior-like cells (ALCs) are scattered through-out the posterior pre-spore domain (Sternfeld and Da-vid, 1982; Devine and Loomis, 1985). The bottom of thefinger/slug is composed predominantly of pstB cellswith an intermixing of ALCs, together referred to asrearguard cells (Bonner, 1957; Sternfeld, 1992).

Culmination is the final stage of development, and aseries of cell migrations shape the fruiting body formedduring this phase. First, the posterior of the slug movesunder the tip. The pstAB cells migrate downwardthrough the center of the pre-spore cells to form a cell-ulosidic stalk that becomes embedded in the basal disc(Jermyn et al., 1989; Shimada et al., 2005). The stalksubsequently elongates by migration of pstA and pstOcells into its apical end and differentiate into stalk cells(Jermyn et al., 1989; Early et al., 1993). The pre-sporecells move up the forming stalk and differentiate intospore cells (Jermyn et al., 1989; Anjard et al., 1998).ALCs have been proposed to be regulatory cells whosedirected migration is crucial for morphogenesis of thefruiting body (Abe et al., 1994; Dormann et al., 1996;Jermyn et al., 1996; Sternfeld, 1998a, 1998b), and theyform the upper cup and lower cup of the maturing sorus(Sternfeld and David, 1982; Jermyn et al., 1989). Theupper cup cells are involved in elevation of the non-motile spores, a step critical for the formation of maturefruits (Sternfeld and David, 1982).

Amino acid depletion induced by starvation is con-sidered to be essential for the initiation of developmentin Dictyostelium (Marin, 1976, 1977; Margolskee et al.,1980). One of the effects of amino acid starvation is asubstantial decrease in the rate of initiation of proteinsynthesis (Alton, 1977; Margolskee and Lodish, 1980).In yeast and mammalian cells, GCN2 senses amino acidstarvation and induces altered cell physiology in re-sponse to such starvation (Hinnenbusch, 1996; Hardinget al., 2000). GCN2 is a protein kinase that phosphory-lates the a-subunit of the translation initiation factoreIF2 (Dever et al., 1992). While GCN2 activation incells starved of amino acids can inhibit general proteinsynthesis, it also activates the translation of specificmRNAs, usually transcription factors that mediate theresponse to amino acid limitation (Dever et al., 1992).

IfkA, ifkB, and ifkC are three GCN2-like genespresent in Dictyostelium. They posses all the hallmarksof the prototypical GCN2 protein. The ifkA and ifkBgenes have been individually disrupted with no obviouseffect on the ability of the cells to initiate development(Fang et al., 2003). IfkA null cells form large moundsdue to a reduced extracellular level of the proteincountin (Fang et al., 2003). IfkB null cells develop nor-mally but with an aberrant stalk structure. We report

herein that disruption of the ifkA and ifkB genes withinthe same strain results in severe morphological defor-mations. The defects appear to be because of an in-creased adhesiveness of the double null cells that mayinterfere with appropriate cell contacts and with cellsorting and spatial patterning during morphogenesis. Inaddition, the double null cells have a propensity to dif-ferentiate into pstO/ALC-cell lineages, most likely be-cause of precocious nuclear localization of the STATctranscription factor.

Methods

Cell growth, development, and transformation

Dictyostelium discoideum strain A� 4 was used as the wild-typestrain in all experiments. Cells were grown axenically in HL-5 me-dia or on SM plates with Klebsiella pneumoniae (Singleton et al.,1987). Cells grown in the presence of bacteria were used, after re-moval of the bacteria, for development as described (Singleton,1989; Singleton et al., 1998). Transformation of cells with DNA wasperformed utilizing either a calcium phosphate precipitation meth-od (Nellen et al., 1984) or by electroporation (Singleton et al.,1998).

Disruption of the ifkA and ifkB genes

Two GCN2-like genes, ifkA (NCBI accession AAM43647) and ifkB(NCBI accession AAM33717) have been identified. The ifkA genehas been disrupted, and the null strain characterized (Fang et al.,2003). To disrupt the ifkB gene, two sequences were amplifiedby polymerase chain reaction (PCR) from genomic DNA. A752 bp fragment encompassing sequences upstream of thecoding region was amplified using the primers CAACTGTTAATGGAATCGAACCAAC (50 primer) and CGCCCGGGA-GATTAAACCAGGTG (30 primer). Another sequence of 830 bpfrom the encoded kinase domain was amplified using the primersGCGGATCCTATCTGGTGATTTGG (50) and GGTTTCTTTCTAGATGATGATG (30). The amplified fragments were fused at aBamHI site engineered via the primers and then inserted intopGEM-1 (Promega, Madison, WI) using the XbaI and SphI sites. Ablasticidin resistance gene cassette (Sutoh, 1993) of 1400 bp wasinserted into the BamHI site. The resulting plasmid was digestedwith EcoRI and HindIII to release the ifkB disruption cassette andthe digest was transformed into exponentially growing A� 4 cells.Transformants were selected as described (Singleton et al., 1998).Clonal isolates were obtained and disruption of the ifkB gene wasconfirmed by PCR. Multiple independent isolates were obtainedand they all possessed the same phenotype when developed understandard conditions. One of the clones (BS160) was used for thedouble disruption.For the double disruption, the blasticidin resistance gene cassette

in the ifkA and ifkB disruption constructs was replaced with thehygromycin resistance gene cassette. IfkA null cells (with blasticidinresistance gene) were transformed with the ifkB hygromycin resist-ance gene cassette for the disruption of the ifkB gene. IfkB null cells(with blasticidin resistance gene) were transformed with the ifkAhygromycin resistance gene cassette for the disruption of the ifkAgene. Several independent clones were obtained in each instanceand disruption of both the ifkA and ifkB genes was confirmed byPCR. All clones exhibited an identical altered phenotype as de-scribed in the results. For most experiments, the results are shownfor strain BS161.

584

Cell cohesion assay

Cell–cell adhesion during development was determined as described(Chia et al., 2005). Cells were harvested, washed free of bacteria,and resuspended in starvation buffer (20mM KCl, 5mM MgCl2,20mM potassium phosphate, pH 6.5, 0.5% streptomycin sulfate) at1� 107 cells/ml. Cells were shaken at 180 r.p.m. at 211C. At regulartime intervals aliquots were diluted to 3� 106 cells/ml in the samebuffer, and the number of single cells were counted. The percentageof cell aggregation was calculated as follows: [(number of singlecells at t0� number of single cells at tn)/number of single cells at T0]� 100, where t represents hours of starvation.

RT-PCR

RNA was isolated from growing cells and from cells at various timesafter the initiation of development using Trizol (Sigma, St. Louis,MO). RT-PCR was carried out as described (Pekovich et al., 1998). Inall RT-PCR reactions, oligonucleotides specific for the H7 gene wereused as an internal control as H7 mRNA is expressed at constantlevels during growth and all stages of development (Zhang, 1995).

Histochemical staining for b-galactosidase activity

LacZ constructs for the pre-stalk- and pre-spore-specific promotersecmA, ecmO, ecmAO, ecmB, and pspA were generously provided byK. Jermyn and J. Williams and were transformed into A� 4 andifkA/ifkB null cells by calcium phosphate precipitation. Wild-typecells marked by constitutively expressing b-galactosidase with theactin-15 promoter[A� 4-A15/lacZ (TL35)] were obtained from theDictyostelium Stock Center (http://www.dictybase.org/StockCen-ter/StockCenter.html), and were used for co-development experi-ments. A construct allowing expression of b-galactosidase with theactin 15 promoter was kindly supplied by K. Weijer and was usedfor marking of the ifkA/ifkB null cells for the co-development ex-periments. Bluo-gal (Sigma) staining of filter-developed cells wasperformed as described (Dingermann et al., 1989) with modifica-tions (Richardson et al., 1994).

In situ hybridization

An approximately 500 bp sequence complementary to the kinasedomain of both the ifkA and ifkB genes was amplified by PCR fromgenomic DNA and cloned into the T-easy vector (Promega). Dig-oxigenin (DIG)-labeled RNA was prepared using a DIG RNALabeling Mix (Roche, Nutley, NJ) as per the manufacturer’s in-structions with SP6 polymerase, and was used as the probe. A� 4,ifkA null and ifkB null cells were developed on hydrophilic filters(Millipore FHLC 02500, Billerica, MA) for different time intervalsto collect the various developmental stages. Developing entitieswere fixed, and in situ hybridization was performed as described(Kirsten et al., 2005).

Western analysis

Wild-type and ifkA/ifkB null cells were grown on bacterial platesfor 36–48 hr, and the cells were harvested and plated on nitrocel-lulose filters for development. Growing cells and cells developed for12 hr (mounds) were lysed, and total cellular protein was deter-mined. Twenty micrograms of protein from each lysate was frac-tionated on SDS-PAGE, and the expression level of the specificprotein was detected by Western analysis using the respective an-tibodies (Fang et al., 2003). Antibodies for Gp24, Gp80, and Gp150were kindly provided by Dr. C.-H. Siu and Dr. D. Blumberg.

Results

IfkA/ifkB null cells exhibit defective morphogenesis

Previously we reported on the subtle developmental de-fects for ifkA null cells (Fang et al., 2003). The ifkB genewas disrupted as described in Materials and methods,and we now report that this strain also demonstratesonly minimal morphological aberrations. While disrup-tion of the ifkB gene resulted in an overexpression ofmany pre-stalk-specific genes, it did not cause any vis-ible morphological defects except for an aberrant stalkstructure, with about 1/3–1/2 of the stalk lying on thesubstratum (data not shown). We reasoned that theremay be functional redundancies among the Ifk proteins,and thus we generated strains with both the ifkA andifkB genes disrupted. Doubly disrupted strains weregenerated starting from either the ifkA disruptedstrain (BS153) or the ifkB disrupted strain (BS160). In-dependent isolates were obtained in both cases, andall double null strains showed the same defectivephenotype.

IfkA/ifkB null cells grew normally in axenic mediumand with bacteria on plates. However, they exhibitedmorphological defects when deprived of nutrients andplated for development. Although the starved cells be-gan aggregating with normal timing, the aggregationstreams failed to break into individual aggregates as isseen in the wild-type strain. Instead cells streamed into alarge aggregate that subsequently gave on average fourto six attached mounds that developed as a cluster (Fig.1E). Single or multiple tips appeared for each moundwithin a cluster, and these formed normal sized fingers.However, the fingers within a cluster remained attachedto each other mostly at the base and lower portions,thus giving rise to a whorl pattern of attached fingers(Fig. 1F).

During the finger/slug transition, the fingers fell ontothe substratum and made elongated and deformed slugsas they tried but failed to pull away from the commonbase (Fig. 1G and pictures in subsequent figures). Asculmination began, many of the clumped second fingersbecame partially fused together and differentiated intoan irregular and entangled mass lacking proper stalksbut nonetheless containing some spores (Fig. 1H). Afew entities (10%) not in clumps were able to formfruiting bodies but with a shorter than normal stalk.When examined by microscopy, the ifkA/ifkB nullspores were smaller in size but refractile and elliptical inshape as are wild-type spores. The spores were heat anddetergent resistant, and they germinated and grew nor-mally when shaken in axenic media or when plated on abacterial lawn. The severe morphological defects of thedouble null strain, not seen in either of the single nullstrains, suggest that IfkA and IfkB are redundant insome functions and are necessary for proper morpho-genesis.

585

Previously we demonstrated that a lack of IfkA re-sulted in the loss of a normal, small increase in eIF2aphosphorylation during aggregation. For the ifkA/ifkBdouble null strain, eIF2a phosphorylation was the sameas that in wild-type cells after aggregation (not shown)even though this was the time when morphological de-fects became apparent in the mutant strain. However,ifkA and ifkB expression post-aggregation are spatiallyrestricted to a small number of cells. Given our exam-ination of eIF2a phosphorylation was on the entire de-veloping entities, it is unlikely that any phosphorylationdifferences in only 10%–20% of the cells would bedetected.

Spatial expression of ifkA and ifkB becomes restrictedto ALC and pstO cell lineages

Previous examination of temporal expression of ifkAand ifkB genes indicated that both were expressed ingrowing cells and, albeit at different levels, throughoutdevelopment (Fang et al., 2003). To examine the spatialexpression pattern of ifkA and ifkB mRNA, in situ hy-bridization was performed in the wild-type A� 4 (forexpression pattern of both), ifkA null (for expressionpattern of ifkB), and ifkB null (for expression pattern ofifkA) developing structures. This approach was takendue to the fact that ifkB is essentially identical in se-quence to ifkA except that it does not encode the pseu-dokinase domain and another domain of unknownfunction, both found at the amino terminus of IfkA.Thus, a probe specific for only ifkB cannot be made.Instead, a riboprobe complementary to the essentiallyidentical (99%) encoded kinase domain of ifkA andifkB mRNA was used in the in situ hybridizations withthe individual null strains, which show normal cell typepatterning using typical cell type markers.

During the mound stage, ifkA and ifkB mRNAshowed preferential expression in the basal region cor-responding to ALC and pstB cells (Figs. 2A, 2D, 2G).Within first fingers and slugs, ifkA mRNA was ex-pressed only in the pre-stalk region and was completelyabsent from the basal zone (Fig. 2E), whereas ifkBmRNA was expressed in the basal cells and corticallyalong the lower portion of the finger with faint but re-producible expression in the pre-stalk region (Fig. 2H).In culminants, ifkA mRNA was predominantly presentin the upper cup region (Fig. 2F), while ifkB mRNAwas expressed in both the upper and lower cups (Fig.2I). Interestingly, during culmination expression waslost in the rearguard/basal disc region. The ifkA andifkB genes thus display strongest expression in pre-stalkcell types, especially those derived from pstO and ALCcells.

Wild-type and ifkA/ifkB null cells do not distribute toall cell types when co-developed

Since ifkA and ifkB mRNA is preferentially expressedin cell types derived from pstO and ALC cells, synergyexperiments were done to analyze the differentiationpreference of ifkA/ifkB null cells during development.Differentiation preferences of mutant cells often can bededuced from the sorting pattern of mutant cells whenco-developed with wild-type cells (Blaschke et al., 1986).Ten percent of ifkA/ifkB null cells, expressing the vis-ualization marker b-galactosidase, were mixed with90% of wild-type cells and developed under standardconditions. IfkA/ifkB null cells sorted predominantly tothe basal region of mounds, first fingers, and slugs, witha few scattered cells in the pre-stalk region and corticalareas of the fingers/slugs (Figs. 3A,3B). During culmi-nation, the double null cells specifically sorted to the

Fig. 1 Developmental morphology of wild-type (A� 4) and ifkA/ifkB null strains. Cells were plated for development under standard

conditions. Mounds (A, E); first fingers (B, F); slugs (C, G); lateculminants (D, H).

586

upper cup region with a few cells in the lower cup andbasal disc of the culminant (Fig. 3C). In the reciprocalcombination (10% of marked A�4 cells mixed with90% ifkA/ifkB null cells), A� 4 cells sorted preferen-tially to the anterior of the mound (Fig. 3D). At the firstfinger/slug stage, A� 4 cells had moved to the anteriorpre-stalk region and to the boundary between the pre-stalk and pre-spore regions (Fig. 3E). Within theclumped culminants, A� 4 cells were found in thespore mass (Fig. 3F).

Developing ifkA/ifkB null cells show increased adhesion

In Dictyostelium, appropriate cell–cell and cell substrateadhesion is critical for efficient cell migration duringmorphogenesis. Altered cell adhesion may interfere withproper cell movement leading to aberrant morphogen-esis (Siu, 2004). Developing ifkA/ifkB null structuresappear to be more attached to the filters as compared

with the wild-type structures, and the entities are unableto separate from one another as development proceeds.To determine the extent of cell–substrate adherence ofthe ifkA/ifkB null cells, wild-type cells and ifkA/ifkBnull cells were developed on nitrocellulose filters to themound stage. Filters were vortexed for 3min to dislodgeunattached cells, and the percentage of cellular proteinleft on the filters, as a reflection of the number of at-tached cells, was determined. Total cellular protein wasmeasured from identically prepared filters that were notsubjected to vortexing and hence removal of unattachedcells. The difference between the protein levels found onthe two filter sets provides a measure of the relativeadhesion to the substrate of developing wild-type orifkA/ifkB null cells (Varney et al., 2002).

As shown in Figure 4A, at 12 hr of development(mound stage), about 13% of the plated ifkA/ifkB cellsremained adhered to the filters as compared with only7% of the wild-type cells. This indicates that the cell tosubstrate adhesion was approximately twofold higher indeveloping ifkA/ifkB null cells than in wild-type cellsand might be responsible in part for the aberrant mor-phology of the ifkA/ifkB nulls. An increased adhesionfor developing ifkA/ifkB null cells was further con-firmed by a cell–cell agglutination assay in which sub-stantially more cell clumping was noted in the starvedmutant cells (but not in growing cells) as compared withwild-type cells (Fig. 4B). When shaking cells werepulsed with cyclic adenosyl monophosphate (cAMP),clumping occurred earlier and was more severe, withvirtually all mutant cells forming a ‘‘film’’ of cells withinthe bottom of the shaking flask within 2 hr post-starvation.

We examined the timing and levels of mRNA ex-pression periodically out to 12 hr for the known celladhesion molecules gp24, gp80, and gp150 in the mu-tant cells, and no differences were seen when comparedwith the wild-type expression patterns (data not shown).Since IfkA/IfkB may regulate translation, we also in-vestigated the protein levels of the adhesion moleculesin ifkA/ifkB nulls. As seen in Figure 5A, the levels of allthree proteins in the mutant strain were comparablewith levels in the wild-type cells. Similarly, mRNA ex-pression of the ampA gene, encoding an anti-adhesiveprotein, was unaltered in the mutant strain (Fig. 5B).Additionally, no altered expression of any of theseknown cell adhesion molecules was found in the pulsingexperiment described above, even though pulsing re-sulted in early and severe clumping of the mutant cells(data not shown).

Co-development with wild-type cells rescues theaberrant morphology

Mutant cells with cell non-autonomous defects developwell when mixed with wild-type cells (Devreotes, 1994;

Fig. 2 Spatial expression pattern of ifkA and ifkB mRNA in de-veloping wild-type (A–C), ifkB null (D–F) and ifkA null cells (G–I).Cells were developed and structures at the mound (A, D, G); firstfinger (B, E, H); and late culminant (C, F, I) stages were analyzedby in situ hybridization using a probe complementary to the essen-tially identical kinase domain of the ifkA and ifkB genes. Labels tothe left of the panels refer to the fact that staining in the ifkB nullstrain results from hybridization to the ifkA mRNA while stainingin the ifkA null strain results from hybridization to the ifkBmRNA.Staining in A� 4 cells obviously is the combination of the twomRNAs.

587

Shaulsky et al., 1995; Shaulsky and Loomis, 1996; Yuand Saxe, 1996). To determine if the developmental de-fects observed in ifkA/ifkB nulls could be rescued byproviding a source of normal cells, ifkA/ifkB null cellswere mixed with different ratios of wild-type cells andallowed to co-develop. As seen in Figure 6, the presenceof 10% wild-type cells failed to rescue the morpholog-ical defects. Increasing the ratio of wild-type cells to25% gave significant reversal of the defects. At 25%wild-type cells, aggregates were more separated, fewerfingers and slugs remained attached to one another, anda substantial number of normal fruits were formed. In-creasing the percentage of wild-type cells to 50% com-pletely rescued the morphological defects of the ifkA/ifkB null strain, with a normal number of fruits formingwith a size comparable with that of wild type. Eventhough some fingers were initially attached at their bas-es, they were able to separate as slugs and form indi-vidual, normal fruits. Staining indicated mutant cellswere distributed throughout the fruits.

Spatial patterning is altered in developing ifkA/ifkB nullcells in favor of ALC/pstO cells

Since the ifkA/ifkB null strain showed defective culmi-nation, it was of interest to examine whether any par-ticular cell type was missing or disproportionate in themutant. To examine the spatial pattern of cell types indeveloping ifkA/ifkB null cells, the cells were trans-formed with vectors carrying cell type-specific promot-ers (ecmAO, ecmA, ecmO, ecmB, and pspA) driving lacZgene expression, and the resulting structures were

histochemically stained for b-galactosidase activity af-ter various times of development.

As expected, ecmAO, the full promoter of the ecmAgene, resulted in strong expression in pstA cells and to alesser extent in pstO cells and ALCs in the wild-typestrain, with the most abundant expression occurring inthe anterior 15% of the slug (Fig. 7). In contrast, ifkA/ifkB null fingers showed greater staining in the pstOregion as compared with the pstA region. Upon sub-sequent development, expression in the mutant strainprogressively extended from the pstO region toward theposterior of the fingers and covered most of theposterior region of the slug and terminal structures byculmination (Fig. 7).

The ecmA promoter is the proximal portion of thefull promoter for the ecmA gene, and as such it is a pre-stalk-specific promoter that is expressed in the anteriorpstA/AB domains (Jermyn et al., 1989). In the devel-oping ifkA/ifkB null fingers, significantly reduced levelsof staining were observed as compared with the wild-type cells (Fig. 7). By late fingers/early slugs, lowecmA::lacZ expression was seen mostly in the pstAB�

and pstO domains with a high degree of variability fromone entity to another. Therefore ecmA appears to besubstantially underexpressed and mis-regulated in theifkA/ifkB mutant strain.

The ecmO promoter is the distal portion of the fullpromoter for the ecmA gene, and as such it is a pre-stalk-specific promoter that is expressed in ALCs andpre-stalk O cells (Jermyn et al., 1989). Developingmounds of ifkA/ifkB null cells showed earlier than nor-mal and apparent overexpression of ecmO::lacZ (notshown). By first fingers, expression was not only evidentin the pstO domain, but significant expression occurred

Fig. 3 Synergy experiments with wild-type and ifkA/ifkB null cells.Vegetative cells tagged with lacZ were mixed with untagged cells ina 1:9 ratio and allowed to co-develop to form chimeric organisms

which were histochemically stained for b-galactosidase activity atthe mound (A, D), slug (B, E), and culminant stages (C, F).

588

anteriorly within regions normally occupied by pstAcells (except for the very tip) and posteriorly toward thepre-spore domain (Fig. 7). In the terminal structures,heavy staining was observed throughout except at thevery tips (not shown). The staining pattern withecmO::lacZ suggests that ecmO was being induced ear-ly and was significantly overexpressed, and pre-sporecells were either dedifferentiating or transdifferentiatinginto ecmO-expressing cells (ALCs) during later stages ofdevelopment.

ecmB is a pre-stalk-specific promoter that is ex-pressed in the pstAB core as a centralized cone of cellsand, to a lesser degree, in ALCs (Jermyn et al., 1989).During culmination, it is expressed in the stalk tube andthe basal disc cells in wild-type cells. In the ifkA/ifkBnull strain, ecmB::lacZ expression began at the normal

time, i.e. in the slugs, but consistently with an inversionof the cone relative to that in wild-type cells (Fig. 7).During culmination, ecmB::lacZ expression becamerandom with the strongest staining localized to regionsthat apparently represented attempts at stalk formationand to random patches within the ‘‘spore mass’’ of theaberrant terminal structures (not shown).

pspA is a pre-spore-specific promoter that is ex-pressed in the posterior pre-spore domain in the wild-type fingers/slugs and in the sorus of the fruiting bodies.In the ifkA/ifkB null strain, pspA::lacZ expression cameup normally at the tipped mound stage, but by the firstfinger and slug stages, expression in the pre-spore do-main appeared to retract posteriorly with time, with lessthan 50% of cells in the slug expressing pspA::lacZ(Fig. 7). By the late slug/second finger stage, the regionof expression was further reduced to the extreme pos-terior of the slug/second fingers. During culmination,clumps showed patchy and reduced lacZ expression inthe ‘‘spore mass’’ regions (data not shown). The stain-ing pattern with pspA::lacZ in the ifkA/ifkB null strainconfirmed the apparent loss of pre-spore cells, presum-ably to ALC/pstO cells, during the later times ofdevelopment.

Spatial and temporal expression of the cell type-spe-cific markers in the ifkA and ifkB single null strainswere essentially identical to that in the parental wild-type strain.

STATc is nuclear localized in growing ifkA/ifkB nullcells

During the finger/slug stage, differentiation inducingfactor (DIF-1) induces the nuclear localization ofSTATc in pstO cells, ALCs, and rearguard cells, butnot in pstA cells (Fukuzawa et al., 2001). STATc is oneof the Dictyostelium Signal Transducer and Activator ofTranscription proteins and is a negative regulator of theproximal promoter of the ecmA gene (Fukuzawa et al.,2001). As the ifkA/ifkB null strain exhibited significant-ly decreased ecmA::lacZ expression, we examined thestatus of nuclear translocation of STATc in ifkA/ifkBnull cells transformed with a STATc:GFP construct.When growing cells first are made competent to respondto DIF by starvation and shaking in phosphate bufferfor 4 hr and then exposed to DIF-1, tyrosine phospho-rylation, and transitory nuclear localization of endog-enous STATc and the GFP fusion is induced(Fukuzawa et al., 2003). For the GFP fusion, nuclearlocalization is easily detected because of the greatly en-hanced fluorescence upon its concentration within thenucleus (Fukuzawa et al., 2003).

Surprisingly, about 80% of the growing ifkA/ifkBnull cells already showed persistent nuclear localizationof STATc:GFP before any starvation or DIF-1 expo-sure (Fig. 8). In stark contrast, very little fluorescence

Fig. 4 Adhesion properties of wild-type and ifkA/ifkB null cells. (A)Cell–substrate adhesion during development in wild-type and ifkA/ifkB null cells. A� 4 and ifkA/ifkB null cells were plated onto ni-trocellulose filters for development. At the mound stage, one set offilters was vortexed for 3min in conical tubes containing starvationbuffer in order to remove cells not attached to the filter. The proteinremaining on the filters, as an indicator of the number of attachedcells, was determined. To determine the total number of attachedand detached cells as reflected by protein levels, identical filters wereassayed, omitting the vortexing step. The data shown is the averageof two independent experiments each performed with triplicatesamples with the mean standard error shown. (B) Cell cohesionduring development in wild-type and ifkA/ifkB null cells. Singlecells in each strain were scored at the indicated time point and thepercentage of aggregated cells was determined by comparison of theremaining single cells to the starting number of cells. The datashown is the average of two independent experiments with the meanstandard error shown.

589

was seen, as expected, with growing wild-type cells.When the wild-type cells were plated on filters and al-lowed to develop, fluorescence was observed corre-sponding to the typical pattern of nuclear localizationof STATc, with fluorescence initially being seen in fin-gers/slugs and only within pstO and ALC cells and laterbeing restricted to the upper and lower cup regions ofthe culminant (not shown). In the developing mutantcells, intense (nuclear) fluorescence was seen through-out aggregation, mounds, and first fingers. During sub-sequent development fluorescence intensity declinedover time. Transformants possessing a non-phospho-rylatable STATc:GFP (Y to F mutant, Fukuzawaet al., 2001) showed no nuclear localization ineither strain, indicating that the localization seen ingrowing ifkA/ifkB null cells is dependent on tyrosinephosphorylation.

DIF is produced by developing (pre-spore) cells andnot in growing cells (Kay and Thompson, 2001), andgrowing cells are not competent to respond to DIF(Fukuzawa et al., 2001). In addition, the persistent nu-clear localization of STATc in growing mutant cells wasobserved in cells washed and placed at low cell titer intonew cultures. Thus, it seems unlikely that DIF is thecause for the nuclear localization of Dd-STATc in thegrowing mutant cells. Nuclear localization of STATcalso is known to be induced by various stresses (Araki

et al., 2003). We ruled out a stress-induced response ingrowing mutant cells by showing no enhanced expres-sion of the gapA gene in ifkA/ifkB null cells (data notshown). Induction of gapA occurs during stress and isdependent on stress-induced nuclear localization ofSTATc but not DIF-induced nuclear STATc (Arakiet al., 2003).

IfkA/ifkB null cells are unresponsive to exogenous DIFin vitro

DIF is a prime morphogen considered to be involved inpre-stalk and pre-spore cell differentiation in developingDictyostelium cells (Morris et al., 1987). DIF-1 is re-quired for the differentiation of pstO cells and regulatesthe ratio of pstO to pre-spore cells in the aggregates(Thompson and Kay, 2000). IfkA/ifkB null cells showedearly induction of ecmO expression and a significantlyenlarged pstO domain. It was therefore of interest toexamine the DIF sensitivity of the ifkA/ifkB mutantcells. Firstly, DIF-1 responsiveness of ifkA/ifkB nullcells was tested in a monolayer assay in which differ-entiation is uncoupled from morphogenesis. In themonolayer assay, ifkA/ifkB null cells produced essen-tially no vacuolated stalk cells even after 48 hr of incu-bation with 50 nM DIF-1, whereas the wild-type cells

Fig. 5 Expression levels of adhesion and anti-adhesion molecules inwild-type and the ifkA/ifkB null strain. (A) Cells from both strainswere plated for development, and total protein was isolated at theindicated time in hours (0, growing cells). Twenty micrograms ofthe cellular protein was loaded in each well. Western analysis, using

anti-Gp24 antisera, anti-Gp80 antisera and anti-Gp150 antiserawas performed. (B) Total RNA was isolated from cells developedon filters for 0, 4, 8, and 12 hr. RT-PCR was carried out usingoligonucleotides specific for the ampA gene. H7-specific oligonuc-leotides were used as an internal control.

Fig. 6 Co-development with wild-type cells rescues the morpholog-ical defects of the ifkA/ifkB null cell strain. IfkA/ifkB null cells weremixed with different numbers of wild-type cells and allowed to co-

develop on filters for 24 hr. (A) Ten percent wild type; (B) 25% wildtype; (C) 50% wild type.

590

differentiated as stalk cells under these conditions (datanot shown). The lack of stalk cell formation in vitro isconsistent with the absence of stalk cells in the termi-nally developed structures of the double null strain.

Changes in pre-stalk gene expression were analyzedin response to DIF-1 to further examine the sensitivityof the double null strain to DIF. DIF-1 is known toinduce the expression of certain pre-stalk genes in cellsdissociated from multicellular aggregates (Mohantyet al., 1999). IfkA/ifkB null cells and wild-type cellswere developed to the mound stage, dissociated, andshaken in suspension with 50 nM of DIF-1. RNA was

isolated at various time points to analyze DIF inducedpre-stalk gene expression. The ecmA, cudA, and aslAgenes were induced in wild-type cells by 2 hr (notshown) and remained so out to at least 8 hr of DIFtreatment (Fig. 9A). Under the same conditions, ifkA/ifkB null cells showed no DIF induction of these genesover the 8 hr incubation, suggesting that the mutantcells were unresponsive to DIF under the given condi-tions. In contrast, ifkA/ifkB null cells showed margin-ally increased or comparable levels (to wild type)of induction of these genes when developed on filtersunder standard conditions (Fig. 9B).

Discussion

The severe morphological aberrations and altered ad-hesion and patterning seen in developing ifkA/ifkB nullcells are in agreement with the temporal and spatialexpression pattern of the ifkA and ifkB genes and sug-gest a role for IfkA and IfkB in morphogenesis duringDictyostelium development. As the disruption individ-ually of the ifkA gene or the ifkB gene showed onlysubtle morphological defects, ifkA and ifkB appear tobe mostly redundant in their functions. The two un-covered defects that may account for the morphologicaland patterning aberrations of the ifkA/ifkB null strainare the enhanced adhesion of the developing mutantcells and the nuclear localization of STATc in growingand early developing mutant cells.

The severe morphological defects of clumpedmounds, multiple fingers attached at the base, slugsunable to pull away from one another, and fusion of thestructures during defective culmination leading to dis-torted terminal structures are phenotypes consistent

Fig. 7 Spatial patterning during development of wild-type andifkA/ifkB null cells. Wild-type cells (WT) and ifkA/ifkB null cells(A� /B� ) were transformed with lacZ constructs with various celltype-specific promoters driving its expression (ecmA, ecmO, ec-mAO, ecmB, and pspA). Cells were allowed to develop on filters andwere stained after fixation at the first finger and slug stages. ForifkA/ifkB null cells transformed with ecmO::lacZ, staining was for amuch shorter period due to the greatly enhanced levels of expres-sion. IfkA/ifkB insets show staining times equal to that of the wild-type panels for direct comparisons. Arrows indicate the strongerstaining within the pstA region of wild type, and contrastinglywithin the pstO region of the mutant for the ecmAO panels.

Fig. 8 Nuclear localization of Dd-STATc in growing ifkA/ifkB nullcells. A� 4 and ifkA/ifkB null cells were transformed with the Dd-STATc: GFP fusion construct and grown in axenic medium. Lightmicroscopy (A, C); fluorescence microscopy (B, D). DAPI stainingconfirmed the fluorescence in panel D was nuclear localized.

591

with the enhanced adhesiveness of the null cells. TheifkA/ifkB null cells acquired enhanced and greater thannormal cell–cell and cell–substrate adhesion within thefirst several hours post-starvation. Nonetheless, none ofthe known adhesion or anti-adhesion proteins involvedin regulating cell–cell and cell–substrate adhesion werefound to be overexpressed or underexpressed in devel-oping ifkA/ifkB null cells. This suggests an unknownadhesion mechanism(s) is altered in the absence of IfkAand IfkB. Many of the defects seem attributable tooverly adhesive basal and cortical regions of mounds,fingers, and slugs, consistent with the spatial expressionof ifkA and ifkB in these regions during these stages.Even so, all of the null cells showed enhanced adhesionwhen starved and shaken in suspension, especially whenexogenous cAMP was added to mimic the normalcAMP pulses. Even though the enhanced adhesion thusseems be present for all cells and throughout develop-ment, it only results in problems for certain cell typesand/or at certain stages or times of development.

That altered adhesion of the mutant cells may be re-sponsible for the observed morphological defects isconsistent with the progressive rescue of the defects ashigher wild-type cell numbers were included in the mix-ing experiments. One possibility is that the wild-typecells were producing a secreted factor(s) that modulatesadhesion, analogous to AmpA (Varney et al., 2002).Another possibility is that in the cell agglomeratescomposed of wild-type and mutant cells, a ‘‘reduction’’in adhesion was brought about indirectly by the pres-ence of increasing numbers of contacted/neighboringwild-type cells with their lower level of adhesiveness.The resulting dilution of total adhesion may have al-lowed the developing structures to pull away from eachother and allowed proper cell migration within themulticellular entities to give normal culmination,including stalk formation.

Cell type proportioning and patterning was altered inthe developing ifkA/ifkB null strain. The ifkA/ifkB nullcells displayed large shifts in favor of ALC/pstO celltypes as opposed to the normally constant cell typeproportions seen in wild-type cells. The ifkA/ifkB nullstrain differentiated to give considerably more cells thannormal that express the ecmA gene using the distal re-gion of its promoter (ecmO expression) and much fewercells than normal that express the ecmA gene using theproximal region of its promoter within mounds andthrough second fingers. The ecmO-expressing cells ‘‘in-truded’’ into the pre-spore and pstA domains, exceptwithin the extreme tip and the very rear of the slugs/second fingers. From first fingers through slugs andsecond fingers, the number of cells expressing ecmOprogressively increased and spread from the pstO do-main toward the rear of the finger/slug. Concomitantly,there was a loss of pre-spore (pspA-expressing) cells.Normally slug migration requires a cell type transdif-ferentiation from pre-spore to ALC to pstO cells to re-plenish the small numbers of pre-stalk cells that aresloughed off during migration (Sternfeld and David,1982; Sternfeld, 1992; Abe and Maeda, 1994; Bichlerand Weijer, 1994). The progressive reduction in pspA-expressing cells and the increase in ecmO-expressingcells may reflect an overly active transdifferentiationpathway in the double null cells.

In addition, during normal culmination there is aconversion of pstO cells to pstA cells as the pstA cellpopulation enters the growing stalk tube and matureinto stalk cells (Jermyn et al., 1989; Early et al., 1993).In the double null strain, this process seems not to occuras stalks do not form. In addition, the anterior pstAdomain is typically defined by cells expressing ecmA.Cells in this domain within the double null fingers/slugsmostly were not expressing ecmA::lacZ while some, butnot the very most tip cells, were initially expressing

Fig. 9 Expression levels of DIF-1 inducible genes in wild-type andifkA/ifkB null cells. (A) RNA was isolated from cells that weredeveloped on filters to the mound stage (0) and then shaken for 8 hrwithout (8) or with DIF-1 (81). RT-PCR was carried out usingoligonucleotides specific for each gene (band shown by arrow). H7-specific oligonucleotides were used as an internal control (lowerband in each panel). RNA detected by RT-PCR using the ecmAgene-specific primers is derived from the combined expression from

the ecmA and ecmO (ecmAO) promoters. EcmA is the prototypicalDIF inducible gene, while to our knowledge this is the first dem-onstration of DIF induction of aslA and cudA. (B) Total RNA wasisolated from cells developed on filters for the times indicated (inhours). RT-PCR was carried out using oligonucleotides specific foreach gene (upper band in each panel). H7-specific oligonucleotideswere used as an internal control (lower band in each panel).

592

ecmO::lacZ and continued to do so as developmentprogressed.

These results are suggestive of a role for IfkA andIfkB in cell type proportioning and/or patterning viaregulating the proportion of ALC/pstO cell types dur-ing development. In Dictyostelium, patterning resultsfrom differential cell movements that require optimaland presumably differential cell–cell and cell–substrateadhesion (Williams and Jermyn, 1991; Doolittle et al.,1995; Early et al., 1995; Rietdorf et al., 1996; Clowet al., 2000; Dormann et al., 2000; Thompson et al.,2004), and the cell to cell contacts are in part respon-sible for inducing and maintaining the levels ofpre-spore and pre-stalk-specific gene expression. Thusthe altered adhesion properties of the developingmutant cells may interfere with cell sorting of variouscell types and at different stages, leading to theobserved altered spatial patterning along with defectivemorphogenesis. For example, proper stalk formationrequires posterior migration of the pstAB core cellsafter formation of the initial, cone-shaped pstABzone (Shimada et al., 2005). In the ifkA/ifkB mutantstrain, the pstAB cone was formed but in an invertedposition. Aberrant and incompletely formed stalk-likestructures were subsequently generated, and perhapsthe altered adhesion of the cells prevented normalmigration of the pstAB core cells and hence proper stalkformation.

DIF-1 functions in the differentiation of pstO cells,and in mutants lacking DIF-1 there is a dramatic re-duction in ecmO-expressing cells (Thompson and Kay,2000). Given the enhanced ecmO expression and for-mation of ALC/pstO cell types in developing ifkA/ifkBnull cells, we examined the DIF sensitivity of the mu-tant cells. In contrast to what might be expected, themutant cells were relatively resistant to DIF-1 inductionof stalk cell formation and to induction of pre-stalkgene expression. However, other work has shown thatwhile often informative, the in vitro DIF assay can giveresults that are inconsistent or contrary to in vivo ob-servations (Kimmel and Firtel, 2004; Zhukovskayaet al., 2006). The possibility of increased DIF produc-tion in the developing mutant strain remains to beexamined.

The precocious and persistent localization of STATcwithin the nucleus of growing ifkA/ifkB null cells maycontribute to the observed altered cell patterning andcell type proportions. STATc null strains show aberrantpstO differentiation and implicate STATc as a negativeregulator of spatial patterning and cell type-specificgene expression (Fukuzawa et al., 2001). NormallySTATc is localized to the nucleus of only pstO cell typesand ALCs in fingers and slugs, and its absence inSTATc null cells results in enhanced expression of thepstA marker ecmA::lacZ in pstO cells. Precociousand ectopic nuclear STATc thus may account forthe substantial reduction in expression of ecmA::lacZ

within the developing double null cells. In addition, thenuclear localization of STATc in all cells of the nullstrain at the onset of development and throughout ag-gregation and finger formation may predispose the cellsto differentiate into cell types expressing ecmO (pstO,ALC) once other conditions are met during these stages.If so, this suggests that STATc functions more prom-inently in pstO cell differentiation than previouslyappreciated.

Given the paucity of information on genes regulatedby STATc, discussion of a possible causal relation be-tween the enhanced adhesion and the precocious nu-clear localization of STATc in ifkA� /ifkB� remainsspeculative. In addition to STATc normally being lo-calized to the nucleus in pstO cells and ALCs, later indevelopment it is normally found only in the nucleus ofupper and lower cup cells that are derived from pstO/ALCs. These cell types may require an adhesion systemthat helps maintain their positional integrity. Addition-ally, it has been suggested that ALCs and upper cupcells secrete adhesive substances that pull spores up thedeveloping stalk (Sternfeld, 1998a, 1998b). PerhapsSTATc normally plays a role in expressing genes in-volved in these presumptive adhesive systems, and itsubiquitous and ectopic presence in the nucleus of thedouble null cells, once some level of developmentalcompetency has been attained, may contribute to thealtered adhesive properties of the mutant cells.

STATs are activated by tyrosine phosphorylationand dimerization, a trigger to induce nuclear translo-cation for their biological activity (Milocco et al., 1999).Nuclear localization of STATc in Dictyostelium is typ-ical in that it requires phosphorylation and dimerizat-ion, and dimerization is thought to mask a nuclearexport signal (Fukuzawa et al., 2003). Two triggers ofnuclear localization of STATc are known, certainstresses and DIF-1, but the mechanism of how stressor DIF-1 activate tyrosine phosphorylation remainsunknown (Fukuzawa et al., 2001; Araki et al., 2003).The lack of induction of the gapA gene, a STATc-stressmarker (Araki et al., 2003), ruled out stress inductionaccounting for nuclear localization in the double nullcells. As DIF is not synthesized in growing cells (Kayand Thompson, 2001) and as growing cells are not re-sponsive to DIF (Fukuzawa et al., 2001), it seems likelythat nuclear localization of STATc in growing ifkA/ifkBnull cells is due either to a DIF-independent mechanismor the lack of IfkA and IfkB bypasses the need for DIF.Possession of a mutant strain that alters the normallocalization of STATc to the nucleus provides a usefultool to investigate the mechanism that initiates locali-zation.

Acknowledgments This work was supported by the NSF(0234254). We thank Bruce Appel for the use of his Olympus com-pound microscope. We also thank Jeff Williams, Keith Jermyn,Masashi Fukuzawa, Daphne Blumberg, and Chi-Hung Siu forproviding plasmids and antibodies.

593

References

Abe, F. and Maeda, Y. (1994) Precise expression of the cAMPreceptor gene, car1, during transition from growth to differen-tiation in Dictyostelium discoideum. FEBS Lett. 342:239–241.

Abe, T., Early, A., Siegert, F., Weijer, C. and Williams, J. (1994)Patterns of cell movement within the Dictyostelium slug revealedby cell type-specific, surface labeling of living cells. Cell 77:687–699.

Alton, T.H. (1977) Regulation of protein synthesis during devel-opment of the cellular slime mold Dictyostelium discoideum.Massachusetts Institute of Technology (MIT), Cambridge, MA.

Anjard, C., Zeng, C., Loomis, W.F. and Nellen, W. (1998) Signaltransduction pathways leading to spore differentiation inDictyostelium discoideum. Dev Biol 193:146–155.

Araki, T., Tsujioka, M., Abe, T., Fukuzawa, M., Meima, M.,Schaap, P., Morio, T., Urushihara, H., Katoh, M., Maeda, M.,Tanaka, Y., Takeuchi, I. and Williams, J.G. (2003) A STAT-regulated, stress-induced signaling pathway in Dictyostelium. JCell Sci 116:2907–2915.

Bichler, G. and Weijer, C.J. (1994) A Dictyostelium anterior-likecell mutant reveals sequential steps in the prespore prestalkdifferentiation pathway. Development 120:2857–2868.

Blaschke, A., Weijer, C. and MacWilliams, H. (1986) Dictyosteliumdiscoideum: cell-type proportioning, cell-differentiation prefer-ence, cell fate, and the behavior of anterior-like cells in Hs1/Hs2and G1/G� mixtures. Differentiation 32:1–9.

Bonner, J.T. (1957) A theory of the control of differentiation in thecellular slime molds. Quart Rev Biol 32:232–246.

Braga, V. and Harwood, A.J. (2001) Super glue. Nat Cell Biol3:E168–E170.

Casademunt, E., Varney, T.R., Dolman, J., Petty, C. and Blumb-erg, D.D. (2002) A gene encoding a novel anti-adhesive protein isexpressed in growing cells and restricted to anterior-like cellsduring development of Dictyostelium. Differentiation 70:23–35.

Chia, C.P., Gomathinayagam, S., Schmaltz, R.J. and Smoyer, L.k.(2005) Glycoprotein gp130 of Dictyostelium discoideum influenc-es macropinocytosis and adhesion. Mol Biol Cell 16:2681–2693.

Clow, P.A., Chen, T.L.L., Chisholm, R.L. and McNally, J.G.(2000) Three-dimensional in vivo analysis of Dictyosteliummounds reveals directional sorting of prestalk cells and definesa role for the myosin II regulatory light chain in prestalk cellsorting and tip protrusion. Development 127:2715–2728.

Coates, J.C. and Harwood, A.J. (2001) Cell–cell adhesion and sig-nal transduction during Dictyostelium development. J Cell Sci114:4349–4358.

Dever, T., Feng, T., Wek, R., Cigan, A., Donahue, T. and Hi-nnebusch, A. (1992) Phosphorylation of initiation factor 2a byprotein kinase GCN2 mediates gene-specific translational controlof GCN4 in yeast. Cell 1992:585–596.

Devine, K.M. and Loomis, W.F. (1985) Molecular characterizationof anterior-like cells in Dictyostelium discoideum. Dev Biol107:364–372.

Devreotes, P.N. (1994) G protein-linked signaling pathways controlthe developmental program of Dictyostelium. Neuron 12:235–241.

Dimilla, P.A., Stone, J.A., Quinn, J.A., Albelda, S.M. and Lauf-fenburger, D.A. (1993) Maximal migration of human smoothmuscle cells on fibronectin and type IV collagen occurs at anintermediate attachment strength. J Cell Biol 122:729–737.

Dingermann, T., Reindl, N., Werner, H., Hildebrandt, M., Nellen,W., Harwood, A., Williams, J. and Nerke, K. (1989) Optimiza-tion and in situ detection of Escherichia coli beta-galactosidasegene expression in Dictyostelium discoideum. Gene 85:353–362.

Doolittle, K.W., Reddy, I. and McNally, J.G. (1995) 3D analysis ofcell movement during normal and myosin-II-null cell morpho-genesis in Dictyostelium. Dev Biol 167:118–129.

Dormann, D., Siegert, F. and Weijer, C.J. (1996) Analysis of cellmovement during the culmination phase of Dictyostelium devel-opment. Development 122:761–769.

Dormann, D., Vasiev, B. and Weijer, C.J. (2000) The control ofchemotactic cell movement during Dictyostelium morphogenesis.Phil Trans Roy Soc Lond B 355:983–991.

Dynes, J.L., Clark, A.M., Shaulsky, G., Kuspa, A., Loomis, W.F.and Firtel, R.A. (1994) LagC is required for cell–cell interactionsthat are essential for cell-type differentiation in Dictyostelium.Genes Dev 8:948–958.

Early, A., Abe, T. and Williams, J. (1995) Evidence for positionaldifferentiation of prestalk cells and for a morphogenetic gradientin Dictyostelium. Cell 83:91–99.

Early, A.E., Gaskell, M.J., Traynor, D. and Williams, J.G. (1993)Two distinct populations of prestalk cells within the tip of themigratory Dictyostelium slug with differing fates at culmination.Development 118:353–362.

Fang, R., Xiong, Y. and Singleton, C.K. (2003) IfkA, a presump-tive eIF2alpha kinase of Dictyostelium, is required for propertiming of aggregation and regulation of mound size. BMC DevBiol 3:3.

Fukuzawa, M., Abe, T. and Williams, J.G. (2003) The Di-ctyostelium prestalk cell inducer DIF regulates nuclear accumu-lation of a STAT protein by controlling its rate of export fromthe nucleus. Development 130:797–804.

Fukuzawa, M., Araki, T., Adrian, I. and Williams, J.G. (2001)Tyrosine phosphorylation-independent nuclear translocation of aDictyostelium STAT in response to DIF signaling. Mol Cell7:779–788.

Gao, E.N., Shier, P. and Siu, C.H. (1992) Purification and partialcharacterization of a cell adhesion molecule (gp150) involved inpostaggregation stage cell–cell binding in Dictyostelium discoid-eum. J Biol Chem 267:9409–9415.

Harding, H., Novoa, I., Zhang, Y., Zeng, H., Wek, R., Schapira,A.M. and Ron, D. (2000) Regulated translation initiation con-trols stress-induced gene expression in mammalian cells. Mol Cell6:1099–1108.

Hinnenbusch, A. (1996) Translational control of GCN4: Gene-specific regulation by phosphorylation of eIF-2. In TranslationalControl, Hershey, J., Mathews, M. and Sonenberg, N. eds. ColdSpring Harbor Laboratory Press, Cold Spring Harbor, NY, 199–244.

Jermyn, K., Traynor, D. and Williams, J. (1996) The initiation ofbasal disc formation in Dictyostelium discoideum is an early eventin culmination. Development 122:753–760.

Jermyn, K.A., Duffy, K.T. and Williams, J.G. (1989) A newanatomy of the prestalk zone in Dictyostelium. Nature 340:144–146.

Kamboj, R.K., Lam, T.Y. and Siu, C.-H. (1990) Regulation of slugsize by the cell adhesion molecule gp80 in Dictyostelium discoid-eum. Cell Regulation 1:715–729.

Kay, R.R. and Thompson, C.R.L. (2001) Cross-induction of celltypes in Dictyostelium: evidence that DIF-1 is made by presporecells. Development 128:4959–4966.

Kimmel, A. and Firtel, R. (2004) Breaking symmetries: regula-tion of Dictyostelium development through chemoattractantand morphogen signal-response. Curr Opin Genet Dev 14:540–549.

Kirsten, J., Xiong, Y., Dunbar, A., Rai, M. and Singleton, C.(2005) Ammonium transporter C of Dictyostelium discoideum isrequired for correct prestalk gene expression and for regulatingthe choice between slug migration and culmination. Dev Biol287:146–156.

Knecht, D.A., Fuller, D.L. and Loomis, W.F. (1987) Surfaceglycoprotein, gp24, involved in early adhesion of Dictyosteliumdiscoideum. Dev Biol 121:277–283.

Konijn, T.M., van de Meene, J.G.C., Bonner, J.T. and Barkley,D.S. (1967) The acrasin activity of adenosine-30,50-cyclic phos-phate. Proc Natl Acad Sci USA 58:1152–1154.

Margolskee, J.P., Froshauer, S., Skrinska, R. and Lodish, H.F.(1980) The effects of cell density and starvation on early devel-opmental events in Dictyostelium discoideum. Dev Biol 74:409–421.

594

Margolskee, J.P. and Lodish, H.F. (1980) The regulation of thesynthesis of actin and two other proteins induced early inDictyostelium discoideum development. Dev Biol 74:50–64.

Marin, F.T. (1976) Regulation of development in Dictyosteliumdiscoideum: I. Initiation of the growth to developmental transi-tion by amino acid starvation. Dev Biol 48:110–117.

Marin, F.T. (1977) Regulation of development in Dictyostelium dis-coideum: II. Regulation of early cell differentiation by amino acidstarvation and intercellular interaction. Dev Biol 60:389–395.

Milocco, L.H., Haslam, J.A., Rosen, J. and Seidel, H.M. (1999)Design of conditionally active STATs: insights into STAT acti-vation and gene regulatory function. Mol Cell Biol 19:2913–2920.

Mohanty, S., Jermyn, K.A., Early, A., Kawata, T., Aubry, L.,Ceccarelli, A., Schaap, P., Williams, J.G. and Firtel, R.A. (1999)Evidence that the Dictyostelium Dd-STATa protein is a repressorthat regulates commitment to stalk cell differentiation and is alsorequired for efficient chemotaxis. Development 126:3391–3405.

Morris, H.R., Taylor, G.W., Masento, M.S., Jermyn, K.A. andKay, R.R. (1987) Chemical structure of the morphogen differ-entiation inducing factor from Dictyostelium discoideum. Nature328:811–814.

Nellen, W., Silan, C. and Firtel, R. (1984) DNA-mediatedtransformation in Dictyostelium discoidium. Regulated expres-sion of an actin gene fusion. Mol Cell Biol 4:2890–2898.

Pekovich, S.R., Martin, P.R. and Singleton, C.K. (1998) Thiaminedeficiency decreases steady-state mRNA levels for transketolaseand pyruvate dehydrogenase but not for a-ketoglutarate de-hydrogenase in three human cell types. J Nutr 128:683–687.

Richardson, D.L., Loomis, W.F. and Kimmel, A.R. (1994) Pro-gression of an inductive signal activates sporulation in Di-ctyostelium discoideum. Development 120:2891–2900.

Rietdorf, J., Siegert, F. and Weijer, C.J. (1996) Analysis of opticaldensity wave propagation and cell movement during mound for-mation in Dictyostelium discoideum. Dev Biol 177:427–438.

Sesaki, H. and Siu, C.H. (1996) Novel redistribution of the Ca21-dependent cell adhesion molecule DdCAD-1 during developmentof Dictyostelium discoideum. Dev Biol 177:504–516.

Shaulsky, G., Kuspa, A. and Loomis, W.F. (1995) A multidrugresistance transporter serine protease gene is required for prestalkspecialization in Dictyostelium. Genes Dev 9:1111–1122.

Shaulsky, G. and Loomis, W.F. (1996) Initial cell type divergencein Dictyostelium is independent of DIF-1. Dev Biol 174:214–220.

Shimada, N., Maruo, T.M.M., Urushihara, H. and Kawata, T.(2005) Evidence that the Dictyostelium STAT protein Dd-STATaplays a role in the differentiation of inner basal disc cells andidentification of a promoter element essential for expression inthese cells. Differentiation 73:50–60.

Singleton, C.K. (1989) Nucleotide sequence of VI, a ribosomalprotein gene from Dictyostelium discoideum. Nucleic Acids Res17:7989.

Singleton, C.K., Delude, R.L. and McPherson, C.E. (1987)Characterization of genes which are deactivated upon the onsetof development in Dictyostelium discoideum. Dev Biol 119:433–441.

Singleton, C.K., Zinda, M.J., Mykytka, B. and Yang, P. (1998) Thehistidine kinase DhkC regulates the choice between migratingslugs and terminal differentiation in Dictyostelium discoideum.Dev Biol 203:345–357.

Siu, C.-H. (2004) Regulation of cell–cell adhesion during Di-ctyostelium development. Semin Cell Dev Biol 15:633–641.

Siu, C.-H., Cho, A. and Choi, H.C. (1987) The contact site Aglycoprotein mediates cell–cell adhesion by homophilic bindingin Dictyostelium discoideum. J Cell Biol 105:2523–2533.

Sternfeld, J. (1992) A study of pstB cells during Dictyostelium mi-gration and culmination reveals a unidirectional cell type con-version process. W R Arch Dev Biol 201:354–363.

Sternfeld, J. (1998a) The anterior-like cells in Dictyostelium are re-quired for the elevation of the spores during culmination. DevGenes Evol 208:487–494.

Sternfeld, J. (1998b) The anterior-like cells in Dictyostelium arerequired for the elevation of the sporduring culmination. DevGenes Evol 208:487–494.

Sternfeld, J. and David, C.N. (1982) Fate and regulation of ante-rior-like cells in Dictyostelium slugs. Dev Biol 93:111–118.

Sutoh, K. (1993) A transformation vector for Dictyosteliumdiscoideum with a new selectable marker bsr. Plasmid 30:150–154.

Thompson, C.R.L. and Kay, R.R. (2000) The role of DIF-1 signa-ling in Dictyostelium development. Mol Cell 6:1509–1514.

Thompson, C.R.L., Reichelt, S. and Kay, R.R. (2004) A demon-stration of pattern formation without positional information inDictyostelium. Dev Growth Differ 46:363–369.

Varney, T.R., Casademunt, E., Ho, H.N., Petty, C., Dolman, J.and Blumberg, D.D. (2002) A novel Dictyostelium gene encodingmultiple repeats of adhesion inhibitor-like domains has effects oncell–cell and cell–substrate adhesion. Dev Biol 243:226–248.

Williams, J. and Jermyn, K. (1991) Cell sorting and positionaldifferentiation during Dictyostelium morphogenesis. In: Ger-hardt, J. ed. Cell–Cell Interactions in Early Development. Wiley,New York.

Yu, Y.M. and Saxe, C.L. III (1996) Differential distribution ofcAMP receptors cAR2 and cAR3 during Dictyostelium develop-ment. Dev Biol 173:353–356.

Zhang, Q. (1995) Studies of H7 gene function and regulation of itsexpression by a bidirectional promoter in Dictyostelium discoid-eum. Ph.D. thesis, Vanderbilt University, Nashville, TN.

Zhukovskaya, N., Fukuzawa, M., Yamada, Y., Araki, T. andWilliams, J. (2006) The Dictyostelium bZIP transcription factorDimB regulates prestalk-specific gene expression. Development133:439–448.

595