GENOMICS 11,8-14 (1991)

Direct Sequencing of the Dopamine D, Receptor (DRDZ) in Schizophrenics Reveals Three Polymorphisms

but No Structural Change in the Receptor

GOBINDA SARKAR, * STEPHEN ~&PELNER,* DAVID K. GRANDY, t MARK MARCHIONNI, t OLIVIER CIvw,t JANET SOBELL,* LEONARD HESTON,~ AND STEVE 5. SOMMER*

*Department of Biochemistry and Molecular Biology, Mayo Clinic/Foundation, Rochester, Minnesota 55905; tvollum Institute for Advanced Biomedical Research, Oregon Health Sciences University, Portland, Oregon 9720 7; $ Department of Health

Sciences Research, Mayo Clinic/Foundation, Rochester, Minnesota 55905; and § Washington institute for Mental Illness Research and Training, Fort Steilacoom, Washington 98494

Received February 20, 1991; revised May 1, 1991

The dopamine D, receptor gene (gene symbol DRD2) is a candidate gene for schizophrenia because the potency of certain neuroleptics correlates with their affinity for this receptor. Seven regions of likely functional significance including the coding sequences and the splice junctions were fully sequenced in the dopamine D, receptor of 14 schizophrenics (and partially in several others) meeting DSM-III-R diagnostic criteria and in four unaffected non- Caucasians (97 kb of total sequence). No structural changes were found, suggesting that alteration in the structure of the dopamine D, receptor is not commonly in- volved in the etiology of schizophrenia. However, two com- mon and one uncommon intragenic polymorphisms were found. At least one of the polymorphisms was informative for linkage in 70% of Caucasians and 78% of Koreans. 0 1991 Academic Press, Inc.

INTRODUCTION

Dopaminergic neurons have been implicated in the initiation and execution of movement, the main- tenance of cognitive and emotional equilibrium, the regulation of pituitary function, and perhaps the mechanism of drug and alcohol addiction (Titeler, 1983; Di Chiara and Imperato, 1988). The signal transduction pathway mediated by the dopamine D, receptor may be related to the schizophrenic pro- cess because the relative clinical potency of the phe- nothiazine and butyrophenone neuroleptics corre- lates with their affinity for the receptor (Seeman et al., 1976; Creese et al., 1976; Peroutka and Snyder, 1980). Since the human D, receptor has recently been cloned (Grandy et al., 198913; Selbie et al., 1989) and mapped to llq22-23 (Grandy et al., 1989a), we sought to determine whether structural

o&w7543/91$3.00 Copyright 0 1991 by Academic Press, Inc. All righta of reproduction in any form reserved.

8

differences are found in patients meeting DSM-III- R criteria for schizophrenia. Herein we present the results of sequencing the coding regions and splice junctions of the dopamine D, receptor gene in 14 schizophrenics and 4 unaffected controls (36 genes total). Three intragenic polymorphisms were discov- ered, but none should affect protein structure or ex- pression.

MATERIALS AND METHODS

Amplitaq was purchased from Perk&Elmer Cetus. AMV reverse transcriptase, polynucleotide kinase, T7 and SP6 RNA polymerases, and RNasin were pur- chased from Promega Biotech (Madison, WI). [y- 32P]ATP was from Amersham (Buckinghamshire, UK). Oligonucleotide primers were synthesized on an Applied Biosystems Automated DNA synthesizer (Foster City, CA).

Patients. Fourteen schizophrenic patients meet- ing DSM-III-R diagnostic criteria were chosen for study. These patients were chosen from a collection of 190 schizophrenics that soon will be described in de- tail (Sobell et al., manuscript in preparation). The pa- tients are Caucasians of northern or western Euro- pean descent who were chosen to have a relatively homogeneous country of origin (at least three or four grandparents originated from the same country). The represented countries include Sweden, Norway, Ger- many, and Ireland. In addition, four unaffected indi- viduals including one Asian Indian, one Korean, one Ghanese, and one American Black were analyzed to search for polymorphisms in non-Caucasians.

Eight of the schizophrenics (SS014, SS016, SS073, SSOBO, SSO95, SS125, SS126, SS131) were ascer- tained at Zumbro Valley Mental Health Center, an

DOPAMINE Da RECEPTOR AND SCHIZOPHRENIA 9

1 2 3 4 5 6 7

- Intron

I Exon

1 Intron sequences reported in this paper

[El Alternatively spliced exon

3’ non-coding sequence

7 Position of the infrequent polymorphism or rare variant

v Position of the common polymorphisms

FIG. 1. Gene structure of the human dopamine Da receptor as described in Grandy et al. (8). Exons are numbered l-7. A-G represent intronic sequences reported in this paper (Fig. 2). The arrows point to two differences in sequence from published sequence in that region. The introns and the exons are not drawn to scale.

outpatient treatment center in Rochester, Minne- sota. The remaining six patients (SS031, SS032, SS064, SS065, SS079, SS176) were ascertained at the St. Peter Regional Treatment Center, a state hospital serving Southern Minnesota. The patients averaged 7.8 hospitalizations (range, 1-15) for a total period of 3.5 years (range, 1-14 years).

Laboratory procedures. The cloning and sequenc- ing of the dopamine D, receptor gene has previously been described (Grandy et al., 1989b). The procedure for the extraction of DNA from blood has been de- scribed earlier (Gustafson et al., 1987).

The methods for PCR (polymerase chain reaction), PASA @CR gmplification of specific alleles), and GAWTS (genomic amplification Eith transcript sequencing) have been described in detail elsewhere (Sommer et al., 1990; Stoflet et al., 1988; Sarkar et aZ., 1990a). See also the legend to Fig. 3.

RESULTS

Initially, the dopamine D, receptor cDNA that spans all the exons and the complete 3’ noncoding region was employed to probe Southern blots pre- pared from the genomic DNAs of selected patients and normal subjects (data not shown). The result failed to reveal any defect in the gene in these sam- ples. However, single-base substitutions and small deletions/insertions would have been missed. To per- form direct genomic sequencing of the entire protein coding region and the splice junctions, it was first nec- essary to determine the sequence of part of the flank- ing regions.

The cDNA sequence of the dopamine D, receptor and the genomic sequence of exons 4 through 6 have been described previously (Grandy et al., 1989b; Dal Toso et al., 1989). Herein we present the sequence of

seven undescribed intronic sequences flanking exons in the gene (Fig. 1 and 2).

To examine the D, receptor in schizophrenics and controls, the coding sequence and flanking regions

Region A

aaaattgtgt ttgctcaatt tgtcctacca gctgtaaaaa cttgctagca aaagagtggc agaaggccca acatttttag aaaattctta gccgtaaacc ttaaaatccc gagttggaaa attctcatta ttaaatgcca ggagttggtc ttcttcctgg agacctctgc aagaggccct ctcactgaca ccttgtgtcc atttttcctg cc:GAGCCTG GCCACCCAGT GGCTCCACCG CCCTG

-33

Region R

CTACCTGGA; gtaggtgggc ccc

285

Region c

aggagtacca ggctacagga cctaagctaa tctcccactc ctgctgtcca tccattatgt tgctttgtcc ccag$TGGTA GGTG

2i6

Region D

GCATCGACAT gtgagcccag ccagggtgga agaggttgct ctg

3%

Region E

cctgggcctg caccccagat tcagggtccc ccgcccttgc agGTACACAGCT

3d6

Region F

AATAACGCAY gtacattctg cttttgtttg cctgaggctc agctggccct gg

532

Region G

ggctctgggg accagcctga ccatgccctc tcccccag GCGTGTTCAT

11:9

FIG. 2. Novel genomic sequences flanking exons 1 (A and B), 2 (C and D), 3 (E and F), and 7 (G) are in lowercase letters. Capital letters represent exonic sequences. The numbering system for the exonic sequences is from Grendy et al. (8) and is applicable to exon sequences only.

10 SARKAR ET AL.

TABLE 1

Primers for Amplification and Sequencing”

Region Oligonucleotide No. primers Purpose Sequenceb

I 1 (T7-23)5’EX(-lOS)-38D 2 (SP6-23)11(141)-39U 3 (SP6-23)E1(161)-38U 4 (T7-23)5%X(-277)-39D 5 5’El(-41)-15D 6 E1(114)-15D 7 5’El(-272)-18D 8 5’El(-61)-15D 9 5%X(-169)-18D

10 5’El(-163)-17D 11 11(37)-15U 12 E1(161)-15U 13 5’El(-94)-15U 14 E1(48)-15U 15 E1(124)-15U

II

III

IV

16 17 18 19

20 (T7-23)12(-106)-38D 21 (SP6-23)13(58)-37 22 12(-34)-14D 23 13(38)-14U

24d (T7-23)13(-76)-40D 25d (SP6-23)14(118)-38U 26 13(-36)-14D 27 E4(90)-16D 28 14(62)-16U 29 E4(144)-16U

Exon 1 and flanking sequences (543 bases) (245 + 285 + 13)”

Nested amplimer Amplimer Amplimer Amplimer DS seq DS seq DS seq DS seq DS seq DS seq US seq US seq US seq US seq US seq

T7 + CCAGG AGTTG GTCTT SP+GTAAGCCCAGAGTGAA SP6 + AGCAC GTTGC CGAAG T7 + GTCTG TTCAA GTCAT C TTCCTGCCAGAGCCT CACAC TGCTC ACCCT TTCAAGTCATCTTATTAT CTGAC ACCTT GTGTC TTAGA AAATT CTTAG CCG AATTC TTAGC CGTAA AC TGGAGAAAGTGCTGG AGCAC GTTGC CGAAG AAGAC CAACT CCTGG CTGCCTCTCCAGATC GGCATAGTAGTTGTA

Exon 2 and flanking intronic sequences (217 bases) (74 + 110 + 33)’

(T7-23)11(-256)-38D Amplimer T7 + CCTCC GTATA AGTTG (SP6-23)12(93)-37U Amplimer SP6 + ACAGA CACGA GACA Il(-40)-14D DS seq CCACTCCTGCTGTC 12(49)-16U US seq CAGAA TGGTG AGTGG C

Exon 3 and flanking intronic sequences (221 bases) (42 + 137 + 42)’

Amplimer Amplimer DS seq US seq

T7 + TCAAC TGTTT AGCCC SP6 + CACCC AGGCC TCGA TGCAC CCCAG ATTC GGCCAGCTGAGCCT

Exon 4 and flanking intronic sequences (258 bases) (46 -t 181 + 31)

Amplimer Amplimer DS seq DS seq US seq US seq

T7 + GACAT GAATG TGCTC TT SP6 + TAGCC TAGAC CTAAC CTGAC TCCCT GCCT GTCTA CATCA AGATC T GAGCC CTCTT GGTAA T TGGTGTTGACTCGCTT

Exon 5 and flanking intronic sequences (118 bases) (15 + 87 + 16)’ (numbering system from Dal Toso et al. (4))

V 30 (T7-23)14(1620)-39D’ Amplimer T7 + CCAGT CTGAG TTCCAT 31 (SPS-23)15(2278)-39U’ Amplimer SP6 + AGCTC ATGTC AGTGG A 32 14(1678)-16D DS seq CACTTTGTGTGACCCA 33 15(1843)-15U= us seq GGCAG AAAGA CCTGG

Exon 6 and flanking intronic sequences (495 bases) (151 + 328 + 16)’ (numbering system from Dal Toso et al. (4))

VI 34 (T7-23)15(3068)-38D’ Amplimer T7 + GGCTG CATGA GGATT 35 (SP6-23)16(3706)-38U Amplimer SP6 + ATCCT GCAGC CATGG 36 (T7-23)15(3139)-39D Amplimer T7 + CATGC CTCAG TGACA T 37 15(3139)-16D DS seq CATGCCTCAGTGACAT 38 15(3250)-16D DS sea ATTGT CCGGC TTI’AC! C 39 E6(3353)-15D’ DS se; AGAGGACCCGGTACA 40 36(3423)-16D)’ DS seq TCTCCACAGCACTCCT 41 E6(3340)-14U US seq TGCTG GAGAG CATC 42 E6(3463)-16U US seq TCTTC TCTGG TTTGG C 43 16(3670)-17U’ us seq AATGGACCTTTCACAGA

DOPAMINE D, RECEPTOR AND SCHIZOPHRENIA 11

TABLE l-Continued

Region Oligonucleotide No. primers Purpose Sequence*

VII 44 15(3251)-16D= 45 (SP6-26)E7(1445)-38U 46 (T7-23)-16(-66)-36D 47 (SP6-26)E7(1359)-42U 48 16(-28)-15D 49 (T7-23)E7(1211)-38D 50 (SP6-26)E7(1252)-41U 51 E7(1363)-15U

Coding region of exon 7 and flanking sequence (244 bases) (38 + 195 + 11)

Amplimer Amplimer Nested amplimer Nested amplimer DS seq DS seq US seq US seq

CTTGT CCGGC ‘PTTAC C SP6 + TAGAA GAGGA GGCCG AT T7 + GTGTG GGTGT TCC SP6 + AGGGA GGTGG GAAGC A ACCAGCCTGACCATG T7 + CGCCT GTCCT GTACA SP6 + TGACA TAGCC CAGCC AAGCAGGCTGCTGTG

Primers for PCR amplification of gecific alleles (PASA) for detecting polymorphisms

Pl

P2 P3 P4

P5

(SP6-26)13(58)-40U ATGAATTAGGTGACACTATA GAATAGGCCTCGAGGGAGCA

F3(14)-15D(G”)’ GCCATGCCCATGCTG F3(15)-14D(A”) CCATG CCCAT GCTA 15(3193)-15D(T”) GAGTC TTCAG AGGGT 15(3194)-14D(G”)e AGTCT TCAGA GGGG

D The informative oligonucleotide name and the oligonucleotide sequence are given. The informative names initially may seem cumber- some, but they are very useful in daily practice particularly when a large number of oligonucleotides are generated for multiple gene sequences. The nomenclature is modified from that previously described (Refs. (17,18)) because, in this case, sequence is available only from

the 5’ and 3’ ends of most of the introns. The numbering system for each exon begins with the first nucleotide (e.g., the first base of an exon is numbered 1). The beginning of an intron (the 5’end) also is numbered 1 and the number increases with length, whereas the last nucleotide of the same intron (at the 3’ end) is numbered -1 (therefore the second to the last base of the intron is numbered -2, etc. As examples: oligonucleotide 1 has a 23-base T7 phage promoter sequence at its 5’ end, the dopamine Dz receptor sequence at its 3’ end is located 5’ of exon 1. The initial base of the dopamine-specific sequence is 108 bases upstream of the beginning of exon 1. The oligonucleotide is 38 bases long and it is oriented downstream relative to the direction of transcription. Oligonucleotide 6 is a sequencing primer located in exon 1, no additional sequences are added 5’ to the receptor sequences. The sequence of the oligonucleotide begins 114 bases from the beginning of the exon. The oligonucleotide is 15 bases and oriented downstream. Oligonucleotide 7 is in intron 1. It begins at base 37 of the intron. It is 15 bases long and it is oriented in the upstream direction. All PCRs require one oligonucleotide in the downstream and one oligonucleotide in the upstream orientation. From the numbering system and the exon size (Ref. (8)), one can readily determine the size of an amplified product from any combination of oligonucleotides. In some instances multiple sequencing primers at close spaces have been used to eliminate ambiguities. Also, multiple short repeats in some segments precluded designing primers at desired distances.

* The sequence of the 23 nucleotide T7 promoter is TAA TAC GAC TCA CTA TAG GGA GA and the sequence of the SP6 promoter is AAT TAG GTG ACA CTA TAG AAT AG.

c Indicates total number of nucleotides sequenced for each region in the first set of parentheses. In the second set of parentheses, the total sequence is divided into three parts: the bases 5’ to the exon, the bases in the exon, and the bases 3’ to the exon.

d A suggested STS for the genome project. The amplification in the presence of 5% formamide is robust (see legend to Fig. 3) and the complete sequence of the segment is published (Ref. (4)).

c When published numbering system is used, then the nomenclature can be directly followed from Sarkar and Sommer (17) and Sarkar et al. (18).

f The superscript n indicates the position of a nucleotide that differentiates two PASA primers.

were amplified and directly sequenced in both direc- tions with GAWTS (Stoflet et al., 1988; Sommer et al., 1990). The oligonucleotides used for amplification and sequencing are described in Table 1. The specific- ity of amplification for regions 1,3,6, and 7 (see Fig. 1) was dramatically increased by the addition of form- amide (Sarkar et al., 1990b). Amplification of region 7 required a nested PCR reaction (Haqqi et al, 1988). The amplified segments were sequenced in the direc- tion of transcription (downstream direction) by tran- scribing with SP6 and dideoxy sequencing with re- verse transcriptase (Sommer et al., 1990). The seg- ments were sequenced in the upstream direction by transcribing with T7 polymerase. At least 2 kb was

sequenced in each direction for the 14 schizophrenics and the 4 unaffected individuals (36 alleles; 72 kb of total sequence). For regions 2,5, and 6, sequence was obtained from an additional 14 schizophrenics and 2 unaffected individuals (an additional 25 kb total).

In total, three sequence changes were found (Table 2). Polymorphism 1 is a silent change at Leu141 (G + A). Polymorphism 2 is a transversion (T + G) at nu- cleotide 3208 in the fifth intron (see Dal Toso et al., 1989, for numbering system). Polymorphism 3 in- volves a silent change (a C to T transition) at amino acid His313. It can be detected by amplifying region 6 and digesting with a restriction endonuclease NcoI (Fig. 3). To facilitate detection of polymorphism 2,

12 SARKAR ET AL.

TABLE 2

Polymorphisms in the Dopamine D, Gene

Polymorphism Region Alleles and

base no. Restriction

site

Allele frequency”

Caucasian Korean

1 III ATGCTZTACAA G = 0.98 G = 1.00 (Le@) (423)* A = 0.02 A = 0.0

(4%) (Rare) 2 VI GAGGG,GGAAAG - G = 0.73 G = 0.67

(Intron 5) (3208)’ T = 0.27 T = 0.33 (39%) (44%)

3 VI CACCA$GGTCT NcoI C = 0.69 c = 0.44

(His?) (3420)’ T = 0.31 T = 0.56 (43%) (49%)

a Forty-four Caucasians (88 genes) and 18 Koreans were examined for polymorphisms 2 and 3 while 20 Caucasians and 18 Koreans were examined for polymorphism 1. The fraction of individuals expected to be heterozygous for the polymorphic site is given in parentheses. The two Blacks examined showed the polymorphisms at sites 2 and 3.

* The base number of the polymorphism/rare variant is given in parentheses (numbering system from Grandy et al. (8)). ’ The base numbers of these polymorphisms are from Dal Toso et al. (4).

P ASA assays were developed as previously described Sommer et aZ., 1989; Sarkar et al., 1990a). PASA

(also known as ASA and ARMS) (Wu et al., 1989; Newton et al., 1989) utilizes oligonucleotides whose 3’

SUl23456S

FIG. 3. Detection of polymorphism 3 by amplifying a region of

the gene, digesting the amplified DNA by NcoI, and electrophores- ing in a 3.5% agarose gel. Primers 38 and 35 were used for amplifi- cation. They generate a 480-bp amplified product. There is a non- polymorphic NcoI site in the amplified segment that serves as an internal control for the restriction enzyme digestion. An individual heterozygous for this polymorphism yields segments of 446, 194, 252, and 34 bp (a constant band generated through the nonpoly- morphic NcoI site, usually not seen in the gel), respectively (lanes 1 and 2). Homozygous individuals show either the 446-bp band (lanes 3,4, and 6) or the 194- and 252-bp bands (lane 5). Lane U, undigested amplified DNA. Lane S, DNA size standards obtained by digesting $X174 DNA with HaeIII. PCR conditions are 1 min at 94”C, 2 min at 5O”C, and 3 min at 72°C with 0.1 pM of each oligonu- cleotide and 0.5 U of Amplitaq in the presence of 5% formamide (Ref. (19)). Occasionally two rounds of PCR (nested PCR) are needed (see Ref. (10)) to obtain a clean amplified segment. In such cases, primers 34 and 35 are used first; the amplified material is diluted and used as a template for the second round of PCR with primers 35 and 38.

terminal regions are specific for one of the polymor- phic alleles (Fig. 4). Polymorphism 1 was detected by direct genomic sequencing.

Twenty Caucasians and 18 Koreans were tested for polymorphism 1. Polymorphism 1 is uncommon since only one Caucasian is heterozygous and all others are homozygous for the G allele. The presence of the A allele was confirmed by reamplification and sequenc- ing DNA from the heterozygous individual.

Forty-four Caucasians and 18 Koreans were tested for polymorphisms 2 and 3 (Table 2). These common polymorphisms are in little if any linkage disequilib-

SN123456S

FIG. 4. PASA to detect polymorphism in intron 5 of the dopa- mine D, receptor. Primer sets were either oligonucleotides 35 + P4 or oligonucleotides 35 + P5. Nested PCR was not needed in this case. All other PCR conditions are as in the legend to Fig. 3. An amplified segment expected is of length 514 bp when P4 is used or 515 bp when P5 is used. Lanes 1 and 2, individual homozygous for the G allele. The specific band is seen when oligonucleotides 35 and P5 (lane 2), but not 35 and P4 (lane l), are used. Lanes 3 and 4, individual heterozygous for the polymorphism; lanes 5 and 6, indi- vidual homozygous for the T allele. The location of the specific segment is indicated by an arrow. The PCR conditions are as in the legend to Fig. 3. Lane N, control with no DNA template. Lane S, DNA size markers obtained by digesting #X174 DNA with Ha&I.

DOPAMINE D, RECEPTOR AND SCHIZOPHRENIA 13

rium (x2 for observed versus expected for linkage equi- librium, P < 0.6). Seventy-four percent of individuals were heterozygous for at least one polymorphism compared to a predicted value of 67% at equilibrium. TWO blacks were also examined and found to have the polymorphisms at sites 2 and 3.

In addition to polymorphisms, we find two discrep- ancies near the 3’ end of intron 5 when the published sequence is compared with our sequence (see Dal Toso et aZ., 1989). In a total of 37 individuals se- quenced (74 genes), none have a G (base 3268) as pub- lished, and all of these individuals have a C instead of a T at base 3262. These discrepancies may be due to uncommon alleles or they may represent sequence errors.

DISCUSSION

We present the genomic sequence necessary to di- rectly sequence the coding regions and splice junc- tions of the dopamine D, receptor. Study of these regions in 14 (or more) schizophrenics and four unaf- fected individuals disclosed three single-base poly- morphisms. None of these are likely to have any func- tional significance.

These data indicate that structural changes in the coding region of the dopamine D, receptor are uncom- mon in schizophrenic patients, In a heterozygous indi- vidual, the new heterozygous band must be distin- guished from occasional sequence artifacts. However, it is unlikely that sequence changes have been missed in these individuals because both strands were se- quenced in each individual. Our study of the factor IX gene illustrates our ability to find mutations when present. GAWTS was developed to delineate the mu- tations in individuals with hemophilia B. We have sequenced more than 150 families with hemophilia and found a mutation in 97% of the patients by se- quencing one of the strands (Koeberl et al., 1990; Bot- tema et al., manuscript in preparation). In the five exceptional patients, resequencing confirmed the ab- sence of the sequence change in the regions examined. In addition, by sequencing only one of the strands, we have found a mutation in each of four females who were heterozygous for a mutation. In the dopamine D, receptor, no missense changes or splicing defects were found despite sequencing in both directions.

The absence of amino acid changes in the dopamine receptor hints that the receptor is not commonly in- volved in the etiology of schizophrenia. However, if the dopamine D, receptor is defective in a small sub- set of patients, our sampling may have missed such individuals. Alternatively, regulatory sequences such as those in the yet to be defined promoter or enhancer segments may be involved in a subset of patients. Given the striking correlation of affinity for the dopa-

mine D, receptor and the potency of neuroleptics, it would be prudent to examine these regulatory regions once they are defined.

A recent linkage analysis in two families has failed to implicate the DRD2 gene in the etiology of schizo- phrenia (Moises et aZ., 1991). Additionally, the link- age of the DRD2 locus and Gilles de la Tourette syn- drome was excluded in two extended pedigrees (Ge- lernter et al., 1990). Conflicting results were reported for an association of a restriction fragment length polymorphism in the D, receptor gene with alcohol- ism (Blum et al., 1990; Bolos et aZ., 1990). Thus, the DRD2 gene has not yet been consistently associated with neuropsychiatric disease. The availability of the additional polymorphisms described herein should in- crease the number of informative families for per- forming additional linkage studies.

ACKNOWLEDGMENTS

The work was partially supported by MH44276. S.K. was sup- ported by an Institutional NRSA 5T32-AG00143. We thank Mary Johnson for expert secretarial help.

1.

2.

3.

4.

5.

6.

REFERENCES

BLUM, K., NOBLE, E. P., SHERIDAN, P. J., MONTGOMERY, A., RITCHIE, T., JAGADEESWARAN, P., NOGAMI, H., BRIGGS, A. H., AND COHN, J. B. (1990). Allelic association of human dopamine D, receptor gene in alcoholism. JAMA 263: 2055- 2060.

Bolos, A. M., DEAN, M., LUCAS-DERSE, S., RAMSBURG, M., BROWN, G. L., AND GOLDMAN, D. (1990). Population and pedigree studies reveal a lack of association between the do- pamine D, receptor gene and alcoholism. JAMA 264: 3156- 3160.

CREESE, I., BURT, D. R., AND SNYDER, S. H. (1976). Dopa- mine receptor binding predicts clinical and pharmacological potencies of antischizophrenic drugs. Science 192: 481-483.

DAL Toso, R., SOMMER, B., EWERT, M., HERB, A., PRIT- CHETT, D. B., BACH, A., SHNERS, B. D., AND SEEBURG, P. H. (1989). The dopamine D, receptor: Two molecular forms gen- erated by alternative splicing. EMBO J. 8: 4025-4034.

DI CHIARA, G., AND IMPERATO, A. (1988). Drugs abused by humans preferentially increase synaptic dopamine concen- trations in the mesolimbic system of freely moving rats. Proc. Natl. Ad. Sci. USA 85: 5274-5278.

GELERNTER, J., PAKSTIS, A. J., PAULS, D. L., KURLAN, R., GANCHER, S. T., CIVELLI, O., GRANDY, D., AND KIDD, K. K. (1990). Gilles de la Tourette syndrome is not linked to D,-do- pamine receptor. Arch. Gen. Psychiatry 47: 1073-1077.

GRANDY, D. K., Lrrr, M., ALLEN, L., BUNWW, J. R., MAR- CHIONNI, M., Mm, H., REED, L., MAGENIS, R. E., AND CIVELLI, 0. (1989a). The human dopamine D, receptor gene is located on chromosome II at q22-q23 and identifies a TapI RFLP. Am. J. Hum. Genet. 45: 778-785.

GRANDY, D. K., ~~ARCHIONNI, M. A., MAKAM, H., STOFKO, R. E., ALFANO, M., FROTHINGHAM, L., FISCHER, J. B., BURKE-HOWE, K. J., BUNZOW, J. R-, SERVER, A. C., AND CMZLLI, 0. (1989b). Cloning of the cDNA and gene for a

SARKAR ET AL. 14

9.

10.

11.

12.

13.

14.

15.

16.

17.

human D, dopamine receptor. Proc. Natl. Acad. Sci. USA 86: 9762-9766.

GUSTAFSON, S., PROPER, J. A., BOWIE, E. J. W., AND SOM- MER, S. S. (1987). Parameters affecting the yield of DNA from human blood. Anal. B&hem. 166: 294-299.

HAQQI, T. M., SARKAR, G., DAVID, C. S., AND SOMMER, S. S. (1988). Specific amplification with PCR of a refractory seg- ment of genomic DNA. Nucleic Acids Res. 16: 11844.

KOEEERL, D. D., BOTTEMA, C. D. K., KETTERLING, R. P., BRIDGE, P. J., LILLICRAP, D. P., AND SOMMER, S. S. (1990). Mutations causing hemophilia B: Direct evidence of the un- derlying rates of spontaneous germ-line transitions, trans- versions, and deletions in a human gene. Am. J. Hum. Genet. 47: 202-217.

MOISES, H. W., GELERNTER, J., GRANDY, D. K., GIUFFRA, L. A., KENNEDY, J. L., KIDD, J. R., PAKSTIS, A. J., BUNZOW, J. R., Lrrr, M., VINOGFZADOV, S., ZARCONE, V., MAUER, J., SJOGREN, B., WE’ITERBERG, L., CIVELLI, O., KIDD, K. K., AND CAVALLI-SFOIUA, L. L. (1991). No linkage between a D2- dopamine receptor gene and schizophrenia. Arch. Gen. Psychi- atry 48, in press.

NEWTON, C. R., GRAHAM, A., HEPTINSTALL, L. E., et al. (1989). Analysis of any point mutation in DNA: The amplifi- cation refractory mutation system (ARMS). Nucleic Acids Res. 17: 2503-2515.

NICHOLS, W. C., AND LIEPNIEKS, J. J. (1989). Direct sequenc- ing of the gene for Maryland/German familial amyloidotic polyneuropathy type II and genotypingby allele-specific enzy- matic amplification. Genomics 5: 535-540.

OKAYAMA, H., CURIEL, D. T., BRANTLY, M. L., HOLMES, M. D., AND CRYSTAI;, R. G. (1989). Rapid, nonradioactive de- tection of mutations in the human genome by allele-specific amplification. J. Lab. Clin. Med. 114: 105-113.

PEROUTKA, S. J., AND SNYDER, S. H. (1980). Relationship of neuroleptic drug effects at brain dopamine, serotonin, LY- adrenergic, and histamine receptors to clinical potency. Am. J. Psychiatry 137: 1518-1522.

SARKAR, G., AND SOMMER, S. S. (1989). Access to a messen- ger RNA sequence or its protein product is not limited by tissue or species specificity. Science 244: 331-334.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

SARKAR, G., CASSADY, J., BOTTEMA, C. D. K., AND SOMMER, S. S. (1990a). Characterization of polymerase chain reaction amplification of specific alleles. Anal. Biochem. 186: 64-68.

SARKAR, G., KAPELNER, S., AND SOMMER, S. S. (1990b). Formamide can dramatically improve the specificity of PCR. Nucleic Acids Res. 18: 7465.

SEEMAN, P., LEE, T., CHAU-WONG, M., ANLI WONG, K. (1976). Antipsychotic drug doses and neuroleptic/dopamine receptors. Nature 261: 717-719.

SEEMAN, P., NIZNIK, H. B., GUAN, H-C., BOOTH, G., AND UL- PIAN, C. (1989). Link between D, and D, dopamine receptors is reduced in schizophrenia and Huntington diseased brain. PFOC. Natl. Acad. Sci. USA 86: 10,156-10,160.

SELBIE, L. A., HAYES, G., AND SHINE, J. (1989). The major dopamine D, receptor: Molecular analysis of the human D, subtype. DNA 8: 683-689.

SOKOLOFF, P., GIROS, B., MARTRES, M-P., BOUTHEN~, M-L., ANLI SCHWARTZ, J-C. (1990). Molecular cloning and characterization of a novel dopamine receptor (Da) as a target for neuroleptics. Nature 347: 146-151.

SOMMER, S. S., CASSADY, J. D., SOBELL, J. L., AND BO~MA, C. D. K. (1989). A novel method of detecting point mutations or polymorphisms and its application to population screening for carriers of phenylketonuria. Mayo Clin. Proc. 64: 1361- 1372.

SOMMER, S. S., SARKAR, G., KOEBEFIL, D. D., BOTI’EMA, C. D. K., BUEEZTEDDE, J-M., SCHOWAL~R, D. B., AND CAS- SADY, J. D. (1990). Direct sequencing with the aid of phage promoters. In “PCR Protocols: A Guide to Methods and Ap- plications,” pp. 197-205, Academic Press, San Diego.

STOFLET, E. S., KOEBERL, D. D., SARKAR, G., AND SOMMER, S. S. (1988). Genomic amplification with transcript sequenc- ing. Science 239: 491-494.

TITELER, M. (1983). “Multiple Dopamine Receptors: Recep- tor Binding Studies in Dopamine Pharmacology,” Dekker, New York.

WV, D. Y., UGOZZOLI, L., PAL, B. K., AND WALLACE, R. B. (1989). Allele-specific enzymatic amplification of @globin ge- nomic DNA for diagnosis of sickle-cell anemia. Proc. Natl. Acad. Sci. USA 86: 2757-2760.