APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Aug. 1994, p. 2916-2923 Vol. 60, No. 80099-2240/94/$04.00+0Copyright © 1994, American Society for Microbiology

Differentiation of Mycoplasmalike Organisms (MLOs) in EuropeanFruit Trees by PCR Using Specific Primers Derived from

the Sequence of a Chromosomal Fragment ofthe Apple Proliferation MLO

WOLFGANG JARAUSCH,1 COLETTIE SAILLARD,2* FRANQOISE DOSBA,1 AND JOSEPH-MARIE BOVE2Station de Recherches Fruitie'res' and Laboratoire de Biologie Cellulaire et Moleculaire,2

Institut National de la Recherche Agronomique, Bordeaux, France

Received 29 March 1994/Accepted 6 June 1994

A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with appleproliferation was sequenced. Three putative open reading frames were observed on this fragment. The proteinencoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From thenucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associatedwith European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- andPrunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzymeanalysis of the amplification products revealed restriction fragment length polymorphisms between Malus-,Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. Noamplification with either primer pair could be obtained with DNA from 12 different MLOs experimentallymaintained in periwinkle.

Mycoplasmalike organisms (MLOs) are nonculturable mol-licutes strains associated with more than 300 plant diseasesworldwide (34). Recently, the trivial name "phytoplasma" hasbeen proposed for these organisms (19). In fruit tree cropsthey induce serious diseases which are difficult to control. Allimportant rosaceous fruit tree crops in southern and westernEurope are affected by MLO diseases, such as apple prolifer-ation (AP) (17), pear decline (9), apricot chlorotic leaf roll(35), Molieres disease of sweet cherries (3, 14), peach decline(16), plum leptonecrosis of Japanese plums (18), and earlybursting and plum decline of European plums (16). MLOshave also been detected in almond and flowering cherry trees(27).

Until recently, the lack of specific detection methods hashampered the understanding of these phloem-restricted patho-gens. The identities of the MLOs affecting different fruit treespecies in different geographic areas as well as the epidemiol-ogy of the diseases are still poorly understood. Detection anddifferentiation were based mainly on symptomatology andnonspecific techniques like electron and fluorescence micros-copy. As MLOs of woody plants usually occur in low concen-trations, these detection methods are not always sufficientlysensitive.The development of efficient MLO DNA isolation tech-

niques (24) and the molecular cloning of chromosomal DNAfragments of MLOs made it possible to obtain more specificand sensitive detection procedures based on nucleic acidhybridization (5, 11, 22). These molecular probes have alsofacilitated differentiation among MLOs (10, 26, 28). Thus,molecular probes specific for AP MLOs and stone fruit MLOswere obtained (5, 36). More progress in revealing the phylo-

* Corresponding author. Mailing address: Laboratoire de BiologieCellulaire et Mol6culaire, Institut National de la Recherche Agrono-mique, Centre de Bordeaux, 71, ave. Edouard-Bourleaux, BP 81,33883 Villenave d'Ornon Cedex, France. Phone: (33) 56 84 31 52. Fax:(33) 56 84 31 59.

genetic relationships of MLOs was made by using PCR ampli-fication of the 16S rRNA gene (rDNA) of MLOs. Sequencedata derived from this amplified 16S rDNA were essential forthe phylogenetic positioning of MLOs within the Mollicutes(25, 29). In addition, restriction fragment length polymorphism(RFLP) patterns obtained from the amplified 16S rDNAallowed a first classification of MLOs (2, 39). Pome and stonefruit MLOs appear to be closely related and can be distin-guished only by a single RFLP pattern (39). To obtain more-specific primers for sensitive detection in routine diagnosis,sequencing of chromosomal DNA fragments used as molecu-lar probes for nucleic acid hybridization was already success-fully performed for clover proliferation and aster yellowsMLOs (12, 38).

Therefore, in this study, a previously cloned chromosomalDNA fragment of an AP MLO (5) was partially sequenced toselect PCR primers with different degrees of specificity topome and stone fruit MLOs. The molecular probe derivedfrom this cloned fragment proved to be specific for AP MLOsand stone fruit MLOs (36). Defined MLO isolates, stablymaintained in their in vitro-propagated natural host plants (15,20), were used to establish PCR protocols which were thenapplied to detect MLOs in naturally infected trees. Thus,MLOs affecting Malus, Prunus, and Pyrus species could bespecifically detected and differentiated into three geneticallydistinct groups. Furthermore, two subgroups were found in thegroup of Malus-affecting MLOs.

MATERIALS AND METHODSMLO isolates. MLO isolates used in this study, their original

host plants, and their geographical origins are listed in Table 1.In vitro-maintained MLO isolates were those which werestably maintained in their in vitro-propagated natural hostplants, such as Malus pumila MM106 (15), Prunus mariannaGF 8-1 (20), and Pyrus communis (7a). Graft inoculation wasused to maintain MLO isolates in vivo in experimental or-chards in Bordeaux, France. Healthy in vitro-propagated

2916

on May 31, 2018 by guest

http://aem.asm

.org/D

ownloaded from

DIFFERENTIATION OF MLOs IN EUROPEAN FRUIT TREES BY PCR 2917

TABLE 1. Origins and sources of the MLO isolates

MLO isolate MLO disease Original host plant Geographic origin Source' or

In vitro or in vivo maintainedAP-16 Apple proliferation Malus pumila France 15AP-H93 Apple proliferation Malus pumila France 15AP-G27 Apple proliferation Malus pumila France F. DosbaDBT Early bursting of Prunus marianna GF 8-1 Prunus marianna France 16MOL-RCL Molieres disease from greengage Prunus domestica France 16ACLR-G32 Apricot chlorotic leaf roll Prunus armeniaca France 35B22 Peach decline Prunus persica France 16PD Pear decline Pyrus communis United Kingdom 9

Natural infectionMPUM Apple proliferation Malus pumila France W.J. et al.PARM Apricot decline Prunus armeniaca France W.J. et al.PPER Peach decline Prunus persica France W.J. et al.PSAL Japanese plum decline Prunus salicina France W.J. et al.PCOM Pear decline Pyrus communis France W.J. et al.

Periwinkle maintainedAP-15 Apple proliferation Malus pumila Italy 7AT Apple proliferation Malus pumila Germany 33ACLR Apricot chlorotic leaf roll Uncertain Spain G. LlacerASHY Ash yellows Fraxinus americana United States W. A. SinclairAY Aster yellows Aster France G. MorvanFDI Flavescence doree of grapevine Vitis vinifera Italy L. CarraroGVX Green valley strain of X disease Prunus persica United States M. F. ClarkMOL Molieres disease Prunus mahaleb France F. DosbaPER Peach decline Prunus persica Italy A. RagozzinoPLN Plum leptonecrosis Prunus salicina Italy L. CarraroPYLR Peach yellow leaf roll Prunus persica United States M. F. ClarkSTOL Stolbur disease of tomato Lycopersicon plant France M.-T. CousinULW Elm witches' broom Ulmus carpinifolia France G. MorvanVAC Blueberry witches' broom Vaccinium myrtillus Germany 32a Collected and/or transmitted to periwinkle or provided by the following: F. Dosba, Institut National de la Recherche Agronomique (INRA), Bordeaux, France; W.J.

et al., collected by us in the southwest of France; G. Llacer, Instituto Valenciano de Investigaciones Agrarias, Valencia, Spain; W. A. Sinclair, Cornell University, Ithaca,N.Y.; G. Morvan, INRA, Avignon/Montfavet, France; L. Carraro, Universita degli Studi, Udine, Italy; M. F. Clark, Horticulture Research International, East Malling,United Kingdom; A. Ragozzino, Universita degli Studi, Naples, Italy; M.-T. Cousin, INRA, Versailles, France.

plants and symptomless noninoculated trees of the experimen-tal orchards were used as controls. Naturally infected plantmaterial was collected in the southwest of France in summer.The MLOs found on three apple trees (M. pumila, MLOMPUM), three apricot trees (Prunus armeniaca, MLOPARM), one peach tree (Prunus persica, MLO PPER), oneJapanese plum tree (Prunus salicina, MLO PSAL), and twopear trees (Pyrus communis, MLO PCOM) were analyzed inthis study. Fourteen different MLOs from woody and herba-ceous host plants were experimentally maintained in periwin-kle (Catharanthus roseus) by graft transmission.DNA sequencing. The insert (IH 196; 3.7 kb) of clone pH196

(5) representing a chromosomal DNA fragment of AP MLO(German isolate AT) was subcloned according to standardprocedures (37) into the pUC18 vector by using HindIlIrestriction sites. Plasmid DNA of the resulting clone pUCI196was purified by CsCl buoyant density gradient centrifugation(37), and the insert was partially sequenced on both strandswith a Sequenase kit (version 2.0; United States BiochemicalCorp., Cleveland, Ohio) according to the manufacturer's in-structions.PCR amplification. Total DNA from healthy and diseased

plants was obtained by an MLO enrichment procedure com-bined with cetyltrimethylammonium bromide extraction aspreviously described (2). Shoots from in vitro-propagatedplants as well as midribs from leaves of periwinkle or fruit treeswere used as starting material. Primers deduced from pub-lished sequences (2) were used to amplify an internal fragmentof the MLO 16S rDNA. Primers for the amplification of

chromosomal DNA fragments of European fruit tree MLOswere derived from the sequence of the 1.8-kb chromosomalDNA fragment of the AP MLO (this work) and are listed inTable 2. A 40-,ul PCR mixture contained 10 to 100 ng of totalDNA, 0.5 puM (each) primer, 125 ,uM deoxynucleotide triphos-phate, and 0.5 U of Replitherm polymerase (Epicentre, Mad-ison, Wis.) in the reaction buffer supplied by the manufacturer.In a GeneAmp PCR System 9600 (Perkin-Elmer, Norwalk,Conn.) 40 cycles for each primer pair were conducted, pre-ceded by a 1-min denaturation step at 95°C and followed by anelongation step for 4 min at 72°C. Cycle conditions were asfollows: MLO 16S rRNA primers, 10 s at 95°C, 15 s at 55°C,and 30 s at 72°C; primer pair AP 5-AP 4, 10 s at 95°C, 15 s at58°C, and 45 s at 72°C; primer pair AP 3-AP 4, 10 s at 95°C, 15s at 57°C, and 30 s at 72°C; primer pair AP 9-AP 10, 10 s at

TABLE 2. Nucleotide sequences of primers used for PCRamplification in the 1.8-kb chromosomal DNA fragment of AP MLO

Primer Positionsa Sequence 5' +->3'

AP 3 881-900 GAAACATGTCCTATTGGTGGAP 4 1042-1023 CCAATGTGTGAAATCTGTAGAP 5 560-581 TC-`TlTTAATC'TTCAACCATGGCAP 9 1347-1365 GGTAGAATAATTATATCTCAP 10 1798-1779 TITITCACAACGTATTCCGCC

a Base numbering corresponds to the sequence deposited in the GenBank datalibrary (accession number L22217).

VOL. 60, 1994

on May 31, 2018 by guest

http://aem.asm

.org/D

ownloaded from

2918 JARAUSCH ET AL.

0 500 1000 1500 2000 [bpl

ORF I ORF 2 ORF3-ll:::::::::::~::::::::::::-l-l-l-l--

AP 5S- 4- AP 4

AP3- _-AP4

primer fragmentpair length

APSI4 483 bp

AP 314 162 bp

4-AP 10 AP 3/10 918 bp

AP9_ 4-AAP10 AP9/10 452 bp

FIG. 1. Schematic representation of the 1.8-kb chromosomal fragment of AP MLO isolate AT and positions of the primer pairs used for PCRamplification. AP 5/4, primer pair AP 5-AP 4; AP 3/4, primer pair AP 3-AP 4; AP 3/10, primer pair AP 3-AP 10; AP 9/10, primer pair AP 9-AP10. The predicted size of each PCR product is given. Filled boxes represent three putative ORFs.

95°C, 15 s at 52°C, and 30 s at 72°C; and primer pair AP 3-AP10, 10 s at 95°C, 15 s at 58°C, and 60 s at 72°C.PCR product analysis. PCR amplification products (10 ,lI)

and restriction enzyme digests were analyzed by agarose gelelectrophoresis using various concentrations of agarose or

mixtures of agarose with NuSieve GTG agarose (FMC, Rock-land, Maine). After ethidium bromide staining, the DNAfragments were visualized on a UV transilluminator.For restriction enzyme analysis, 10 to 15 ,ul of PCR ampli-

fication products was digested with AluI, Dral, HincII, Hinfl,RsaI, Spel, or SspI, according to the manufacturer's instruc-tions (Eurogentec, Seraing, Belgium).

Nucleotide sequence accession number. The nucleotide se-quence of 1,812 bp of the previously cloned 3.7-kb HindIIIchromosomal DNA fragment of AP MLO (isolate AT) hasbeen deposited in the GenBank data library under accessionnumber L22217.

RESULTS AND DISCUSSIONDNA sequencing of a chromosomal DNA fragment of AP

MLO. The 3.7-kb HindIII chromosomal DNA fragment of APMLO previously cloned (5) was sequenced over 1,812 bpstarting from one of the HindIII sites. Nearly 90% of the1,812-bp nucleotide sequence was determined on both strands.Figure 1 shows a schematic representation of the sequencedregion. Three putative open reading frames (ORFs), eachpreceded by a putative Shine-Dalgarno ribosome bindingsequence, could be localized. Homology searches in proteindata banks revealed a significant similarity of ORF 2 withnitroreductases from Enterobacter cloacae (6) and Salmonellatyphimurium (40). ORF 3, which is incomplete, shows signifi-cant similarity to a hypothetical 40-kDa protein of Escherichiacoli (21). ORF 1, for which no significant homologies could befound, is separated from ORF 2 by only 13 bp without aterminatorlike structure, suggesting a putative two-gene tran-scription unit. A possible terminator sequence is located in the3'-noncoding region of ORF 2. Concerning the codon usage,

all three tryptophan codons found in ORFs 2 and 3 are UGGcodons and all putative stop codons are UAA codons. This isin accordance with previous results for ribosomal protein genes

of a plant-pathogenic MLO (30, 31) showing that in contrast tomycoplasmas, spiroplasmas, and ureaplasmas, the UGA codondoes not serve as a tryptophan codon and is not used as a

frequent stop codon. This supports results of 16S rDNAsequence analysis (25, 29) that MLOs are phylogenetically

related to acholeplasmas. The chromosomal DNA fragment ofAP MLO exhibits a G+C content of 19% in the coding regionsand of only 7% in the noncoding regions. This finding isconsistent with the A+T-rich genomes of MLOs (23).PCR detection of European fruit tree MLOs maintained in

their in vitro-propagated host plants. For PCR total DNAextracts from MLO-infected, in vitro-propagated Malus,Prunus, and Pyrus plants were used as target DNA. Thisallowed us to work with defined MLO isolates which were

maintained in their natural host plants without seasonal fluc-tuations in MLO concentration (15, 20). In addition, twoperiwinkle-maintained isolates (AP-15 and AT) of Malus-affecting MLOs were studied. The German isolate AT, fromwhich the sequence data were derived, served as a homologouscontrol for the PCR amplifications. The presence of MLOtarget DNA in the total DNA extracts from infected plants waschecked by amplification of the MLO 16S rDNA by a previ-ously published PCR protocol (2; data not shown).The established sequence of a chromosomal DNA fragment

of AP MLO was used to obtain specific primers for PCRdetection of European fruit tree MLOs. Coding regions were

chosen to select primers with relatively high G+C contents(between 26 and 45%). Table 2 summarizes the primers usedin this study, and Fig. 1 shows the locations of the primer pairson the sequence. Primer pair AP 5-AP 4 proved to be specificfor AP MLO isolates, as it yielded a PCR product of theexpected size (483 bp) only with DNA from Malus-affectingMLOs (Fig. 2). Primer pair AP 3-AP 4 gave a PCR product ofthe expected size (162 bp) with DNA from both Malus- andPrunus-affecting MLOs (DBT, MOL-RCL, and ACLR-G32)(Fig. 2). Although an internal fragment of the Pnunus-affectingMLO 16S rDNA was easily amplified by the universal primers,the PCR signal obtained with primer pair AP 3-AP 4 on thesame total DNA extracts was consistently weak, suggesting alower homology of these primers to DNA from Prunus-affecting MLOs. With primer pair AP 3-AP 10 a specific DNAfragment of the expected size (918 bp) could be equally wellamplified from Malus- and Prunus-affecting MLOs. A faintband was also visible in the PCR with DNA from pear decline(PD) MLO (Fig. 2, lane I). Primer pair AP 9-AP 10 exhibitedgreater homology to PD MLO DNA, resulting in good ampli-fication of a specific DNA fragment from Malus- and Pyrus-affecting MLOs and a weaker amplification of the homologousDNA fragment of Prunus-affecting MLOs (Fig. 2). In additionto the band of the expected size (452 bp), faint nonspecific

AP 3 -_

APPL. ENVIRON. MICROBIOL.

on May 31, 2018 by guest

http://aem.asm

.org/D

ownloaded from

DIFFERENTIATION OF MLOs IN EUROPEAN FRUIT TREES BY PCR 2919

AP 5/41018 hp

S17hp3 bhp

hp29 hp _

20bhp1,4 hp _

AP 3/43Ibpp344bp2bph

220/201hp

I54 hp1.34 bp

75bp _

AP 3/101636hpbp

1018 bp

517bhp.3%bp_

220bpbp

AP 9/10

1018bp_p

S17bp -

396bphp

220 hp

.%If.-)

'%I A B ('

1If71hIII%-N1I(L

I) E: F (;

I'I11Is-

\1L()

If I J

%1LO

K L

M A B C D E F G H I J K L

M A B C D E F G H I J K L

M A B C D E F G H I J K L

FIG. 2. Agarose gel electrophoresis of PCR amplifications withprimer pairs AP 5-AP 4, AP 3-AP 4, AP 9-AP 10, and AP 3-AP 10 on

total DNA from healthy or MLO-infected, in vitro-propagated plants.Concentrations of the agarose gels were as follows: AP 5-AP 4, 1.5%agarose; AP 3-AP 4,3% NuSieve and 1% agarose; AP 9-AP 10 and AP3-AP 10, 1% agarose. Lanes M contain the molecular size markers(1-kb ladder; BRL, Pontoise, France). Lanes A, healthy M. pumila;lanes B, AP-infected M. pumila, MLO isolate AP-16; lanes C, AP-infected M pumila, MLO isolate AP-H93; lanes D, healthy Prunusmarianna; lanes E, DBT-infected Prunus mananna; lanes F, Molieres-infected Prunus marianna, MLO isolate MOL-RCL; lanes G, apricotchlorotic leaf roll-infected Prunus marianna, MLO isolate ACLR-G32;lanes H, healthy Pyrus communis; lanes I, pear decline-infected Pyrus

communis; lanes J, healthy C. roseus; lanes K, AP-infected C. roseus,

MLO isolate AP-15; lanes L, AP-infected C. roseus, MLO isolate AT.See Fig. 1 for sizes of the PCR products.

bands of lower molecular weight sometimes became visibleafter PCR amplification when total DNA extracts from healthyor infected Prunus or Pyrus plants were tested. Apart from this,no amplification product with either primer pair could beobserved with DNA from healthy controls. Table 3 summarizesthe results obtained with the different primer pairs.

DNA from 12 other MLO isolates experimentally main-tained in periwinkle (Table 1) was also tested with the fiveprimer pairs. No amplification product could be detected withthe specific primer pairs AP 5-AP 4, AP 3-AP 4, AP 3-AP 10,and AP 9-AP 10, whereas the presence of MLO target DNA inthe total DNA extracts could be confirmed by amplification ofMLO 16S rDNA by a previously published PCR protocol (2;data not shown). These periwinkle-maintained isolates in-cluded MLOs originating from woody plants as well as fromherbaceous host plants. It is worth mentioning that all the APprimer pairs failed to detect MLO-specific DNA from periwin-kle-maintained isolates which were originally transmitted bydodder or by leafhoppers from diseased fruit trees (PER,MOL, ACLR, GVX, PYLR, and PLN). This is not surprising,as 16S rDNA analyses revealed that all these MLOs belong toMLO groups different from the European fruit tree MLOgroup (39). As previously shown (20), fruit tree-maintainedisolates MOL-RCL and ACLR-G32 are genetically differentfrom periwinkle-maintained isolates MOL and ACLR. South-ern blot analysis with various probes (1) confirmed theseresults, showing clearly that German Prunus-affecting MLOisolates are distinct from MLO isolates transmitted experimen-tally either from European fruit trees (MOL, ACLR, andPLN) or from North American fruit trees (GVX and PYLR)to periwinkle.

Detection of fruit tree MLOs in affected trees. The estab-lished PCR procedures were applied to detect fruit tree MLOsin graft-inoculated trees in experimental orchards in Bordeaux(in vivo-maintained Malus- and Prunus-affecting MLO iso-lates) and in naturally infected trees found in the southwest ofFrance. Natural MLO infections of apple (M. pumila, MPUM),pear (Pyrus communis, PCOM), peach (Prunuspersica, PPER),apricot (Prunus armeniaca, PARM), and Japanese plum(Prunus salicina, PSAL) trees were investigated. MLO-specificPCR products were easily detected in total DNA extracts ofinfected trees according to the specificity of the primer pairused. Table 3 gives a summary of the results. MLOs on appletrees were best detected with primer pair AP 5-AP 4, butprimer pairs AP 3-AP 4, AP 3-AP 10, and AP 9-AP 10 gavecomparable results. MLOs on apricot, peach, and Japaneseplum trees were best detected with primer pair AP 3-AP 10,while MLOs on pear trees could be detected only with primerpair AP 9-AP 10. As shown for the Prunus-affecting MLOsmaintained in their in vitro-propagated host plants, primer pairAP 3-AP 4 yielded consistently faint PCR signals with totalDNA extracts of MLO-infected Prunus plants.The concentration of MLOs in the naturally infected pear

trees was very low, as the fluorescence microscopy test with4',6-diamidino-2-phenylindole (DAPI) staining (see reference20 for the method) gave negative results. Also, the apparentlyweaker homology of primer AP 3 to Pyrus-affecting MLODNA may have hampered the detection of Pyrus-affectingMLOs in the naturally infected pear trees. Nevertheless, thepresence of inhibitors of the PCR in the total DNA extracts ofPyrus plants cannot be excluded. No PCR products weredetectable with DNA extracts from symptomless trees of allgenera which were regarded as healthy controls.RFLP analysis of PCR products. RFLP analyses were

performed with PCR products obtained with primer pairs AP5-AP 4, AP 3-AP 4, AP 3-AP 10, and AP 9-AP 10 and templateDNA both from MLO-infected in vitro-propagated Malus,Prunus, and Pyrus plants and from naturally infected trees. Sixdifferent restriction enzymes were tested. Figure 3 shows theRFLP pattern of the PCR products revealed in Fig. 2 afterdigestion with four different restriction enzymes. The positionof the restriction sites on the 1.8-kb chromosomal DNA

VOL. 60, 1994

on May 31, 2018 by guest

http://aem.asm

.org/D

ownloaded from

2920 JARAUSCH ET AL.

TABLE 3. Presence or absence of PCR signals with primer pairs derived from the MLO 16S rDNA or from a 1.8-kbchromosomal fragment of AP MLO

PCR results according to the primer pair usedMLOa Host plant genus

16S rDNAb AP 5-AP 4 AP 3-AP 4 AP 3-AP 10 AP 9-AP 10

In vitro maintainedAP-16 Malus + + + + +AP-H93 Malus + + + + +DBT Prunus + - +C + +MOL-RCL Prunus + - +C + +ACLR-G32 Prunus + - +C + +PD Pyrus + - +C +

In vivo maintainedAP-G27 Malus + + + + +DBT Prunus + - +C + +MOL-RCL Prunus + - +C + +ACLR-G32 Prunus + - +C + +B22 Prunus + - +C + +

Natural infectionMPUM (apple) Malus + + + + +PARM (apricot) Prunus + - + +PPER (peach) Prunus + - + +PSAL (ap. plum) Prunus + - + +PCOM (pear) Pyrus + - - - +

Periwinkle maintainedAP-15 Malus + + + + +AT Malus + + + + +a For codes of MLO isolates see Table 1.b Primers according to reference 2.c Only a faint band visible.

fragment of AP MLO isolate AT is shown in Fig. 4. Table 4summarizes the sizes of the restriction fragments obtainedaccording to three groups of fruit tree MLOs which can bedelineated from the polymorphisms found. The sizes which aregiven for Malus-affecting MLO isolate AT are calculated fromthe sequence data. These fragments and the molecular weightmarker were used to estimate the restriction fragment sizesobtained from the other MLO isolates by comparison of theirmigration after agarose gel electrophoresis.

Digestions of PCR products derived from Malus-affectingMLOs with primer pair AP 5-AP 4 revealed no polymorphismbetween the AP MLO isolates using restriction enzymes SspI,Spel (Fig. 3), and Hinfl (data not shown). PCR products ofprimer pair AP 3-AP 4 originating from Malus- and Prunus-affecting MLOs could be digested as expected with SspI (Fig.3) and DraI (data not shown).An RFLP between Malus- and Prunus- or Pyrus-affecting

MLOs could be revealed by RsaI digestion of PCR productsobtained with primer pairs AP 9-AP 10 and AP 3-AP 10 (Fig.3). The RFLP pattern deduced from the AT MLO sequencecould be obtained only with template DNA from Malus-affecting MLOs (Fig. 3; Table 4). AP 9-AP 10 and AP 3-AP 10PCR products derived from Prunus- and Pyrus-affecting MLODNA missed the RsaI restriction site at nucleotide 1416. AP9-AP 10 RsaI restriction fragments of 359 and 70 bp migratedtherefore as a 429-bp band during agarose gel electrophoresis,and the AP 3-AP 10 RsaI restriction fragments of 359 and 141bp migrated as a 500-bp fragment (Fig. 3; Table 4). Digestionof the AP 9-AP 10 and AP 3-AP 10 PCR products with HincIIrevealed a polymorphism between Prunus- and Pyrus-affectingMLOs as well as between Malus-affecting MLO isolates APand AT (Fig. 3; Table 4). Only isolate AT, from which theestablished sequence originates, showed the expected restric-tion pattern. All other MLO isolates tested had a mutation inthe HincII restriction site at nucleotide 1400. Whereas the AP

9-AP 10 and AP 3-AP 10 PCR products derived from the otherAP MLO isolates and from the Pyrus-affecting MLOs couldnot be digested with HinclI, a second mutation was found inthe PCR products of Prunus-affecting MLOs obtained withprimer pair AP 3-AP 10. This mutation creates a possibleHincII restriction site at nucleotide 1222 resulting in theobserved restriction fragments of 576 and 342 bp (Fig. 3).Thus, according to the sequence data obtained in this studyand according to the results of the RFLP analyses of the PCRproducts, four different restriction maps could be defined for ahomologous chromosomal DNA fragment of European fruittree MLOs (Fig. 4).The European fruit tree MLOs could be differentiated

genetically into three distinct groups, and furthermore, twosubgroups were defined among the Malus-infecting MLOs.Although these groups were established after analysis ofseveral different MLO isolates, either in vitro maintained, invivo maintained, or found as natural infections, studies areunder way with a larger number of samples from naturallyinfected trees to test the genetic variability of the MLOs foundon European fruit trees. The established PCR protocols allowdifferentiation between the three MLO groups without restric-tion enzyme digestion using at least two different primer pairs.Malus-affecting MLOs could be specifically detected withprimer pair AP 5-AP 4. Prunus-affecting MLOs were detect-able with primer pair AP 3-AP 4 but not with primer pair AP5-AP 4, whereas Pyrus-affecting MLOs were not detected withprimer pair AP 3-AP 4 but could be easily detected with primerpair AP 9-AP 10. For routine diagnosis, Prunus-affectingMLOs were best detected with primer pair AP 3-AP 10. RFLPanalysis ofAP 3-AP 10 PCR products with restriction enzymesHincII and RsaI also allowed a differentiation of the threegroups of European fruit tree MLOs.These results confirm data obtained from RFLP analyses of

amplified 16S rDNA which allowed differentiation between

APPL. ENVIRON. MICROBIOL.

on May 31, 2018 by guest

http://aem.asm

.org/D

ownloaded from

DIFFERENTIATION OF MLOs IN EUROPEAN FRUIT TREES BY PCR 2921

SspI Spel AP 9/10M B C K L B C K L

Rsal

M B C K L E F G I

517 hp-_39 hp _3 bp-_296 bp-

220/201 bp_-..

154 bp_134 bp_

75 bp- I

SspI

M B C K L E F G

220 bp-201 bp-

1.54 hp-1.34hp-

75 bp_-.

AP 3/10

517/5,' hp-

.3, hp-_

.344 hp-_296 hp_

220/201 hp_

154 p _I.U hp_I

AP 9/10 HinclI

N4 B C K L E F G I

1018 hp_-

517 hp_hp -_

4W hp_296 hp-_

220/201 hp-154/1 hp -

Rsal

M B C K L E F G I

AP 3/10 HincII

M B C K L E F G I

1018 hp_

517 bp-~39m hp-_Am hp-_2" bp-_

220i201 hp-1I4/1i. hp-_

75 hp_

FIG. 3. Agarose gel electrophoresis of restriction enzyme digests of the PCR products shown in Fig. 2. Concentrations of the agarose gels were3% NuSieve and 1% agarose for AP 5-AP 4, AP 3-AP 4, and AP 9-AP 10 (RsaI); 2% NuSieve and 1% agarose for AP 3-AP 10 (RsaI); and 2%agarose for AP 9-AP 10 and AP 3-AP 10 (HincII). Lanes M contain the molecular size markers (1-kb ladder; BRL). See the legend to Fig. 2 fordetails. Malus-affecting MLOs: lanes B (AP-16), lanes C (AP-H93), lanes K (AP-15), and lanes L (AT). Prunus-affecting MLOs: lanes E (DBT),lanes F (MOL-RCL), and lanes G (ACLR-G32). Pyrus-affecting MLO: lane I (PD).

Malus- and Prunus-affecting MLOs. As both groups of MLOscould be distinguished only by one RFLP pattern, they wereregarded as subgroups of the same group of MLOs (39).Southern blot analysis with various probes (1) supported theseresults, as AP MLOs and Prunus-affecting MLOs formed twogroups with different hybridization patterns.

In our study we were able to demonstrate the genetic

0 500 1000 1500

divergence of Malus- and Pyrus-affecting MLOs, although noRFLP could be found between Malus- and Pyrus-affectingMLOs with amplified internal 16S rDNA fragments (8). Fur-thermore, the English PD MLO isolate maintained in invitro-propagated pear plants showed the same restrictionpatterns as the MLO isolates found on naturally infected peartrees in France. According to our results, Pyrus-affecting

2000 [bp]

SpSsHf SoD RHeR RL & E~~IIL II I

SpBsHf S D R RI I I I I I

Bs D HeR ?

?? R ?-- t ~~~~~~~. subgroup AT

Malus-MLOssubgroup AP

Prunus-MLOs

Pyrus-MLOsFIG. 4. Partial restriction maps of chromosomal fragments of Malus-, Prunus-, and Pyrus-affecting MLOs homologous to a 1.8-kb chromosomal

fragment of AP MLO isolate AT. Restriction sites according to the results of the restriction enzyme analysis of PCR products shown in Fig. 3 areindicated as follows: D, DraI; Hc, HincII; Hf, Hinfl; Sp, SpeI; Ss, SspI; and R, RsaI. Predicted restriction sites, as deduced from the establishedsequence of Malus-affecting MLO isolate AT, which have not been checked in the PCR products are marked by question marks. Filled boxesrepresent ORFs found in the 1.8-kb fragment.

AP 5/4

517 hp_-.39 hp-344 hp-296 bp --

220/2n1 bp_...

154 hp_-1.34 bp-

75 hp-

AP 3/4

. .. . .

VOL. 60, 1994

I

on May 31, 2018 by guest

http://aem.asm

.org/D

ownloaded from

2922 JARAUSCH ET AL.

TABLE 4. Grouping of fruit tree MLOs according to RFLPanalyses of PCR products obtained with different primer pairs

derived from a 1.8-kb chromosomal fragment ofAP MLO

Fragment size(s) (bp)a for MLOs affecting:Primer pair and

restriction enzyme Malus plants (sub- PPUnus plants Pyrs plantsgroups AT and AP)

AP 5-AP 4SspI 200, 188, 95 -SpeI 378, 105Hinfl 255, 228 -

AP 3-AP 4SspI 95, 67 95, 67 -DraI 132, 30 132, 30 -

AP 9-AP 10RsaI 359, 70, 23b 429, 23b 429, 23bHincII AT: 398, 54b 452 452

AP:452AP 3-AP 10RsaI 395, 359, 141, 23b 500, 395, 23b 500, 395, 23bHincII AT: 520, 398 576, 342 918

AP:918a As calculated from the established sequence. -, no amplification product

detectable.b Fragment predicted from the sequence but not visible in the agarose gel.

MLOs seem to be placed genetically between Malus- andPrunus-affecting MLOs. The fact that DNA from Prunus- andPyrus-affecting MLOs could be amplified with primers derivedfrom a nucleotide sequence of a Malus-affecting MLO whereasthe same primers failed to detect MLOs from other woody andherbaceous plants strongly indicates a close genetic relation-ship between the European fruit tree MLOs. Previously de-signed primer pairs derived from cloned chromosomal DNAfragments of clover proliferation MLO (13) and aster yellowsMLO (4) also proved to be able to amplify DNA fragmentsfrom closely related MLOs.The RFLP observed between different Malus-affecting

MLOs confirm previous results (5) obtained after Southernhybridization with one of several probes of AP MLO (IH 184).The German AP MLO isolate AT experimentally maintainedin periwinkle could thus be differentiated from several FrenchAP MLO isolates maintained by graft inoculation in experi-mental orchards in Bordeaux. In this study we have shown thatthe Italian AP MLO isolate maintained in periwinkle seems tobe more closely related, if not identical, to the French isolates.French and Italian AP isolates can thus be regarded as onesubgroup. All the MLOs found on naturally infected appletrees in the southwest of France belong to the AP subgroup.We have shown that sequencing a cloned chromosomal

DNA fragment of a plant-pathogenic MLO is suitable forobtaining PCR primers with different degrees of specificity forthe detection of closely related MLOs. These primers, specificfor European fruit tree MLOs, will greatly facilitate thediagnosis of MLOs in infected orchards, the search for yetunknown insect vectors, and the plant breeding for MLO-resistant varieties and rootstocks.

ACKNOWLEDGMENTSWe thank D. Davies for providing pear decline-diseased, in vitro-

propagated pear plants and L. Carraro, M. F. Clark, M.-T. Cousin, G.Llacer, G. Morvan, A. Ragozzino, W. A. Sinclair, and E. Seemuller forsupplying periwinkle-maintained MLO isolates. We gratefully ac-knowledge B. Blanchard for helpful discussions on the sequence, F.Laigret for help with the computer analysis, and P. Duthil forpreparing the photos.

This work was supported by the Commission of the EuropeanUnion.

REFERENCES1. Ahrens, U., K.-H. Lorenz, and E. Seemuller. 1993. Genetic diver-

sity among mycoplasmalike organisms associated with stone fruitdiseases. Mol. Plant Microbe Interact. 6:686-691.

2. Ahrens, U., and E. Seemuller. 1992. Detection of DNA of plantpathogenic mycoplasmalike organisms by a polymerase chainreaction that amplifies a sequence of the 16S rRNA gene. Phyto-pathology 82:828-832.

3. Bernhard, R., C. Marenaud, J. Eymet, J. Sechet, A. Fos, and G.Moutous. 1977. Une maladie complexe de certains Prunus: "ledeperissement de Molieres." C. R. Acad. Agric. France 1977:178-189.

4. Bertaccini, A., R. E. Davis, R. W. Hammond, M. Vibio, M. G.Bellardi, and I. M. Lee. 1992. Sensitive detection of mycoplas-malike organisms in field-collected and in vitro propagated plantsof Brassica, Hydrangea, and Chrysanthemum by polymerase chainreaction. Ann. Appl. Biol. 121:593-599.

5. Bonnet, F., C. Saillard, A. Kollar, E. Seemuller, and J. M. Bove.1990. Detection and differentiation of the mycoplasmalike organ-ism associated with apple proliferation disease using cloned DNAprobes. Mol. Plant Microbe Interact. 3:438-443.

6. Bryant, C. P., L. Hubbard, and W. D. McElroy. 1991. Cloning,nucleotide sequence, and expression of the nitroreductase genefrom Enterobacter cloacae. J. Biol. Chem. 266:4126-4130.

7. Carraro, L., R. Osler, E. Refatti, and C. Poggi Pollini. 1988.Transmission of the possible agent of apple proliferation to Vincarosea by dodder. Riv. Patol. Veg. S.IV:43-52.

7a.Davies, D. Unpublished results.8. Davies, D. L., D. J. Barbara, and M. F. Clarlk 1993. Detection of

pear decline MLO by polymerase chain reaction. Phytopathol.Mediterr. 32:79.

9. Davies, D. L., C. M. Guise, M. F. Clark, and A. N. Adams. 1992.Parry's disease of pears is similar to pear decline and is associatedwith mycoplasma-like organisms transmitted by Cacopsylla pyri-cola. Plant Pathol. 41:195-203.

10. Davis, R E., E. L. Dally, A. Bertaccini, I. M. Lee, R. Credi, R.Osler, V. Savino, L. Carraro, B. Di Terlizzi, and M. Barba. 1993.Restriction fragment length polymorphism analyses and dot hy-bridizations distinguish mycoplasmalike organisms associated withflavescence doree and southern European grapevine yellows dis-ease in Italy. Phythopathology 83:772-776.

11. Davis, R. E., I. M. Lee, E. L. Dally, N. Dewitt, and S. M. Douglas.1988. Cloned nucleic acid hybridization probes in detection andclassification of mycoplasmalike organisms (MLOs). Acta Hortic.234:115-121.

12. Deng, S., and C. Hiruki. 1990. Enhanced detection of a plantpathogenic mycoplasma-like organism by polymerase chain reac-tion. Proc. Jpn. Acad. 66:140-144.

13. Deng, S., and C. Hiruki. 1991. Genetic relatedness between twononculturable mycoplasmalike organisms revealed by nucleic acidhybridization and polymerase chain reaction. Phythopathology81:1475-1479.

14. Dosba, F., F. Cassiau, K. Mazy, and P. Crossa-Raynaud. 1984. Ledeperissement de Molieres: etiologie et comportement de differ-ents Prunus, p. 99-107. In 4eme Colloque sur les RecherchesFruiteres, Bordeaux. CTIFL-INRA, Paris.

15. Dosba, F., M. Lansac, and J. P. Ducroquet. 1986. Experimentswith apple proliferation and detection using in vitro culture. ActaHortic. 193:323-328.

16. Dosba, F., M. Lansac, K. Mazy, M. Garnier, and J. P. Eyquard.1991. Incidence of different diseases associated with mycoplasma-like organisms in different species of Prunus. Acta Hortic. 283:311-320.

17. Gianotti, J. G., G. Morvan, and C. Vago. 1968. Micro-organismesde type mycoplasme dans les cellules liberiennes de Malus silvestrisL. atteint de la maladie des proliferation. C. R. Acad. Sci. (Paris)Ser. D 267:76-77.

18. Guinchedi, L., C. Poggi-Pollini, and R Credi. 1982. Susceptibilityof stone fruit trees to the Japanese plum-tree decline causal agent.Acta Hortic. 130:285-290.

APPL. ENVIRON. MICROBIOL.

on May 31, 2018 by guest

http://aem.asm

.org/D

ownloaded from

DIFFERENTIATION OF MLOs IN EUROPEAN FRUIT TREES BY PCR 2923

19. International Committee on Systematic Bacteriology Subcommit-tee on the Taxonomy of MoUlicutes. 1993. Minutes of the interimmeetings, 1 and 2 August 1992, Ames, Iowa. Int. J. Syst. Bacteriol.43:394-397.

20. Jarausch, W., M. Lansac, and F. Dosba. 1994. Micropropagationfor maintenance of mycoplasma-like organisms in infected Prunusmarianna GF 8-1. Acta Hortic. 359:169-176.

21. Karow, M., and C. P. Georgopoulos. 1991. Sequencing, mutationalanalysis, and transcriptional regulation of the Escherichia coli htrBgene. Mol. Microbiol. 5:2285-2292.

22. Kirkpatrick, B. C., D. C. Stenger, T. J. Morris, and A. H. Purcell.1987. Cloning and detection of DNA from a nonculturable plantpathogenic mycoplasma-like organism. Science 238:197-200.

23. Kollar, A., and E. Seemuller. 1989. Base composition of the DNAof mycoplasma-like organisms associated with various plant dis-eases. J. Phytopathol. 127:177-186.

24. Kollar, A., E. Seemuller, F. Bonnet, C. Saillard, and J. M. Bove.1990. Isolation of the DNA of various plant pathogenic mycoplas-malike organisms from infected plants. Phytopathology 80:233-237.

25. Kuske, C. R, and B. C. Kirkpatrick. 1992. Phylogenetic relation-ships between western aster yellows mycoplasmalike organism andother prokaryotes established by 16S rRNA gene sequence. Int. J.Syst. Bacteriol. 42:226-233.

26. Kuske, C. R., B. C. Kirkpatick, and E. Seemuller. 1991. Differen-tiation of virescence MLOs using western aster yellows mycoplas-ma-like organism chromosomal DNA probes and restriction frag-ment length polymorphism analysis. J. Gen. Microbiol. 137:153-159.

27. Lederer, W., and E. Seemuller. 1992. Demonstration of mycoplas-mas in Prunus species in Germany. J. Phytopathol. 134:89-96.

28. Lee, I. M., D. E. Gundersen, R. E. Davis, and L. N. Chiykowski.1992. Identification and analysis of a genomic strain cluster ofmycoplasmalike organisms associated with Canadian peach (east-ern) X disease, western X disease, and clover yellow edge. J.Bacteriol. 174:6694-6698.

29. Lim, P. O., and B. B. Sears. 1989. 16S rRNA sequence indicatesthat plant-pathogenic mycoplasmalike organisms are evolutionar-ily distinct from animal mycoplasmas. J. Bacteriol. 171:5901-5906.

30. Lim, P. O., and B. B. Sears. 1991. DNA sequence of the ribosomalprotein genes rp12 and rps19 from a plant-pathogenic mycoplasma-

like organism. FEMS Microbiol. Lett. 84:71-74.31. Lim, P. O., and B. B. Sears. 1992. Evolutionary relationships of a

plant-pathogenic mycoplasma-like organism and Acholeplasmalaidlawii deduced from two ribosomal protein gene sequences. J.Bacteriol. 174:2606-2611.

32. Marwitz, R, B. Kuhbandner, and H. Petzold. 1987. Ubertragungmykoplasmaahnlicher Organismen (MLO) von hexenbesenkran-ken Heidelbeeren (Vaccinium myrtillus) auf Catharanthus roseusmit Hilfe von Cuscuta. Nachrichtenbl. Dtsch. Pflanzenschutzd.(Stuttgart) 39:129-132.

33. Marwitz, R, H. Petzold, and M. Ozel. 1974. Untersuchungen zurUbertragbarkeit des moglichen Erregers der Triebsucht desApfels auf einen krautigen Wirt. Phytopathol. Z. 81:85-91.

34. McCoy, R E., A. Caudwell, C. J. Chang, T. A. Chen, L. N.Chiykowski, M. T. Cousin, J. L. Dale, G. T. N. de Leeuw, D. A.Golino, K. J. Hackett, B. C. Kirkpatrick, R Marwitz, H. Petzold,R C. Sinha, M. Sugiura, R F. Whitcomb, L. L. Yang, B. M. Zhu,and E. Seemuller. 1989. Plant diseases associated with mycoplas-ma-like organisms, p. 545-640. In R. F. Whitcomb and J. G. Tully(ed.), The mycoplasmas, vol 5. Spiroplasmas, acholeplasmas, andmycoplasmas of plants and arthropods. Academic Press, Inc., NewYork.

35. Morvan, G. 1977. Apricot apoplexy: apricot chlorotic leaf roll.EPPO Bull. 7:37-55.

36. Saillard, C., F. Bonnet, L. Bouneau, F. Dosba, E. Seemuller, andJ. M. Bove. 1993. DNA probes for detection of apple proliferationand chlorotic leaf roll MLOs. Phytopathol. Mediterr. 32:80.

37. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecularcloning: a laboratory manual, 2nd ed. Cold Spring Harbor Labo-ratory Press, Cold Spring Harbor, N.Y.

38. Schaff, D., I. M. Lee, and R E. Davis. 1992. Sensitive detection andidentification of mycoplasmalike organisms by polymerase chainreactions. Biochem. Biophys. Res. Commun. 186:1503-1509.

39. Schneider, B., U. Ahrens, B. C. Kirkpatrick, and E. Seemuller.1993. Classification of plant-pathogenic mycoplasma-like organ-isms using restriction-site analysis of PCR-amplified 16S rDNA. J.Gen. Microbiol. 139:519-527.

40. Watanabe, M., M. Ishidate, and T. Nohmi. 1990. Nucleotidesequence of Salmonella typhimurium nitroreductase gene. NucleicAcids Res. 18:1059.

VOL. 60, 1994

on May 31, 2018 by guest

http://aem.asm

.org/D

ownloaded from