Different endophyte communities colonize buds of sprouts...
Transcript of Different endophyte communities colonize buds of sprouts...
1
Different endophyte communities colonize buds of sprouts compared to
mature trees of mountain birch recovered from moth herbivory
Running title: Bud microbiome of mountain birch after herbivory
Pirjo Koivusaari 1, Johanna Pohjanen 1, Piippa R. Wäli1, Saija H.K. Ahonen 1, Karita
Saravesi1, Anna Mari Markkola, Kaisa Haapala 1, Marko Suokas 1, Janne J. Koskimäki
1, Mysore V. Tejesvi 1, 2, Anna Maria Pirttilä 1*
1 Ecology and Genetics, University of Oulu, PO Box 3000, FIN-90014 Oulu, Finland
2 Chain Antimicrobials, Teknologiantie 2, FIN-90590 Oulu, Finland
*Corresponding author.
Anna Maria Pirttilä
Ecology and Genetics
University of Oulu
POB 3000
90014 Oulu, Finland
Key words: arctic, bacteria, diversity, Betula, next-generation sequencing, shoot
2
Abstract
Plant meristems were earlier thought to be sterile. Today meristem-associated shoot
endophytes are mainly reported as contaminants from plant tissue cultures, the number
of observed species being very low. However, the few strains characterized have the
capacity for infecting host cells and affecting plant growth and development. Here we
studied the communities of endophytic bacteria in the buds of mountain birch exposed
to winter moth herbivory, to identify differences between sprouts and branches of
mature birch trees. Mountain birch of the high subarctic is cyclically exposed to winter
moth and produces sprouts to generate new trees as a survival mechanism. The majority
(54 %) of operational taxonomic units (OTU) belonged to Xanthomonadaceae and
Pseudomonales of Proteobacteria. Most of the observed species were classified as
Xanthomonas (28 %). Sprout buds had the highest diversity, containing approximately
three times more species, and significantly more (43 %) Pseudomonas species than the
mature trees (14 %) (Figure 4). Our results demonstrate that endophytic communities
of buds are richer than previously thought. We suggest that the meristem-associated
endophytes should be studied further for a possible role in sprouting and aiding
regeneration of trees.
3
Introduction
Endophytic bacteria that live in plant tissues have most often been studied in the roots
of crop plants where they colonize the apoplast or dead cells (Hardoim et al., 2015).
However, shoot-associated endophyte communities significantly differ from the root-
associated communities by colonization and diversity (Moore et al., 2006, Mano et
al., 2006, 2007, Izumi et al., 2008, Yrjälä et al., 2010, Compant et al., 2011).
Therefore, endophytic bacteria that colonize plant shoots can have different traits than
root endophytes considering host growth and development.
Plant shoot tips or buds were long thought to be sterile (Pierik, 1997). Even today
they are rarely studied for endophytes, apart from the occurrence of microbes in plant
tissue cultures (Reed et al., 1998, Kamoun et al., 1998, Laukkanen et al., 2000, Pirttilä
et al., 2000, Van Aken et al., 2004, Thomas et al., 2007, Ulrich et al., 2008,
Quambusch et al., 2014). The endosymbiont Methylobacterium extorquens
DSM13060 isolated from bud meristems of Scots pine is the best studied so far. This
bacterium can induce growth and development of host seedlings to the same level as
mycorrhizal fungi (Pohjanen et al., 2014). Unlike many bacterial root endophytes, the
meristem-dwelling endophytes of Scots pine do not induce plant growth through
hormones, but other compounds, such as adenine ribosides, may be responsible for
the growth effect (Pirttilä et al., 2004). Furthermore, the meristem-associated
endosymbionts of Scots pine, M. extorquens DSM13060 and Pseudomonas synxantha
DSM13080, colonize host cell interior where they aggregate around the nucleus
(Pirttilä et al., 2000, Koskimäki et al., 2015). The M. extorquens DSM13060 infection
is aided by methyl-esterified 3-hydroxybutyrate oligomers that have antioxidant
activity (Koskimäki et al., 2016). M. extorquens genome encodes several so-called
nucleomodulins, eukaryotic transcription factors that can interfere with host
4
transcription and metabolism (Koskimäki et al., 2015). All this data indicate that
meristem-associated endophytes can have an overlooked role in the growth and
development of their hosts. Therefore, these endophytes deserve detailed studies on
their diversity and distribution in plants.
Mountain birch (Betula pubescens ssp. czerepanovii ((N. I. Orlova) Hämet-Ahti) is a
tree comprising the treeline forest as the single species at the subarctic of
Fennoscandia. Besides constant herbivory by e.g. reindeer, mountain birch forests are
regularly exposed to massive outbreaks of lepidopteran herbivores, autumnal moth
(Epirrita autumnata L.) and winter moth (Operophtera brumata L.) (Tenow et al.,
2007). During repeated outbreaks, the larvae of the autumnal moth that feed on
mountain birch leaves can permanently kill birch forest within large areas, whereas
winter moth damage has earlier been restricted to river valleys and seashores (Tenow
1972, Jepsen et al., 2008). However, in 2008, the winter moth spread to exceptionally
large areas of northernmost parts of Finland, destroying ~400 km2 of mountain birch
forest, likely due to climate warming (Jepsen et al., 2008, Kaukonen et al., 2013).
Some birch trees can survive the attacks by producing defense compounds
unfavorable for the moth larvae, by compensating the loss, and by producing new
leaves after the feeding (Tenow et al., 2005, Schoonhoven et al., 2006, Tømmervik et
al., 2005, Wielgolaski 2005). Due to high herbivory pressure and extreme growth
conditions, the main mechanism of propagation and survival of mountain birch after
moth herbivory, and in general, is sprouting (Karlsson et al., 2004). Whereas fungal
endophytes and epiphytes of mountain birch leaves and their role in herbivory
resistance have been extensively studied (e.g. Helander et al., 1993, Lappalainen and
Helander 1997, Ahlholm et al., 2002), bacterial endophytes have not been considered
5
in relation to herbivory. To characterize the diversity and niche occupation of
meristem-associated endophytes, we analyzed by next-generation sequencing (NGS)
the bacterial communities of buds of mountain birch after winter moth herbivory.
Materials and Methods
Experimental setup
Material used in the study was mountain birch buds collected from subarctic
Kaldoaivi Wilderness Area located in Utsjoki, Finland (Mieraslompolo 7 724° 056’
N, 510° 527’ E; 255 m) in August 2012 (Figure 1). Samples were collected from an
area where altogether 400 km2 of mountain birch forest had suffered from severe
winter moth attack (Kaukonen et al., 2013, Saravesi et al., 2015). Samples were taken
from five tree groups (OP5, OP7, OP8, OP10, OP13), comprising susceptible
(partially recovered) and tolerant (totally recovered controls) mature mountain birches
and their sprouts (Figure 1, Table I). Three branch samples of 5-15 cm in length were
collected from each tree. In addition, sprout samples (max. three per tree) were
collected from all groups expressing sprouting and having live sprouts (Figure 1,
Table I). The initial sample size was 45 (one bud per branch or sprout, three branches
or sprouts per tree), and after collection the samples were transported at +4 °C to
laboratory, where buds were separated and stored frozen (-80 °C) until used for DNA
isolation. Each bud was treated individually in the analysis. During handling in the
laboratory, some buds were dismissed and the resulting final sample size in the
analyses was 33 buds (Table I).
DNA Extraction
6
Before DNA extraction, the bud samples were surface sterilized to exclude epiphytes.
Samples were kept in 4 % calcium hypochlorite for 15 minutes and rinsed three times
with sterile water for ten minutes in a laminar flow hood. After the surface
sterilization, samples were ground in liquid nitrogen. DNA was extracted from 40 mg
of frozen plant material by using DNeasy Plant Mini Kit (Qiagen, USA). Before using
the kit, two additional steps were done. First, 300 µl of lysozyme in TE-buffer (50
mg/ml) was added, and the samples were incubated for 15 minutes at room
temperature. Then, 30 µl of 10 % SDS and 10 µl of proteinase K (20 mg/ml) were
added, and samples were incubated at 50 °C for 15 minutes. After this, the kit
protocol was followed according to manufacturer’s instructions from step 1 (addition
of AP1 buffer) onwards. The pure DNA was eluted with 50 µl of molecular grade
water and stored at -20 °C until used. NanoDrop 1000 (Thermo Scientific,
Wilmington, USA) was used to quantify the DNA.
Designing of primers specific for endophytic bacteria
For testing specificity of primers, DNA was isolated as described above from leaves
of downy birch (Betula pubescens Ehrh.) collected from the Biodiversity Unit, Oulu,
Finland (65° N; 25°30’ E; 5 m), which comprises botanical greenhouse gardens and
field collections (http://www.oulu.fi/biodiversityunit/), and DNA of
Methylobacterium extorquens DSM13060 was isolated as described by Koskimäki et
al., (2015).
The 16S rDNA genes of Methylobacterium extorquens DSM13060 (AF267912),
Amycolicicoccus subflavus DQS3-9A1 (NR_116057), Lactobacillus rhamnosus NT10
(JN813101), Olivibacter ginsengisoli Gsoil 060 (NR_041504), Pinus taeda
7
chloroplast (KC427273), and Abies homolepis mitochondria (AB029360) were
aligned in ClustalW. The alignment was manually scanned for short (~20 nt)
sequences similar between the bacterial and different from chloroplast and
mitochondria sequences. The selected potential primers were tested for hairpin, self-
dimer and hetero-dimer formation in OligoAnalyzer Tool 3.1 (IDTDNA) and
analyzed by programs Probe Match (Cole et al., 2014) in RDP and BLASTN (Benson
et al., 2013) in Genbank for similarity with bacteria, chloroplast and mitochondrial
sequences. The primers selected for Ion Torrent sequencing were F22 (5-AGC AGC
CGC GGT AAT ACG W-3; Escherichia coli 16S gene positions 518-537, Genbank
accession no. J01859.1) and R21 (5-TAA TCC TGT TYG CTC CCC AC-3; E. coli
positions 769-789).
Gradient PCR
Optimal PCR conditions for microbial DNA amplification with minimal amplified
plant mitochondrial or chloroplast DNA were then tested by gradient PCR (Veriti®
96-Well Thermal Cycler, Thermo Scientific, Finland), i.e. that the primers would only
bind to microbial DNA, and not to chloroplast, mitochondrial or birch genome DNA.
DNA of downy birch and Methylobacterium extorquens DSM13060 were used as the
control template. Theoretical melting temperatures were 59.3 °C for F22 and 55.6 °C
for R21, and the temperature gradient tested was from 50.7 °C to 62.4 °C. The
following cycling conditions were used in gradient PCR: 4 min; 27 cycles of 95 °C,
15 sec; 55 °C or 57 °C (gradient ± 5 °C), 15 sec; 72 °C, 30 sec after an initial
denaturation of 95 °C. PCR reactions were performed in 50-µl reactions, each
containing 1x Phusion GC buffer, 10 µM of forward and reverse primers, 0.2 mM
8
dNTPs, 50 ng of DNA template and 0.5 U of Phusion High-Fidelity DNA Polymerase
(Thermo Scientific, Espoo, Finland).
Amplification of bacterial rRNA genes by Ion Torrent
A fragment of the 16S small-subunit ribosomal gene was amplified with the primers
F22 and R21. The F22 primer contained an Ion Torrent sequencing adapter sequence
A (Lifescience Technologies, USA), 10-bp unique barcode sequence and one
nucleotide linker. The R21 primer contained an Ion Torrent adapter trP1 sequence.
The amplification was performed in 50-µl reactions, each containing 1x Phusion GC
buffer, 0.4 µM of forward and reverse primers, 0.2 mM dNTPs, 0.5 U of Phusion
High-Fidelity DNA Polymerase, 3 % dimethyl sulfoxide (DMSO), 0.2 mg/ml of
bovine serum albumin (BSA), and 20 ng of genomic community DNA of each
mountain birch bud sample as the template. For sequencing, each individual PCR
product was purified with Ampure XP reagent (Agencourt Bioscience, CA, USA),
concentration was measured with Quant-IT PicoGreen reagent (ThermoFisher
Scientific), and size and purity were determined with MultiNA capillary electrophosis
system (Shimadzu, Kyoto, Japan). Samples were then pooled in equivalent amounts,
the resulting pool was re-purified with AMPure XP reagent, and the final DNA
concentration was measured with Quant-IT PicoGreen reagent. Ion Torrent PGM
sequencing was performed at Biocenter Oulu Sequencing Center (Univ. Oulu, Oulu,
Finland) using 400 bp chemistry and 314 v2 kit.
Bioinformatics and statistical analyses
The Ion Torrent sequences were processed and analyzed using the state-of-the-art
procedures of QIIME (Caporaso et al., 2010). Sequences were quality filtered with the
9
following adjustments: sequences shorter and longer than 200-600 bp length and
sequences with a quality score under 20 were removed. UCLUST (Edgar 2010) was
used for the de novo operational taxonomic unit (OTU) picking with a sequence
similarity value of 97%, and for taxonomic assignments. Chimeric sequences were
identified using blast fragments approach (Altschul et al., 1990) and removed from the
data. GreenGenes (McDonald et al., 2012, Werner et al., 2012) was used as a reference
database. Alpha diversity indices (Chao1, Shannon, Simpson) were calculated in
QIIME and statistical significances were tested with the Mann-Whitney U test in SPSS
program between tree groups, and between tolerant and susceptible trees, and between
mature trees and sprouts.
Isolation and identification of endophytic bacteria from buds of mature mountain
birch branches
An additional sampling of 42 buds was performed on randomly selected three
mountain birches from the same forest where the initial sampling took place, with the
aim of isolating endophytic Pseudomonas sp. for further testing. The samples were
collected as branches of 5-15 cm, as the selected trees had no sprouts. After
collection, the samples were transported at +4 °C to the laboratory, where buds were
separated from branches and immediately processed further. The buds were surface
sterilized with 4 % calcium hypochlorite for 15 min and rinsed three times with sterile
water. The buds were individually ground with mortar and pestle in 100 µl sterile
distilled water. The mixture of ground tissue and water was transferred with a pipette
onto LB-medium and grown for up to eight months. Emerging microbial growth was
isolated and tentatively classified under light microscope as filamentous fungi, yeasts,
10
or bacteria. Bacterial isolates were transferred onto a new LB plate and further
identified by sequencing the internal transcribed spacer region (ITS) of ribosomal
RNA genes.
Briefly, a few bacterial cells were taken from a pure fresh culture in a PCR reaction
mixture of 0.4 µM primers (FGPS1490-72: TGCGGCTGGATCCCCTCCTT,
FGPL132-38: CCGGGTTTCCCCATTCGG) (Normand et al., 1996), 1x Phusion GC
buffer, 0.2 mM dNTPs, 0.5 U of Phusion High-Fidelity DNA Polymerase and water up
to 20 µl. The following cycling conditions were used in PCR: 30 cycles of 98 °C, 10
sec; 65 °C, 15 sec; 72 °C, 30 sec after an initial denaturation of 98 °C for 3 min. The
resulting PCR products were sequenced according to the manufacturer’s instructions
(Abi Prism BigDye Terminator Cycle Sequencing Kit and AbiPrism 377 DNA
Sequencer, PerkinElmer).
Results
Specificity of sequencing primers
The 16S ribosomal RNA gene was scanned thoroughly using alignments of species
from various bacterial classes and plant mitochondria and chloroplast, to find short
20-bp regions that would be most specific to bacteria and not mitochondria and
chloroplast. The primers were designed to amplify a 200-300-nucleotide long region
suitable for sequencing with the Ion Torrent Sequencer, and to contain a
hypervariable region of the ribosomal 16S RNA gene. As a result, the primers F22
and R21 were identified as the best primer candidates for Ion Torrent sequencing,
generating a 271-bp long PCR product from the hypervariable region v4 of bacterial
11
16S rRNA gene. When the specificity of the primers F22 and R21 was tested by
gradient PCR, 2-7 bands were amplified from downy birch DNA at temperatures of
50.7-62.4 °C (Figure 2). In the temperature of 62.4 °C, only one band was amplified
of the same size as the PCR product from the genomic DNA of Methylobacterium
extorquens DSM13060 (Figure 2). Therefore, the most specific amplification was
obtained at the annealing temperature of 62.4 °C and used in the following PCR
reactions.
Total microbiome of mountain birch buds
From the original sample collection, 12 bud samples were dismissed for various
reasons, and therefore the final number of sequenced bud samples was 33 (Table I).
Specifically, 26 mature tree bud samples, of which 14 originated from susceptible
trees and 12 from tolerant trees, and 7 sprout bud samples were successfully analyzed
(Table I). Among all sequences analyzed, 16 % were mitochondrial and 6 %
chloroplast, which were removed from the dataset. A total of 182 operational
taxonomy units (OTUs) were identified from the complete dataset. The majority of
the OTUs (84 %) belonged to the phylum Proteobacteria. In addition, OTUs
belonging to phyla Firmicutes (9 %), Bacterioidetes (4 %) and Actinomycetales (2.5
%) were identified among the microbiome of mountain birch buds (Figure 3). At the
family level, the majority of the OTUs were identified into the families
Xanthomonadaceae (33 %) and Pseudomonales (21 %). The OTUs belonged mainly
to genera Pseudomonas (21 %), Xanthomonas (28 %) and Burkholderia (10 %),
Stenotrophomonas (5 %), Achromobacter (4 %), Lactococcus (4 %),
12
Lachnospiraceae (4 %), Cloacibacterium (3 %), Sphingomonas (3 %), and
Curvibacter (3 %).
In the complete dataset, the Shannon and Simpson indices varied in the samples
between 0.65 - 4.49 and 0.27 - 0.94, respectively (Table II), indicating the overall
varying bacterial diversity in the community. We found no statistically significant
differences in the bacterial diversity measured by Shannon, Simpson and Chao-1
indices between susceptible and tolerant trees, or between mature trees and sprouts
(Table III).
The microbiome of mature tree buds
The majority of the OTUs in the bud microbiome of mature trees belonged to the
family Xanthomonadaceae (33 %). In addition, members of Burkholderiales (11 %),
Pseudomonadeacae (14 %), Firmicutes (9 %), Bacteroidetes (5 %) and
Actinomycetales (3 %) were present (Figure 4a). There were no statistically
significant differences in the microbiomes between the tree groups, or between
tolerant and susceptible trees. OTUs belonging to the genera Curvibacter (3 %),
Tepidimonas (3 %), Achromobacter (5 %), Lactococcus (5 %) and Cloacibacterium
(4 %) were more abundant, although not statistically significantly, in the buds of
mature trees than sprouts.
The microbiome of sprout buds
13
The highest diversity of endophytes was observed in the buds collected from sprouts.
On average, three times more OTUs were observed in sprout buds than in mature tree
buds. The microbiome of sprout buds consisted mainly of OTUs belonging to
Pseudomonacaeae (43 %), and members of Xanthomonadaceae (10 %),
Enterobacteriales (8 %) and Burkholderiales (9 %) were the minority (Figure 4b).
Overall, the sprout bud microbiome had fewer OTUs belonging to phyla Firmicutes
(3 %), Bacteroidetes (3 %) and Actinomycetales (1 %), than that of mature trees.
Sprout buds had more members belonging to Erwinia (5 %), Ralstonia (3 %),
Sphingomonas (7 %), Rhizobium (3 %) and Methylobacterium (2 %) than mature tree
buds. However, these differences were not statistically significant. The only
statistically significant difference (p=0.011) was the relative abundance of
Pseudomonas species (43 %) in buds collected from sprouts than those from mature
trees (14 %).
Cultivable endophytic bacteria of mountain birch buds
Altogether 15 microbial strains were isolated from 12 mountain birch buds among the
total of 42 buds examined (28.6 % isolation frequency). Of the strains isolated, nine
were filamentous fungi, two yeasts, and four bacterial strains, but due to the objective
of isolating Pseudomonas spp., the filamentous fungi and yeasts were not studied
further. Two bacterial strains had identical sequences of internal transcribed spacer
(ITS) region of ribosomal RNA gene and were similar with Micrococcus luteus sp.
(Genbank No. CP007437.1). Two other strains also had identical ITS sequences and
were classified as an unknown strain with the closest match of 27 % for
14
Corynebacterium deserti strain (CP009220.1) in BLAST database search. One M.
luteus strain and one Corynebacterium-like strain originated from the same bud.
Discussion
Overall, our knowledge on microbial diversity in plant buds is scarce. Earlier, it was
thought that the bud tissues are the most sterile tissues of the plant (Pierik 1997). The
first reports on endophytes in plant buds have demonstrated zero to few species
present, obtained by isolation from bud-derived tissue cultures (Reed et al., 1998,
Kamoun et al., 1998, Laukkanen et al., 2000, Pirttilä et al., 2000, Van Aken et al.,
2004). For example, a few strains of endophytic bacteria were isolated from the tissue
cultures of hazelnut (Reed et al., 1998) and a Pseudomonas sp. was identified from
micropropagated sour cherry plantlets (Kamoun et al., 1998). We have earlier isolated
Methylobacterium extorquens, Pseudomonas synxantha and Mycobacterium sp. from
buds or bud-derived tissue cultures of Scots pine (Laukkanen et al., 2000, Pirttilä et
al., 2000) and localized these bacteria as endophytes in the meristematic tissues of
pine buds (Pirttilä et al. 2000, 2005). An important discovery was made when an
AFLP-cDNA library was sequenced from buds of poplar (Rohde et al. 2007).
Bacterial sequences were identified in the library, indicating an active community
participating in dormancy of the poplar buds. However, the libraries were made from
non-sterilized samples (Rohde et al. 2007) and therefore could also represent
epiphytic activity. Recently, Miliute et al. (2016) isolated altogether 38 bacterial
strains from an undefined number of surface-sterilized apple buds, which suggested
that buds may harbor a richer community of endophytic bacteria than previously
thought.
15
In the present study, the number of endophytes was at the same level in the buds of
mountain birch, as is found in other plant tissues by next-generation sequencing. For
example, root segments of Populus deltoides contained 83 ± 78 endophytic OTUs
identified by pyrosequencing (Gottel et al., 2011). Our study demonstrates that as
many as 182 OTUs can be identified in a bud endophytic microbiome. Although
surface sterilization protocols do not eliminate potential epiphytic DNA remains, this
is significantly more than expected, considering the 0-3 isolates typically obtained. In
our study, the isolation technique resulted in two bacterial strains obtained from 42
bud samples. In contrast, bacterial endophytes isolated from root, or stem, typically
reach higher numbers. For example, elm trees can have cultivable bacteria between
39-62 haplotypes in stems and roots (Mocali et al., 2003). This suggests that plants
harbor mainly unculturable endophytes in the bud tissues.
It is not possible to conclude, based on this study, whether high diversity of bacteria
in buds is beneficial, harmful, or neutral for the host plant. The fact that sprouts had
significantly higher diversity of microbiome in the buds than adult trees is regardless
interesting in the light of existing research data. For example, the meristem-associated
endophyte of Scots pine, M. extorquens DSM13060, can induce growth and health of
the host through production of adenine ribosides and methyl-esterified 3-
hydroxybutyrate oligomers, and by directly affecting host metabolism (Pirttilä et al.,
2004, Koskimäki et al., 2015, Pohjanen et al., 2014, Koskimäki et al., 2016).
However, the role of bud endophytes of mountain birch in sprouting and growth
remains to be studied in the future.
16
The bacterial microbiome of mountain birch has not been earlier studied. Izumi et al.,
(2008) analyzed the endophytes of mature silver birch (Betula pendula Roth) trees by
culturing and identifying the isolated strains by sequencing. They discovered Bacillus
spp. and Acinetobacter spp. as the most common endophytes in silver birch stem and
leaves, but neither of these were identified in mountain birch buds in our study.
Similarly, Izumi et al., (2008) reported none of the species in silver birch that we
found abundant in mountain birch buds, Xanthomonas, Pseudomonas, and
Burkholderia. This is not surprising, considering the completely different habitats and
environmental growth conditions, as well as different tissues of these two species
studied. Mountain birch is the main tree species present in the ecosystem of the
subarctic treeline, where it forms monocultures.
In our study, Pseudomonas spp. were significantly more abundant in sprout buds than
in buds of mature trees. After herbivory, the mature trees of mountain birch produce
more sprouts as a recovery mechanism (Karlsson et al., 2004). In general,
Pseudomonas spp. are often isolated as endophytes, and some strains have been
reported as plant growth promoting, P. synxantha, from buds of Scots pine (Pirttilä et
al., 2004), four Pseudomonas sp. isolates (Oa_2, O_16, D_7, Ga_1) from apple buds
(Miliute et al., 2016), and P. putida W619 from Populus trichocarpa × deltoides
(Taghavi et al., 2009). Because Pseudomonas spp. are normally rather easy to
cultivate on laboratory media, we attempted to isolate these bacteria from buds of
mountain birch for testing their potential growth effect on birch in vitro. However, no
Pseudomonas strains grew out from the bud tissues, instead we obtained a
Micrococcus sp. and a Corynebacterium-like strain. This means that the
Pseudomonas spp. present in mountain birch buds are probably unculturable, and
might have more or less intimate relationship with their hosts. We suggest that the
17
Pseudomonas spp. of mountain birch buds should be studied further for a possible
role in sprouting and aiding regeneration of trees.
Acknowledgements
We would like to thank the Nature Conservation Societies of Oulu and Kuopio,
Finland. Gerhardus Lansink, Nelli Mikkola, Ruwanthi Tissera and Visa Kamppari are
gratefully acknowledged for technical help. We declare no conflict of interest or
relationship, financial or otherwise, that might be perceived as influencing an author’s
objectivity is considered a potential source of conflict of interest.
References
Ahlholm J, Helander M, Elamo P, Saloniemi I, Neuvonen S, Hanhimäki S,
Saikkonen K. (2002) Micro-fungi and invertebrate herbivores on birch trees:
fungal mediated plant-herbivore interactions or responses to host quality? Ecol.
Lett. 5:648-655.
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. (1990) Basic local
alignment search tool. J Mol Biol 215:403-410.
Benson DA, Cavanaugh M, Clark K, Karsch-Mizrachi I, Lipman DJ, Ostell J,
Sayers EW (2013) GenBank. Nucleic Acids Res. 41:D36-42.
Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK,
Fierer N, Peña AG, Goodrich JK, Gordon JI, Huttley GA, Kelley ST, Knights D,
Koenig JE, Ley RE, Lozupone CA, McDonald D, Muegge BD, Pirrung M,
18
Reeder J, Sevinsky JR, Turnbaugh PJ, Walters WA, Widmann J, Yatsunenko T,
Zaneveld J, Knight R (2010) QIIME allows analysis of high-throughput
community sequencing data. Nature Meth. 7:335-336.
Cole JR, Wang Q, Fish JA, Chai B, McGarrell DM, Sun Y, Brown CT, Porras-Alfaro
A, Kuske CR, Tiedje JM. (2014) Ribosomal Database Project: data and tools for
high throughput rRNA analysis. Nucleic Acids Res. 42:D633-42.
Compant S, Mitter B, Colli-Mull JG, Gangl H, Sessitsch A. (2011) Endophytes of
grapevine flowers, berries, and seeds: identification of cultivable bacteria,
comparison with other plant parts, and visualization of niches of colonization.
Microb. Ecol. 62:188-197.
Edgar RC. (2010) Search and clustering orders of magnitude faster than BLAST.
Bioinformatics 26:2460-2461.
Gottel, NR, Castro HF, Kerley M, Yang ZM, Pelletier DA, Podar M, Karpinets T,
Uberbacher E, Tuskan GA, Vilgalys R, Doktycz MJ, Schadt CW (2011) Distinct
microbial communities within the endosphere and rhizosphere of Populus
deltoides roots across contrasting soil types. Appl. Environ. Microbiol. 77:5934–
5944.
Helander ML, Neuvonen S, Sieber T, Petrini O. (1993) Simulate acid rain affects birch
leaf endophyte population. Microbial Ecol. 26:227-234.
Izumi H, Anderson IC, Killham K, Moore ERB. (2008) Diversity of predominant
endophytic bacteria in European deciduous and coniferous trees. Can J. Microbiol.
54:173-179.
Jepsen JU, Hagen SB, Ims RA, Yoccoz NG. (2008) Climate change and outbreaks of
the geometrids Operopthera brumata and Epirrita autumnata in subarctic birch
forest: evidence of a recent outbreak range expansion. J. Animal Ecol. 77:257-264.
19
Kamoun R, Lepoivre P, Boxus P. (1998) Evidence for the occurrence of endophytic
prokaryotic contaminants in micropropagated plantlets of Prunus cerasus cv.
‘Montgomery’. Plant Cell Tiss.Org. Cult. 52:57–59.
Karlsson PS, Tenow O, Bylund H, Hoogesteger J, Weih M. (2004) Determinants of
mountain birch growth in situ: effects of temperature and herbivory. Ecography
27:659-667.
Kaukonen M, Ruotsalainen AL, Wäli PR, Männistö MK, Setälä H, Saravesi K,
Huusko K, Markkola A. (2013) Moth herbivory enhances resource turnover in
subarctic mountain birch forests? Ecology 94:267-272.
Koskimäki JJ, Pirttilä AM, Ihantola E-L, Halonen O, Frank C. (2015) The
intracellular Scots pine shoot symbiont Methylobacterium extorquens DSM13060
aggregates around the host nucleus and encodes eukaryote-like proteins. mBio
6:e00039-15.
Koskimäki JJ, Kajula M, Hokkanen J, Ihantola E-L, Kim JH, Hautajärvi H, Hankala
E, Suokas M, Pohjanen J, Podolich O, Kozyrovska N, Turpeinen A, Pääkkönen M,
Mattila S, Campbell BC, Pirttilä AM (2016) Methyl-esterified 3-hydroxybutyrate
oligomers protect bacteria from hydroxyl radicals. Nature Chem. Biol. 12:332–
338.
Laukkanen H, Soini H, Kontunen-Soppela S, Hohtola A, Viljanen M. (2000) A
mycobacterium isolated from tissue cultures of mature Pinus sylvestris interferes
with growth of Scots pine seedlings. Tree Physiol. 20:915–920.
Lappalainen JH, Helander ML. (1997) The role of foliar microfungi in mountain birch
– insect herbivore relationships. Ecography 20:116-122.
20
Mano H, Tanaka F, Nakamura C, Kaga H, Morisaki H. (2007) Culturable endophytic
bacterial flora of the maturing leaves and roots of rice plants (Oryza sativa)
cultivated in a paddy field. Microbes Environ. 22:175-185.
Mano H, Tanaka F, Watanabe A, Kaga H, Okunishi S, Morisaki H. (2006) Culturable
surface and endophytic bacterial flora of the maturing seeds of rice plants (Oryza
sativa) cultivated in a paddy field. Microbes Environ. 21:86-100.
McDonald D, Price MN, Goodrich J, Nawrocki EP, DeSantis TZ, Probst A, Andersen
GL, Knight R, Hugenholtz P. (2012) An improved Greengenes taxonomy with
explicit ranks for ecological and evolutionary analyses of bacteria and archaea.
ISME J 6:610–618.
Miliute I, Buzaite O, Gelvonauskienė D, Sasnauskas A, Stanys V, Baniulis D. (2016)
Plant growth promoting and antagonistic properties of endophytic bacteria isolated
from domestic apple. Zemdirbyste-Agriculture 103:77-82.
Mocali S, Bertelli E, Di Cello F, Mengoni A, Sfalanga A, Viliani F, Caciotti A, Tegli
S, Surico G, Fani R (2003) Fluctuation of bacteria isolated from elm tissues during
different seasons and from different plant organs. Res. Microbiol. 154:105-114.
Moore FP, Barac T, Borremans B Oeyen L, Vangronsveld J, van der Lelie D,
Campbell CD, Moore ER. (2006) Endophytic bacterial diversity in poplar trees
growing on a BTEX-contaminated site: The characterisation of isolates with
potential to enhance phytoremediation. Syst. Appl. Microbiol. 29:539-556.
Normand P, Ponsonnet C, Nesme X, Neyra M, Simonet P. (1996) ITS analysis of
prokaryotes. In: Akkermans DL, van Elsas JD, de Bruijn FJ. (eds) Molecular
21
Microbial Ecology Manual. Kluwer Academic Publishers: Dordrecht, The
Netherlands, pp 1–12.
Pierik RLM. (1997) In vitro culture of higher plants. Kluwer Academic Publishers:
Dordrecht, the Netherlands, 353 p.
Pirttilä AM, Laukkanen H, Pospiech H, Myllylä R, Hohtola A. (2000) Detection of
intracellular bacteria in the buds of Scots pine (Pinus sylvestris L.) by in situ
hybridization. Appl. Environ. Microbiol. 66:3073-3077.
Pirttilä AM, Joensuu P, Pospiech H, Jalonen J, Hohtola A. (2004) Bud endophytes of
Scots pine produce adenine derivatives and other compounds that affect
morphology and mitigate browning of callus cultures. Physiol. Plant. 121:305-312.
Pirttilä AM, Pospiech H, Laukkanen H, Myllylä R, Hohtola A. (2005) Seasonal
variation in location and population structure of endophytes in buds of Scots pine.
Tree Physiol. 25:289-297.
Pohjanen J, Koskimäki JJ, Sutela S, Ardanov P, Suorsa M, Niemi K, Sarjala T,
Häggman H, Pirttilä AM. (2014) The interaction with ectomycorrhizal fungi and
endophytic Methylobacterium affects the nutrient uptake and growth of pine
seedlings in vitro. Tree Physiol. 34:993-1005.
Quambusch M, Pirttilä AM, Tejesvi MV, Winkelmann T, Bartsch M. (2014)
Endophytic bacteria in plant tissue culture: differences between easy- and difficult-
to-propagate Prunus avium genotypes. Tree Physiol. 34:524–533.
Reed BM, Mentzer J, Tanprasert P, Yu X. (1998) Internal bacterial contamination of
micropropagated hazelnut: identification and antibiotic treatment. Plant Cell Tiss.
Org. Cult. 52:67-70.
22
Rohde A, Ruttink T, Hostyn V, Sterck L, Van Driessche K, Boerjan W. (2007) Gene
expression during the induction, maintenance, and release of dormancy in apical
buds of poplar. J. Exp. Bot. 58:4047-4060.
Saravesi K, Aikio S, Wäli PR, Ruotsalainen AL, Kaukonen M, Huusko K, Suokas M,
Brown SP, Jumpponen A, Tuomi J, Markkola A. (2015) Moth outbreaks alter root-
associated fungal communities in subarctic mountain birch forests. Microb. Ecol.
69:788-797.
Schoonhoven LM, van Loon JJA, Dicke M. (2006) Insect-plant biology. (2nd edition).
Oxford University Press, New York.
Taghavi S, Garafola C, Monchy S, Newman L, Hoffman A, Weyens N, Barac T,
Vangronsveld J, van der Lelie D (2009) Genome survey and characterization of
endophytic bacteria exhibiting a beneficial effect on growth and development of
poplar. Appl. Environ. Microbiol. 75: 748–57.
Tenow O. (1972) The outbreaks of Oporinia autumnata Bkh. and Operophthera spp.
(Lep., Geometridae) in the Scandinavian mountain chain and northern Finland
1862-1968. Zoologiska Bidrag från Uppsala. Supplement 2:1-107.
Tenow O, Bylund H, Nilssen AC, Karlsson PS. (2005) Long-term influence of
herbivores on northern birch forests. In: Wielgolaski FE, Karlsson PS, Neuvonen
S, Thannheiser D. (eds) Plant ecology, herbivory, and human impact in Nordic
mountain birch forests. Springer, pp 165-181.
Tenow O, Nilssen AC, Bylund H, Hogstad, O. (2007) Waves and synchrony in
Epirrita autumnata/Operophtera brumata outbreaks. I. Lagged synchrony:
regionally, locally and among species. J. Animal Ecol. 76:258-268.
23
Thomas P, Kumari S, Swarna GK, Prakash DP, Dinesh MR. (2007) Ubiquitous
presence of fastidious endophytic bacteria in field shoots and index-negative
apparently clean shoot-tip cultures of papaya. Plant Cell Rep. 26:1491–1499.
Tømmervik H, Wielgolaski FE, Neuvonen S, Solberg B, Høgda KA. (2005) Biomass
and production on a landscape level in the mountain birch forest. In: Wielgolaski
FE, Karlsson PS, Neuvonen S, Thannheiser D. (eds) Plant ecology, herbivory, and
human impact in Nordic mountain birch forests. Springer, pp 53-70.
Ulrich K, Ulrich A, Ewald D. (2008) Paenibacillus – a predominant endophytic
bacterium colonizing tissue cultures of woody plants. Plant Cell Tiss. Org. Cult.
93:347–351.
Van Aken B, Peres CM, Doty SL, Yoon JM, Schnoor JL (2004) Methylobacterium
populi sp. nov., a novel aerobic, pink-pigmented, facultatively methylotrophic,
methane-utilizing bacterium isolated from poplar trees ( Populus deltoides x nigra
DN34). Int. J. Syst. Evol. Microbiol. 54:1191–1196.
Werner JJ, Koren O, Hugenholtz P, DeSantis TZ, Walters WA, Caporaso JG,
Angenent LT, Knight R, Ley RE. (2012) Impact of training sets on classification
of high-throughput bacterial 16S rRNA gene surveys. ISME J 6:94-103.
Wielgolaski FE. (2005) History and environment of the Nordic mountain birch. In:
Wielgolaski FE, Karlsson PS, Neuvonen S, Thannheiser D. (eds) Plant ecology,
herbivory, and human impact in Nordic mountain birch forests. Springer, pp 3-18.
Yrjälä K, Mancano G, Fortelius C, Åkerman M-L, Sipilä T-P. (2010) The incidence
of Burkholderia in epiphytic and endophytic bacterial cenoses in hybrid aspen
grown on sandy peat. Boreal Environ. Res. 15:81-96.
24
25
Table I. Experimental setup describing the samples obtained from each tree group (OP).
Tree Group Tree status Branch buds Sprout buds
Tolerant 1 1
OP5 Susceptible 3 *
Tolerant 3 *
OP7 Susceptible 3 1
Tolerant 3 1
OP8 Susceptible 3 2
Tolerant 3 *
OP10 Susceptible 3 2
Tolerant 2 *
OP13 Susceptible 2 *
* No living sprouts present
Table II. Alpha diversity indices (Chao1, Shannon, Simpson) of the bacterial
communities in mountain birch bud samples from mature trees (susceptible or tolerant)
and their sprouts.
Tree group Tree status Simpson Shannon Chao1
OP5 Tolerant 0.80 2.45 7
OP7 Tolerant 0.84-0.88 2.75-3.42 14.5-
21.25
OP8 Tolerant 0.5-0.94 1.0-4.33 3.0-
24.67
OP10 Tolerant 0.67 1.58-1.79 6.0-7.0
OP13 Tolerant 0.61-0.81 1.45-2.96 3.0-
31.0
OP5 Susceptible 0.28-0.8 0.65-2.32 2.0-
15.0
OP7 Susceptible 0.64-0.81 1.87-2.52 6.5-
11.0
26
OP8 Susceptible 0.75-0.89 2.0-3.53 10.0-
27.0
OP10 Susceptible 0.55-0.56 1.37-2.17 4.0-
34.17
OP13 Susceptible 0.79-0.92
3.17-3.93
30.0-
49.0
OP5 Tolerant sprout 0.89 4.49 72.21
OP8 Tolerant sprout 0.56 1.37 4.0
OP7 Susceptible
sprout
0.85 3.66 58.20
OP8 Susceptible
sprout
0.56-0.91 1.37-3.74 4-35.17
OP10 Susceptible
sprout
0.90-0.93
3.84-4.69
32.0-
57.05
27
Table III. Statistical significances of the Simpson, Shannon and Chao1 indices of the
bacterial communities in mountain birch bud samples between tolerant and susceptible
trees, and mature trees and sprouts, tested by the Mann-Whitney U test in SPSS.
Simpson’s index Shannon’s index Chao1
Tree status Mann-
Whitney U
p-value Mann-Whitney U p-value Mann-
Whitney U
p-value
Tolerant ×
Susceptible
79 0.325 65 0.107 59.5 0.059
Mature ×
Sprout
61.5 0.438 76.5 0.980 47 0.135
28
Figure Legends
Figure 1. Schematic diagram of the experimental setup and example trees. a) Bud
samples were collected from branches and sprouts of five mountain birch tree groups
suffered from severe moth attack. Each tree group contained a tolerant (totally
recovered) and a susceptible (partially recovered) tree, and their sprouts, if present. (b-
d) Examples of mountain birch trees sampled after winter moth herbivory. b) Tolerant
birch tree from group OP5 which had leaves in the majority (>70 %) of all branches, c)
Susceptible birch tree from group OP13 which had re-emerged leaves in some (30-70
%) branches, d) Sprout of susceptible birch from group OP8.
Figure 2. Testing the specificity of primers F22 and R21 on bacterial ribosomal 16S
rRNA gene. The sample DNAs were genomic DNA of Methylobacterium extorquens
DSM13060 (lanes 10-14, 15-21) and downy birch DNA (lanes 2-9, 22-27). Lanes 1,
15, Mass Ruler (Fermentas). The products were separated on 1 % agarose gel stained
with ethidium bromide. Products are shown from gradient PCR reactions with
annealing temperatures of 50.7 °C (lanes 2, 10), 51.6 °C (lanes 3, 11), 52.7 °C (lane 4),
54.0 °C (lanes 5, 12), 55.4 °C (lanes 6, 13), 56.8 °C (lanes 7, 14), 57.0 °C (lane 8), 57.4
°C (lanes 9, 16), 58.8 °C (lanes 17, 22), 59.4 °C (lane 23) 60.1 °C (lanes 18, 24), 61.2
°C (lanes 19, 25), 62.0 °C (lanes 20, 26), 62.4 °C (lanes 21, 27).
29
Figure 3. The relative abundance of total microbiome of mountain birch buds (N=
33). The most dominant genera found were Xanthomonas (28 %), Pseudomonas (21
%), Burkholderia (10 %) and Stenotrophomonas (5 %).
Figure 4. The microbiomes of buds of mature trees (a) and sprouts (b). a) The
majority of the OTUs in the bud microbiome of mature trees belonged to the family
Xanthomonadaceae (33 %). b) The microbiome of sprout buds consisted mainly of
OTUs belonging to Pseudomonacaeae (43 %).