Dgaston dec-06-2012
-
Upload
dan-gaston -
Category
Technology
-
view
439 -
download
0
description
Transcript of Dgaston dec-06-2012
![Page 1: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/1.jpg)
Integrated Learning Session
Daniel Gaston, PhD
Dr. Karen Bedard Lab, Department of Pathology
Bioinformatics: Intro to RNA-Seq Analysis
December 6th, 2012
![Page 2: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/2.jpg)
Overview Introduction
Considerations for RNA-Seq Computational Resources/Options
Analysis of RNA-Seq Data Principle of analyzing RNA-Seq General RNA-Seq analysis pipeline “Tuxedo” pipeline Alternative tools
Resources http://www.slideshare.net/DanGaston
![Page 3: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/3.jpg)
Before You Start: Considerations for RNA-Seq Analysis
Next-Generation Sequencing experiments generate a lot of raw data 25-40 GB/sample/replicate for most
transcriptomes/tissue types/cell lines/conditions
Require more computational resources than many labs routinely have available for analyse data At minimum several processing “cores” (8 minimum) Large amount of RAM (16GB+) Large amount of disk storage space for intermediate and
final results files in addition to raw FastQ files Can be a significant amount of time per sample (days to
week)
![Page 4: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/4.jpg)
Computational Options Local (Large workstation or cluster) Remote Computer/Cluster
(ComputeCanada/ACENet) Cloud Services
Amazon Web Services Cloud/Local Bioinformatics ‘Portals”
Galaxy Chipster GenomeSpace CloudBioLinux CloudMan BioCloudCentral (Interface to CloudMan, CloudBioLinux,
etc)
![Page 5: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/5.jpg)
RNA-Seq Analysis Workflow
![Page 6: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/6.jpg)
So I Ran an RNA-Seq Experiment. Now What? Need to go from raw “read” data to gene
expression data We now have:
De-multiplexed fastq files for each individual sample and replicate
We want lists of: Differentially expressed genes/transcripts Potentially novel genes/transcripts Potentially novel splice junctions Potential fusion events
Organize your data, programs, and additional resources (discussed later)
![Page 7: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/7.jpg)
What is the Raw Data A single lane of Illumina HiSeq 2000
sequencing produces ~ 250 – 300 million “reads” of sequencing
Can be paired or single-end sequencing (paired-end preferred)
Various sequencing lengths (number of sequencing cycles) 2x50bp, 2x75bp, 2x100bp, 2x150bp most
common Cost versus amount of usable data
True raw data is actually image data with colour intensities that are then converted into text (A, C, G, T and quality scores) called FastQ
![Page 8: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/8.jpg)
FastQ
FASTA format file with a header line, sequence line, and quality scores for every base in the sequenced read
In Paired-End Sequencing one file for each “end” of sequencing (Primer 1 and Primer 2)
Qualities scores are encoded with a single character representing a number. Most common encoding scheme is called Phred33. Old Illumina software used Phred64 but current generation does not. (Illumina 1.3 – 1.7 is Phred64) Often needs to be set explicitly in alignment programs
@M00814:1:000000000-A2472:1:1101:14526:1866 1:N:0:1TGGAACATGCGTGCGNAGCCGAAAGTGTGTCCCCACTTTCATATGAAGAAAGACTG+?????BBBBB9?+<+#,,6C>CAEEHHHFFHHHHFEHHHHHHHHHGHHHHHHHHHH
![Page 9: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/9.jpg)
General Analysis Pipeline
Visualization / Statisticss
Abundance/Expression
Transcript Reconstruction
Short-Read Alignment
![Page 10: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/10.jpg)
What is Short-Read Alignment?
Section of Reference Chromosome
Paired-End Reads
![Page 11: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/11.jpg)
What’s Special About RNA-Seq
Normally distance between paired-reads and size of insertions both constrained
With RNA-Seq the source is mRNA, not genomic DNA
Mapping to a reference genome, not transcriptome
Need to account for introns, pairs can be much further apart than expected
![Page 12: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/12.jpg)
Transcript Reconstruction: Intron/Exon Junctions
Exon1 Exon 2 Exon 3
![Page 13: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/13.jpg)
Transcript Reconstruction: Alternative Splicing
Exon1 Exon 2 Exon 3
![Page 14: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/14.jpg)
Transcript Reconstruction: Novel Exon/Transcript Identification
Exon1 Exon 2 Exon 3Exon X
![Page 15: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/15.jpg)
Transcript Reconstruction: Fusion Transcripts
Exon1 Exon 2 Exon 3
Gene 2 Exon 4
![Page 16: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/16.jpg)
Transcript Reconstruction: Differential Expression
Sample 1
Sample 2
![Page 17: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/17.jpg)
What else can we look for? Combine with ChiP-Seq to differentiate various
levels of regulation Integrative analyses to identify common
elements (micro-RNA, transcription factors, molecular pathways, protein-DNA interactions)
Combine with whole-exome or whole-genome sequencing Allele-specific expression Allelic imbalance LOH Large genomic rearrangements/abnormalities
![Page 18: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/18.jpg)
Caution Need to differentiate between real data and
artifacts Differentiate between biologically meaningful
data and “noise” Sample selection, experimental design,
biological replication (not technical replication), and robust statistical methods are important
Looking at your data “by eye” is useful, but needs to be backed up by stats
Avoid experimenter bias Try and be holistic in your analyses
![Page 19: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/19.jpg)
Visualizing with IGV
![Page 20: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/20.jpg)
“Tuxedo” Analysis Pipeline
CummeRbund
CufflinksCufflinks Cuffcomp
areCuffmerg
e Cuffdiff
Tophat
Bowtie
![Page 21: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/21.jpg)
What you need before you begin The individual programs Reference genome (hg19/GRCh37)
FASTA file of whole genome, each chromosome is a sequence entry
Bowtie2 Index files for reference genome Index files are compressed representations of the
genome that allow assembly to the reference efficiently and in parallel
Gene/Transcript annotation reference (UCSC, Ensembl, ENCODE, etc) Gives information about the location of genes and
important features such as location of introns, exons, splice junctions, etc
![Page 22: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/22.jpg)
Step 0: Bowtie Bowtie forms the core of TopHat for short-read
alignment Initial mapping of subset of reads (~5 million) to
a reference transcriptome to estimate inner-distance mean/median and standard deviation for tophat
This info can be retrieved from the library prep stage but is actually better to estimate from your final data
Sample command-line:
bowtie –x /path/to/transcriptome_ref.fa –q –phred33 –local –p 8 -1 read1.fastq -2 read2.fastq –S output.sam
![Page 23: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/23.jpg)
Step 1: Tophat Tophat is a short-read mapper capable of
aligning reads to a reference genome and finding exon-exon junctions
Can be provided a list of known junctions, do de novo junction discovery, or both
Also has an option to find potential fusion-gene transcripts
Sample command-line:
tophat –p 8 –G gene_annotations.gtf –r inner_distance –mate-std-dev std_dev –o Output.dir /path/to/bowtie2indexes/genome read1.fastq read2.fastq
![Page 24: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/24.jpg)
About TopHat Options -o: The path/name of a directory in which to
place all of the TopHat output files -G path to and name of an annotation file so
TopHat can be aware of known junctions Reference Genome: Given as path and “base
name.” If reference genome saved as: /genomes/hg19/genome.fa then the relevant path and basename would be /genomes/hg19/genome
Inner Distance = Fragment size – (2 x read length)
![Page 25: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/25.jpg)
TopHat: Additional options --no-mixed --b2-very-sensitive --fusion-search Running above options on 6 processing cores
on one sample took ~26 hours
![Page 26: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/26.jpg)
Step 2: Cufflinks Cufflinks performs gene and transcript
discovery Many possible options
No novel discovery, use only a reference group of transcripts
de novo mode (shown below, beginner’s default) Mixed Reference-Guided Assembly and de novo
discovery. Options for more robust normalization methods
and error correction Sample command-line:
cufflinks –p 8 –o Cufflinks.out/ accepted_hits.bam
![Page 27: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/27.jpg)
Step 3: Cuffmerge Merges sample assemblies, estimate
abundances, clean up transcriptome Sample command-line:
cuffmerge –g gene_annotations.gtf –s /path/to/genome.fa –p 8 text_list_of_assemblies.txt
![Page 28: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/28.jpg)
Step 4: Cuffdiff Calculates expression levels of transcripts in
samples Estimates differential expression between
samples Calculates significance value for difference in
expression levels between samples Also groups together transcripts that all start
from same start site. Identify genes under transcriptional/post-transcriptional regulation
Sample command-line:
cuffdiff –o Output.dir/ –b /path/to/genome.fa –p 8 –L Cond1,Cond2 –u merged.gtf cond1.bam cond2.bam
![Page 29: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/29.jpg)
Cuffdiff Output FPKM values for genes, isoforms, CDS, and groups of
genes from same Transcription Start Site for each condition FPKM is the normalized “expression value” used in RNA-Seq
Count files of above As above but on a per replicate basis Differential expression test results for genes, CDS,
primary transcripts, spliced transcripts on a per sample (condition) comparison basis (Each possible X vs Y comparison unless otherwise specified) Includes identifiers, expression levels, expression difference
values, p-values, q-values, and yes/no significance field Differential splicing tests, differential coding output,
differential promoter use
![Page 30: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/30.jpg)
Step 5: CummeRbund (R)
Trapnell et al., 2012
![Page 31: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/31.jpg)
Visualization
Trapnell et al., 2012
![Page 32: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/32.jpg)
Help! Command X failed
Keep calm Don’t blame the computer Check input files and formats Google/SeqAnswers/Biostars
Results looks “weird” Check the raw data Re-check the commands you used
RNA-Seq analysis is an experiment: Maintain good records of what you did, like any
other experiment
![Page 33: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/33.jpg)
Alternative tools Alternative short-read alignment
BWA -> Can not align RNA-Seq data GSNAP STAR -> Requires minimum of 30GB of RAM
Alternative transcript reconstruction STAR Scripture
Alternative Expression/Abundance Estimation DESeq DEXSeq edgeR
![Page 34: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/34.jpg)
Resources
![Page 35: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/35.jpg)
Software Websites TopHat http://tophat.cbcb.umd.edu Cufflinks http://cufflinks.cbcb.umd.edu STAR http://gingeraslab.cshl.edu/STAR/ Scripture
http://www.broadinstitute.org/software/scripture/
Bioconductor http://www.bioconductor.org/ DEXSeq DESeq edgeR
Blah
![Page 36: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/36.jpg)
Additional Resources Differential gene and transcript expression
analysis of RNA-Seq Experiments with TopHat and Cufflinks (2012) Nature Protocols. 7(3)
www.biostars.org (Q&A site) SeqAnswers Forum GENCODE Gene Annotations
http://www.gencodegenes.org/ ftp://ftp.sanger.ac.uk/pub/gencode
TopHat / Illumina iGenomes References and Annotation Files: http://tophat.cbcb.umd.edu/igenomes.html
![Page 37: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/37.jpg)
Dalhousie University Dr. Karen Bedard Dr. Chris McMaster Dr. Andrew Orr Dr. Conrad Fernandez Dr. Marissa Leblanc Mat Nightingale Bedard Lab IGNITE
Acknowledgements
Dr. Graham Dellaire Montgomery Lab
Stanford Dr. Stephen
Montgomery BHCRI CRTP Skills
Acquisition Program
![Page 38: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/38.jpg)
Experimental Data for Genes of Interest
![Page 39: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/39.jpg)
UCSC Genome Browser
![Page 40: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/40.jpg)
UCSC Genome Browser
![Page 41: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/41.jpg)
MetabolicMine
![Page 42: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/42.jpg)
MetabolicMine
![Page 43: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/43.jpg)
NCI Pathway Interaction Database
![Page 44: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/44.jpg)
The Cancer Genome Atlas Identify cancer subtypes, actionable driver
mutations, personalized/genomic/precision medicine
More than $275 million in funding from NIH Multiple research groups around the world 20 cancer types being studied 205 publications from the research network
since late 2008
![Page 45: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/45.jpg)
The Cancer Genome Atlas
![Page 46: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/46.jpg)
The Cancer Genome Atlas
![Page 47: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/47.jpg)
The Cancer Genome Atlas
![Page 48: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/48.jpg)
UNIX/Linux command-line basics
![Page 49: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/49.jpg)
What is UNIX? UNIX and UNIX-Like are a family of computer
operating systems originally developed at AT&T’s Bell Labs Apple OS X and iOS (UNIX) Linux (UNIX-Like)
![Page 50: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/50.jpg)
Intro The terminal (command-line) isn’t THAT scary.
Maintaining a Linux environment can be challenging, but most of these analyses can also be done in an OS X environment
Installing software can sometimes be cumbersome and confusing, however many standard bioinformatics programs and software libraries are fairly easy to set-up
Working with the programs from the command-line will often give you a better appreciation for what the program does and what it requires
![Page 51: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/51.jpg)
Terms to Know Path: The location of a directory, file, or
command on the computer. Example: /Users/dan (OS X home directory)
![Page 52: Dgaston dec-06-2012](https://reader035.fdocuments.in/reader035/viewer/2022062703/55504452b4c90580748b4cb3/html5/thumbnails/52.jpg)
The Commands You Need to Know ls: Lists the files in the current directory.
Directories (folders) are just a special type of file themselves
cd: Change directory pwd: View the full path of the directory you
are currently in cat: Displays the contents of a file on the
terminal screen head / tail : Displays the top or bottom
contents of a file to the screen respectively