Development of Helper-Dependent Adenoviral Vectors for Gene … · 2015-07-30 · 1.1. Eye...
Transcript of Development of Helper-Dependent Adenoviral Vectors for Gene … · 2015-07-30 · 1.1. Eye...
Development of Helper-Dependent Adenoviral Vectors for Gene Therapy for
Inherited Retinal Diseases
by
Simon Lam
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy
Graduate Department of Laboratory Medicine and Pathobiology University of Toronto
© Copyright by Simon Lam 2015
ii
Development of Helper-Dependent Adenoviral Vectors for Gene Therapy for Inherited Retinal Diseases
Simon Lam Doctor of Philosophy
Laboratory Medicine and Pathobiology University of Toronto
2015
Abstract
There have been significant advancements in the field of retinal gene therapy in the past
decade. In particular, therapeutic efficacy has been achieved in three separate human
clinical trials using adeno-associated viruses (AAV) to treat a type of Leber’s congenital
amaurosis caused by RPE65 mutations. However, despite the success with AAV,
challenges remain for delivering large therapeutic genes or genes requiring long DNA
regulatory elements to the retina.
For example, Stargardt’s disease, a form of juvenile macular degeneration, is caused by
defects in ABCA4, a gene that is too large to be packaged in AAV. ABCA4 encodes an
ATP dependent flipase and when its function is lost, its substrate undergoes chemical
reactions that cause it to become toxic to the retinal pigment epithelium (RPE). This
leads to the apoptosis of the RPE and the subsequent loss of the photoreceptor (PR) cells.
Therefore, individuals born with mutations in both copies of ABCA4 eventually lose their
vision. Stargardt’s disease represents an attractive target for gene therapy because it is an
autosomal recessive disease, because PR cells are neuronal and thus do not exhibit cell
turnover, and because it is a very slow progressing disease, thus early detection and
treatment can abrogate much of the vision loss. Therefore, we investigated the ability of
helper dependent adenovirus (HDAd) to deliver genes to the retina as it has a much
larger transgene capacity.
iii
Our results indicate that HDAd vectors can transduce the entire width of the mouse
retinal epithelium using a very low dose, with high transgene expression, long duration,
and low toxicity. However, it was also observed that while the RPE was completely
transduced, very little of the neural retina was transduced. We discuss the potential
causes of this, with viral tropism and inability to penetrate the outer limiting membrane
of the retina as potential causes. We conclude that HDAd vectors are highly efficient for
gene delivery to the RPE, and that with modifications to the method of vector injection,
HDAd may prove to be an excellent gene delivery tool for the neural retina.
iv
Acknowledgments
I wish to thank Dr. Jim Hu for the opportunity of pursuing this degree, as well as his
valuable advice and guidance during the years I have been in his laboratory. I also wish
to thank my fellow lab members, in particular Dr. Huibi Cao and Jing Wu for their
technical assistance and advice, and Cathleen Duan for her assistance in vector
production.
I wish to thank my advisory committee members, Dr. Derek van der Kooy and Dr. Ming
Tsao, for their time, advice, and insight during the course of this degree.
I wish to thank Dr. Robert S. Molday (University of British Columbia), Laurie Molday,
and Hidayat Djajadi for their generosity and support while I learned their techniques for
tissue preparation, imaging, and working with the ABCA4 protein.
I wish to thank Dr. Ji-jing Pang (University of Florida) and Dr. Bo Chang (The Jackson
Laboratory) for teaching me their sub-retinal injection technique.
I wish to thank Dr. Rod Bremner (University of Toronto) for kindly providing the Y79
and WERI-Rb cell lines.
I also wish to thank my parents for their support through the many years and multiple
degrees I have pursued, and my friends for their emotional support throughout the years.
Finally, I wish to thank my partner who has made great sacrifices during these times, and
her family for their support, advice, and understanding.
v
Table of contents
1. Introduction ....................................................................................................... 1
1.1. Eye physiology ............................................................................................................ 1
1.1.1. Anatomy .................................................................................................................. 1
1.1.2. Phototransduction .................................................................................................. 7
1.1.3. Immune privilege .................................................................................................. 10
1.2. Stargardt’s disease .................................................................................................... 11
1.2.1. Molecular etiology ................................................................................................ 12
1.2.2. Current treatment options and recent research................................................... 13
1.3. Gene Therapy ........................................................................................................... 14
1.3.1. Non‐viral gene therapy delivery methods ............................................................ 15
1.3.2. Viral vectors ........................................................................................................... 18
1.3.3. Adenovirus tropism ............................................................................................... 31
1.3.4. Retinal gene therapy ............................................................................................. 37
1.3.5. Gene Therapy for Stargardt’s disease ................................................................... 38
1.4. Hypothesis ................................................................................................................ 40
2. Materials and Methods .................................................................................... 41
2.1. Molecular Cloning ..................................................................................................... 41
2.1.1. Plasmid extraction ................................................................................................. 41
2.1.2. Transformation of competent E. coli DH5α .......................................................... 46
2.1.3. Polymerase Chain Reaction ................................................................................... 46
2.1.4. Restriction digest ................................................................................................... 51
2.1.5. Agarose gel electrophoresis .................................................................................. 52
2.1.6. Ligation .................................................................................................................. 52
2.1.7. Sequencing ............................................................................................................ 53
2.2. Tissue Culture ........................................................................................................... 53
2.2.1. Cell lines ................................................................................................................ 53
2.2.2. Transfection........................................................................................................... 55
2.2.3. Transduction.......................................................................................................... 55
vi
2.2.4. Flow Cytometry ..................................................................................................... 56
2.2.5. qRT‐PCR ................................................................................................................. 56
2.2.6. Western Blot ......................................................................................................... 57
2.3. HDAd vector production ........................................................................................... 61
2.4. Animal models .......................................................................................................... 64
2.4.1. Mydriasis and Anesthesia ...................................................................................... 64
2.4.2. Trans‐sclera sub‐retinal injection .......................................................................... 65
2.4.3. Trans‐corneal sub‐retinal injection ....................................................................... 66
2.4.4. Cryosection ............................................................................................................ 67
2.4.5. Immunofluorescence ............................................................................................ 69
2.4.6. Microscopy ............................................................................................................ 70
3. Results ............................................................................................................. 72
3.1. Promoter constructs ................................................................................................. 72
3.1.1. Ubiquitous promoters ........................................................................................... 72
3.1.2. Rhodopsin promoters ........................................................................................... 75
3.1.3. G protein‐coupled Receptor Kinase 1 promoter ................................................... 81
3.2. Introns....................................................................................................................... 83
3.3. ABCA4::EGFP fusion protein did not yield detectable fluorescence ........................ 89
3.4. Transduction efficacy and cell specificity of HDAd vectors carrying the reporter
gene EGFP ................................................................................................................................. 90
3.4.1. HDAd is capable of delivering EGFP to cultured cells and the rhodopsin promoter
confers fluorescence in a cell‐specific manner ..................................................................... 90
3.4.2. Vector particle to infectious unit ratio ................................................................ 102
3.4.3. in vivo injections of HDAd carrying the EGFP reporter gene .............................. 103
3.5. HDAd carrying the therapeutic gene is capable of transducing cells and conferring
expression ............................................................................................................................... 133
3.5.1. Injections of HDAd vector carrying ABCA4 into mouse retina ............................ 140
3.5.2. mRNA, western blots and IF using different batches of CAG‐ABCA4 reveals
variations in vector efficacy between batches .................................................................... 146
4. Discussion ..................................................................................................... 149
4.1. Anomalous protein bands observed when CAG‐ABCA4 vector is used to transduce
WERI‐Rb cells is likely a result of RNA processing ................................................................... 149
vii
4.2. HDAd required to transduce the entire retinal epithelium is low, but is also difficult
to quantitate precisely, and there are variations in VP:IU between batches ......................... 152
4.3. The tropism of the HDAd vector may be reducing the transduction of
photoreceptor cells ................................................................................................................. 159
4.4. Potential application of HDAd in RPE diseases ....................................................... 165
4.5. Patches of complete retinal transduction .............................................................. 167
5. Conclusion ..................................................................................................... 173
6. References ..................................................................................................... 175
Appendix ...................................................................................................................... 197
Appendix A – Curve fit for Section 3.4.2 ........................................................................ 197
Appendix B – List of abbreviations ................................................................................. 199
Appendix C – List of Publications .................................................................................. 201
viii
List of Tables
Table 1 – List of plasmids ................................................................................................ 42
Table 2 – List of primers .................................................................................................. 48
Table 3 – List of cell lines ................................................................................................ 54
Table 4 – List of antibodies .............................................................................................. 60
ix
List of Figures
Figure 1 – Schematic diagram of the cross-section of human eye [41] .............................. 5
Figure 2 – Schematic diagram of the retina [108] .............................................................. 6
Figure 3 – Schematic diagram of the visual cycle [42] ...................................................... 9
Figure 4 – Schematic of the HDAd production technique with the Cre/Lox system [154]
............................................................................................................................ 30
Figure 5 – Schematic figure of adenovirus structure [152] and fiber structure [138] ...... 35
Figure 6 – Schematic diagram of adenovirus attachment and entry via CAR and integrin
binding [152] ...................................................................................................... 36
Figure 7 – The CAG promoter is more active than CMV as measured by EGFP
expression ........................................................................................................... 74
Figure 8 – Flow cytometry of transfected cells demonstrate the cell specificity of the Rho
promoter and the increase in transcription resulting from IRBPE ..................... 79
Figure 9 – Rho-EGFP confers higher gene expression than GRK1-EGFP ...................... 82
Figure 10 – BLAST search of hybrid intron sequence ..................................................... 86
Figure 11 – The sequence of the template plasmid contains 9 differences compared with
the reference sequence in a segment of ~800 bp. ............................................... 88
Figure 12 – HDAd can deliver EGFP to cultured cells, and the rhodopsin promoter is
cell-specific ......................................................................................................... 93
Figure 13 – Confocal photomicrographs of ARPE-19, HeLa and WERI-Rb cells
transduced with either CAG-EGFP or Rho-EGFP ............................................. 95
Figure 14 – Flow cytometry confirms fluorescence conferred by CAG-EGFP and cell
specificity of rhodopsin promoter ...................................................................... 99
x
Figure 15 – Representative flow cytometry plots demonstrating the gating method used
to reduce false-positives caused by auto-fluorescence. .................................... 100
Figure 16 – Representative flow cytometry histograms ................................................. 101
Figure 17 – Microspheres injected into the sub-retinal space of mouse eyes ................ 106
Figure 18 – Sequential sections of a mouse retina injected with CAG-EGFP HDAd ... 110
Figure 19 – High magnification view of a retina injected with CAG-EGFP ................. 111
Figure 20 – Low dose injections of CAG-EGFP confer expression down to 1 x 105 VP
.......................................................................................................................... 116
Figure 21 – Long-term monitoring of CAG-EGFP injected mice .................................. 119
Figure 22 – Patches of transduction of the neural retina after CAG-EGFP injection .... 121
Figure 23 – Injections of FGAdV Ad5 and Ad5/F35 both with and without RGD deletion
results in no significant increase in PR transduction ........................................ 125
Figure 24 – LPC does not increase photoreceptor transduction ..................................... 129
Figure 25 – HDAd carrying Rho-EGFP injected into the sub-retinal space of mice ..... 132
Figure 26 – mRNA from cell lines transduced with CAG-ABCA4 and Rho-ABCA4 .. 135
Figure 27 – Western blot of cell lines transduced with CAG-ABCA4 and Rho-ABCA4
.......................................................................................................................... 137
Figure 28 – Immunofluorescence imaging of cell lines transduced with either CAG-
ABCA4 or Rho-ABCA4 ................................................................................... 139
Figure 29 – qRT-PCR for transgenic ABCA4 from injected mouse eyes ...................... 142
Figure 30 – Immunofluorescence imaging of mouse eyes injected with CAG-ABCA4 144
Figure 31 – Magnified view of the areas within the yellow box from Figure 30 ........... 145
xi
Figure 32 – Comparison of batches of CAG-ABCA4 by qRT-PCR, immunofluorescence
and western blot ................................................................................................ 148
1
1. Introduction
Gene therapy, in the simplest terms, is the use of DNA to treat diseases by delivering the
DNA to a patient’s cells. Over the last 5 decades, gene therapy has progressed from a
conceptual exercise to a therapy approved for clinical use. In the work herein, we made
progress towards the use of helper-dependent adenoviral vectors (HDAd) to treat
Stargardt’s disease, an inherited form of juvenile macular degeneration caused by a
defective gene in the photoreceptor cells of the retina. The results presented here
demonstrate the potential and the challenges involved in the use of HDAd in treating
retinal diseases.
1.1. Eye physiology
The eye is a complex organ that focuses, detects, and interprets light into the images
perceived by the brain. Not only is it anatomically complex to manipulate the incoming
light onto the retina, the retina is a complex layer of many cell-types with sophisticated
chemical relationships to convert the light into neurological signals that are processed
before transmission to the brain. The retina must also contain a range of supporting cells
to ensure the health and function of the cells involved in this process. Because of this
complexity, there is a wide range of diseases that affect the eye.
1.1.1. Anatomy
The eye’s anatomy revolves around two major objectives: the manipulation of incoming
light to project a focused image on the surface of the retina, and the detection and
processing of this light into an appropriate signal for transmission to the brain via the
optic nerve.
2
The overall physical structure (Figure 1) is contained by the sclera, a thick connective
tissue that forms the white globe of approximately 6.5 mL in volume, 25 mm in diameter
in an adult human [106]. The anterior side features a circular opening of approximately
60 degrees which houses the parts of the eye responsible for admitting and manipulating
light. This light first passes through the cornea, an outer protective layer. It then passes
though the pupil which controls the amount of light admitted, similar to the aperture of a
camera, and into the lens which focuses the light as appropriate via the ciliary muscles
which alter the shape of the lens. Within this anterior chamber of the eye between the
cornea and the lens is contained a liquid known as the aqueous humour. The light exits
the lens into the vitreous, a high viscosity liquid, and into the retina.
The retina’s primary function is to detect light, a role fulfilled by photoreceptor cells
(PR). Figure 2 shows the organization of the cells within the retina. There are two types
of PR cells, rods and cones, which detect light in general and specific wavelengths of
light respectively. Low-light vision is conferred by rods and colour vision is conferred by
combinations of cones with different sensitivities to different colours. Both types of PR
cells are physically separated into two distinct sections; the segments that contain the
mechanisms to detect light, and the cell bodies within the outer nuclear layer that
maintain the cell’s ability to function. As Section 1.2.1 describes in detail, these are the
cells of concern with Stargardt’s disease.
Moving towards the vitreous from the PR cells is the outer plexiform layer (OPL) where
connections between PR and neural cells take place. These neural cells have their cell
3
bodies within the inner nuclear layer (INL), and consist of horizontal cells, bipolar cells,
amacrine cells, and Müller cells [108].
The signals from both rods and cones are aggregated by bipolar cells or horizontal cells,
with the horizontal cells also making lateral connections to allow for cross-talk to
interpret and coalesce the signal. Some of these signals are transmitted to the amacrine
cells that further aggregate and simplify the signal by allowing for processing between
pathways before passing the signals onto the retinal ganglia. In brief, the combination of
bipolar cells, horizontal cells, and amacrine cells aggregate, interpret, and simplify the
signals from the PR cells to the ganglion cells via a complicated non-linear network of
lateral and vertical communication to reduce the amount of data that needs to be
transmitted. From these retinal ganglion cells, the information is passed via the optic
nerve to the brain. [104]
Like other neural cells, the neural retina cells require support from glial cells to provide
nutritional sustenance and physiological upkeep. In the neural retina, this is mainly
provided by Müller cells. However, in addition to typical functions of glial cells, Müller
cells also serve the additional function of providing barriers to the edges of the neural
retina. Like many other neural retina cells, although the Müller cell body sits in the INL,
the cell projects extensively in both directions towards the photoreceptors and the
vitreous. On the PR side, the Müller cell membrane flattens and connects with other
Müller cells as well as PR cells to form the outer limiting membrane (OLM). This serves
to seal the neural retina from the sub-retinal space while allowing PR cell’s outer
segments to project through and be accessible to retinal pigment epithelium cells. On the
4
side facing the vitreous, the Müller cell membranes also spread to form the inner limiting
membrane (ILM), serving as a barrier between the neural retina and the vitreous [105].
These are of significance in the discussion in Section 4.5, as they affect the distribution
and penetration of the gene therapy vector.
Looking towards the opposite side of the PR, away from the neural retina, is the retinal
pigment epithelium (RPE). The RPE is attached to the Bruch’s membrane and the
choroid. Bruch’s membrane serves as a medium through which the RPE can interact with
the choroid, transferring materials between the blood supply in the choroid and the RPE
cells. The RPE projects processes that interlace with the PR cells to ingest PR segments
that are shed as a normal function of the PR cells, and recycle substrates back into a
usable form for the PR. Although RPE and PR are normally essentially in contact with
each other, retinal detachment can occur with the PR cells separating away from the
RPE, forming a sub-retinal space. Injection into the sub-retinal space is a common
method of delivering material to the retina, especially the RPE. In the studies described
herein, the interaction between the RPE and PR is of particular importance as it plays a
key role in the progression of Stargardt’s diseases as well as other degenerative diseases
targeted by gene therapy.
5
Figure 1 – Schematic diagram of the cross-section of human eye [41]
This schematic cross-section of the eye shows the main features of the human eye. The
anatomy of the retina is shown in further detail in Figure 2. It is important to note that the
mouse eye contains a significantly larger lens, occupying approximately 50% of the
volume of the posterior chamber (vitreous humour). The implications of this on the
injection technique are described in Sections 2.4.2 and 2.4.3.
6
Figure 2 – Schematic diagram of the retina [108]
In this schematic diagram of the retina, the orientation is such that light enters from the
bottom of the diagram from the vitreous humour, separated from the retina by the inner
limiting membrane, towards the retinal pigment epithelium which is adjacent to the
choroid which is not shown in this figure as it is not strictly speaking a part of the retina.
The neural retina is the layers of cells encompassed by the outer and inner limiting
membrane (i.e. all parts of the retina except the retinal pigment epithelium). The sub-
retinal space is not labelled in this diagram as it does not exist until retinal detachment
which results in the neural retina separating from the retinal pigment epithelium.
7
1.1.2. Phototransduction
Phototransduction is the process by which light is converted to signals passed to the
neural retina for processing into images. It consists of a neurological side that causes
signalling to the neural retina, and a chemical side to recycle substrates. We are primarily
interested in the chemical side of phototransduction (Figure 3) as it participates in the
etiology of Stargardt’s disease.
Rhodopsin, present on the membranes of the discs of the PR cell segments, is sensitive to
light. It is bound to 11-cis retinal and isomerizes 11-cis retinal into all-trans retinal upon
activation. This causes rhodopsin to initiate a signal transduction cascade and release the
all-trans retinal. The signal transduction cascade is initiated by the activation of
transducin, which in turn activates phosphodiesterase (PDE). PDE then hydrolyzes
cGMP, leading to the closure of cGMP-gated channels on the plasma membrane of the
PR cell. The closure of these channels results in hyperpolarization of the membrane,
down-regulating the release of glutamate at the synaptic terminal. This change in
glutamate is the format in which signal transduction then occurs to the rest of the neural
retina [107]. Interestingly, each step of this cascade allows for significant amplification,
resulting in minimum detectable light sensitivity of 5-14 photons under extreme dark
adaptation [82].
Concurrently, the released all-trans retinal must be recycled back into 11-cis retinal for
binding to rhodopsin. It is hydrolyzed and reduced to all-trans retinol by all-trans retinol
dehydrogenase. In this form, it is transported into the RPE where lecithin retinol
acyltransferase (LRAT) esterifies all-trans retinol into all-trans retinyl ester. A crucial
8
enzyme, RPE65, then isomerizes and hydrolyses it into 11-cis retinol. 11-cis retinol
dehydrogenase then converts it back into 11-cis retinal which is transported back into the
PR cell for binding to rhodopsin, completing the cycle [107].
9
Figure 3 – Schematic diagram of the visual cycle [42]
In this diagram, the chemicals involved in the visual-cycle are in black. The green text
indicates the enzyme involved in the conversion. It is important to note that the
orientation of this figure is reversed from a typical presentation of the retina and the RPE
is show below the photoreceptors in this figure. ABCA4 transports N-retinylidene-PE
which is a result of all-trans retinal reacting with phosphatidyl ethanolamine, and thus is
not represented in this diagram as it is not a necessary enzyme for the visual cycle.
10
1.1.3. Immune privilege
The eye has long been known to be an immune privileged organ, and anterior chamber-
associated immune deviation (ACAID) was identified in 1977 [93]. Since then, immune
privilege has also been observed in the sub-retinal space [223] and the vitreous [190,
223]. As gene therapy for the eye mainly concerns the posterior chamber, more
specifically the retina, this summary of immune privilege of the eye will be primarily
regarding the posterior chamber.
As the retina is well protected from antigens from the anterior of the eye, the primary
concern for immune privilege is to prevent antigens being introduced via the blood
stream. The main defense against this is the blood-retinal barrier, formed by tight
junctions of the retinal capillary endothelial cells that prevents free diffusion while
supplying nutrients and removing waste products from the retina [86]. Beyond this, the
RPE has multiple pathways of down-regulating inflammatory cells [91, 240], including
changing the nature of the T-cells that find themselves in the micro-environment
surrounding the RPE [194-197]. RPE also expresses FAS ligand and PD-L1, thus
activated immune cells expressing FAS and PD-1 receptor become apoptotic when
bound to the RPE [210]. These apoptotic cells also produce IL-10, an
immunosuppressive cytokine, pushing the balance of the immune response towards the
suppressive side [62, 75, 149].
Within the sub-retinal space immediately adjacent to the RPE, TGF-β is present and acts
as an immunosuppressive neuropeptide and is responsible for much of the immune
privilege [195, 223]. Furthermore, retinoic acid, in particular all-trans-retinoic acid
11
derived from all-trans-retinol within the PR cells, is found within the RPE and sub-retinal
space [52, 118]. Retinoic acid appears to interact with the function of TGF-β and acts as
a cofactor for some of TGF-β’s immune-suppressive functions, potentially via
conversion of T-cells to Treg cells [96, 148, 242].
From this, it is clear that the retina benefits from multiple strategies to provide immune
privilege. This immune privilege is necessary as many of the neural retina cells are
incapable of regenerating, thus immune damage from an inflammatory response cannot
be repaired adequately and can be permanently damaging to the retina. As a result, an
abrogated response is preferable to the normal levels of immune response observed in
most other organs. The disastrous consequences of the loss of immune privilege can be
observed in autoimmune diseases such as sympathetic ophthalmia. In the context of gene
therapy, the immune privilege is exploited as the reduced immune response reduces the
adverse effects of the introduction of antigens in the form of the transgenic protein as
well as the vector itself. This allows for stronger transgene expression and longer
persistence of transduced cells.
1.2. Stargardt’s disease
Stargardt’s disease is an autosomal recessive form of juvenile macular degeneration first
described by Karl Stargardt in 1909 [193]. It has an estimated prevalence of 1 in 10,000
individuals [67], although this is dependent on the population examined and is higher in
certain populations [168]. Patients afflicted with this disease generally report gradual
bilateral decline in vision before 20 years of age. It can be diagnosed by ophthalmoscopic
examination by a lack of foveolar reflex and yellow flecks that appear in the macula. In
12
more progressed disease, the atrophy of the RPE may be visible within the macula. It can
also be diagnosed via electroretinography [112].
There are three known forms of Stargardt’s disease. Stargardt’s disease 1 (STGD1) is the
most common form of Stargardt’s disease and is the subject of the work herein Two
other forms of Stargardt’s also exist. Stargardt’s type 3 (STGD3) is a result of mutations
in ELOVL4, a gene involved in the synthesis of very long chain saturated and
polyunsaturated fatty acids [124]. Stargardt’s type 4 (STGD4) is a result of mutations in
PROM1, a transmembrane glycoprotein that plays a critical role in photoreceptor dis
membrane morphogenesis [238]. Both of these are very rare diseases, and are unrelated
to STGD1 and as such are beyond the scope of this work.
1.2.1. Molecular etiology
The gene causing Stargardt’s disease is the ATP-dependent flipase ABCA4 which is
closely tied to but not directly active in phototransduction. This gene is located on the
short arm of chromosome 1 in humans [94]. As phototransduction is initiated in the disc
lumen in PR cell segments with the rhodopsin being bound to the disc lumen membranes,
the all-trans retinal is transported across the membrane into the cytoplasm. However, a
portion of all-trans retinal will react with phosphatidyl ethanolamine (PE) to form N-
retinylidene-PE. In this form, it must be transported back to the cytoplasmic side of the
disc membrane by ABCA4, where the all-trans retinal can disassociate from PE and
continue its chemical cycle [144, 145, 198]. In the case of Stargardt’s disease, the
ABCA4 flipase is defective, causing N-retinylidene-PE to build up within the disc lumen.
N-retinylidene-PE can also react with a second molecule of all-trans retinal to form di-
13
retinoid-pyridinium-PE (A2PE). While this is not harmful per se, when the outer segment
of the PR cell is shed and phagocytosed by the RPE, A2PE present in the segment’s disc
lumen is also taken up. Lysosomal degradation of A2PE results in the hydrolytic product
di-retinoid-pyridinium-ethanolamine (A2E), which cannot be further degraded.
Consequently, A2E accumulates to form the lipofuscin deposits characteristic of
Stargardt’s disease. Lipofuscin acts as a detergent that compromises the membrane
integrity [56, 84], and converts into free radical epoxides that are capable of killing the
RPE cells [191, 192].
With the loss of the RPE, the corresponding PR cells lose the necessary support required
to sustain their function and cannot survive. As a result, a defect in ABCA4, a gene that
functions in the PR cells, results in the build-up of a toxic substrate that does not affect
the PR cells, but causes RPE apoptosis, thus indirectly causing the death of the PR cells.
As a result, Stargardt’s disease causes a progressive retinal degeneration.
1.2.2. Current treatment options and recent research
Currently, there are very few options available to patients of Stargardt’s disease. As with
many retinal diseases, recommendations are often made to minimize exposure to light,
especially strong sunlight, as it increases the metabolism in the retina, and thus
accelerates the progression of disease. While drugs are in development to treat
Stargardt’s disease and some show promise in delaying disease progression or improving
visual acuity [30, 44, 95], curing this disease would undoubtedly require the restoration
of gene function. It should be noted that while stem cell therapy towards regenerating the
RPE would also be beneficial [225], the photoreceptor cells are the causative agent in the
14
loss of RPE and replenishment of the RPE would not be a permanent solution. As such,
the cure to Stargardt’s disease rests in gene therapy.
1.3. Gene Therapy
In the simplest terms, gene therapy is the use of DNA as a therapeutic agent to deliver
genes to the host cell. Unlike conventional therapies where the therapeutic agent or a
precursor of the therapeutic agent is delivered, gene therapy relies on the host cell to
generate the therapeutic agent using the cell’s own machinery for transcribing and
translating the DNA into a therapeutic protein product. First conceptualized in 1971
[172], gene therapy has slowly developed from concept to application over the last 50
years. Although the majority of gene therapy studies are still experimental, several have
reached human clinical trials and commercialization of the first treatments has begun
[21].
A more recent development is the rise of ex vivo gene therapy where the patient’s cells
are extracted and then treated using gene therapy before being placed back into the
patient. For the work herein, we shall concentrate on its traditional, in vivo use as an ex
vivo application of gene therapy to Stargardt’s disease is not possible given that PR cells
are permanent and do not regenerate. In addition, the potential of generating an immune
response using the transgene to produce a DNA vaccine or DNA vector vaccine has also
been studied, although its purpose is significantly different from traditional gene therapy
and is beyond the scope of this work as it has no applications in the retina.
Gene therapy vectors can be separated into non-viral and viral vectors. Each individual
class of vectors has advantages and disadvantages as outlined below.
15
1.3.1. Non-viral gene therapy delivery methods
While much of the latest work in gene therapy delivery has concentrated on viral based
vectors gene therapy was first attempted using non-viral methods. These attempts were a
result of necessity as the molecular biological techniques for modifying viruses did not
yet exist, and thus many of the methods employed were carried over from in vitro work.
Generally speaking, these methods are less immunogenic and are less complicated.
While most have fallen out of favour due to their low efficacy, polymer based vectors
hold great promise for the future of non-viral gene therapy vectors.
1.3.1.1. Injection based methods
Microinjection is the direct injection of DNA into a single cell microscopically [229].
This simple mechanical process is effective but is only practical when a small number of
cells are targeted; it would be impractical to target an organ or even parts of an organ
using this technique. It also requires that the cell be accessible.
Direct local injection is the simple delivery of the DNA via direct injection to the target
area rather than to a specific cell [230]. While it holds potential for DNA based vaccines
[2], it yields low levels of gene expression, especially if the DNA is unaccompanied.
This mostly stems from the lack of a means by which the DNA can be delivered
intracellularly. More recent research has focused on injection of DNA conjugated to
polymers to improve efficacy (Section 1.3.1.4).
Jet injection using high-pressure gas as a carrier to carry a high-speed aerosol has been
examined as a means of needle-less sub-dermal delivery and is by no means a new
technology. However, it has gained traction in more recent times as the high-pressure jet
16
generates pores in the membrane of cells in the immediate area and thus can result in
intracellular delivery of DNA [222]. While many types of tissues can be treated, the
target area must be within a short distance from the skin [167], making it impractical for
many diseases. However, like other injection methods, it holds promise for DNA vaccine
delivery.
1.3.1.2. Electroporation
Alternative to injecting DNA into the area near the cells, or using a mechanical method
of delivering the DNA intracellularly, electroporation allows for delivery of the DNA
introduced to the target cells. Originally used as an in vitro technique, it is accomplished
by applying a high-voltage current to the target cells, causing transient pores to form in
the cell membrane which allows the DNA to enter the cell [153]. Interestingly, in an
experiment where the DNA was delivered systemically, transduction only took place in
the immediate area of the electroporation, indicating that targeting a specific organ is
possible without localized DNA delivery [178]. Very large DNA of up to 150 kb has
been studied to be efficiently delivered [128], with long term transgene expression of
over a year in vivo [146].
However, there are also significant limitations to electroporation. First, because it relies
on a voltage that can only be applied to a limited area, the gene transfer cannot be applied
to an entire organ in most cases. Second, for internal organs, surgical procedures are
required to appropriately place the electrodes. This is in addition to the need to deliver
the DNA to the desired area. Finally, the application of high voltage can induce tissue
damage [55]. This makes it unsuitable for organs that are sensitive to damage.
17
1.3.1.3. Liposomes
Liposomes are spheres consisting of cationic lipids. Each lipid molecule consists of a
hydrophilic head, a hydrophobic anchor, and a hydrophobic linker [31]. These lipid
molecules form a phospholipid bilayer similar to the cell membrane. This bilayer is
formed into spheres with the DNA contained within them.
The preparation of liposome complexes is highly sophisticated although the formation of
the complexes themselves is spontaneous [60]. The type of complexes created is based
on the chemical composition of the lipid, presence and properties of a co-lipid, salt
concentration, and incubation conditions, with the resulting complexes varying in size,
surface charge, structure and stability. Perhaps most importantly, the charge of the lipid
must be equal to or greater than the charge of the DNA to achieve complete
encapsulation [164].
Although the exact method by which the DNA enters the cell via lipofection is not
known, it likely occurs as a result of the liposome membrane fusing with the cell
membrane [61], or by endocytosis [163]. The presence of a lipid membrane has been
suggested to be disruptive to the lysosome and allows for the release of DNA into the
cytoplasm under the endocytosis model [236]. The process by which the DNA
dissociates from the oppositely charged liposome and enters the nucleus in the absence of
any external assistance is currently unknown and may contribute to the relatively low
efficacy of liposome mediated gene delivery in cells that are not actively dividing [20].
However, many groups are working on the various aspects of liposomal gene transfer and
many possibilities are yet to be explored.
18
1.3.1.4. Polymers
Recently, non-viral gene therapy has shifted significantly towards the use of cationic
polymers rather than liposomes. These polymers form complexes with the negatively
charged DNA forming small nanoparticles rather than large, hollow spheres. Many
natural and artificial polymers have been studied including chitosan [181],
polyamidoamine [205], and poly-(L)-lysine [232]. Although there have been reports of
toxicity stemming from the polymer [53], much work remains to determine the best type
and size for each application as well as chemical modifications which may reduce
toxicity, and improve efficacy. There is also the potential of conjugating multiple
polymers, combination with liposomes, or the synthesis of new polymers [220].
However, the use of polymers for gene therapy is very much in its infancy in comparison
with the other non-viral gene delivery methods and in comparison with viral vectors.
1.3.2. Viral vectors
Engineered viruses became the center of attention for potential vectors for gene therapy
as techniques evolved to better understand and manipulate viruses. This is because by
their very nature, viruses are designed to deliver and express their DNA payload in a host
cell in order to create more viruses and proliferate. Millions of years of evolution had
honed the skills of various viruses to accomplish this task and the wide variety of
different viruses each have varying ways to enter the host cell and reproduce. Given that
viruses are already ideally suited to deliver DNA to cells, the goal of viral vector gene
therapy development concentrates mostly on removing the harmful side of viral
19
infections while retaining and optimizing the virus’s ability to deliver and express the
DNA within.
The first and most obvious negative effect of a normal virus infection is illness. As the
natural life cycle of the virus progresses, it usurps the host cell’s machinery into
generating more virions (i.e. replicating). This process destroys the cell and damages the
tissues. However, a significant portion of the disease presentation stems from the
immune response as it recruits immune cells to the site, causing inflammation, and
destroying infected cells. Neither of these is desirable in a gene therapy vector as not
only is the tissue damage not desirable, the immune response will also help clear infected
cells and thus reduce the duration and therefore efficacy of the treatment. In addition, the
replication of the vector, and thus the possibility that it can spread beyond the treated
patient, is generally regarded as undesirable. As a result, often the first step to generating
a viral vector is to disable its ability to replicate.
Also related to the immune response is the fact that through co-evolution, the immune
response is designed to protect against viral infections. Therefore, it is highly desirable to
reduce the immunogenicity of the vector. This is often accomplished via the deletion of
viral genes to eliminate their expression inside the host cell, thus reducing the number of
antigens available to the immune system.
The above are just two of the many modifications that are involved in engineering a virus
for gene therapy use. Several of the most popular viral vectors and their properties are
discussed in depth individually below.
20
1.3.2.1. Retrovirus
Retroviruses are enveloped viruses with a genome consisting of ssRNA of 7-11 kb
containing three ORFs: capsid proteins, replication enzymes, and envelope glycoproteins.
The virus derives its name from the retrotranscription of its RNA into DNA using
reverse-transcriptase before being integrated into the host-cell genome. This integration
is permanent and is not site-specific [233].
Via deletion of the three ORFs, up to 8kb of DNA payload can be carried by retroviruses.
The ability to integrate into the host genome allows for long term expression of the gene
as it does not suffer from the dilution effects common to DNA in episomes as the
transgenes are replicated along with the host genome. Due to the low prevalence of
retroviruses in the human population, there is also low pre-existing immunity,
contributing to higher efficacy.
However, retroviral vectors suffer from two significant disadvantages. First, as the
retrotranscribed DNA lacks the ability to enter the nucleus, it can only transduce
replicating cells by taking advantage of the break-down in the nuclear envelope during
mitosis [202]. Second, and perhaps more importantly, is that the integration of the viral
DNA into random genomic sites represents not only a theoretical safety issue as with all
randomly integrating vectors, but in the case of retrovirus, actual harm has been
observed; in children treated for severe combined immunodeficiency disease linked to
the X-chromosome (SCID-X1), a clinical trial of 9 patients resulted in 4 cases of acute
leukemia and one death [77]. Although this was better accepted as a consequence
compared with the Gelsinger case (section 1.3.2.4), both due to the fact that the risk was
21
previously known and because of the severity of the disease being treated, it was
nonetheless an undesirable outcome. Work has since taken place towards the
development of self-inactivating (SIN) vectors where the risk of over-expression of gene
near the insertion site is reduced [57] and the safety of these vectors has improved [127].
Lentiviruses are a genus within retroviruses that are of particular interest for gene therapy
and exhibit several differences from other retroviruses. The primary advantage of
lentivirus is the ability to assemble a pre-integration complex using cellular proteins to
deliver the reverse transcribed viral genome to the nucleus, allowing for transduction of
non-dividing cells unlike other retroviruses [22]. Also, while retroviruses typically target
transcriptionally active promoters for integration into the host genome [59], lentiviruses
preferentially integrate away from such locations [37], thus increasing the safety over
other retroviral vectors. Furthermore, the development of self-inactivating lentiviral
vectors further improved the safety of lentiviral vector by minimizing the risk of
recombination as well as aberrant expression of host genes due to integration [127, 142,
243]. Apart from these particular benefits, lentivirus shares most other properties with
other retroviruses.
As a potential vector for carrying ABCA4, the 8 kb capacity of retroviruses would be the
bare minimum as it allows for only 1 kb of regulatory regions. As described in Section
3.1.2, the promoter used to restrict expression to photoreceptor cells, even without the
enhancer element, is already approximately 2 kb. Although the regulatory regions could
be designed to fit within the 1 kb limit, it was considered sub-optimal and would not
allow for a margin should the inclusion of additional components become desired.
22
1.3.2.2. Herpes virus
Herpes virus based vectors are usually based on herpes simplex virus (HSV) type 1, a
large DNA virus with a genome of 152 kb that targets neural cells and enters a latent
state. The large size of the virus allows for a very large DNA payload. Earlier versions of
herpes based vectors deleted only genes that resulted in pathogenicity, although later
developments followed with the deletion of genes for replication [73], and finally,
removal of all viral genes from the vector, requiring external sources of genes for DNA
replication, viral assembly, and DNA packaging [133].
As HSV vector does not integrate into the host cell genome, it carries a safety advantage
of not disrupting the host cell’s gene expression, although this comes at the cost of
having transient expression as the DNA is degraded or diluted by cell replication. Its
large carrying capacity has also allowed researchers to express combinations of genes
using a single vector as required for certain diseases [200].
However, as HSV-1 is a highly prevalent virus with a latent stage, most individuals have
an immune response against the virus, especially as the virus reactivates into the lytic
cycle intermittently, stimulating the immune system. This pre-existing immunity reduces
the vector’s efficacy in human use and may contribute towards its short duration of
transgene expression which is less than AAV, retroviral, and adenoviral vectors [120].
Associated with the presence of latent virus is the possibility that co-infection would
result in recombination with the wildtype virus to regain replication-competence,
although this is limited in the later versions of vectors which carry very little viral gene
sequences, thus reduced likelihood of homologous recombination [48, 132].
23
While HSV based vectors do fill a niche in being able to deliver large combinations of
genes, their short duration of expression and conflict with pre-existing immunity
relegates them to being ideal for transient use, such as for use as an anti-tumor or vaccine
agent, but not ideal for most other purposes including Stargardt’s disease.
1.3.2.3. Adeno-Associated Virus
Adeno-associated viruses (AAV) are small, non-enveloped viruses with an icosahedral
capsid. As they require co-infection with adenovirus or herpes simplex virus to replicate,
they were first discovered in association with adenovirus and hence the name. In the
absence of a co-infection, the viral genomes integrate into human chromosome 19 as a
pro-virus until a co-infection rescues the pro-virus into the lytic phase of viral replication.
The integration of AAV into this site has no-known ill effects [166]. It is a very small
virus, with a single-stranded DNA genome of 5 kb, containing only two ORFs: replicase
for genome replication, and capsid proteins [97].
Although AAV is highly prevalent, it is not known to cause human disease and has a
remarkably mild immune response [213]. This, in combination with its non-pathogenic
site specific integration, wide tropism, and ability to transduce cells regardless of their
cell cycle makes AAV a favourite amongst viral vector mediated gene therapy
candidates. There are over 100 human clinical trials in place using AAV as the vector of
choice [1, 74]. In particular, the human clinical trials using AAV to treat Leber’s
congenital amaurosis (LCA) will be discussed in detail in Section 1.3.3.
However, AAV is not without its disadvantages. The first and most obvious is that
AAV’s small genome limits the size of DNA that can be delivered. Many genes,
24
including ABCA4 which is the subject of the work herein, are too large to be packaged by
AAV. Second, the removal of the replicase results in loss of site specificity in integration
although it also greatly reduces the probability of integration, thus AAV delivered DNA
results mostly in episomal form [187]. This negates the advantage of safe, targeted
integration as seen in AAV without replicase deletion. In addition, AAV’s single-
stranded genome requires conversion to double-stranded DNA before the transgene can
be expressed, a process that introduces a time delay not necessarily acceptable to certain
applications [43].
While great progress is being made with AAV, there are some applications for which
AAV is unsuitable, and there exist limitations, in particular the packaging of large genes
including ABCA4, that appear to be insurmountable.
1.3.2.4. Adenovirus
Adenovirus (Ad) contains a single, linear, double-stranded genome of 36 kb. Its surface
is non-enveloped and is in the form of an icosahedral capsid. There are more than 50
serotypes that infect humans and have such a high prevalence that 75% of normal,
healthy children have antibodies for at least one serotype by 12 years of age [46, 47,
186]. Serotypes such as Ad2 and Ad5, with low natural pathogenicity, wide tropism, and
high levels of transgene expression, are popular candidates for gene therapy. This is in
part because adenoviral vectors (AdV) are capable of infecting post-mitotic cells due to
their ability to deliver the viral DNA to the nucleus, thus pose a significant advantage
over viral vectors that rely upon nuclear membrane breakdown during mitosis for nuclear
entry [87].
25
However, adenoviral vectors (AdV) also suffer from several drawbacks. First, the high
prevalence of Ad also means that there is significant pre-existing immunity against Ad in
most individuals. However, this can be partially circumvented by selecting non-human or
low-prevalence serotypes of Ad. Second, although the serotypes of Ad used in gene
therapy do not cause serious diseases in immunocompentent individuals, they can elicit a
significant immune response. Furthermore, DNA delivered by AdV exists in an episome
in the transduced cell that neither replicates, nor integrates into the host genome. While
this can be considered a safety advantage over integrating viruses such as retroviruses
(Section 1.3.2.1), it also results in dilution and eventual loss of transgene expression as
the transduced cells replicate and old cells are lost.
AdV have had a lengthy development process. The first AdV removed only the early
region 1A (E1A) to disable replication while also providing space for transgene insertion
[72]. Later developments involved mainly the deletion of the E1B and E3 regions to
reduce the immune response by reducing viral protein expression and to also reduce the
probability of recombination with wildtype Ad [24]. These are often referred to as first-
generation AdV (FG-AdV). Second generation AdV resulted from the deletion of E2A
and E4 regions, further improving the safety, efficacy, and carrying capacity of AdV [58,
71, 113, 182, 219, 237]. Following this path of viral gene deletion, the latest generation
of AdV, termed helper-dependent adenoviral vector (HDAd) or high-capacity adenoviral
vector is devoid of all viral genes and is the vector used in the work herein (Section
1.3.2.5).
26
However, in the long history of AdV, despite the successes enjoyed in improving the
vector and the many clinical trials employed using this vector, it is also known as the
agent that caused the first and most well-known gene therapy related death of a clinical
trial subject. In 1999, Jesse Gelsinger died from an overt immune response to an
excessive dose of AdV injected to his hepatic artery [165]. This resulted in a significant
setback for gene therapy, not only for AdV, but for the entire field in general as the
safety of the concept of gene therapy, and viral vector mediated gene therapy in
particular, underwent significant re-examination. The safety concerns may have been
exacerbated by the fact that Gelsinger’s ornithine transcarbamylase deficiency was
controlled by diet and medication and thus did not represent a condition that would have
been otherwise fatal. A decade and a half later, as work on gene therapy progresses, the
importance of safety over treatment efficacy has remained in the minds of researchers in
this field.
While AdV appears to be ideal for delivering ABCA4 to the retina, the lingering issues
surrounding toxicity and immune response to the vector caused us to choose the latest
development of AdV, namely HDAd, as our vector of choice (Section 1.3.2.5).
1.3.2.5. Helper-dependent Adenoviral vector
During the course of AdV development, it was proposed that the removal of all viral
proteins would lead to a decreased immunogenicity beyond what was being achieved
with the removal of only selected genes [139]. This helper-dependent adenoviral vector
(HDAd) was first developed simultaneously by two separate groups, one in hopes of
27
developing a vector for treating cystic fibrosis [65] and the second towards treating
muscular dystrophy [100].
To produce HDAd, DNA containing only the payload, inverted terminal repeats (ITR),
and packaging signal is transfected into the producer cell line. While this DNA is
produced in bacteria as a plasmid, the portion required for HDAd production is released
prior to transfection by restriction digest to remove the components required for growth
in bacteria and improve efficiency by exposing the ITRs. After transfection, helper virus
is added to provide the necessary viral genes for viral protein production, vector DNA
replication and virion assembly.
Because the DNA containing the payload is flanked by viral ITR sequences, this DNA is
replicated by viral proteins as if it was the viral genome. The presence of the packaging
signal in the payload-carrying DNA causes it to be packaged into virions. The cells are
lysed and the HDAd is purified from helper virus and cell debris by gradient
centrifugation. Any residual helper virus is not replication-competent as it requires the
E1 gene supplied by the HEK293 derived production cell line, much like first generation
adenoviral vectors.
This method was improved via the use of a Cre-Lox system whereby the packaging
signal of the helper virus was flanked by LoxP sites. The addition of Cre recombinase
into the production cell line resulted in the loss of the packaging signal from the helper
virus genome upon infection of the producer cell by the helper virus (Figure 4). The loss
of the packaging signal renders the helper virus genome incapable of being packaged into
virions. This change significantly reduces contamination by helper virus, thus reducing
28
the immunogenicity of the vector preparation [160]. The definitive modification of AdV
into HDAd involved the reversal of the packaging signal within the helper virus [158]. It
was previously noted that homologous recombination was observed between the helper
virus and the HDAd, giving rise to HDAd with rearranged genetic elements and escape
of recombined variants of the helper virus [180]. By reversing the direction of the
packaging signal in only one of these two constructs, homologous recombination would
now result in DNA far too large to be packaged into the virion. This change further
improved the purity, and thus safety and efficacy of the HDAd, as the reduced viral gene
expression in transduced cells also reduced the immune response.
Only one clinical trial has been documented using helper-dependent adenoviral vector in
delivering the F8 gene for treating hemophilia A, but the results were not available in a
peer-reviewed format [117, 175, 212, 226].
HDAd has several unique benefits when compared with other viral gene therapy vectors.
The first is its very large payload capacity; in the absence of any viral genes, almost all of
the packaging capacity of ~30 kb can be used towards carrying transgenes and regulatory
regions for those transgenes. In comparison with AAV which has a packaging capacity of
only 4.7 kb, this allows for the delivery of large genes such as ABCA4.
As an additional effect of the lack of viral genes, the efficacy of transduction is also
increased, resulting in a higher number of cells successfully transduced and increased
transgene expression for a given dose because the lack of viral genes equates with a lack
of viral proteins being produced within the transduced cell. The presence of viral proteins
would increase the immune response to transduced cells and cause them to be cleared by
29
the immune system, hence reducing the strength and duration of transgene expression
[160].
Upon viral entry, the adenovirus capsid undergoes a controlled disassembly. The viral
genome in complex with viral proteins is then transported to the nucleus and delivered
via the nuclear pore complex (Figure 6) [99]. This process of nuclear entry is missing in
certain viruses such as retroviruses, and they must rely on the cell to undergo mitosis and
the break-down of the nuclear-envelope before access to the nucleus can be gained. As
such, adenovirus is capable of transducing cells regardless of their cell-cycle status,
making them capable of transducing quiescent cells.
As previously discussed, the ability of a virus to integrate its DNA into the host genome
can be viewed as a benefit or a safety risk. In the case of gene therapy for Stargardt’s
disease, the ability to integrate into the host genome would be considered only as an
additional safety risk. This is because photoreceptor cells are neural cells that do not
regenerate or “turnover”, and thus any cells transduced would remain active indefinitely.
As there are no concerns regarding the dilution of the transgenes during mitosis, there is
no advantage to viral genome integration.
30
Figure 4 – Schematic of the HDAd production technique with the Cre/Lox system [154]
This figure shows schematically the DNA contribution from the helper virus and vector
plasmid. Of note are the loxP sites on the helper virus genome that flank the packaging
signal (ѱ). The production cell line, 293Cre, express the Cre recombinase that removes
the packaging signal such that the helper virus genome will not be packaged. The cell
line also provides the E1 adenoviral genes, as the helper virus lacks the E1 region,
ensuring the helper virus is unable to replicate in cells other than the producer cell line.
The foreign gene indicated in the figure corresponds to the EGFP and ABCA4 transgene
used in the work herein. The stuffer sequences consist of human non-coding genomic
sequences and serve to provide the appropriate length of DNA for viral packaging.
31
1.3.3. Adenovirus tropism
The tropism of a virus refers to the type of cells that the virus is capable of infecting.
Tropism is primarily a function of the types and quantity of the receptors present that are
compatible between the viral capsid and the cell surface. Note that in the context of this
section, tropism concerns the viral attachment and entry into the host cell, but does not
refer to the requirements of the virus life cycle.
(See Figure 5 for a schematic figure of viral structure and Figure 6 for a schematic
diagram of viral entry)
Adenovirus serotype 5 (Ad5) is part of species C [64]. As such, it uses the
Coxsackievirus B and adenovirus receptor (CAR), heparan sulfate glycosaminoglycans
(HSG), as receptors [137]. Clathrin mediated endocytosis then occurs to envelop the
virion into an endosome after binding between the RGD motif present on the penton-base
that forms part of the viral capsid and the cell-surface integrins [157, 188]. The
conditions within the endosome then trigger viral disassembly and escape from the
endosome [43, 77, 201].
The primary receptor for adenoviral tropism is CAR. This receptor functions as a
homophilic adhesion molecule during neuro-network formation [85], although it was first
discovered for its binding to Coxsackievirus and adenovirus, and hence its name. This
homophilic binding contributes to the integrity of tight junctions formed between
epithelial cells [39]. Almost all adenoviruses, except for species B, utilize CAR as a
receptor for cellular attachment to bind the virion onto the host cell [170]. It is the
trimeric, carboxy-terminal knob of the fibers projecting from the surface of the viral
32
capsid that binds to the CAR, and is a known factor in gene therapy viral vector tropism,
specifically in applications involving Ad5 [171]. Previous studies have demonstrated that
the length and flexibility of the fiber is crucial for CAR dependent viral attachment and
entry, with viruses carrying short fibers having much lower binding affinity for CAR
expressing epithelial cells [231]. In addition, the disruption of CAR by adenovirus fiber
mediates the escape of newly created virions from the epithelial cell layers [217].
Integrins are a diverse family of heterodimeric receptors that serve a wide range of
cellular functions, including cell adhesion, cell growth and differentiation, cell motility,
wound repair, and phagocytosis [88]. Many cellular and extra-cellular proteins contain an
RGD motif that binds to integrins for such purposes [177]. Because integrins are so
widely expressed, many viruses and bacteria of diverse backgrounds and widely varying
targets all express such RGD motifs, including enterovirus [13] Coxsackievirus [174],
HIV [214], as well as Borrelia sp. [38], Yersinia sp. [89] and Bordetella sp. [90]
bacteria. Sequence analysis and modification experiments have revealed that while the
RGD motif is required for integrin interaction, it is the flanking sequences that specify
which integrin the RGD motif will interact with [227].
In the context of adenovirus, an interaction between the RGD motif in the penton base of
the viral capsid [135] and the integrins present on the host-cell surface mediates viral
entry [7, 12, 135, 207, 228]. Although the presence of the RGD motif is not necessary for
successful transduction, it greatly increases the efficiency of infection [70].
Heparan sulfate glycosaminoglycans (HSG) have been observed to contribute to Ad2 and
Ad5 viral attachment in a CAR independent manner such that when both CAR and HSG
33
binding have been blocked, neither serotype is able to establish viral attachment and
entry [49, 50]. Experiments involving the mutation of the fiber have shown that a motif
present in the proximal part of the Ad5 fiber is necessary and sufficient for HSG binding.
When CAR interaction, integrin binding, and the HSG binding have all been disabled,
Ad5 cannot infect animal models [188, 189].
In summary, the viral tropism is largely influenced by the fiber-knob – CAR interaction
for viral attachment, and RGD motif – integrin interaction for viral entry. Interestingly,
there is a synergistic effect in play as a long, flexible fiber in the presence of the RGD
motif allows for simultaneous interaction of both components, resulting in higher
infection efficiency [169].
34
35
Figure 5 – Schematic figure of adenovirus structure [152] and fiber structure [138]
This schematic figure of the adenovirus and fiber demonstrate the icosahedral shape of
the viral capsid formed by the hexons. The fibers of the adenovirus project from the
vertices where the facets of the protein capsid intersect. Of particular note in this diagram
is are the penton base, fiber, and fiber knob as expanded at the bottom of the figure as
they determine the tropism of the virus as discussed in Section 1.3.3.
36
Figure 6 – Schematic diagram of adenovirus attachment and entry via CAR and integrin
binding [152]
The initial step of adenovirus entry involves the binding of the fiber knob to its cell-
surface receptor which is CAR or CD46 in most serotypes. The integrin on the cell
surface then comes in contact with the RGD motif present in the penton base of the fiber,
and triggers endocytosis via a clatherin coated pit. After endosomal escape, the viral
genome is directed to the nucleus via the cell’s microtubule network, making nuclear
entry possible despite the presence of a nuclear envelope.
37
1.3.4. Retinal gene therapy
The first and most well-known success with retinal gene therapy involved the use of
AAV to treat Leber’s congenital amaurosis sub-type 2 (LCA2). Three separate but
simultaneous human clinical trials were conducted to assess the ability of AAV to treat
this disease caused by RPE65 mutations. All three trials reported no safety concerns after
treatment and noticeable but not dramatic increases in visual function [34, 81, 130].
Improvements in visual perception compared to the baseline was still observed 1 year
after treatment [129] and immune response continued to be minimal [184]. The group
with the largest cohort of 12 then selected three patients for administration of the vector
into the contra-lateral eye that was not treated in the initial trial [9]. Both subjective
visual function assessments and objective measurements demonstrated improved visual
abilities in the newly treated eye and minimal immune response.
This data was very encouraging in the development of retinal gene therapy as it
demonstrated the possibility of retinal gene therapy mediated by viral vectors. It also
proved that the immune response is minimal, likely due to the immune privileged status
of the eye. Consequently, researchers have been emboldened to pursue retinal gene
therapy, with a clinical trial underway for choroideremia [126] and another planned for
Leber’s hereditary optic neuropathy [45]. Notably, both employ AAV as their vector
which is understandable given the proven efficacy of AAV in the retina. Also of interest
is that of the three diseases, Leber’s hereditary optic neuropathy is the only one that
involves the neural retina, and it will be interesting to learn how well the AAV can
38
deliver therapeutic genes to the neural retina, and whether there will be an immune
response.
1.3.5. Gene Therapy for Stargardt’s disease
Studies towards applying gene therapy to treat Stargardt’s disease have been conducted
by several groups. AAV has been a particularly hot topic in ocular gene therapy
especially given the progression of the human clinical trials in the treatment of Lebers
congenital amaurosis (Section 1.3.4). However the size of ABCA4 clearly exceeds that of
the packaging capacity of AAV at 4.6 kb. Despite this contradiction, one group has
claimed success in expressing ABCA4 via AAV [4]. However, this finding was not
commonly accepted and three individual groups have followed up to find that the
original study likely observed an aberration of multiple, incomplete parts of ABCA4
being carried by separate virions and that co-transduction within the host cell led to
random recombination. As such, AAV cannot confer expression of the ABCA4 protein to
host cells [83, 114, 234].
Others have investigated the use of lentivirus for delivering ABCA4. Unlike AAV, their
carrying capacity allows for the delivery of an intact ABCA4. Kong et al. used an equine
infectious anemia virus (EIAV) based vector, a sub-category within lentiviral vectors, to
demonstrate reduced A2E accumulation in knock-out mice. However, functional
phenotypes were not assessed and the transduction levels, even when using a CMV
promoter, were very low [109]. Nonetheless, this group has conducted non-human
primate studies with good morphological results, despite the lack of functional assays or
39
biochemical assays [15]. The results have led to human clinical trials (NCT01367444)
although the trials are still in progress and the results are as yet unpublished.
Nanoparticle-based gene therapy (Section 1.3.1.4) using DNA bound lysine polymers has
also been conducted and showed some function recovery, although the distribution of the
expression is poor [78] as the authors have conceded themselves [79].
Although the studies describe herein were initiated before the publication of the EIAV
and the nanoparticle trials, we nonetheless believe there is value in the work as lentivirus
contains safety concerns still under study. In addition, neither the lentivirus nor the
nanoparticles established the same level of transduction distribution as we demonstrated
using helper-dependent adenoviral vectors (Section 3.4.1).
40
1.4. Hypothesis
Given the potential advantages to the use of HDAd, we hypothesized that HDAd could
be used to deliver ABCA4 to the photoreceptor cells of the retina in an animal model.
To test this hypothesis, we proposed two main objectives:
Determine whether HDAd can deliver reporter genes to transduce the retina with
control over cell-specificity via transcriptional regulation
Determine whether replacement of the reporter gene with an ABCA4 expression
cassette can confer ABCA4 expression in cell culture and in vivo using mouse
models.
This work would represent a significant step towards retinal gene therapy as it would
validate the use of HDAd in this application as there have been no studies of the use of
HDAd in the retina, and would circumvent the problems of carrying capacity associated
with AAV which is currently popular in retinal gene therapy.
41
2. Materials and Methods
2.1. Molecular Cloning
2.1.1. Plasmid extraction
For plasmid minipreps, each culture was first plated on 1.5% w/v LB Lennox agar and
incubated at 37˚C in an incubator. Single colonies were picked using a sterile toothpick
and transferred into 1 mL of LB Lennox broth and incubated at 37˚C with shaking at 200
RPM for 8 hours. 50 μL of this was used to inoculate 5 mL of LB Lennox broth and
incubated at 37˚C with shaking at 200 RPM for 16 hours. Plasmid extraction was
performed using the QIAprep Spin Miniprep Kit (QIAGEN Inc. Canada, Mississauga)
with the microfuge protocol as per manufacturer’s instructions. Elution was performed
using 50 μL of Elution Buffer, yielding approximately 500 ng/μL. In all growth media,
ampicillin at 200 μg/mL (Sigma-Aldrich Canada Ltd., Oakville) was used for selection
and for maintaining the plasmid. All microbiological growth media were purchased from
Difco (Becton, Dickinson and Company, Mississauga) unless otherwise stated.
A list of plasmids can be found in Table 1.
42
Table 1 – List of plasmids
Plasmid name Construct Notes pBluescript II SK (+)
Common cloning construct
pBSIIPubcHAHprp3CodingBGHpA
From previous work in Hu Lab; source of Ubiquitin C intron
pC4HSU Plasmid for HDAd vector production (Sections 1.3.2.5, 2.3)
pcDNA3 Used as source of bovine growth hormone polyA tail
pEGFP-C1 Used as source of EGFP after addition of stop codon
pMP6A Used as source of hybrid intron (Section 3.2)
pRK5-ABCR Source of ABCA4 [199] pSL001 BGH polyA BGH polyA PCR from pcDNA3 pSL002 EGFP – BGH polyA pSL003 Hybrid intron – EGFP –
BGH polyA
pSL004 PCMVIE – Hybrid intron – EGFP – BGH polyA
pSL005 EGFP EGFP PCR from pEGFP-C1 with stop codon insertion
pSL006 Hybrid intron Hybrid intron PCR from pMP6A pSL007 PCMVIE CMVIE promoter from phCMV1 pSL008 PCMVIE – Hybrid intron pSL010 PRho323 – hybrid intron –
EGFP – BGH polyA 323 bp rhodopsin promoter PCR from RP11-529F4
pSL011 PRho1553 – hybrid intron – EGFP – BGH polyA
1553 bp rhodopsin promoter PCR from RP11-529F4
pSL012 IRBPE - PRho323 –Hybrid intron – EGFP – BGH polyA
IRBP Enhancer PCR from genomic HEK293 DNA
pSL013 IRBPE - PRho1553 –Hybrid intron – EGFP – BGH polyA
IRBP Enhancer PCR from genomic HEK293 DNA
pSL014 PCMVIE – Hybrid intron – adaptor – BGH polyA
PstI-AgeI-PacI-BamHI adaptor put in place of EGFP for ABCA4 insertion
pSL015 PRho323 –Hybrid intron – adaptor – BGH polyA
PstI-AgeI-PacI-BamHI adaptor put in place of EGFP for ABCA4 insertion
pSL016 PRho1553 –Hybrid intron – PstI-AgeI-PacI-BamHI adaptor
43
adaptor – BGH polyA put in place of EGFP for ABCA4 insertion
pSL017 IRBPE - PRho323 –Hybrid intron – adaptor – BGH polyA
PstI-AgeI-PacI-BamHI adaptor put in place of EGFP for ABCA4 insertion
pSL018 IRBPE - PRho1553 –Hybrid intron – adaptor – BGH polyA
PstI-AgeI-PacI-BamHI adaptor put in place of EGFP for ABCA4 insertion
pSL019 PCMVIE – Hybrid intron – ABCA4 – BGH polyA
ABCA4 inserted using adaptor
pSL020 PRho323 – Hybrid intron – ABCA4 – BGH polyA
ABCA4 inserted using adaptor
pSL021 PRho1553 –Hybrid intron – adaptor – BGH polyA
ABCA4 inserted using adaptor
pSL022 IRBPE - PRho323 – Hybrid intron – ABCA4 – BGH polyA
ABCA4 inserted using adaptor
pSL023 IRBPE - PRho1553 – Hybrid intron – ABCA4 – BGH polyA
ABCA4 inserted using adaptor
pSL024 PCMVIE – Hybrid intron – EGFP – BGH polyA in pC4HSU
From pSL004
pSL025 IRBPE - PRho1553 –Hybrid intron – EGFP – BGH polyA in pC4HSU
From pSL013
pSL026 PCMVIE – Hybrid intron – ABCA4 – BGH polyA in pC4HSU
From pSL019
pSL027 IRBPE - PRho1553 – Hybrid intron – ABCA4 – BGH polyA in pV4HSU
From pSL023
pSL028 PCMVIE – Hybrid intron – ABCA4::EGFP – BGH polyA
Fusion protein of ABCA4 and EGFP
pSL029 PRho323 – hybrid intron – ABCA4::EGFP – BGH polyA
Fusion protein of ABCA4 and EGFP
pSL030 PRho1553 – hybrid intron – ABCA4::EGFP – BGH polyA
Fusion protein of ABCA4 and EGFP
pSL031 IRBPE - PRho323 –Hybrid intron – ABCA4::EGFP – BGH polyA
Fusion protein of ABCA4 and EGFP
pSL032 IRBPE - PRho1553 –Hybrid Fusion protein of ABCA4 and
44
intron – ABCA4::EGFP – BGH polyA
EGFP
pSL033 PCMVIE – Hybrid intron – ABCA4::EGFP – BGH polyA in pC4HSU
From pSL028; Did not proceed with virus production
pSL035 PRho1553 – hybrid intron – ABCA4::EGFP – BGH polyA in pC4HSU
From pSL030; Did not proceed with virus production
pSL044 PCMVIE – EGFP – BGH polyA
Hybrid intron removed
pSL045 IRBPE - PRho1553 –EGFP – BGH polyA
Hybrid intron removed
pSL046 PCMVIE – EGFP – BGH polyA in pC4HSU
From pSL044; For vector production of CMV-EGFP
pSL047 IRBPE - PRho1553 –EGFP – BGH polyA in pC4HSU
From pSL045; For vector production of Rho-EGFP
pSL048 PCMVIE –CMV Intron A – EGFP – BGH polyA
CMV Intron A inserted from PCR of phCMV1
pSL049 IRBPE - PRho1553 – CMV Intron A – EGFP – BGH polyA
CMV Intron A inserted from PCR of phCMV1
pSL050 PCMVIE –CMV Intron A – EGFP – BGH polyA
Did not proceed with virus production
pSL051 IRBPE - PRho1553 – CMV Intron A – EGFP – BGH polyA in pC4HSU
Did not proceed with virus production
pSL052 IRBPE - PRho1553 – UBC Intron – EGFP – BGH polyA
UBC intron inserted from p pBSIIPubcHAHprp3CodingBGHpA
pSL053 IRBPE - PRho1553 – UBC Intron – Adaptor – BGH polyA
pSL054 IRBPE - PRho1553 – UBC Intron – ABCA4 – BGH polyA
pSL056 IRBPE - PRho323 –EGFP – BGH polyA
pSL057 PCMVIE – Adaptor – BGH polyA
pSL058 PCMVIE – CMV Intron A – Adaptor – BGH polyA
pSL059 PCMVIE – ABCA4 – BGH polyA
pSL060 PCMVIE –ABCA4::EGFP – BGH polyA
45
pSL061 PCMVIE – CMV Intron A – ABCA4 – BGH polyA
pSL062 PCMVIE – CMV Intron A – ABCA4::EGFP – BGH polyA
pSL065 IRBPE - PRho1553 – CMV Intron A – ABCA4::EGFP – BGH polyA
pSL066 IRBPE - PRho1553 – CMV Intron A – ABCA4 – BGH polyA
pSL067 IRBPE - PRho1553 –ABCA4 – BGH polyA
pSL068 IRBPE - PRho1553 –ABCA4 – BGH polyA in pC4HSU
From pSL067; For vector production; Rho-ABCA4
pSL069 PCMVIE – ABCA4 – BGH polyA in pC4HSU
From pSL059; For vector production; CMV-ABCA4
pSL070 PCAG – EGFP – BGH polyA pSL071 PCAG – EGFP – BGH polyA
in pC4HSU From pSL070; For vector production; CAG-EGFP
pSL072 PCAG – adaptor – BGH polyA
pSL073 PCAG – ABCA4 – BGH polyA
pSL074 PCAG – ABCA4 – BGH polyA in C4HSU
From pSL073; For vector production; CAG-ABCA4
RP11-529F4 BAC library clone containing rhodopsin promoter, purchased from The Center for Applied Genomics, Toronto
46
2.1.2. Transformation of competent E. coli DH5α
Competent E. coli DH5α was prepared using the calcium chloride method [179]. DNA
used for transformation was prepared by plasmid miniprep as per Section 2.1.1. An
individual 100 μL aliquot of the competent bacteria was removed from -80˚C storage and
thawed on ice for 10 minutes. 10 μL of DNA at approximately 500 ng/μL was added to the
bacteria and incubated further on ice for 30 minutes. The cells were then heat-shocked in a
42°C water-bath for 45 seconds and placed on ice for 2 minutes. 1 mL of LB broth was
added to each aliquot and incubated at 37°C for 45 minutes. 10 μL and 100 μL aliquots were
plated onto agar with the appropriate antibiotic. A separate 10 μL aliquot was plated onto
agar without antibiotic to demonstrate the viability of the culture. The remainder was
centrifuged at 3,000 x g for 5 minutes. Most of the supernatant was removed, the pellet was
resuspended, and plated.
2.1.3. Polymerase Chain Reaction
Polymerase chain reactions (PCR) were conducted using a Geneamp PCR System 2400
thermocycler (PerkinElmer Inc, Woodbridge). The Finnzyme Phusion High-Fidelity PCR
Kit (New England Biolabs Ltd., Whitby) was used, including all associated reagents.
Each 200 μL tube contained 25 to 50 μL of the reaction mixture (For 50 μL reaction: 37
μL water, 1 μL dNTP at 10 mM, 0.5 μL of each primer, 0.5 μL DNA template at 250
ng/μL, 10 μL of 5x HF Buffer, 0.5 μL polymerase). The primers used are listed in Table
2.
Where required for subsequent manipulations, post-PCR clean-up was conducted using
the QIAquick PCR Purification Kit (QIAGEN Inc. Canada, Mississauga) with the
47
microfuge protocol as per manufacturer’s instructions. Elution was performed using 20
μL of Elution Buffer per 50 μL of PCR reaction.
48
Table 2 – List of primers
Name Construct Sequence Notes
20090205-01 PstI-EGFP Forward ATCTGCAGCGCCACCATGGTGA
For PCR of EGFP from pEGFP-C1
20090205-02 EGFP-BamHI Reverse
ATGGATCCTCACTTGTACAGCTCGTCC
20090206-01 BamHI-BGH polyA Forward
ATGGATCCTATTCTATAGTGTCACCTAAATGCTAGAG
For PCR of BGH polyA tail from pcDNA3
20090206-02 BGH polyA-NotI Revserse
ATGCGGCCGCTCCCCAGCATGCCT
20090206-03 EcoRV-ExIntron Forward
ATGATATCGCCTGGAGACGCCA For PCR of hybrid
intron from pMP6A 20090206-04
ExIntron-PstI Reverse
ATCTGCAGGTTGGACCTGGGAGTGG
20090209-01 XhoI-PCMVIE Forward
ATCTCGAGTAGTTATTAATAGTAATCAATTACGGGG For PCR of CMVIE
promoter from phCMV1
20090209-02 PCMVIE-EcoRV Reverse
ATGATATCGATCTGACGGTTCACTAAACC
20090320-02 Xho-PRHO500 Forward
ATGCCTCGAGCAATTCCATGCAACAAGGA
For PCR of rhodopsin promoter from RP11-529F4; single reverse promoter, multiple forward promoters to create different promoter lengths
20090320-03 Xho-PRHO1000 Forward
ATCGCTCGAGCAGTGCCCTGTCTGCTG
20090320-04 Xho-PRHO2000 Forward
ATCGCTCGAGCTGCTAAGCTGTGTGGGAT
20090414-01 PRHO-EcoRV Reverse 2
GCATGATATCGGCTGTGGCCCTTG
20090414-02 XhoI-PRHO323 Forward
GTACCTCGAGAGTTAGGGGACCTTCTCCTC
20090414-03 XhoI-PRHO1553 Forward
GCATCTCGAGTGTTTGTGGTCCCTGTG
20090415-01 KpnI-IRBP Enhancer Forward
GCATGGTACCTGGAGGCAGAGGAGAAG For PCR of IRBP
enhancer 20090415-02
IRBP-XhoI Enhancer Reverse
GCATCTCGAGGCTTTATGAAGGCCAA
49
AGA
20090506-01 AgeI-ABCA4 Forward
CGATACCGGTCGCCACCATGGGCTTCGTGAGACAGATAC For PCR of ABCA4
from pRK5-ABCA4 20090506-02
ABCA4-PacI Reverse
CGATTTAATTAATCAGTCCTGGGCTTGTCG
20090506-03 PstI-AgeI-PacI-BamHI Adaptor Forward
GCGATACCGGTCGATTTAATTAACGATG
Joined without PCR to form an adaptor. Used in place of EGFP to add restriction sites for ABCA4 insertion
20090506-04 PstI-AgeI-PacI-BamHI Adaptor Reverse
GGATCCATCGTTAATTAAATCGACCGGTATCGCTGCAG
20091210-01 SalI-ABCA4-EGFP Forward
ATCGGTCGACAAGCCCAGGACATGGTGAGCAAGGGCG
Used to PCR with pRK5-ABCA4 to form an ABCA4 mega-primer and then PCR with pSL005 to form ABCA4::EGFP fusion
20091210-02 EGFP-PacI Reverse ATCGTTAATTAATCACTTGTACAGCTCGTCCATG
20100707-01 CMV Intron A-EcoRV Reverse
ATCGGATATCCTGCAGAAAAGACCCAGG
For PCR of CMV Intron A from phCMV1
20100707-02 EcoRV - CMV Exon 1 Forward
ATGCGATATCCAGATCGCCTGGAGAC
20100809-03 UBC Intron Corr Forward
AGCCCGCTACTCACCAA
For PCR of UBC intron from pBSIIPubcHAHprp3CodingBGHpA
20100809-04 UBC Intron Corr Reverse
TTGGTGAGTAGCGGGCT
20100809-05 AgeI-EGFP Forward
GTACACCGGTCGCCACCATGGTGAGC
For PCR of EGFP from pEGFP-C1 with a different added restriction site
20101018-01 Mid-IRBPE Forward
CAGCAGGGCTAAGGATATG
For use in sequencing
20101018-02 Mid-BGH PolyA Reverse
AGCATGCCTGCTATTGTC
For use in sequencing
20101018-03 Late-PRHO Forward
GAGGTCACTTTATAAGGGTCTG
For use in sequencing
20101018-04 Late-EGFP Reverse GCTCAGGTAGTGGTTGTCG
For use in sequencing
20101018-05 Early-PCMV Forward
CATAGCCCATATATGGAGTTCC
For use in sequencing
50
20101018-06 Late-PCMV Forward
CGGTGGGAGGTCTATATAAGC
For use in sequencing
20111014-01 hABCA4-F CGGAGGATTCTGATTCAGGAC
For qRT-PCR of ABCA4
20111014-02 hABCA4-R GGGAGCAGACATTGGAGTC
For qRT-PCR of ABCA4
20111014-03 ABCA4-End Forward
TGCTCATCGAGGAGTACTCAG
For use in sequencing
20111014-04 ABCA4-PolyA Gap Reverse
GGTGACACTATAGAATAGGATCCATC
For use in sequencing
51
2.1.4. Restriction digest
Restriction digests were performed as per manufacturer supplied protocols. All reactions
consisted of 5% of the enzyme mixture in the appropriate buffer, supplemented with 100
μg/mL bovine serum albumin (BSA). The DNA content of the reaction consisted of up to
50% of the volume of the reaction when derived from plasmid miniprep (Section 2.1.1)
or from PCR after clean-up (Section 2.1.3). The remainder of the reaction consisted of
water and the supplied reaction buffer. For reactions where phosphate removal from the
cleavage sites was desired, 1 μL of calf intestinal alkaline phosphatase was added to the
reaction.
Where blunt-ending after restriction digest was desired, the reaction was first cleaned-up
using the QIAquick PCR Purification Kit (QIAGEN Inc. Canada, Mississauga) with the
microfuge protocol as per manufacturer’s instructions for post-enzymatic reaction
cleanup. Mung bean nuclease was used as per manufacturer’s instructions. Temperature
control for the blunt-ending reaction was accomplished by incubating inside an
appropriately programmed thermocycler.
Where alkaline phosphatase treatment was desired to prevent self-ligation, calf intestinal
phosphatase (CIAP) was used as per manufacturer’s instructions. It was added with the
restriction enzyme in most cases, but added after the digest and further incubated if the
restriction enzyme required an incubation temperature other than 37 ˚C.
All restriction digest enzymes, CIAP, BSA, and mung bean nuclease were purchased
from New England Biolabs (New England Biolabs Ltd., Whitby).
52
2.1.5. Agarose gel electrophoresis
Agarose gels were cast at 0.8% agarose (BioShop Canada Inc., Burlington) by mass and
run at 80 volts for 90 minutes in tris-acetate EDTA buffer (TAE: 40 mM Tris-base, 1
mM EDTA, 20mM CH3COOH). Visualization of DNA was accomplished staining the
gel in 0.5 μg/mL ethidium bromide (Sigma-Aldrich Canada Ltd., Oakville ) solution in
TAE, and then photographed under UV transillumination. For resolving DNA below
2,000 bp, 1.5% agarose gels were used while 0.5% agarose gels were used for separating
DNA larger than 8,000 bp.
Where required, the DNA was extracted from the gel using the QIAquick Gel Extraction
Kit (QIAGEN Inc. Canada, Mississauga) with the microfuge protocol as per
manufacturer’s instructions. Elution with 10 μL of elution buffer was performed twice to
maximize DNA concentration and recovery.
2.1.6. Ligation
Ligations were performed with 100 ng of vector DNA per reaction, with the insert DNA
at molar ratios of 3, 5, and 10 times relative to the vector. The combination of vector
DNA, insert DNA, and water was placed in a PCR tube and heated in the thermocycler to
80°C, then reduced to 16°C at 1°C per minute. Buffer and T4 DNA ligase (New England
Biolabs Ltd., Whitby) were then added as per manufacturer recommendations and
incubated at 16°C for 4 hours, then stored at 4°C until transformation.
53
2.1.7. Sequencing
DNA for sequencing was prepared by plasmid miniprep (Section 2.1.1) or by PCR
(Section 2.1.3). The DNA was then diluted to 250 ng for plasmid DNA, or 50 ng for PCR
products, both in 7 μL of sterile water. 5 pmols of primer in 0.7 μL of sterile water was
added. A list of the primers used can be found in Table 2. All sequencing was performed
by The Center for Applied Genomics at The Hospital for Sick Children. The resulting
electrophoretograms were reviewed manually using GENtle (SourceForge,
http://sourceforge.net/projects/gentle-m/).
2.2. Tissue Culture
2.2.1. Cell lines
The mammalian tissue cell lines used are listed in Table 3 along with the media used and
sources. The cells were grown in either 75 cm2 or 25 cm2 ventilated tissue culture flasks
(BD Biosciences, Mississauga) at 37°C in 5% CO2, 95% room-air atmosphere. When the
cells exceeded 80% confluence, the medium was removed by aspiration. The cells were
washed three times in 5 mL sterile PBS (Wisent Inc., St. Bruno). All liquid was removed
before 1 mL of 0.25% trypsin with 2.21 mM EDTA (Wisent Inc., St. Bruno) was applied.
When the cells detached, 5 mL of medium was added and the entire volume was
transferred to a 15 mL conical-bottom centrifuge tube. The cells were centrifuged for 5
minutes at 1200 x g, and the supernatant was discarded. The pellet was then resuspended
in 5 mL of medium. A 0.5mL volume of this suspension was seeded to 20 mL of medium
in a new 75 cm2 flask and incubated. Unless otherwise stated, all media were
supplemented with penicillin-streptomycin (Wisent Inc., St. Bruno).
54
Table 3 – List of cell lines
Cell line Media Notes
116
MEM (Joklik modified), 10% FBS, Penicillin/Streptomycin; Hygromycin 100 μg/mL
Suspension adapted, Cre expressing cell line for vector production [158] MEM from Sigma-Aldrich Canada Ltd., Oakville; FBS from Gibco (Life Technologies Inc., Burlington)
ARPE-19 DMEM-F12, 10% FBS, Penicillin/Streptomycin
RPE like cell line DMEM-F12 from Wisent Inc., St. Bruno
HeLa RPMI 1640, 10% FBS, Penicillin/Streptomycin
Cervical epithelial cell line RPMI 1640 from Wisent Inc., St. Bruno
WERI-Rb RPMI 1640, 10% FBS, Penicillin/Streptomycin
Retinoblastoma cell line, used for in vitro studies with cell-type specific promoters Kind gift of Dr. Rod Bremner (University of Toronto, Toronto)
Y79 RPMI 1640, 10% FBS, Penicillin/Streptomycin
Retinoblastoma cell line, used for in vitro studies with cell-type specific promoters; Later replaced with WERI-Rb; Kind gift of Dr. Rod Bremner (University of Toronto, Toronto)
55
2.2.2. Transfection
1 x 106 cells per well were seeded into 6-well tissue culture treated plates (BD
Biosciences, Mississauga) in 1 mL of transfection medium (complete tissue culture
medium without antibiotics). The cells were incubated until approximately 80%
confluence. For each well, 800 ng of DNA from DNA miniprep (Section 2.1.1) was
suspended in 50 μL of plain media. At the same time, 2 μL of Invitrogen Lipofectamine
2000 (Life Technologies Inc., Burlington) was suspended in 50 μL of basal media. Both
were incubated at room temperature for 5 min before being combined. This was further
incubated at room temperature for 20 minutes before the mixture was added to the cells.
The cells were then incubated for 16 hours, after which the medium was aspirated. The
cells were washed and incubated in complete medium.
2.2.3. Transduction
2.5 x 105 cells per well were seeded into a 6-well tissue culture treated plate in 1 mL of
medium and incubated overnight. The medium was removed and the attached cells were
washed twice with plain medium without antibiotics and FBS. 300 μL of plain medium
was added per well and the viral vector, appropriately diluted in 100 μL of plain medium
for the desired titer, was added. The plates were gently agitated to ensure the suspension
was well mixed, and incubated for 2 hours under normal culture conditions. Each well
was then supplemented with 2.6 mL of complete media to restore normal FBS and
antibiotics concentrations.
56
2.2.4. Flow Cytometry
Cells in each well from a 24 well plate were trypsinized using 200 μL of 0.25% trypsin
with 2.21 mM EDTA (Wisent Inc., St. Bruno). 800 μL of PBS were then added to the
well and the entire volume transferred to a test tube and analysed on a BD FACSCalibur
(BD Biosciences, Mississauga). Data analysis was performed using FlowJo software
(Tree Star Inc, Ashland).
2.2.5. qRT-PCR
Quantitative real-time PCR was performed using RNA isolated from tissue culture cells
using the Illustra RNAspin Mini Kit (GE Healthcare Life Sciences, Baie d’Urfe) as per
manufacturer’s instructions. For eye tissues, the eye was prepared by enucleation and
dissection in the same manner as for cryosection for imaging (Section 2.4.4). This leaves
the eye-cup containing the retina, with the lens and cornea removed. After dissection, the
remaining musculature was resected and homogenized in lysis buffer using a bead-beater
with sterile stainless beads of 5 mm diameter. Complete homogenization was confirmed
by visual inspection. RNA extraction then proceeded as per manufacturer’s instruction.
The RNA was quantified by photospectrometry after elution.
For reverse transcription into cDNA, Invitrogen SuperScript II Reverse Transcriptase
was used (Life Technologies Inc., Burlington) as per manufacturer’s instructions. 1 μg of
the RNA was used as template with random hexamer primer (Fisher Scientific – Canada,
Ottawa) and 1 μL of RNaseOUT ribonuclease inhibitor (Life Technologies Inc.,
Burlington) in a 20 μL reaction. The reaction was incubated in a Geneamp PCR System
57
2400 thermocycler (PerkinElmer Inc, Woodbridge) under conditions specified by the
manufacturer’s instructions.
The resultant cDNA was diluted by 5-fold before use in qPCR. Power SYBR Green PCR
Master Mix was used as per manufacturer’s instructions for 25 μL reactions. 1.5 μL of 20
μM of each primer was added. The primers used can be found in Table 2. The instrument
used was a 7500 Real-Time PCR System. Both the reagent and the instrument were
purchased from Applied Biosystems (Life Technologies Inc., Burlington).
2.2.6. Western Blot
Protein for western blotting was harvested by washing the cells in PBS and lysing in a
detergent buffer (50 mM HEPES pH 7.4, 50 mM NaCl, 2 mM MgCl2, 26 mM CHAPS, 1
mM DTT; NaCl and MgCl2 from BioShop Canada Inc., Burlington, all other chemicals
from Sigma-Aldrich Canada Ltd., Oakville), containing Complete Protease Inhibitor
(Hoffmann-La Roche Limited, Mississauga) as per manufacturer’s instructions. 300 μL
of buffer was added to each well of a 6-well plate and incubated on ice for 10 minutes
before each sample was transferred to a microcentrifuge tube and centrifuged at 12,000 g
for 60 minutes at 4 ˚C. 30 μL of the supernatant was combined with 30 μL of sample
buffer then loaded into a well of an 8% SDS poly-acrylamide mini-gel. The gel and
buffer were as follows:
2x sample buffer: 10% SDS 400 μL/mL, 0.5M Tris pH 6.8 250 μL/mL, glycerol 200
μL/mL, 0.2% bromophenol blue 50 μL/mL, 2-mercaptoethanol 100 μL/mL
4x separating gel buffer: Tris base 181.6 g/L, SDS 1g/L, pH 6.6
4x stacking gel buffer: Tris base 60.54 g/L, SDS 1g/L, pH 6.8
58
8% SDS separating gel: 30% acrylamide/bisacrylamide 5.33 mL, 4x separating gel buffer
5 mL, water 9.57 mL, 10% APS 100 μL, TEMED, 10 μL
Stacking gel: 30% acrylamide/bisacrylamide 1.33 mL, 4x stacking gel buffer 2.5 mL,
water 6.06 mL, 10% APS 100 μL, TEMED, 10 μL
(30% acrylamide/bisacrylamide solution, APE, and TEMED from Bio-Rad Life Science,
Mississauga; 2-mercaptoethanol from Sigma-Aldrich Canada Ltd., Oakville; All other
chemicals from BioShop Canada Inc., Burlington)
The gel was run at 200 volts for 2 hours or until the bromophenol blue reached the
bottom of the gel. The gel running buffer consisted of Tris base 2.9 g/L, glycine 14.4 g/L,
SDS 1g/L.
After separation, the proteins were transferred onto a Protran nitrocellulose membrane
(Sigma-Aldrich Canada Ltd., Oakville) in transfer buffer (Tris base 3.3 g/L, glycine 14.4
g/L, methanol 20% v/v). The transfer was performed at 200 volts for 1 hour with the
entire apparatus chilled with ice.
After transfer, the membrane was blocked with 1% skim milk in PBS for 1 hour. The
solution was discarded and the primary antibody diluted in PBS was added. After
incubation at room temperature for 1 hour with gentle rocking, the membrane was
washed 3 times in PBS with 0.05% Tween-20 (Sigma-Aldrich Canada Ltd., Oakville) for
15 minutes each time. The horseradish peroxidase secondary antibody was then applied
after dilution in PBS with 0.1% Tween-20 and 0.1% skim milk and incubated with
rocking for 1 hour before washing 3 times as previously described. Amersham ECL
Prime (GE Healthcare Life Sciences, Baie d’Urfe) was then applied as per
manufacturer’s instructions and the membrane was imaged using an Odyssey FC
Imaging System (Li-Cor Biosciences, Lincoln).
59
A list of antibodies can be found in Table 4.
60
Table 4 – List of antibodies
Target Type/Conjugate Notes
ABCA4 Mouse IgG
Rim 3F4;Targets C-terminal of ABCA4; hybridoma fluid; Used at 1:3 dilution for immunofluorescence and 1:5 dilution for Western blot Kind gift of Dr. Robert S. Molday (University of British Columbia, Vancouver)
GAPDH Rabbit IgG (polyclonal) Used for Western blotting at 1:3000 dilution; Trevigen, Gaithersburg
Mouse IgG Alexa Fluor 488
Used for immunofluorescence at 1:3000 dilution; Molecular Probes (Life Technologies Inc., Burlington)
Mouse IgG Horseradish Peroxidase Used for Western blotting at 1:3000 dilution; Bio-Rad Life Science, Mississauga
Rabbit IgG Cy3
Used for immunofluorescence at 1:500 dilution; Jackson ImmunoResearch Laboratories, West Grove
Rabbit IgG Horseradish Peroxidase Used for Western blotting at 1:3000 dilution; Bio-Rad Life Science, Mississauga
Rhodopsin Rabbit IgG (polyclonal)
Used for immunofluorescence at 1:100 dilution; Imgenex, San Diego
61
2.3. HDAd vector production
Viral vector production was accomplished based on previously published protocols [154,
158]. All HDAd production was based on the C4HSU plasmid [154, 158] as the
backbone for gene insertion. 10 μg of the plasmid was digested with PmeI to remove the
portions of the plasmid required for bacterial propagation, and expose the inverted
terminal repeats. A 6 cm diameter tissue culture plate of 116 cells (293-derived, Cre
expressing, suspension adapted production cell line; Table 3) seeded at 20% confluence
was transfected using the CellPhect Transfection Kit (GE Healthcare Life Sciences, Baie
d’Urfe) as per manufacturer’s instructions when the culture reached 90% confluence.
After 24 hours of additional incubation, the medium was changed and 4 x 108 PFU of
NG163 helper virus was added. The culture was incubated for a further 4-5 days and
monitored for cytopathic effect (CPE).
When CPE was present, the cells were harvested by repeatedly pipetting up and down to
detach the cells. The cells in the mixture were lysed by freezing in dry ice chilled
ethanol, and thawed. The lysate in medium was aliquoted and stored in 4% sucrose at -
80˚C and referred to as passage 0 (P0). 20% of the lysate was then used to inoculate
another 6 cm plate of 116 cells at 90% confluence, while simultaneously adding 1.6 x 108
PFU of NG163 helper virus. After 4-5 days of incubation or upon appearance of CPE,
the cells were again harvested and lysed by freezing and thawing as for P0. This mixture
of lysate and media was also aliquoted, stored, and referred to as passage 1 (P1). This
was repeated to obtain passages 2, 3, and 4.
62
For large scale amplification, 10x 15 cm diameter tissue culture plates of 116 cells at
90% confluence were harvested and incubated in a 3 L Celstir flask (Wheaton, Millville)
with 1 liter of media at 60 RPM. At 3 x 105 cells/mL, 500 mL of media is added. On the
2 subsequent days, 500 mL and 1000 mL of media were added. One day after the final
media addition, the cell suspension was centrifuged at 2000 RPM (700 g) at 4 ˚C for 10
minutes in 500 mL polypropylene centrifuge bottles, using a J2-HC centrifuge with a JA-
10 rotor. The centrifuge, rotor, and centrifuge bottles were all purchased from Beckman
Coulter Canada (Mississauga). The cell pellet was resuspended in 150 mL of the
supernatant (conditioned media).
The cell-suspension and 1.1 x 1011 PFU of NG163 were combined in a 250 mL Celstir
flask (Wheaton, Millville). Either the entire volume of passage 3 or 4 from the small
scale vector production, or 2.2 x 1013 vector particles (VP) of previously purified HDAd
vector was also added and incubated for 2 hours with stirring at 60 RPM. If the
previously purified HDAd was of a known infectious titre (IU), 1.1 x 1011 IU was used.
This was then transferred into a 3 L Celstir flask containing 460 mL of conditioned
media from previous cell amplification and 1370 mL of fresh media, and incubated for
72 hours with stirring. The cells were harvested by centrifugation as previously
described, and resuspended in 17 mL of 10 mM Tris-HCl at pH 8.0 (storage buffer) and
stored at -80 ˚C.
To lyse the cell suspension, it was thawed on ice and 1.5 ml of 5% sodium deoxycholate
was added, disrupting lipid membranes without affecting the viral capsid. It was
incubated at room temperature for 30 minutes with gentle rocking. 100 μL of Benzonase
63
nuclease (Sigma-Aldrich Canada Ltd., Oakville) was added and incubated at room
temperature for 30 minutes with gentle rocking. Cell debris was eliminated by
centrifugation at 5500 RPM (2400 g) at 4 ˚C for 15 minutes. This centrifugation
employed 50 mL thick-walled polypropylene centrifuge bottles and a JA-20 rotor, both
from Beckman Coulter Canada (Mississauga), using a J2-HC centrifuge.
To purify the vector, a CsCl gradient was formed in a thin wall, ultra-clear, open top, 14
mL centrifuge tube containing 3 mL of 1.25 g/mL, 3 mL of 1.35 g/mL, and 0.5 mL of 1.5
g/mL CsCl in 10mM Tris-HCl at pH 8.0 (storage buffer). The vector suspension was
placed on the top of this gradient. The mixture was centrifuged at 35,000 RPM (151,000
g) at 4 ˚C for 60 minutes using a SW41 swinging bucket rotor in an Optima
ultracentrifuge, both from Beckman Coulter Canada (Mississauga). Two bands are
typically visible, and the band containing the HDAd vector can be identified as the more
abundant band, while the less abundant band is comprised of residual helper virus.
Identification can also be confirmed by comparing the relative packaged DNA content.If
the HDAd contains a larger packaged DNA than the helper virus genome, HDAd would
be expected to be in the lower, denser portion of the gradient. If the packaged DNA size
is smaller than the helper virus genome, it would be expected to be the higher band. The
appropriate band was harvested by puncturing the tube with a 20 gauge needle and
aspirating the band. This was then transferred into a 15 mL conical bottom tube with an
equal volume of storage buffer. A second gradient centrifugation was done layering the
extracted band from the first centrifugation step on 7 mL of 1.3 g/mL CsCl, with the
remaining volume filled with storage buffer. It was centrifuged overnight at 35,000 RPM
64
(151,000 g) at 4 ˚C, and the visible band was harvested. The equipment was identical to
the previous step.
To dialyze the vector, the harvested band was injected into a 10k molecular weight cut-
off Slide-A-Lyzer dialysis cassette (Fisher Scientific – Canada, Ottawa). This was
dialyzed in 500 mL of storage buffer at 4 ˚C for 24 hours with 2 changes of buffer. The
final product was extracted from the dialysis cassette and stored in aliquots containing
10% glycerol. A small portion was used for measuring the DNA content at OD260. An
estimate of the virus particle density is then calculated based on the packaged DNA size
and OD260. The formula for determining the titre [154] is as follows:
OD260 • dilution factor • 1.1 x 1012 • 36 / (size of vector in kb)
The typical size of the vector genome is approximately 37 kb.
Much of the vector production was performed by Cathleen Duan in our laboratory. Her
contribution was very much appreciated.
2.4. Animal models
All animal work described herein was performed at the Laboratory Animal Services of
the Hospital for Sick Children with supervision by the veterinary staff and with the
approval of the Animal Care Committee. All animals were mice of CD1 strain, and
purchased through Charles River Laboratories (Sherbrooke).
2.4.1. Mydriasis and Anesthesia
24 hours before injection, the right eye of each mouse was administered 1 drop of 1%
atropine sulfate. Within 30 minutes of injection, 1 drop of 1% tropicamide and 1 drop of
65
2.5% phenylephrine HCl were administered to the right eye, and readministered
immediately before injection if the pupil dilation was deemed inadequate. The above
ophthalmic solutions were purchased from Alcon (Alcon Canada Inc., Mississauga). To
protect the eye and improve visualization into the eye, the right eye was covered using a
solution of 2.5% hypromellose (Akorn, Lake Forest). The surface tension of the solution
provided a smooth surface, avoiding the optical distortion that resulted from viewing
through the relatively rough surface of the eye.
For anesthesia, a mixture of 1 mg ketamine and 0.1 mg xylazine per 10 g body weight
was administered by intraperitoneal injection. These were sourced from Zoetis (Zoetis
Canada, Kirkland) and Bayer (Bayer HealthCare, Toronto) respectively.
2.4.2. Trans-sclera sub-retinal injection
All injections took place when the mice were 3 to 6 weeks of age. Before injection,
fluorescein (Sigma-Aldrich Canada Ltd., Oakville) was added to a final concentration of
0.1 mg/mL to give colour to the vector suspension such that the injection could be better
visualized.
(See Figure 1 for a schematic diagram of the eye)
For the trans-sclera method of sub-retinal injection, a 32 gauge needle (BD – Canada,
Mississauga) was used to make an incision distal to the corneal limbus, medial to the
head and parallel to the sagittal plane. This is identified externally as the “whites” of the
eye, near the edge where the iris begins. A custom 33 gauge, 1 inch, blunt-point needle,
mounted to a Model 85, 5 μL syringe (Hamilton Company, Reno) loaded with 1 μL of
66
the vector was inserted into this opening. It was guided by dissection microscope (M-
series; Leica Microsystems Inc., Concord) through the eye to the portion of the retina
directly opposite the incision site. The needle was pressed against the retina with gentle
pressure to ensure penetration across the neural retina without exceeding beyond the
choroid. The plunger was then depressed at a rate of less than 1 μL / minute. If excessive
leakage was observed by the presence of colour in the vitreous humour, the injection was
paused and the needle was repositioned and the rate of injection reduced. After the
plunger had been fully depressed, the needle was held in place for an additional 60
seconds as early withdrawal of the needle from the injection site resulted in reflux of the
vector from the sub-retinal space into the vitreous.
After the needle had been withdrawn, a small amount of Cortimyxin antibiotic ointment
(Sandoz Canada, Boucherville) was applied. The animal was allowed to recover in a
heated, oxygen rich environment.
The animal and equipment were hand-held during the injection. One person performed
the injection with an assistant who pushed the plunger. No additional equipment was
used to secure the animal or the syringe.
2.4.3. Trans-corneal sub-retinal injection
Preparation, post-operative treatment, and the equipment used were identical for the
trans-corneal method of sub-retinal injection. However, the initial incision was made in
the cornea, proximal to the limbus, rather than in the sclera, distal to the limbus. This
area is identified externally as the edge of the clear portion of the eye. This incision was
made at a very shallow angle to avoid penetrating beyond the anterior chamber and
67
damaging the lens. The tip of the needle containing the vector was then inserted into the
anterior chamber through this opening at a shallow angle to avoid damaging the lens. The
needle was then rotated with the tip within the anterior chamber such that the needle was
pointed perpendicular to the cornea. The needle was then inserted into the vitreous, close
to but not penetrating the lens. By advancing the needle such that the tip was close to the
periphery of the vitreous chamber, the tip of the needle did not penetrate the lens. Rather,
as the needle was advanced, the shaft of the needle displaced the lens medially. When the
needle tip was approximately at the opposite side of the eye relative to the injection site,
the tip was pressed against the retina and the rest of the injection proceeded as previously
described.
2.4.4. Cryosection
Animals were sacrificed using CO2 as per the protocols of the Laboratory Animal
Services of the Hospital for Sick Children. After sacrifice, the top of each eye was
marked using a water-proof marker to locate the superior side of the sclera and provide
orientation after enucleation from the orbit.
To enucleate the eyes, the eye lids were pulled back to expose the space between the
orbit and the eye. The extraocular muscles were severed using curved iris scissors.
Further pulling back the eye lids resulted in the proptosis of the eye, extending it beyond
the orbit. The neurovascular bundle was then cut using curved iris scissors and removed.
The eye was immediately placed in 4% paraformaldehyde (Sigma-Aldrich Canada Ltd.,
Oakville) in PBS (Wisent Inc., St. Bruno), and fixed for 2 hours.
68
After fixation, the eye was dissected. The cornea was cut away using straight 2 mm
Vannas spring scissors (Fine Science Tools Inc., North Vancouver). The lens was then
extracted slowly using forceps, taking care not to pull the retina away with the lens. The
remaining tissue was washed 3 times with PBS for 5 minutes each, and an increasing
concentration of sucrose (Fisher Scientific – Canada, Ottawa) up to 20% w/v in 5% steps
with 15 minutes between each step at room temperature.
To embed the tissue, a polyethylene 16 mm x 8 mm embedding mold was filled with
PolyFreeze tissue freezing medium (both from Polysciences, In., Warrington). The tissue
was removed from the sucrose and excess liquid was absorbed with a laboratory wipe.
The tissue was then placed in the freezing medium with the marked superior side of the
sclera facing upwards. This allowed for proper orientation of the tissue upon sectioning.
The contra-lateral (left) eye was also embedded in the same block to serve as a control.
Both tissues were placed on one half of the embedding cassette when viewed
longitudinally, leaving the other half empty. This block was then frozen in a mixture of
dry ice and ethanol.
A Leica Cryostat CM3050S (Leica Microsystems Inc., Concord) was set for -24 ˚C
cabinet and object temperature and 12 μm thick sections. The block was mounted such
that the first half of the block to be cut contained no tissues. For every section, the empty
half was cut first and paused. This section was then folded over the section with the
tissues and adhered by heating with friction by repeated brushing. The cut was then
finished and the section mounted onto frosted glass slides (Fisher Scientific – Canada,
Ottawa) that have been pre-cooled to the cryostat cabinet temperature. By folding the
69
section over onto itself, the added structural integrity greatly reduced curling of the
section, ensuring it was mounted as flat as possible onto the slide. The use of cooled
slides prevented the section from melting onto the glass quickly, distorting the
morphology. 4 sections were taken and mounted onto the same slide before the block
was advanced by 50 μm and the process repeated.
2.4.5. Immunofluorescence
A list of antibodies used can be found in Table 4.
Sections mounted on glass slides were isolated using an ImmEdge hydrophobic barrier
pen (Vector Laboratories Canada Inc., Burlington). After allowing to dry, PBS at pH 7.4
was applied, followed by a block/permeablize buffer containing 10% goat serum (Wisent
Inc., St. Bruno) and 0.2% Triton X-100 (Sigma-Aldrich Canada Ltd., Oakville) in PBS,
and incubated at room temperature for 15 minutes before being removed by aspiration.
The primary antibody was diluted in PBS with 2.5% goat serum and 0.1% Triton X-100,
applied to the section, and allowed to incubate for 2 hours at room temperature. This was
then washed with PBS containing 0.1% Tween-20 (Sigma-Aldrich Canada Ltd.,
Oakville) for 3 times, 15 minutes each. The secondary antibody, diluted in the same
buffer as the primary antibody, was then applied and allowed to incubate for a duration
appropriate for the antibody, typically 2 hours at room temperature. The wash cycle was
repeated as previously described, and the sections were mounted using DAPI Hard-Set
mounting medium (Vector Laboratories Canada Inc., Burlington) and a no. 0 glass
coverslip.
70
For immunofluorescence of tissue culture cells, glass coverslips were sterilized and
treated with 1 mg/mL of poly-D-lysine (Sigma-Aldrich Canada Ltd., Oakville) for 2
hours inside wells of 6-well plates. The coating solution was washed off with PBS before
adding cells and growth media. The cells adhered to the cover-slip after overnight
incubation and were handled in a similar way to cells grown directly in 6-well plates.
To prepare the cells for imaging, the coverslips were washed with PBS and the cells were
fixed with 4% paraformaldehyde for 30 minutes. The coverslips were then washed with
PBS 3 times for 15 minutes each. The blocking, permeabilization and antibody staining
was then carried out as with tissue sections. The coverslips were then mounted using
DAPI Hard-Set directly onto the glass slide. Where direct fluorescence to observe EGFP
was used, the cells or tissues were fixed and mounted as described above directly after
washing with PBS.
2.4.6. Microscopy
For epifluorescence microscopy, a Leica DM IL inverted microscope was used with a
Leica DFC300F colour CCD camera (Leica Microsystems Inc., Concord).
For confocal microscopy, a Nikon A1R Si point scanning confocal microscope (Nikon
Instruments Inc., Melville) was used. To obtain high resolution while covering the large
area of an entire mouse eye, each image consists of many individual confocal images,
stitched together by software to form a single image. A 40x water immersion objective
was used, with the raster scan set to 1024 x 1024 pixel resolution per image. Before
scanning the large image, each section was mapped for location and a focus map formed
to compensate for levelling. Up to 120 images (10 x 12 fields) were then acquired by the
71
acquisition software Nikon NIS Elements, and stitched with 15% overlap. This resulted
in images of approximately 120 megapixels per eye section. 2 to 4 channels were used,
depending on the number of fluorescent signals expected. Typically, the green channel
was used to detect either EGFP or ABCA4 expression, while red was used for detecting
auto-fluorescence. In some cases, red was used for anti-rhodopsin staining, in which case
the blue channel was used for detecting auto-fluorescence. A “transmitted” channel was
also used initially to provide a pseudo differential interference contrast image, although
this was omitted from later images due to excessive file sizes exceeding the processing
capability of the software. Each channel was acquired at 12-bits colour depth (4096
levels). The resulting file sizes for 2-channel images were between 500 to 900 megabytes
and 4-channel images exceeded 1 gigabyte.
After acquisition and stitching, image manipulation was performed using Volocity 6.1
(PerkinElmer Inc, Woodbridge). The images were exported into Tagged Image File
Format (.TIF) at 1% of original resolution, resulting in images of approximately 1
megapixel per eye section. Adobe Photoshop CS6 (Adobe Systems Canada, Ottawa) was
used to convert the file into Joint Photographic Experts Group format (.JPG). This was
necessary because the exported .TIF files were not compatible with Adobe Illustrator
CS6 (Adobe Systems Canada, Ottawa) used to assemble the figures.
72
3. Results
3.1. Promoter constructs
A large number of potential promoter constructs were initially examined for fulfilling the
goal of a high-expression, ubiquitously active promoter, and a photoreceptor-cell specific
promoter with maximum expression without sacrificing specificity. Four promoters were
tested for expression levels, two ubiquitously active, and two photoreceptor-cell specific.
The use of a photoreceptor cell specific enhancer element and a synthetic intron were
also examined for their ability to increase expression levels.
3.1.1. Ubiquitous promoters
A ubiquitously active promoter was sought to provide a means of determining which
cells were transduced by the vector, and serving as a comparison to a cell-specific
promoter to demonstrate the efficacy of the cell-specific promoter.
The cytomegalovirus immediate early (CMV-IE) promoter, refered to as PCMVIE in this
work, was an obvious choice for a high-expression, ubiquitously active promoter. Since
its discovery in 1984 [206], it has been studied extensively and used for non-cell specific
expression of transgenes in many cell types. Expression of transgenes in the RPE and
photoreceptor cells has been observed under its control [11]. The plasmids cloned to
express genes under control of PCMVIE can be found in Table 1. In brief, PCMVIE was
cloned from the commercially sourced phCMV1 (Genlantis, San Diego). PCMVIIE was
cloned in place to produce EGFP and ABCA4 initially with the presence of a hybrid
intron (pSL004 for EGFP and pSL019 for ABCA4; see Section 3.2 for the hybrid intron).
73
The expression cassette was also cloned into pC4HSU for HDAd production (pSL 024
for EGFP and pSL0026 for ABCA4). When the hybrid intron was rejected (Section 3.2),
the plasmids had to be rebuilt without an intron (pSL044 for EGFP and pSL059 for
ABCA4), as did the corresponding pC4HSU based HDAd production plasmids (pSL046
and pSL059 respectively). The intermediate plasmids not mentioned here can also be
found in Table 1.
Transduction of a CMV-EGFP containing HDAd vector into different cell-types
demonstrated robust expression of EGFP and the efficacy of the HDAd vector (see
Figure 7).
The chicken beta-actin gene was also determined to have high-expression, ubiquitously
active promoter shortly after PCMVIE was identified [66]. Later work on this promoter
yielded the AG promoter, consisting of the promoter, first exon, and first intron of the
chicken beta-actin gene (A), altered by replacing the 3’intron splice-site with that from
the rabbit beta-globin gene (G) [141]. The addition of the CMV early enhancer element
(C) yielded the final CAG promoter [156], although it is not strictly speaking only a
promoter. This construct has resulted in an expression level over 100-fold higher than
with the traditional CMV promoter-enhancer combination [235].
Most of the in vitro and in vivo work described herein had been conducted using both the
CMV and CAG promoters but only the results using the CAG promoter have been
included as the CAG promoter confers higher levels of EGFP fluorescence than CMV
(Figure 7), implying higher transcription levels. A full list of plasmids using this
promoter (PCAG) can be found in Table 1.
74
Figure 7 – The CAG promoter is more active than CMV as measured by EGFP
expression
WERI-Rb (retinoblastoma) cells were transduced with HDAd carrying either CMV-
EGFP or CAG-EGFP. Epifluorescence microscopy reveals that the CAG construct
confers significantly higher levels of fluorescence but does not result in a higher number
of fluorescent cells. Both images were taken with very short exposure times (100 ms) as
CAG-EGFP yielded fluorescence levels that saturated the sensor under normal settings.
The use of short exposure times for both vectors allowed for the comparison of the
relative fluorescence intensities. A normal exposure (1 second) shows CMV-EGFP
yields a bright fluorescence signal similar to the CAG-EGFP image shown here. (8000
VP/cell; 3 days post-transduction, corresponding with a plateau in the level of observed
fluorescence.)
75
3.1.2. Rhodopsin promoters
Cell-specificity was desired in expression of the transgene as expression of ABCA4 into
cell-types that cannot process NR-PE into vitamin A would result in its accumulation in
the cell, potentially causing toxic effects. For example, if ABCA4 was expressed in RPE
cells, ABCA may increase RPE uptake of NR-PE, increasing the rate of lipofuscin
deposit formation, thus accelerate the progress of Stargardt’s disease.
Cell specificity can be achieved by physically targeting the virus for a specific cell-type,
limiting transcription to the appropriate cell type, or preventing translation into protein in
undesired cell types. While it is theoretically possible to physically target the virus to
photoreceptor cells over other cell types, it is practically impossible to modify the viral
tropism to such an extent that the virus would be unable to transduce RPE cells.
Translational regulation is relatively poorly understood and quantification of translational
regulation by Western blot is less sensitive than quantification of mRNA by qRT-PCR.
As such, it was decided to seek a photoreceptor-cell specific promoter to limit expression
of the transgene to photoreceptor cells.
An obvious choice for a photoreceptor specific promoter is rhodopsin. It is the most
abundant protein in the photoreceptor cell and accounts for 90% of the protein content in
photoreceptor disc membranes [80]. Many of the initial studies involving photoreceptor
specific expression of transgenes used murine or bovine rhodopsin upstream sequences
to limit gene expression [119, 239]. Therefore, we selected the rhodopsin promoter for
restricting transgene expression to photoreceptor cells.
76
A significant amount of work has been committed to the analysis of the rhodopsin
upstream sequence which showed significant homology between species for up to 5 kb
upstream of transcriptional start [10]. On the other hand, in vitro experiments have
shown that sequences as short as ~300 bp can confer cell specific expression in
retinoblastoma cells [155]. As no data is available on upstream sequences shorter than
300 bp, this was taken as the lower limit of what we could consider as specific. While the
use of vectors with small carrying capacity such as AAV would necessitate short
promoters to allow for longer protein encoding regions (Section 1.3.2.3), the use of
HDAd gives significant flexibility in promoter length.
It is difficult to predict the specific functions of the upstream sequences as the specific
interactions between the sequence and the relevant transcription factors are not well
elucidated. While it was possible to use the full 5 kb upstream sequence, it would be
cumbersome in cloning the sequence, and the sequence homology observed between
species does not indicate that the entire sequence is necessary to preserve photoreceptor
specificity. On the other hand, it is possible that sequences further upstream than the
minimum ~300 bp may help limit expression to photoreceptor cells. Therefore, it was
decided to clone two versions; a long version containing 1553 bp upstream of the
transcriptional start, and a short version containing 323 bp immediately upstream of the
transcriptional start site.
The interphotoreceptor retinoid binding protein (IRBP), also known as interstitial retinol-
binding protein, is an extracellular protein that is found in high concentration only in
photosensitive tissues [23]. IRBP mRNA is found to accumulate in these tissues [211]
77
and sequence analysis found a CpG rich island 1578 to 1108 bp upstream of
transcriptional start [3]. Sequence homology between species underlined the importance
of this region and experiments demonstrated that the segment in question binds to a
protein found in the nuclei of bovine retina and Y79 cells [17]. In vitro studies combining
this segment with the rhodopsin promoter demonstrated a 2-fold increase in protein
expression over the same promoter in the absence of this enhancer segment [136]. The
data also indicated that the addition of the IRBP enhancer does not affect the cell-
specificity of the rhodopsin promoter [155]. This enhancer was then cloned directly
upstream of the long and short rhodopsin promoter constructs. This resulted in four
promoter versions in total, a short and a long promoter, each with and without the
enhancer.
All four versions were cloned upstream of EGFP. Plasmids containing each expression
cassette were transfected into a retinoblastoma cell line (Y79) and a retinal epithelium
derived cell line (ARPE-19) and the cells were analyzed by flow cytometry (Figure 8). In
the absence of the enhancer element, both rhodopsin promoter lengths yielded similar
mean fluorescence intensities (MFI). The addition of the enhancer element significantly
increased the MFI with both the long and short promoter lengths. With the enhancer in
place, the difference between the long and short promoters did not result in a statistically
significant difference in MFI. In addition, neither version of the promoter produced
fluorescence in APRE-19, thus confirming the cell-specificity conferred by the rhodopsin
promoters.
78
Cell specificity of the rhodopsin promoters was evident by EGFP expression only in Y79
and not in APRE-19 cells with all rhodopsin promoter constructs. The addition of the
IRBPE significantly increases gene expression (Figure 8). Therefore, subsequent
experiments using the rhodopsin promoter utilized the long, 1553 bp promoter with the
IRBP enhancer element directly upstream, denoted by “Rho”.
Of note is the low expression observed with both cell lines with the CMV promoter;
while it is clearly and consistently above the background level, it is much lower than
expected and barely observable under epifluorescence microscopy (data not shown). The
low expression was likely a result of the hybrid intron used which will be discussed in
Section 3.2. With the exception of Figure 8, the data contained herein does not contain
constructs containing this hybrid intron.
79
Figure 8 – Flow cytometry of transfected cells demonstrate the cell specificity of the Rho
promoter and the increase in transcription resulting from IRBPE
Flow cytometry of ARPE-19 and Y79 cells transfected with plasmid DNA containing the
short or long versions of the rhodopsin promoter or the CMV promoter, all controlling
the production of EGFP. The results demonstrate that there is no significant difference in
the mean fluorescence intensity, indicating that there is no loss in expression when using
the long version. The addition of the IRBP enhancer results in a large increase in mean
fluorescence intensity, indicating that the IRBP enhancer increases expression. The low
expression level observed with the CMV promoter likely indicates inefficiencies as a
result of the hybrid intron as discussed in section 3.2.
80
(Error bars represent standard error of the mean. 2-way ANOVA showed statistically
significant interaction between cell-type and promoter. * indicates p < 0.01 in
comparison with Control Y79 by pairwise t-test with Bonferroni correction. Other
pairwise comparisons were not tested. n = 3)
81
3.1.3. G protein-coupled Receptor Kinase 1 promoter
Another commonly used promoter for photoreceptor specific expression is the G protein-
coupled receptor kinase 1 (GRK1) promoter. GRK1 serves as the kinase that
phosphorylates rhodopsin and is specifically expressed in photoreceptor cells. Unlike
rhodopsin, GRK1 is expressed in both rod and cone cells, thus there is an advantage to
using GRK1 over rhodopsin. It had been previously examined for in vivo photoreceptor
specific expression using AAV vectors, although expression levels appear to be lower
than that observed with the rhodopsin promoter [98].
In order to ascertain whether GRK1 would be superior to rhodopsin in our use with
HDAd vectors, it was cloned in place of the rhodopsin-IRBPE combination. Initial
plasmid transfection experiments demonstrated that the level of fluorescence was not
stronger than with Rho-EGFP as determined by epifluorescence microscopy.
Nonetheless, a significant amount of work was undertaken to make the construct into an
HDAd viral vector as it was our belief that the promoter activity in plasmid and in viral
vector delivered forms may be different. Epifluorescence microscopy demonstrated that
Rho-EGFP does confer significantly stronger fluorescence compared to GRK1-EGFP
even in the context of HDAd transduction (Figure 9), thus confirming that GRK1 is a
weaker promoter as indicated by the literature. Consequently, the work contained herein
concentrates on the Rho-EGFP construct.
82
Figure 9 – Rho-EGFP confers higher gene expression than GRK1-EGFP
Epifluorescence microscopy demonstrates that the level of expression conferred by the
rhodopsin promoter is significantly higher than that conferred by the GRK1-EGFP.
HDAd vectors carrying either construct were transduced into WERI-Rb cells at 32,000
VP/cell. The results are epifluorescence photomicrographs taken after 5 days of
incubation. Earlier time points resulted in lower fluorescence while later fluorescence
resulted in the cells growing beyond confluence.
83
3.2. Introns
The addition of an intron is well known to increase transgenic gene expression [33, 159].
As such, our initial constructs included introns immediately before the start codon in
hopes that they would improve gene expression. A list of the constructs and whether or
not they included an intron can be found in Table 1.
The hybrid intron was initially developed and characterized for use in studies of cancer
gene therapy via AAV[162]. This sequence consisted of a combination adenovirus major
late gene intron and mouse immunoglobulin intron, hence “hybrid” intron. It had been
previously used in our laboratory for the purposes of increasing expression levels of
transgenes [101]. Due to this previous success, all the initial plasmid constructs were
built incorporating this hybrid intron (plasmids pSL003, pSL004, pSL008 through
pSL032 and the corresponding HDAd vectors vSL014 through vSL035).
Attention was drawn to a problem in experiments involving the transfection of cultured
cells with the constructs in a plasmid background, when epifluorescent microscopy failed
to show fluorescence at levels expected from the high expression promoter of CMV.
Flow cytometry analysis of transfected cells detected only minimal levels of fluorescence
(See section 3.1.2, Figure 8). Transfection parameters that were explored included host
cell type, transfection agents, DNA mass, ratio of transfection agent vs DNA mass,
duration of transfection, media type, and incubation period but all were unsuccessful in
improving EGFP expression
Under the premise that the transfected plasmid may result in different promoter activity
than DNA delivered by the viral vector, work was undertaken to generate the series of
84
HDAd vectors containing these constructs. However, transduction of cultured cells with
these vectors also failed to demonstrate fluorescence despite numerous attempts.
Transduction parameters included host cell type, duration of transduction, media used,
concentration of FBS, multiplicity of infection, and incubation period. Satisfactory levels
of fluorescence could not be obtained with the CMV promoter + intron construct under
any of the conditions. (data not shown)
Examination then turned to the sequences of the expression cassettes of the constructs to
ensure that they matched the designs and expectations from in silico cloning. DNA
sequencing revealed that all of the sequences are precisely as expected with no errors or
mutations (data not shown). Attention then turned to the individual components that
comprised the expression cassette to ensure their functions. The only component that was
not fully documented and not directly cloned from popular commercially available
cloning vectors was the hybrid intron, although the sequence matched the sequence and
map provided by the previous users of the hybrid intron in our laboratory.
A BLAST search of the sequence that was provided showed that it was not as one would
expect of the combination adenovirus major late gene intron and mouse immunoglobulin
intron (Figure 10). The sequence contained the CMV major immediate early gene’s 5’
UTR, a 3’ truncated CMV intron A, and a synthetic intron truncated at both the 5’ and 3’
ends. This synthetic intron is commercially available in vectors such as pIRES3hyg
(Clontech Laboratories Inc., Mountain View). This partial synthetic intron is likely part
of the hybrid intron as the hybrid intron sequence provided contains portions of both
intron components as described by the original authors and aligns to portions of
85
pIRES3hyg. However, in the hybrid intron, it has been truncated at both ends, thus is
possibly missing the splice sites.
The problem encountered with the hybrid intron was likely an issue with the
recombination of the intron in the source plasmid and not the intron itself as the synthetic
intron is in common commercial use. Regardless of the specific details as to why this
particular intron resulted in a major reduction in protein production, the intron was the
most suspect and was the only portion of the construct that was not cloned from a
popular, commercially available vector. While the evaluation of the intron took place
using the CMV promoter + intron combination, the rhodopsin promoters also contained
the same intron. As such, work was immediately undertaken to remove the intron from
all constructs, although all the plasmid had been otherwise completed (pSL004, pSL010 -
pSL013, pSL019- pSL027). Because ABCA4 is a large protein, encoded by a 7kb ORF
and thus contained many restriction enzyme sites, it was decided early in the in silico
design stages to have all the other components assembled before inserting ABCA4 via an
adaptor segment, producing the intermediate plasmids pSL014 to pSL018. The intron
was inserted very early in the process (pSL003), and as a result, it became impossible to
remove the intron from subsequent plasmids (pSL019-pSL027). All constructs were
abandoned and cloning had to be started anew.
The need to replace the intron led to several simultaneous approaches with no intron, and
ubiquitin C intron (section 3.2) being cloned and examined.
86
Sequence of the cloned hybrid intron GCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCGGGAACGGTGCATTGGAACGCGGATTCCCCGTGCCAAGAGTGACGTAAGTACCGCCTATAGAGTCTATAGGCCCACCCCCTTGGCTTCTTATGCGACGGATCAATTCGCTGTCTGCGAGGGCCAGCTGTTGGGGTGAGTACTCCCTCTCAAAAGCGGGCATGACTTCTGCGCTAAGATTGTCAGTTTCCAAAAACGAGGAGGATTTGATATTCACCTGGCCCGCGGTGATGCCTTTGAGGGTGGCCGCGTCCATCTGGTCAGAAAAGACAATCTTTTTGTTGTCAAGCTTGAGGTGTGGCAGGCTTGAGATCTGGCCATACACTTGAGTGACAATGACATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGGTCCAAC Legend:
Expected: 5’ UTR; Intron
BLAST search:
CMV major immediate early gene 5’ UTR CMV Intron A (partial, major 3’ truncation, no 3’ splice site) Synthetic Intron (7 bp 5’ truncation, 9 bp 3’ truncation)
Figure 10 – BLAST search of hybrid intron sequence
The BLAST result from the hybrid intron revealed that the sequence contained
components beyond that which was expected. Perfect identity was found in the sequence
of the CMV immediate early 5’ UTR, a truncated CMV intron A, and an incomplete
synthetic intron truncated at both ends.
87
Shortly after the problem with the hybrid intron was identified, an article was published
on the potent expression enhancing functions of the ubiquitin C 5’ UTR intron [14]. The
ubiquitin C intron was already available as a result of earlier work in our lab [218]. Work
was then undertaken to incorporate this intron into our constructs.
Repeated attempts to clone this intron by PCR failed to yield the correct sequence under
a wide variety of PCR and cloning conditions. PCR using different enzymes, salt
concentrations, and annealing temperatures were attempted, all yielded the same
incorrect sequence. Sequencing of these cloned introns revealed that there were multiple
differences between the clones and the reference sequence (GenBank accession:
NC_000012; Figure 11) . As many cloned introns from different PCRs all yielded the
same sequencing results, making a PCR error unlikely, the template plasmid
(pBSIIPubcHAHprp3CodingBGHpA) was also sequenced to reveal that the differences
were inherent in the template used. Comparison of the sequencing data with the expected
sequence from our lab reveals that the sequence of the cloned intron is consistent with
expectations but different from the GenBank reference sequence. While the differences
did not involve the splicing junctions and may not have affected splicing efficiency nor
protein expression levels, the decision was made to avoid complications by cloning the
constructs again without an intron.
Unless specifically noted, the results in the subsequent sections employed plasmids and
viral vectors that do not contain an intron sequence.
88
Sequence of Ubiquitin C intron from the template plasmid
GTGAGTT1GCGGGCTGCTGGGCTGGCCGGGGCTTTCGTGGCCGCCGGGCCGCTCGGTGGGACGGAA2GCGTGTGGAGAGACCGCCAAGGGCTGTAGTCTGGGTCCGCGAGCAAGGTTGCCCTGAACTGGGGGTTGGGGGGAGCGCA3CAAAATGGCGGCTGTTCCCGAGTCTTGAATGGAAGACGCTTGTA4AGGCGGGCTGTGAGGTCGTTGAAACAAGGTGGGGGGCATGGTGGGCGGCAAGAACCCAAGGTCTTGAGGCCTTCGCTAATGCGGGAAAGCTCTTATTCGGGTGAGATGGGCTGGGGCACCATCTGGGGACCCTGACGTGAAGTTTGTCACTGACTGGAGAACTCGGG5TTTGTCGTCTGG6TTGCGGGGGCGGCAGTTATG7CGGTGCCGTTGGGCAGTGCACCCGTACCTTTGGGAGCGCGCGCC8TCGTCGTGTCGTGACGTCACCCGTTCTGTTGGCTTATAATGCAGGGTGGGGCCACCTGCCGGTAGGTGTGCGGTAGGCTTTTCTCCGTCGCAGGACGCAGGGTTCGGGCCTAGGGTAGGCTCTCCTGAATCGACAGGCGCCGGACCTCTGGTGAGGGGAGGGATAAGTGAGGCGTCAGTTTCTT9TGGTCGGTTTTATGTACCTATCTTCTTAAGTAGCTGAAGCTCCGGTTTTGAACTATGCGCTCGGGGTTGGCGAGTGTGTTTTGTGAAGTTTTTTAGGCACCTTTTGAAATGTAATCATTTGGGTCAATATGTAATTTTCAGTGTTAGACTAGTAAATTGTCCGCTAAATTCTGGCCGTTTTTGGCTTTTTTGTTAG
5’ splice site 3’ splice site Differences:
1 – A in reference sequence 2 – G in reference sequence 3 – additional G in reference sequence 4 – G in reference sequence 5 – extra nucleotide compared to reference sequence 6 – extra nucleotide compared to reference sequence 7 – missing G compared to reference sequence 8 – missing C compared to reference sequence 9 – C in reference sequence
Figure 11 – The sequence of the template plasmid contains 9 differences compared with
the reference sequence in a segment of ~800 bp.
89
3.3. ABCA4::EGFP fusion protein did not yield detectable
fluorescence
Simultaneous with the work to insert the ABCA4 coding sequence, an attempt to create
an ABCA4::EGFP fusion protein was also made. This comprised plasmids pSL028
through pSL035 which included the hybrid intron, and pSL060 which did not. The DNA
was formed by PCR of the ABCA4 gene from pSL019 with a primer overlapping EGFP
to generate a mega-primer, which was then used to amplify the rest of EGFP (Forward
primer: 20090506-01; Mid-primer with overlap: 20091210-01; Reverse primer for
EGFP: 20091210-02). This resulted in the C-terminal fusion of ABCA4 to EGFP. As the
primers contained restriction sites compatible with the adaptor segment used for ABCA4
insertion, the plasmids containing ABCA4 were restriction digested and ligated with the
ABCA4::EGFP fusion protein. Restriction digest and DNA sequencing were performed
to ensure the proper in-frame joining of the segments.
Transfection of cultured cells with the CMV promoter based expression plasmid
(pSL028) failed to yield any detectable levels of fluorescence under a wide variety of
transfection conditions. Subsequent to the discoveries regarding the hybrid intron
(Section 3.2), a version without an intron was also made (pSL060) which also did not
yield any detectable fluorescence. While it is possible that the lack of a linker-segment
prevented the folding of EGFP or the proper inclusion of transmembrane domains of
ABCA4 into the membrane, it was decided that antibody studies would suffice for the
detection and localization of the ABCA4 transgene, and work with the fusion protein was
abandoned.
90
3.4. Transduction efficacy and cell specificity of HDAd vectors
carrying the reporter gene EGFP
As the constructs containing the ABCA4 gene do not carry any reporter genes, it was
decided to first work with constructs that were carrying EGFP, but otherwise identical to
the ABCA4 constructs, in order to assess and optimize the transduction. Before using the
viral vectors in vivo, experiments in cell culture were first carried out to assess the
relative activities of the different promoters and cell specificity as well as confirming the
infectivity of the vector particles.
3.4.1. HDAd is capable of delivering EGFP to cultured cells and
the rhodopsin promoter confers fluorescence in a cell-specific
manner
To determine whether the HDAd vectors are able to confer reporter gene expression to
cultured cells, HDAd carrying CAG-EGFP was transduced into ARPE-19, HeLa, and
WERI-Rb cells. As the cell types differed in their sensitivity to the toxicity caused by the
presence of HDAd, transduction experiments were carried out to determine the maximum
tolerable dose of vector particles for each cell type. Three different doses were selected
as determined by the minimum dose required to confer detectable fluorescence, and the
maximum dose tolerated by the most sensitive cell type before cell death is observed.
These doses are represented in Figure 12 to demonstrate dose response.
CAG, being a ubiquitously expressed promoter, confers gene expression to all three cell
lines even at the lowest dose of 500 VP/cell. The high level of fluorescence is not
91
apparent in the figure as all the images are taken at equal settings, and thus the exposure
time had to be reduced to prevent over-saturation at the higher doses. In all three cell
lines, the number of cells transduced and the intensity of fluorescence increased with
dose, likely indicating that at the lowest dose, not all cells have been transduced, and that
at high doses, a large portion of the cells will have been transduced by multiple virus
particles.
Also of interest is that the intensity of fluorescence varies with the cell lines used. WERI-
Rb is particularly high in the intensity of fluorescence observed and this pattern was
repeatedly observed regardless of the vector used and whether the cells were analyzed by
epifluorescence microscopy (Figure 12), confocal microscopy (Figure 13), or flow
cytometry (Figure 14). The intensity of fluorescence observed may be a result of the
efficacy of transduction in WERI-Rb cells, or the level of protein production inherent in
WERI-Rb cells. Because of this particular property of WERI-Rb, the use of Y79 was
discontinued in favour of WERI-Rb for experiments in cell culture.
When HDAd vector carrying Rho-EGFP was used, fluorescence could not be observed in
ARPE-19 nor HeLa cells. Fluorescence was also not observed in HEK293 cells when
transduced with Rho-EGFP (data not shown). However, when transduced into WERI-Rb
cells, fluorescence could be observed. This result indicates that the Rho-EGFP construct,
with the additional IRBP enhancer, expressed EGFP in a cell-specific manner. However,
due to the relative efficiencies of the different promoters, the fluorescence observed with
Rho-EGFP is weaker than with CAG-EGFP at the same dose. When higher amounts of
vector were used, cell-specificity was maintained up to 16,000 VP/cell with very intense
92
fluorescence observed from WERI-Rb cells while no fluorescence could be detected
when using other cell lines. When using doses higher than 32,000 VP/cell, cell death
could be observed which may be a result of the enormous number of vector particles
present overwhelming the cell. The maximum tolerable dose is cell-specific as cell-death
was observed in HeLa cells at doses 16-fold higher, while HEK293 cells reacted
adversely at doses as low as 8000 VP/cell (Data not shown).
Confocal microscopy confirmed the same pattern, with the EGFP well distributed
throughout the cytoplasm (Figure 13). There was no nuclear localization of the EGFP,
although the images do show overlap as each image is an “extended focus” (i.e. merged)
representation of a Z-stack. Despite the increased sensitivity of confocal microscopy over
epifluorescence microscopy, there was no detectable fluorescence from ARPE-19 nor
HeLa cells transduced with Rho-EGFP.
93
Figure 12 – HDAd can deliver EGFP to cultured cells, and the rhodopsin promoter is
cell-specific
Epifluorescence microscopy shows that HDAd is capable of delivering EGFP to cultured
cells to confer fluorescence in a dose dependent manner. The CAG-EGFP construct
confers ubiquitous expression while the use of the rhodopsin promoter (Rho-EGFP)
restricts expression to retinoblastoma cells (WERI-RB) and not epithelial cells (ARPE-19
94
and HeLa). All images were taken at identical settings, using a 5x objective, 5 days after
transduction.
All images were taken with very short exposure times (100 ms) as WERI-Rb transduced
with CAG-EGFP yielded fluorescence levels that saturated the sensor under normal
settings. The use of short exposure times allowed for the comparison of the relative
fluorescence intensities between the different cell lines and vectors.
95
Figure 13 – Confocal photomicrographs of ARPE-19, HeLa and WERI-Rb cells
transduced with either CAG-EGFP or Rho-EGFP
Confocal microscopy confirms that CAG-EGFP confers EGFP fluorescence to all cell
types while transduction with Rho-EGFP results in fluorescence only in WERI-Rb cells.
Note that the intensity of fluorescence cannot be compared as each cell type requires
different sensitivity settings to avoid over/under saturation (Scale bar = 10 μm; 5 days
post-transduction)
96
In addition to qualitative analysis by microscopy, ARPE-19 and WERI-Rb cells
transduced with either CAG-EGFP or Rho-EGFP HDAd were analysed by flow
cytometry in order to obtain a quantitative comparison. In order to increase the sensitivity
of detecting EGFP-positive cells and to avoid false-positives that result from auto-
fluorescence, cells were gated by plotting the EGFP channel against the adjacent channel.
Only cells that had increased EGFP fluorescence without an equally proportioned
increase in the adjacent channel were considered positive (Figure 15). Using this method,
it is clear that even at a low dose of 500 VP/cell, approximately 80% of ARPE-19 cells
were transduced by CAG-EGFP, leading to detectable levels of fluorescence (Figure
14a). The difference in minimal dose for detectable fluorescence between the microscopy
results (Figure 12) and flow cytometry is attributed to the higher level of sensitivity of
flow cytometry. The minimal dose needed for detectable fluorescence by flow cytometry
demonstrates the high efficacy of the HDAd vector. The data with CAG-EGFP indicates
that the percentage of positively gated cells increased with dose (Figure 14a) and it is
important to note that the increase was not linear as the percentage of positive cells
reaches a plateau. The reaching of the plateau is particularly visible with ARPE-19 cells,
although it can also be mathematically shown with WERI-Rb cells. As the number of
vector particles increases, the probability of a cell being infected by more than one vector
particle increases. On the basis of probability, increasing the vector particles by two-fold
results in the reduction of uninfected cells by half, but that does not equate to a two-fold
increase in infected cells. This statistical calculation can be used to give an estimate of
the number of active virus particles (infectious units; IU) per vector particle (Section
3.4.2).
97
Interestingly, it is apparent that there was absolutely no EGFP production from Rho-
EGFP transduced ARPE-19 cells despite the high doses applied (Figure 14a, Figure 15).
This indicates that the rhodopsin promoter has sufficient cell-specificity that no leakage
was observed, unlike the situation with many inducible promoters.
Figure 14b demonstrates that the mean fluorescence intensity (MFI) increased with dose
in a linear manner when either cell-type was transduced with CAG-EGFP. The MFI of
ARPE-19 cells did not change when transduced with Rho-EGFP while the MFI of
WERI-Rb changed in a dose dependent manner (Figure 14c), again demonstrating the
tight control that the rhodopsin promoter exerts over transgene expression. Note,
however, that the relative fluorescence intensity between the two cell types was not
directly comparable as the settings had to be adjusted between the cell types to ensure
proper gating and to stay within the dynamic range of the instrument.
Figure 15 shows representative flow cytometry plots demonstrating the gating method
used to reduce false positives caused by auto-fluorescence. It differs from traditional
gating by histogram (Figure 16) in that it employs the adjacent channel to reduce false-
positives stemming from auto-fluorescence.
98
99
Figure 14 – Flow cytometry confirms fluorescence conferred by CAG-EGFP and cell
specificity of rhodopsin promoter
Flow cytometry indicates that (a) the percentage of positively gated cells increased in
dose dependent manner when either cell type was transduced with CAG-EGFP. As
expected, only WERI-Rb but not ARPE-19 responded to Rho-EGFP. (b, c) Similar
results were obtained when examining the mean fluorescence intensity with increases
observed with dose in all cases except for when ARPE-19 was transduced with Rho-
EGFP, again confirming the cell-specificity of Rho-EGFP. Statistical analyses to
compare the percentage of positive cells were not necessary as they were clearly dose
dependent, as were the mean fluorescence intensities. The dose-dependencies revealed by
curve-fit were calculated to be 0.9316 and 0.9082 for ARPE-19 and WERI-Rb cells
respectively. (The numbers following CAG/Rho indicate VP/cell applied. n=3 Error bars
represent standard error of the mean. 2-way ANOVA of the CAG promoter (B) found
statistically significant difference on dose only while 2-way ANOVA of the Rho
promoter found statistically significant interaction between dose and cell-type. Pairwise
comparisons were not conducted.)
100
Figure 15 – Representative flow cytometry plots demonstrating the gating method used
to reduce false-positives caused by auto-fluorescence.
101
Grey – C4HSU (control) Red – RHO-EGFP (2500 VP/cell) Green – CAG-EGFP (2500 VP/cell)
Figure 16 – Representative flow cytometry histograms
Representative flow cytometry plots showing the difference in mean intensity as a result
of transduction with RHO-EGFP or CAG-EGFP and the differences between cell lines.
The quantified results are shown in Figure 14 B and C.
102
3.4.2. Vector particle to infectious unit ratio
From the flow cytometry data (Figure 14a), we could extrapolate the number of VP/cell
that yields 50% transduction by curve fitting. From that, it was mathematically possible
to estimate the number of infectious vector particles (infectious units, IU) compared to
total viral particles (VP), assuming the transduction process allowed for all active
particles to function. This calculated value (IU) is similar to the titre in plaque forming
units (PFU) that is usually used to quantify viruses. IU is necessary in place of PFU in
HDAd because HDAd are replication incompetent and thus cannot form plaques.
The details of the curve fit applied can be found in Appendix B.
For ARPE-19 cells transduced with CAG-EGFP, the dose required for infection of 50%
of the cells (ID50) was calculated to be 92.40 (77.84 to 107.0, 95% CI) and 230.1 (191.7
to 268.4, 95% CI) for WERI-Rb cells transduced with CAG-EGFP. This value
corresponds to the number of vector particles per cell (VP/cell) required to transduce
50% of the cells. The difference between cell lines is indicative of the differences in the
ability of each cell-type to be transduced (i.e. transduction efficiency). As ARPE-19
demonstrated a 2.5 fold higher transduction efficiency than WERI-Rb, the calculations
below were based on a Kd of 92.40 from ARPE-19. However, the Kd at 100%
transduction efficiency is likely to be even lower as there may be cell lines with even
higher transduction efficiency than ARPE-19.
Mathematically, as defined by the Poisson distribution, the theoretical multiplicity of
infection (VP/cell) required to infect 50% of the cells is -ln(0.5) or 0.693. Since 92.4
VP/cell transduced 50% of the cells, a conservative estimate of the number of active
103
vector particles per total number of vector particles was calculated to be approximately
92.4 / 0.69 or 133. In other words, 1 in 133 vector particles could transduce an ARPE-19
cell under these particular transduction conditions, or there is 1 infectious unit per 133
vector particle. However, keeping in mind the difference observed in ARPE-19 and
WERI-Rb, it is likely that the actual number of infectious particles per vector particle
was even lower as there were multiple assumptions and simplifications involved and that
transduction of ARPE-19 did not occur at 100% efficiency. Therefore, we estimated that
approximately 1 in 100 vector particles were capable of delivering their genome to the
cell and express transgenes. The implications of this calculation will be discussed in
depth in Section 4.2.
3.4.3. in vivo injections of HDAd carrying the EGFP reporter gene
Having confirmed the infectivity and cell-specificity of the vectors in cell culture, we
applied the vector to wildtype CD1 mouse.
There are multiple methods of introducing the vector to the retina. The simplest method
involves direct injection of the vector into the vitreous with the expectation that the
vector will diffuse through the inner limiting membrane and all the retinal cell layers to
reach the photoreceptor layer as shown previously [216]. This method was rejected on
the basis that the HDAd vector is significantly larger physically compared with the AAV.
Nonetheless, it was attempted several times using the CAG-EGFP vector without success
(2 groups of mice, n=10 each).
A method of injecting the vector directly into the sub-retinal space involves making an
incision in the sclera of the eye, through which a fine needle is inserted until it rests
104
against the choroid across the vitreous from the injection site [54, 81]. This was the
method employed in this section and is referred herein as the trans-sclera method.
(Section 2.4.2)
Before proceeding to performing sub-retinal injections to deliver the HDAd vector, 1 μm
diameter fluorescent microspheres were used to determine whether the trans-sclera
method was feasible and reliable for delivering particles to the sub-retinal space. Injected
mice were sacrificed one week after injection to allow for recovery of retinal detachment
caused by the injection. Initial injections of the microspheres into mouse retinas using the
trans-sclera method did not result in microspheres in the sub-retinal space after the mice
were sacrificed and the retinas examined by microscopy (2 groups, n=10 each; data not
shown). Instead, the microspheres were found to be sparsely dispersed throughout the
eye, indicating that the microspheres had failed to enter the sub-retinal space and had
been excreted from the vitreous as part of the normal fluid flow within the vitreous
chamber of the eye.
Because the microspheres were provided at 2% (w/v), a subsequent attempt was made
after diluting the microspheres to 0.2% by mass. Successful injections demonstrated that
the microspheres were found almost exclusively along the RPE as expected given the
phagocytic properties of the RPE cells (Figure 17). However, microspheres were found
in only 20% of the eyes injected (n=10), indicating that while the technique is viable,
further refinement of the technique was required.
Other methods of introducing material to the sub-retinal space have been documented.
Using trans-sclera injections, one group had previously used a pressurized method to
105
produce a liquid jet to avoid the difficulty involved in making and maintaining physical
contact with the retina during injection [147]. However, the need for specialized
equipment made it impractical to implement in our laboratory.
Alternatively, in order to avoid passing through the lens and to gain a more oblique angle
for maintaining contact with the retina, an alternative approach was used whereby the
initial incision is made in the cornea, and the needle is guided from the anterior chamber
into the vitreous chamber. This approach resulted in significantly higher success rate
(Section 3.4.3.1) and is described in detail in Section 2.4.3. This trans-corneal method
replaced the trans-sclera method. As such, the results described herein, with the
exception of Figure 17, used the trans-corneal method.
Over the course of the work described herein, the successful injection rate for the trans-
corneal method increased gradually from 20% to a plateau of 80%. As the described
method remained the same, the difference in success rate can only be attributed to an
increase in the technical skill gained through the injection of several hundred mice over a
period of several years. After having reached the 80% plateau and no further
improvement in the injections was apparent, all the in vivo experiments were repeated to
ensure consistency of the data. As such, the data presented herein represent the latter,
repeated experiments.
106
Figure 17 – Microspheres injected into the sub-retinal space of mouse eyes
Injection of fluorescent microspheres into mouse eyes demonstrate that trans-sclera sub-
retinal injection is feasible for delivering substances into the sub-retinal space. (RPE –
retinal pigment epithelium; OS – outer segment (photoreceptors); ONL – outer nuclear
layer; INL – inner nuclear layer)
107
3.4.3.1. CAG-EGFP consistently confers expression of EGFP
throughout the entire retinal epithelium
After having confirmed the possibility of delivering materials to the sub-retinal space via
sub-retinal injection, we proceeded to assay the function and distribution of HDAd
vectors delivered by the same method. Vectors carrying CAG-EGFP were used to
determine what cell types can be transduced by HDAd.
As previously mentioned, the earlier methods of injection yielded limited success, as did
the earlier methods of cryosectioning (Sections 3.4.3 and 2.4.4 respectively). 1 x 1010 VP
in 1 μL volume of CAG-EGFP was injected into the sub-retinal space of mice with
sacrifice taking place one week post-injection. The trans-sclera method of injection
yielded approximately 20% success (6 groups, n=10 each), comparable to the success
rate with microspheres. Using the trans-cornea method, the initial rate of success
increased to 67% (5 groups, n=28 total). The technique was further refined over time,
resulting in a higher success rate in more recent experiments. Later experiments with
varying dose, modified vectors, and different incubation periods have reached a
consistent 80% success rate.
After injection, each eye was cryosectioned and visualized by confocal microscopy. The
sections are made across the transverse plane, each section being 12 μm thick. The
technique is described in detail in section 2.4.4. Figure 18 demonstrates the typical
results of CAG-EGFP injection. 10 separate sections were taken approximately 100 μm
apart, progressing from the inferior to the superior side. The relative size is kept the same
across all sections, hence the change in size of the eye observed as the sections progress
108
through the center of the eye where the diameter is the largest. It is clear from this set of
images that the RPE has been completely transduced across all three dimensions.
These confocal images of an entire eye section were generated by merging approximately
100 fields-of-view at approximately 1 megapixel resolution for each field of view, thus it
is possible to examine a small area of the retina without any loss of resolution. The
technique is described in detail in section 2.4.6. Such high magnification examination
reveals that the fluorescence exists exclusively in the RPE, indicating that the vector
failed to transduce the photoreceptor layer, or any other layer of the retina except the
RPE (Figure 19).
109
110
Figure 18 – Sequential sections of a mouse retina injected with CAG-EGFP HDAd
Sequential sections of CAG-EGFP injected mice reveal that the RPE was transduced
across the entire retina. The sections are 12 μm each, separated by approximately 100
μm. The sections are in the transverse plane, progressing from the inferior to the superior
side. The eye was injected with 1 x 1010 VP in 1 μL of HDAd encoding CAG-EGFP. The
animal was sacrificed 1 week post-injection. (Scale bar = 500 μm)
111
Figure 19 – High magnification view of a retina injected with CAG-EGFP
A high magnification view of the retina after injection with CAG-EGFP reveals that the
fluorescence was exclusive to the RPE layer, indicating that the vector failed to transduce
the photoreceptor cells. (RPE – retinal pigment epithelium; OS – outer segment
112
(photoreceptors); ONL – outer nuclear layer; INL – inner nuclear layer; 1 x 1010 VP in 1
μL of HDAd encoding CAG-EGFP; 1 week post-injection; Scale bar = 50 μm)
113
3.4.3.2. Efficient gene delivery can be accomplished with as
few as 1x105 particles
The use of 1 x 1010 VP for the injections in section 3.4.3.1 was predicated on the
concentration of vector available from vector production and the limits to the volume of
vector that can be injected. Specifically, the highest concentration of the CAG-EGFP
vector available was 1 x 1013 VP / mL. As the largest volume we could inject into the eye
was 1 μL, that yielded a maximum of 1 x 1010 VP per injection. However, with more
experience and a gradually increasing reliability in injection, it became clear that while 1
x 1010 VP represented the maximum dose, the minimum dose was unknown. It was
theorized that a lower dose should allow for a lower immune response to the vector.
Therefore, work was undertaken to determine the minimum dose that would allow for a
complete transduction of the retinal epithelium. 10-fold dilutions of the vector were
made, down to 1 x 105 VP per μL, allowing for the same volume to be injected at each
dose, thus giving the same volume for each dose to diffuse and spread within the sub-
retinal space. (n=5 at each dose, 5 doses)
The results indicate that fluorescence can be detected at doses as low as 1 x 105 VP,
although the number of cells transduced becomes visibly less with a lower density
despite the spread across the retinal epithelium (Figure 20). Doses lower than 1 x 105 VP
were not tested. At 1 x 106 VP, fluorescence could still be observed in the RPE across the
entire retinal epithelium. (Note that a section of the RPE on the posterior side of the eye
was lost during tissue processing and does not represent a lack of reporter gene
114
expression in that area.) Although a complete transduction was observed at 1 x 106 VP,
the latter long term experiments used 1 x 107 VP in order to obtain an adequate margin.
115
116
Figure 20 – Low dose injections of CAG-EGFP confer expression down to 1 x 105 VP
Injections of low doses of CAG-EGFP reveals that the fluorescence is detectable in the
RPE across the entire retina at 1 x 107 VP but became more sparse with lower doses. (All
doses at 1 μL of HDAd encoding CAG-EGFP; 1 week post-injection; Scale bar = 500
μm)
117
3.4.3.3. Long term fluorescence can be observed in injected
mouse retinas for a minimum of 4 months
As with any other uses of gene therapy, the duration of transgene expression was of
interest as re-administration of the gene therapy vector, especially when it involves
microsurgical manipulation of the eye, is undesirable.
Initial work delivering 1 x 1010 VP of the vector showed excellent expression at 3 weeks,
but no expression at 3 months (n=5 for each). In addition, extensive retinal damage was
observed, indicating that an immune response had likely occurred. (Data not shown,
identical in appearance to Figure 21 labelled as “Damaged Retina”) As the immune
response may have been a result of the vector’s toxicity rather than injection damage, and
injection of the carrier liquid (10mM Tris-HCl, pH 8.0) only did not result in retinal
damage, we sought to repeat the long-term expression studies using a minimal amount of
viral vector.
After having determined the minimal dose for a reliable, complete transduction across
the retinal epithelium (1 x 106 VP, Section 3.4.3.2), work was undertaken to determine
the duration for which expression can persist using 1 x 107 VP. These animals were
sacrificed at 1 month, 2 month, and 4 month intervals (Figure 21; n=5 each), using
previous results as representative of 1 week (Figure 20). The results indicate that strong
reporter gene expression could still be detected in most of the retinal epithelium as long
as 4 months after vector injection. Of the 5 mice injected with CAG-EGFP, 2 showed no
transgene expression, nor any morphological changes. These likely represented failed
injections where the vector failed to reach the sub-retinal space. A third mouse showed
118
trace amounts of EGFP expression, but it was accompanied by massive retinal damage
(Figure 21, labelled as “Damaged Retina”), with no discernible separation of the inner
and outer nuclear layers. The fourth mouse exhibited retinal damage without any
detectable fluorescence. The fifth mouse demonstrated complete transduction of the RPE
across the entire retina and did not exhibit any retinal damage, demonstrating that long-
term expression of transgenes is possible after delivery by HDAd vectors without
apparent retinal damage. The differences in retinal damage were likely due to differing
amounts of injection trauma, thus while some had caused a breach in the immune
privilege status of the retina, some had not caused such a breach and resulted in no retinal
damage.
Longer incubation periods after injection were not tested due to time limitations.
119
Figure 21 – Long-term monitoring of CAG-EGFP injected mice
Long-term monitoring of CAG-EGFP injected mice indicate that strong transgene
expression can be detected for a minimum of 4 months in the majority of the retinal
epithelium, although retinal damage can be observed in some cases. (1 x 107 VP in 1 μL
of HDAd encoding CAG-EGFP; Scale bar = 500 μm)
120
3.4.3.4. Although the expression is largely limited to the RPE,
there are some isolated patches where all layers within the
retina are transduced.
The results presented thus far show that transduction across the retina was robust, but
was only observed in the RPE in the vast majority of cases. However, occasionally, cells
in the neural retina could be observed to give a strong fluorescent signal. This occasional
neural retina transduction had been observed in sporadic single cells, and in large patches
of cells, covering up to 20% of the retina (Figure 22 A and B respectively). From a sub-
set of the later experiments where the imaging technique was more refined, transduction
of the neural retina was observed in 20% of successful CAG-EGFP injections (n=11).
There is no obviously discernible pattern of where these patches occur as they are
random in location and not localized to the injection site nor anatomical feature. Possible
origins of these patches are discussed in Section 4.5
121
Figure 22 – Patches of transduction of the neural retina after CAG-EGFP injection
Confocal microscopy of CAG-EGFP injected mice reveal that occasional transduction of
cells other than the RPE can be observed. These can occur as individual cells (A) or as
122
patches where many cell-types are transduced across the retinal layers (B). (1 x 107 VP in
1 μL of HDAd encoding CAG-EGFP; 1 week post-injection; Scale bar = 100 μm)
123
3.4.3.5. Injections of First-Generation, pseudotyped Ad5/F35
vector carrying CMV-EGFP did not appreciably skew
transduction towards photoreceptor cells
Previous work by others has suggested that the use of a pseudotyped adenovirus serotype
5 with fiber from serotype 35 (Ad5/F35) could skew the tropism of the adenovirus in
such a way that may be beneficial to photoreceptor transduction [143]. The rationale for
the fiber replacement stems from the binding of Ad5 fiber knob to CAR receptors which
are highly abundant on the RPE, while the Ad35 fiber (F35) knob binds to CD4 [131].
In addition, it has been suggested that the RGD domain in the penton base of the viral
capsid facilitates the uptake of the vector by the RPE, thus depleting the vector from the
sub-retinal space and preventing photoreceptor transduction [25, 203].
As the majority of the transduction observed in our experiments occurred in the RPE, it
was desirable to test Ad5/F35 in the eye to determine if HDAd would benefit from such
modifications. However, given the technical difficulty in producing a pseudotyped
HDAd, it was necessary to first confirm these findings using adenoviral vectors (AdV)
provided by our collaborators.
First-generation adenoviral vectors (FGAdV) generated from Ad5 and Ad5/F35, each
with and without the RGD domain deletion, were introduced by sub-retinal injection (1 x
108 PFU, 4 treatment groups, n=5 each). Each vector contained identical constructs
producing EGFP under the control of the CMV immediate early gene enhancer/promoter.
To serve as a comparison, an injection of 1 x 1010 VP of HDAd CAG-EGFP has also
124
been included in the figure. In all cases, large portions of the retina were found to be
fluorescent, although the expression was exclusively found within the RPE (Figure 23).
The results were not substantially different between Ad5, Ad5/F35, nor any combination
with the RGD deletion. Note that in these images, an earlier method of sample
preparation was used. As a result, there was significantly more unintentional separation
of the RPE from the neural retina than in other figures in this work. The tearing of the
RPE away from the neural retina results in the RPE processes to be separated from the
main cell body of the RPE, and are left intertwined with the photoreceptor segments.
While this may be mistaken for photoreceptor cell expression of EGFP, actual
transduction of photoreceptor cells are significantly different in appearance, with
fluorescence being observed in the outer nuclear layer as well as the photoreceptor
segments. Actual photoreceptor cell transduction can be seen in Section 3.4.3.7, Figure
25, for comparison.
While precise quantitation is not available, the lack of a significant shift towards
transduction of the photoreceptor cells was sufficient to conclude that modifications of
the HDAd5 in this manner would not yield the desired result.
125
Figure 23 – Injections of FGAdV Ad5 and Ad5/F35 both with and without RGD deletion
results in no significant increase in PR transduction
Injections of first generation adenoviral vectors of serotype 5 (Ad5), serotype 5 with
fibers from serotype 35 (Ad5/F35), and each with the RGD domain deleted from the
penton base (ΔRGD), failed to demonstrate a significant increase in the transduction of
126
photoreceptor cells. The HDAd image serves as a basis of comparison. (AdV carrying
CMV-EGFP were injected at 1 x 108 PFU in 1 μL; HDAd carrying CAG-EGFP was
injected at 1 x 1010 VP in 1μL;1 week post injection; n=5 for each treatment group;
Scale bar = 50 μm)
127
3.4.3.6. LPC does not result in improved transduction of the
PR cells.
Lysophosphatidylcholine (LPC) had been used previously to improve vector uptake in
various lung gene therapy studies [110, 121, 123], including work in our laboratory
[102]. However, studies by others have suggested that LPC has an inhibitory effect on
adenoviral entry by interfering with viral protein-host cell binding [76].
In order to determine whether LPC has any effect on photoreceptor transduction, mice
were injected with CAG-EGFP HDAd vector mixed with 0%, 0.005% or 0.010% LPC
by volume (3 groups, n=5 each). The results indicate no apparent difference when LPC is
used as the photoreceptor cells remain un-transduced (Figure 24). Note that as the
method used for sample preparation was a less refined technique, like Figure 23 from
Section 3.4.3.5, there are visible RPE processes intertwined with the photoreceptor cells
but they do not represent photoreceptor cell transduction.
128
129
Figure 24 – LPC does not increase photoreceptor transduction
The addition of LPC at 0.005% or 0.010% yields no appreciable difference to the
transduction of the photoreceptor cells compared with the control. (CAG-EGFP HDAd
vector at 1 x 1010 VP in 1 μL;1 week post injection; Scale bar = 50 μm)
130
3.4.3.7. Injections of HDAd Rho-EGFP results in sporadic,
limited transduction restricted to photoreceptor cells only
In order to assess the photoreceptor specificity of the Rho-EGFP construct in vivo, HDAd
vectors carrying the construct were injected into the sub-retinal space using methods
identical to CAG-EGFP injections (section 3.4.3.1). In the majority of cases, no
transduction could be detected in the retina (Figure 25A). However, in approximately
20% of the cases, small areas of transduction can be found (Figure 25B and D;6 groups,
total n = 28; The presence of these areas could be reliably detected only using a method
of tissue preparation and imaging used in the later part in the work herein, thus earlier
experiments were not included.) Under high magnification, it became apparent that in
these areas, fluorescence is restricted exclusively to the photoreceptor cells (Figure 25C
and E). These areas of transduction indicate that the rhodopsin promoter construct (IRBP
Enhancer with 1553 bp rhodopsin promoter, Section 3.1.2) confers cell-specific
fluorescence. This is confirmed with the complete lack of transduction of the RPE, even
in areas where successful photoreceptor transduction can be found.
131
132
Figure 25 – HDAd carrying Rho-EGFP injected into the sub-retinal space of mice
Injections of Rho-EGFP usually resulted in no visible transduction (A). However, in
approximately 20% of the cases, areas of transduction can be found (B and D; each from
different mice). High magnification views of these areas reveal that transduction is
exclusive to photoreceptor cells (C and E, corresponding to the red boxed area of B and
D respectively). (Scale bars = 500 μm (A, B, D), Scale bars = 100 μm (C and E); 1 x 1010
VP in 1 μL of HDAd vector carrying Rho-EGFP; 1 week post-injection)
133
3.4.3.8. Injection of the GRK1-EGFP vector results in no
detectable fluorescence.
Although the GRK1 promoter had proven to be weaker than the rhodopsin promoter in
cell culture (Section 3.1.3), we decided to attempt to use GRK1-EGFP in equivalent
mouse studies in case the difference was caused by peculiarities in the cell lines. Work
was undertaken to generate HDAd vectors based on the plasmid constructs. However, no
transduction could be detected in any part of the retina after GRK1-EGFP injection.
Furthermore, no sporadic areas of transduction could be observed, unlike the results with
Rho-EGFP. (3 groups, total n = 15)
3.5. HDAd carrying the therapeutic gene is capable of
transducing cells and conferring expression
Having confirmed the function in vivo of the vectors using the EGFP reporter gene,
vector constructs carrying ABCA4 rather than EGFP were used in cell culture and in vivo
to confirm HDAd’s ability to deliver large genes with the expectation that their
behaviour would be otherwise identical.
CAG-ABCA4 transduction resulted in ABCA4 mRNA production in both ARPE-19 and
WERI-Rb cells as determined by qRT-PCR (Figure 26). Rho-ABCA4 transduction
resulted in ABCA4 mRNA production in WERI-Rb cells only. The results are consistent
with the data produced with reporter genes (Section 3.4.1), indicating that the rhodopsin
promoter construct retained cell-specificity despite the change in the gene expressed.
134
Of interest is the consistently higher expression levels observed in WERI-Rb, which is in
agreement with the observations from the reporter gene assays (Section 3.4.1). As the
increased levels of expression detected here was in the mRNA, it stands to reason that the
explanation for WERI-Rb expressing more protein was not because of higher translation,
but due to differences in transcription.
This experiment was repeated using different doses of vector. The results from 8000
VP/cell, 16,000 VP/cell, and 32,000 VP/cell showed the same pattern of relative
expression as the data presented in Figure 26.
135
Figure 26 – mRNA from cell lines transduced with CAG-ABCA4 and Rho-ABCA4
qRT-PCR shows that CAG-ABCA4 transduction results in ABCA4 mRNA production
regardless of cell type, while Rho-ABCA4 results in mRNA production in WERI-Rb but
not in ARPE-19 cells. (32,000 VP/cell; 2 days post-transduction)
136
In order to confirm that the results from the mRNA experiments correlate with protein
produced, HeLa, ARPE-19 and WERI-Rb were transduced with 8000 VP/cell of CAG-
ABCA4 or Rho-ABCA4 (Figure 27). The results indicate that all three cell lines produce
detectable levels of ABCA4 protein of the appropriate ~256 kDa size (indicated by the
red box). Furthermore, only WERI-Rb produced ABCA4 when transduced with Rho-
ABCA4, confirming that cell-specificity was not lost when the EGFP reporter gene was
replaced with ABCA4.
In addition, two bands of approximately ~130 kDa can be observed when WERI-Rb was
transduced with CAG-ABCA4. Repeated experiments have shown that these bands are
consistent under a variety of conditions for protein extraction and separation. A dilution
series showed that these bands are present even at very low doses and because they are
more abundant than the expected 256 kDa band, they appear before the expected band as
the dose is increased through the detectable limit. (Data not shown)
137
Figure 27 – Western blot of cell lines transduced with CAG-ABCA4 and Rho-ABCA4
Western blot analysis of 3 cell lines transduced with CAG-ABCA4 and Rho-ABCA4
reveal that the CAG-ABCA4 confers ABCA4 protein expression to all 3 cell lines while
Rho-ABCA4 produces protein only in WERI-Rb cells. In addition, there are two
prominent bands of lower molecular weight that appear only when WERI-Rb cells are
transduced with CAG-ABCA4. (Red box indicates the expected size of ABCA4 at ~256
kDa; 8000 VP/cell; 5 days post-transduction)
138
To further confirm the presence of the protein in transduced cells, cultured cells (ARPE-
19, HeLa, and WERI-Rb) transduced with CAG-ABCA4 or Rho-ABCA4 (8000 VP/cell)
were stained with anti-ABCA4 antibody and imaged for immunofluorescence (Figure
28). The results are fully consistent with previous data; CAG-ABCA4 transduction
resulted in production of ABCA4 in all three cell lines while Rho-ABCA4 did not elicit
ABCA4 production in any cell line other than WERI-Rb.
139
Figure 28 – Immunofluorescence imaging of cell lines transduced with either CAG-
ABCA4 or Rho-ABCA4
Immunofluorescence imaging of cell lines transduced with either CAG-ABCA4 or Rho-
ABCA4 shows the same pattern of expression as earlier observed, with CAG-ABCA4
conferring expression in all cell lines while Rho-ABCA4 confers expression only to
WERI-Rb cells. (5 days post-transduction; Scale bar = 10 µm)
140
3.5.1. Injections of HDAd vector carrying ABCA4 into mouse
retina
Having confirmed the function of the vector in cell culture, HDAd carrying the ABCA4
expression cassettes was injected into mouse retina to assay for function and distribution.
To assay the delivery of ABCA4 by HDAd in vivo, mouse eyes were injected with CAG-
ABCA4 (1 x 1010 VP). The animals were sacrificed at 7 days post-injection, and the
tissue was processed for assay of mRNA by qRT-PCR. The results from human-specific
ABCA4 primers indicate that hABCA4 is detectable from injected eyes but not from
control eyes (Figure 29).
141
142
Figure 29 – qRT-PCR for transgenic ABCA4 from injected mouse eyes
Mouse eyes injected with CAG-ABCA4 were processed for assay of mRNA by qRT-
PCR. The relative abundance graph (A) is derived from data obtained by qRT-PCR (B).
The results indicate that CAG-ABCA4 elicits ABCA4 mRNA production in vivo. (n=4;
Error bars represent the standard error of the mean; the difference is statistically
significant based on t-test p<0.05; 1 week post-injection)
143
3.5.1.1. Immunofluorescence imaging of CAG-ABCA4
injected mice indicate ABCA4 expression within the RPE.
Mouse eyes injected with 1x1010 VP of CAG-ABCA4 were stained with anti-ABCA4
and imaged for immunofluorescence (Figure 30 and Figure 31). The results show a
fluorescent signal in some areas of the RPE in approximately 20% of mice (n=10).
Fluorescence was not observed in control mice nor in antibody controls. Furthermore, no
fluorescence was observed in the photoreceptor cell layers even though the antibody used
is cross-reactive between mouse and human ABCA4, and the mice were wildtype and
thus should express ABCA4.
This lack of fluorescence from the photoreceptor cells in these wildtype mice indicates
that the antibody staining is not sufficiently sensitive to detect endogenous ABCA4
expression. The presence of fluorescence signal from the RPE of injected mice, given
that the RPE does not naturally express ABCA4, therefore must represent exogenous
expression conferred upon the RPE by HDAd carrying CAG-ABCA4. The fluorescence
in the RPE but not in the photoreceptor cells also implies that the expression levels of
ABCA4 conferred upon the RPE cells by the vector exceeds that of the photoreceptor’s
endogenous levels.
A more definitive experiment to confirm the function of the CBA-ABCA4 vector would
involve the use of ABCA4-/- knockout mice whereby any detectable ABCA4 expression
can only arise as a result of successful transduction. However, this experiment could not
be performed as such knockout mice were not available to our laboratory.
144
Figure 30 – Immunofluorescence imaging of mouse eyes injected with CAG-ABCA4
Immunofluorescence imaging of mouse eyes injected with CAG-ABCA4 indicate
ABCA4 expression in the RPE cells in some areas within the retina. A magnified view of
the area within the yellow box showing RPE transduction can be seen in Figure 31. (1 x
1010 VP; 1 week post-injection; DAPI – blue; ɑABCA4 – green; ɑRhodopsin – red)
145
Figure 31 – Magnified view of the areas within the yellow box from Figure 30
Magnified view of the areas within the yellow box from Figure 30 demonstrating the
presence of ABCA4 within the RPE of CAG-ABCA4 injected mice. (Scale bar = 250
μm; 1 x 1010 VP; 1 week post-injection; DAPI – blue; ɑABCA4 – green; ɑRhodopsin –
red)
146
3.5.2. mRNA, western blots and IF using different batches of
CAG-ABCA4 reveals variations in vector efficacy between
batches
In order to refine HDAd vector based gene delivery, it would be helpful to quantify the
variations between batches of vector produced. Because of the low quantity of CAG-
ABCA4 vector produced per production run, varying from 1 x 108 VP to 2 x 1013 VP, 5
separate runs were made, resulting in separate batches of varying concentration and
possibly varying quality. Note that repeated production runs was not necessary with the
EGFP reporter vectors as the yield from a single production run was adequate for a large
number of experiments, thus fewer different batches were used for examination.
mRNA extracted from HeLa cells transduced with 32,000 VP/cell of each batch was
examined by qRT-PCR (Figure 32A). The results indicate a large variation between
batches and not correlated with the storage duration of each batch. This experiment was
repeated with 8000 VP/cell and 16,000 VP/cell, resulting in the same pattern of relative
abundances. To confirm that the difference in mRNA results in a variation in protein
production, the first three batches were examined by immunofluorescence and by
western blot (Figure 32B). The protein expression confirms the results observed by
mRNA.
It is important to note that all the data presented herein of CAG-ABCA4 were conducted
using a single final batch of the vector (Batch 4) to ensure consistency within the data.
147
148
Figure 32 – Comparison of batches of CAG-ABCA4 by qRT-PCR, immunofluorescence
and western blot
mRNA extracted from HeLa cells transduced with different batches of CAG-ABCA4, all
at 32,000 VP/cell, reveal that the amount of mRNA produced as a result of transduction
is highly variable (A; 3 days post-transduction). This variation is seen in protein
production by immunofluorescence imaging and western blot (B; 5 days post-
transduction).
149
4. Discussion
Adenoviral gene therapy has been in development for many decades, and this study was
not the first in attempting to apply adenoviral gene therapy for the treatment of retinal
disease. However, the hypothesis of applying helper dependent adenoviral vectors to
treat Stargardt’s disease had not been previously tested. Unfortunately, we encountered
several obstacles to the in vivo application of the vector that have not been described
previously in cell culture and in vivo studies. However, we did succeed in establishing
excellent transduction of the retinal epithelium at very low doses, and prove that strict
cell specificity can be obtained using transcriptional regulation. Below the knowledge
gained and the possible future directions for applying HDAd to retinal gene therapy are
discussed.
4.1. Anomalous protein bands observed when CAG-ABCA4
vector is used to transduce WERI-Rb cells is likely a result of
RNA processing
In the western blot experiments, we observed that the combination of CAG-ABCA4
vector and WERI-Rb cells gave two anomalous bands at approximately 130 kDa in
greater concentration than the expected band at 250 kDa (Section 3.5.1, Figure 27).
When WERI-Rb cells were transduced with very low doses of CAG-ABCA4, the two
lower-mass bands appeared before the expected band. Furthermore, these bands were not
observed with any other combination of vector and cell line.
The possible sources of these bands can be summarized as errors in the vector, post-
translational modifications, protein cleavage, or alternative mRNA products. It is also
150
important to note that the Rim3F4 antibody used for detection targets the C-terminus of
the protein, thus both bands contain the C-terminus and therefore the bands do not
represent two separate parts that add up to the complete protein. In other words, the
bands do not represent the cleavage of the intact protein unless there are two separate
cleavage events, each resulting in an N-terminal product.
It is highly unlikely for errors in the vector to cause the observed bands as the sequence
of vector portions carrying ABCA4 was confirmed in its entirety. The same cassette was
also used to construct Rho-ABCA4, which does not result in the additional bands.
Furthermore, the use of the same vector yields only faint bands of the same unexpected
size when used in cell lines other than WERI-Rb. As such, errors in the vector are highly
unlikely.
Post-translational modifications have been well studied by our collaborators (Dr. Robert
S. Molday, University of British Columbia) [209]. Post-translational modifications were
also discussed as a potential source of these bands, as it is possible that the high levels of
expression from the combination of CAG promoter and WERI-Rb’s high transcriptional
activity could result in post-translational modification mechanisms not being able to
maintain pace with protein production. Although several glycosylation sites and five
phosphorylation sites were found, none of these modifications explain the additional
bands observed as both bands are significantly smaller than the expected protein size. In
addition, although a disease-associated mutation in one of the phosphorylation sites was
observed to lead to protein misfolding and degradation, a western blot of the affected
protein did not result in a size-shift corresponding to the bands we observed.
151
Degradation products of proteins often result in western blot smears or bands of smaller
sizes. The same vector used in other cell lines does not result in degradation, thus the
aberrant band does not appear to be normal degradation caused by the protein or by the
vector used. Additionally, the same cell line transduced with Rho-ABCA4 does not result
in the same bands of comparable intensity, thus this could not be a result of degradation
inherent in the cell line. It could be argued that the high levels of protein production
resulting from this combination of promoter and cell line may have triggered an
unidentified protein degradation mechanism due to excess protein accumulation.
However, when minimum amounts of vector were used to minimize instances of
multiple-infection, the anomalous bands appear well before the expected band emerges,
thus it does not appear to be dependent on protein over-production. As such, it is difficult
to justify the bands as degradation products.
Finally, it is possible that the bands reflect alternative mRNA products. As the cloned
sequence contains no introns within ABCA4, splicing cannot account for shortened
products preserving the antibody-binding C-terminus. However, it is possible that
translation of the mRNA started at a site other than the one expected. There are multiple
in-frame ATG near the middle of the mRNA that would result in proteins of the observed
size and provide the C-terminus for antibody binding. This errant translation is not a
result of an error in the expression cassette of the vector construct as the same vector
performs normally in other cell lines. Also, because WERI-Rb transduced with Rho-
ABCA4 vector does not yield the anomalous bands, it is not a feature inherent in WERI-
Rb cells. The only explanation is that the high transcriptional activity of WERI-Rb cells,
in conjunction with the CAG-ABCA4, is causing such errant translation as to result in
152
two N-terminal truncated proteins. This errant translation is not observed in Rho-
ABCA4 as the promoter results in much less mRNA production. As mentioned
previously, even when minimum amounts of vector were used, the anomalous bands
appear earlier than the expected band. This observation could be a result of a single
transduction event per cell being sufficient to produce a high level of mRNA, even
though as a population the majority of cells are not transduced. As a result, there is a
fixed ratio between complete and truncated proteins being produced, and as more cells
are transduced via increasing the dose, the complete protein becomes more abundant and
detectable.
It is unlikely that these aberrant proteins are produced in vivo. In future studies, after
neural retinal transduction can be established reliably, an animal model could be used to
determine whether the transgene is performing as expected via physiological or
phenotypic studies.
4.2. HDAd required to transduce the entire retinal epithelium is
low, but is also difficult to quantitate precisely, and there are
variations in VP:IU between batches
Although uncommon, lentiviruses have been studied for use in the retina. In two such
studies, there was only partial transduction of the RPE and sparse transduction of the
neural retina at 1 x 106 PFU [155, 241]. Studies with AAV typically use doses ranging
from 1 x 108 VP to 2 x 109 VP [29, 98, 131], although doses as high as 1 x 1013 VP have
also been used [157]. While doses above 1 x 1010 VP are reported consistently as giving
effective transduction, lower doses have been observed at times to be inadequate [241].
153
Previous dosage studies with first-generation (E1 deletion only) adenoviral vectors in
mice have shown that 1 x 107 PFU is the minimum dose required to obtain complete RPE
transduction of a CMV-LacZ expression cassette [11]. Other studies subsequently used
this dose as an absolute minimum, often with doses as high as 1 x 109 PFU and have
demonstrated repeatedly that doses under 1 x 107 PFU are inadequate for complete
transduction [204, 241].
A few other studies have attempted to use HDAd vectors in the retina with very limited
effect. In one study, only very sporadic, small points of the retina could be seen to
express the GFP reporter gene at doses of 1 x 108 VP [115]. A separate group first
quantitated their vector based on the number of fluorescent cultured HeLa cells obtained
after transduction with vector encoding EGFP to determine the volume required to obtain
a set number of infectious units (IU), similar to the plaque forming units (PFU) that
would otherwise be used to quantitate virus [111]. That study found approximately 50%
transduction within the RPE of the retina when 5 x 104 IU was used. The authors also
stated that “virtually complete transduction” was obtained at 5 x 105 IU and that higher
titre did not improve transduction, although the images presented were similar to the
incomplete transduction results we obtained at a dose 10 to 100 times below that required
for complete transduction (Figure 20, CAG-EGFP 1 x 105 VP).
From our own data, Figure 20 clearly demonstrates that complete transduction can be
obtained at a dose of 1 x 107 VP (1 x 105 IU) or lower. The high magnification
examination of these injected retinas reveal that there are no breaks or untransduced
areas across the entire retinal epithelium, identical in appearance to that of Figure 13 and
154
thus likely indicates that even 1 x 107 VP (1 x 105 IU) is above saturation and well
beyond the minimum required. The doses used in this study achieved a high level of
transduction using doses lower than those previously documented.
However, it is important to note that there is considerable difficulty in precisely
quantifying non-replicative viral vectors in the absence of a reporter gene. Replicative
viral vectors, or viral vectors which can replicate in specialized production cell lines, can
be easily assessed by plaque forming assays. However, with vectors such as AAV and
helper-dependent adenovirus, indirect methods of quantification must be used.
If a vector carries a reporter gene, it is also easily quantifiable. This can be done via
several methods including flow cytometry after transduction in cell culture as
demonstrated in Section 3.4.2. However, there are many scenarios in which a reporter
gene may not be desirable as it may adversely affect monitoring of the results, or may
trigger additional immune effects. In the absence of a reporter gene, antibody staining
could be used to determine the percentage of transduced cells, but this method introduces
the possibility of transduced cells not being detected as a result of weak antibody
staining, and thus yield an underestimate of the infectious units.
Quantification of non-replicating vectors not carrying reporter genes relies on
quantifying the DNA content within the vector preparation, after purification steps have
been taken to remove DNA not packaged within the virion. In its most basic form, it can
be accomplished by simple photospectrometry to estimate DNA concentration [140,
154]. A more precise quantification can be obtained via qPCR targeting either the
transgene [173] or the inverted terminal repeats [6]. However, qPCR only measures the
155
viral particle-associated DNA. It neither confirms the entirety of the vector DNA, nor
does it assay for the ability of the vector to actually transduce cells. It was shown in a
previous study using AAV, detecting certain portions of the packaged DNA can result in
an over-representation of how many virions have packaged the entirety of the DNA
successfully [221]. While AAV and adenovirus have different methods of packaging, the
possibility of incomplete DNA packaging exists in adenovirus as well. A further
refinement is available by detecting adenovirus in cell culture after transduction to
quantify the viral genome DNA [69]. The cells are carefully washed after incubation with
the virus to remove unattached virus. The cells are lysed and qPCR is used to determine
the number of vector genome copies present in the lysate. However, the argument can be
made that virions that have attached onto the cells may be defective in viral entry, and
such protocols are unable to determine whether the viral DNA is intracellular or attached
but extracellular.
Ideally, to confirm transduction without the use of a reporter gene, the mRNA produced
by the vector payload must be assayed by qRT-PCR. However, as mRNA accumulates
over time as a result of continuous transcription from the viral template, strict temporal
controls must be in place to ensure that the data is consistent. The mRNA level would
then need to be correlated with a plaque forming assay using a replication competent
vector, such as first-generation adenovirus in a producer cell line, carrying the same
construct in order to serve as a comparison. If performed under identical conditions, a
standard curve of the qRT-PCR from the replication competent vector can then be drawn
against the resultant PFU. The use of different promoters would require a new standard
curve due to differing transcription activity. Also, the assay must be conducted in the
156
same cell line even if a more physiologically relevant cell line is desired as cell lines
differ in transcriptional activity. In addition, the time of incubation before analysis must
be short enough to occur before viral genome replication in the replication competent
vector and yet long enough for sufficient mRNA to allow for qRT-PCR analysis. Finally,
it makes the assumption that there are no cis-acting elements present in the replication
competent vector that might affect the transcriptional activity of the gene of interest.
This, in conjunction with the obvious practicality concerns as each construct must be
made into separate vectors, makes it of questionable value.
Unfortunately, as can be seen in Section 3.5.2, despite the extensive experience in our lab
in vector production, the quality of each batch of vector still varies significantly. For non-
replicative viral vectors to succeed, an accurate way of determining titre and improved
methods to optimize vector quality must both be employed.
Associated with the difficulty in quantitation is the variation found between batches of
HDAd which affects the particle to IU ratio. As shown in Section 3.4.2, we found a
particle to IU ratio of approximately 1:100. This result is approximately double that of
previously published ratios between the number of virus particles and infectious units
using wildtype Ad5 grown in 293 cells (1:60) [19]. The presence of non-infectious
particles is attributable to viral production, specifically the packaging of incorrect DNA,
contamination from helper virus, and the presence of defective virions carrying the
desired DNA payload. Although a portion of the defective virus is unavoidable, some of
it can be attributed to the production techniques employed.
157
As shown in Section 3.5.2, Figure 32, there is a variation of approximately 5-fold
between the least and most efficacious batches of CAG-ABCA4 vector as determined by
qRT-PCR for measurement of ABCA4 mRNA.
The presence of helper virus contamination can adversely affect experimental results as
they would act as first-generation adenoviral vectors, expressing multiple viral genes that
contribute to immunogenicity in vivo. In addition, quantitation by optical density is
unable to distinguish between HDAd and helper virus, thus the presence of helper virus
would also contribute towards an apparent reduction in infectivity.Higher quality and
reliability in helper-dependent adenoviral vector production would contribute towards the
ease and reproducibility of experiments.
The method used for our HDAd production is a commonly accepted method involving
multiple rounds of small-scale production using tissue culture plates, followed by several
rounds of large-scale production using stirring flasks, each round requiring co-infection
with helper [154]. The key problem with this method is that the products of each round
of amplification may be impure, containing incorrectly packaged DNA, recombined
vector genomes, as well as helper virus contamination. These undesired components are
then carried over and, if inverted terminal repeats are present, are amplified along with
the desired product. In addition, the helper virus carried over contributes to the titer of
additional helper virus that must be added during each round, and therefore adversely
skews the ratio between helper and helper-dependent particles.
Multiple strategies are already in place to help reduce helper virus contamination. The
earliest involved the addition of LoxP sites flanking the packaging signal of the helper
158
virus and the addition of Cre recombinase to the cell line to render helper virus DNA
unable of being packaged [160]. Further refinements led to the reversal of the direction
of the packaging signal, thus rendering homologous recombination products between the
helper DNA and helper-dependent DNA too long to be packaged. Although these genetic
changes reduce the helper virus contamination between rounds of replication, they do not
eliminate the problem, nor do they address the carry-over of contamination other than
helper virus.
The imprecise method by which production occurs also contributes towards the lack of
reliability. The published method requires 6-8 serial passages on small plates, each done
blindly without knowledge of how much helper virus is being carried over and how much
of the helper-dependent vector is present. The lysate is then used to inoculate the
suspension-cell culture for large scale production. While the passage with highest helper-
dependent genome DNA, and thus highest yield of helper-dependent virus, can be
identified by Southern blot after the passages, the helper virus is added at the beginning
of each serial passage without quantifying the amount of carried-over virus. There is also
no monitoring of the helper virus and helper-dependent virus present at the end of each
passage to optimize the subsequent round. Furthermore, the actual quantity of helper
virus present in the inoculum is not known, only that it was a fraction of the highest
yielding of the serial passages.
Ideally, after the serial passages, the vector should be purified by ultra-centrifugation to
minimize helper virus contamination. Quantitation by optical density would then allow
for an estimate of the titre for inoculating the large suspension production culture. Doing
159
so would allow for a much better controlled inoculum of helper virus as it removes carry-
over from previous amplifications. It also provides a precise, repeatable inoculum of
helper-dependent virus, as insufficient inoculum would lead to under production while
excessive inoculum may lead to earlier cell-death and thus also reduce yield.
Alternatively, the integration of the entire helper virus genome into a production cell line
would completely eliminate all issues of helper virus contamination. As this modified
cell line would be capable of making complete albeit empty virions, the modifications
would require that the production be strictly controlled. Similar to the first generation
virus where the E1 gene is deleted, thus disrupting the initiation of virus production, E1
could also be placed under a strict inducible promoter to prevent virus production and
cell-death until chemical induction.
Despite these issues, it is important to keep in mind that although the viral vector
production in the laboratory setting may be sub-optimal, helper-dependent adenoviral
vectors for clinical trials would require GMP production and much improved purity to
permit its use. It is likely that with such improved production, the retinal degradation
observed in Section 3.4.3.3 would not be of significant concern and would not represent
a significant hurdle in the use of helper-dependent adenoviral vectors for retinal gene
therapy.
4.3. The tropism of the HDAd vector may be reducing the
transduction of photoreceptor cells
Section 3.4.3 demonstrated conclusively that HDAd is highly effective in transducing the
RPE of the retina. However, these high magnification views also demonstrate that there
160
is no transduction in cell types other than the RPE. This pattern of transduction seems to
indicate that the vector is unable to transduce the other cell types, including our target
photoreceptor cells, by sub-retinal injection. The possible reasons why the vector cannot
transduce these cells must be due to the tropism of the viral vector, the inability of the
vector to access the relevant cells, or the inability of the cells to express the reporter
gene. This section discusses the tropism of the viral vector. The possibility of the viral
vector being unable to access the relevant cells as a cause of the lack of neural retinal
transduction is discussed in Section 4.5 as part of the discussion relating to the patches of
transduction described in Section 3.4.3.4.
Adenovirus serotype 5 (Ad5) is primarily a respiratory virus and thus has a tropism for
epithelial cells, particularly those found within the respiratory tract. Upon injection into
the sub-retinal space, it is expected that the tropism of the virus results in the preferential
infection of the RPE. As the HDAd vector has a viral capsid identical to that of
adenovirus, it would be logical to expect the vector to preferentially transduce the RPE.
This is apparent by the results observed with CAG-EGFP vectors where complete
transduction of the RPE is observed without transduction of other cells (Section 3.4.3.1).
While information is not available to skew the viral vector tropism towards photoreceptor
cells, it is possible to skew the tropism away from the RPE.
Ad5 infection of the eye is known and targets multiple sites within the eye, including the
corneal epithelial cells, corneal stromal fibroblasts, and conjunctival epithelial cells [8].
However, there are no known infections of the eye that are specific to the photoreceptor
as the cells are well protected and thus infections only occur in the anterior portion of the
161
eye. As such, the receptors for viral binding and infection of photoreceptor cells are
unknown. It would be logical to surmise that skewing the viral tropism away from
epithelial cells in general would increase the proportion of injected viral vector available
to transduce photoreceptor cells. Since, it is known that CAR is absent on photoreceptors,
and CD46 is present [131], it would be desirable to alter the viral vector such that the
fiber-knob can no longer bind to CAR. It would also be desirable to delete the RGD-
motif such that it can no longer bind to ɑvβ5 integrin as it is also commonly expressed on
epithelial cells [39, 227], thus reducing attachment and viral entry to the epithelial cells
respectively. However, the heparan sulfate associated binding to the fiber should be left
undisturbed as HSG are expressed within the retina’s neural cells and photoreceptors [27,
150].
Previous works have examined the effects of pseudotyping adenoviral vectors to alter
their tropism. A study using a variety of mutated adenoviral vectors to skew tropism has
been observed to alter the effects of systemic vector delivery as the organs of non-human
primates are affected differently [188]. For example, the removal of the HSG binding site
from the fiber shaft significantly decreased liver transduction. The same group also
studied the same effects in mice and observed effects in differential tropism after these
modifications [189], although both studies viewed differences between organs but not
between different cell types.
In a study specific to the use of adenoviral transduction of photoreceptors, a vector of
Ad5 expressing Ad17 fibers revealed that the shorter fibers of the species D virus failed
to improve photoreceptor transduction [25], despite the expectation that Ad17 fibers
162
would reduce epithelial cell transduction by making the vector less-able to
simultaneously engage the CAR via the fiber knob and the integrins via RGD. The
authors also deleted the RGD motif from the penton base and claimed improved
photoreceptor cell transduction, although the fluorescence images look doubtful with
significant background fluorescence and very poor morphology. Furthermore, the authors
had noted that the expression was patchy and the morphology did not allow for adequate
assessment of how much of the retina was transduced.
A more recent study pseudotyped Ad5 with fibers from Ad35 which targets CD46 and
from Ad37 which targets sialic acid, and also included Ad5 with the RGD motif deleted
[203]. The fibers of both Ad35 and Ad37 are short [231], and thus should result in
reduction in RPE transduction. However, Ad5/F35 showed a reduction in neural retina
transduction while Ad5/F37 showed a marginal improvement. This effect was also
observed by others, although the level of transduction was poor [131], necessitating anti-
GFP staining as fluorescent observation alone was insufficiently sensitive. Deletion of
the RGD domain showed no apparent effect. This difference between Ad35 and Ad37
fibers is likely due to the inability of Ad37 fiber to bind to CAR [26]. Rather, sialic acid
is used for cell-surface attachment, and the increased transduction of Ad5/F37 into
photoreceptor cells may be attributable to this [5]. In fact, sialic acid has been determined
to be present in the photoreceptor cell surfaces, although it is also present in the RPE
[40]. It is interesting to note that in both studies, the expression beyond the RPE was
observed to be patchy. This will be further discussed in Section 4.5
163
In summary, very few high quality studies have been conducted in the pseudotyping of
adenovirus, and the data for skewing adenoviral tropism for the photoreceptor is scarce at
best. As such, any effort to intensively modify the HDAd for photoreceptor tropism
would rely on very limited knowledge and much speculation. That said, in designing an
optimized helper-dependent adenoviral vector specifically for the photoreceptors, one
should aim towards reducing the viral tropism for epithelial cells, while increasing
affinity for the sialic acid found on photoreceptor cells. In terms of the fiber knob, one
would desire changing the knob such that it carries the Ad37 sequence and thus binds to
sialic acid rather than CAR.
Given that ɑvβ5 integrins are known to be on the RPE, the interaction between the RGD
motif and RPE integrins is clearly to be avoided. This can be accomplished via the
modification of the sequences flanking the RGD motif to skew the affinity towards
another integrin type as previously shown [227]. However, as it is not known what type
of integrin is present on the photoreceptor, we are left with the options of either deleting
the RGD entirely, or altering the sequences without the knowledge of what type of
integrin should be targeted. As such, it would be necessary to engage in a proper study
employing a range of different modified vectors to determine what flanking sequences
are optimal for binding to photoreceptor cells, if there is any effect to be found beyond
RGD deletion. Note that in our experiments using first-generation adenoviral vectors, we
did not observe an effect with RGD deletion (Section 3.4.3.5, Figure 23). The lack of
effect is likely because the CAR targeted by the Ad5 fiber and the CD46 targeted by the
Ad35 fiber were sufficiently abundant on the RPE that any effects of RGD deletion was
164
overwhelmed in Ad5ΔRGD and Ad5/F35ΔRGD respectively, and had entered the cells
via an integrin-independent pathway.
As for the length of the fiber, it is difficult to determine whether a long fiber, such as that
of Ad5, would be preferable to a short fiber, such as that of Ad 37. While it is known that
a long fiber with a CAR compatible knob increases viral entry in cell culture [183], and
that integrin binding improves viral entry, it is possible that a long fiber may prove to be
beneficial when a sialic acid compatible knob is present as it would allow for the same
simultaneous binding that has been proposed to improve viral transduction [169]. This
would depend on whether integrins are present on the photoreceptor cells, whether the
integrins are accessible from the sub-retinal space; and if the integrin is different from the
ɑvβ5 found on the RPE [122, 176]. Given the lack of knowledge of the presence or
absence of integrins on the photoreceptor cells, there would be no benefit in using a long
fiber. However, if the fiber knob can no longer bind CAR, there would also be no
detriment in using the long fiber. As previously mentioned, given that there is no
information available on the integrins of photoreceptor cells, there is no rationale for
selecting a short versus long fiber. However, as HSPG binds to the proximal shaft area of
the Ad5 fiber [189], and such proteoglycans exist in the photoreceptor cells [116, 150,
151], it would be beneficial to use a long Ad5 fiber with an unmodified shaft to facilitate
such interaction.
Finally, it should be noted that CD46 is a receptor for some species B adenoviruses such
as Ad35 [68]. Conflicting information exists on the presence or absence of CD46 in
photoreceptor cells [63, 131]. This would indicate that CD46 may be present in
165
photoreceptors but at a very low level whereby some groups are unable to detect it, as
supported by a separate study comparing its expression in other parts of the eye [16].
Although it may be beneficial to include affinity for CD46, doing so would require the
sacrifice of affinity to sialic acid as it is also targeted by the fiber knob [161]. In addition,
increasing affinity to CD46 may prove to have a negative effect as CD46 is also
abundant on the RPE [137]. The presence of CD46 on the RPE likely accounts for the
lack of improvement observed with the first generation Ad5/F35 in our in vivo
experiments involving reporter genes (Section 3.4.3.5, Figure 23).
Given that Ad37 has a fiber knob that binds to sialic acid and not to CAR, and that the
effect of fiber length is unknown given the lack of known integrin interaction, it is logical
to suggest that rather than pseudotyping Ad5, a helper-dependent version of Ad37 could
be generated instead. However, Ad37 has much stronger integrin binding than Ad5
[134], an interaction that was confirmed by studies blocking integrin via antibodies [32].
As such, a HDAd version of Ad37 is precluded.
An ideal HDAd vector for targeting photoreceptors would require the modification of the
fiber knob to that of Ad37 so that it can bind to sialic acid, without modifying the shaft
such that it can still bind to HSPG. It would also require either modification of the penton
base to remove the RGD motif, or if more information is available, modify the sequences
flanking the RGD motif to alter the integrin it has affinity for.
4.4. Potential application of HDAd in RPE diseases
Our ability to transduce the entire retinal epithelium at very low doses (Section 3.4.3.2)
suggests the possibility of ocular gene therapy using HDAd to target the RPE. Of the
166
many causes of inherited retinopathies, the RPE-specific genes that may be responsible
are RPE65, LRAT, RDH5 [35], and MERTK [18].
RPE65 has been well studied and is well into human clinical trials using AAV as
mentioned previously (Section 1.3.4) [9, 34, 36, 81, 129, 184]. Because of the small size
of the RPE65 gene does not necessitate the use of a larger vector and the already
demonstrated safety and efficacy of AAV in its treatment, the most expedient path
towards clinical application remains with AAV.
Mutations in LRAT causes a form of Leber’s congenital amaurosis [103]. The gene
encodes a lecithin retinol acyltransferase, a key enzyme in the visual cycle (Section
1.1.2). LRAT gene therapy has been studied using AAV with significant electro-
physiological results but poor distribution of gene expression [8]. Furthermore, it has
been argued that the regulatory regions required for LRAT expression cannot be
packaged within the limits of the AAV vector despite the small size of the gene [103].
Given the very preliminary results and lack of widespread transduction observed in
studies thus far, there is the potential that HDAd may be a more efficacious vector for
delivering LRAT to the RPE.
Fundus albipunctatus is a rare disease that has been identified to be caused by the gene
RDH5, a retinal-pigment epithelial specific gene that can cause retinal degeneration with
no known treatment [35]. RDH5 is a crucial gene in the visual cycle (Section 1.1.2), but
the possibility of treating this disease using gene therapy has yet to be studied. As an
autosomal recessive disease of the RPE, HDAd is an ideal vector for delivering a
functional copy of RDH5 for the treatment of this disease.
167
Of these four genes, only MERTK is not directly involved in the visual cycle (Section
1.1.2). MERTK is a gene associated with the phagocytosis of the shed photoreceptor
segments by the RPE, and its dysfunction causes a form of retinitis pigmentosa. MERTK
has been treated in animal studies using lentivirus [208], adenovirus [215], as well as
AAV [51, 185]. The positive results have led to human clinical trial using AAV which
has been initiated but the results are as yet unpublished [18]. As with RPE65, because of
the advanced development of therapy with AAV, the most expedient path towards
clinical application remains with AAV.
Although two of these diseases have progressed to clinical trials with AAV, and the third
has had preliminary studies with AAV, this does not necessarily preclude studies in
HDAd. Our studies with the minimum dose required for complete transduction of the
RPE is many folds lower than that observed with other vectors (Section 4.2), and as such
HDAd may have a role should the toxicity associated with high doses of AAV prove
problematic.
4.5. Patches of complete retinal transduction
In the majority of injection of vectors carrying CAG-EGFP, no transduction of the neural
retina could be observed while the entirety of the RPE was fluorescent. However, in
some cases, patches of transduction within the neural retina could be observed (Section
3.4.3.4). Similarly, injections of vectors carrying Rho-EGFP displayed no fluorescence in
the majority of cases, although occasional patches of fluorescence limited to the
photoreceptor cells could be observed (Figure 25). These patches were very interesting as
it showed that the HDAd vector is capable of transducing the neural retina, suggesting
168
that viral tropism is not the limiting factor in neural retinal transduction. Rather, some
other mechanism is preventing the vector present in the sub-retinal space from
transducing the neural retina.
The sub-retinal injections for vector delivery targets the posterior portion of the retina,
approximately 30˚ offset laterally in parallel with the transverse plane (Figure 1). Due to
the limitations of the equipment and techniques employed, it is difficult to obtain higher
precision. However, it is clear that the patches of transduction seen in Figure 22 and
Figure 25 are not close to the injection site. Because the location of these patches varies,
it is also apparent that the patches do not correspond to any particular anatomical feature
in the eye.
Although these patches do not correspond to the injection site, it is nonetheless possible
that they arise from injection injury. In particular, as the use of a dissection microscope
gave only limited depth perception and the physical resistance provided by the eye is
minimal, it is possible that the needle tip had scraped and damaged the retina in those
areas unintentionally. The most likely explanation is that the accidental injury causes a
large tear on the vitreous side of the retina, during which the vector present on and
around the tip of the needle is transferred to the wound. In the actual injection site, the
needle is carefully pressed against the retina with minimal movement, causing a much
smaller break in the retina. This smaller break in the retina, with a clean edge as a result
of intentional injection, likely permitted the retina to seal the gap upon withdrawal of the
needle, thus reducing the ability of the vector to diffuse past the outer limiting
169
membrane. However, in the case of accidental injury, the wound caused was much larger
and thus the vector could enter the neural retina.
This indicates that HDAd is able to, if not efficient at, transducing the photoreceptor
cells. If we consider the possibility that these patches indicate areas where there was
inadvertent injury to the retina, the logical explanation would be that the lack of
transduction in other cases represents an inability to access and/or infect the cells, while
the physical injury provided a route of infection to the neural retina.
It is possible that the trauma caused a release of cytokines that resulted in the movement
of receptors and/or co-receptors to become accessible on the surface of the target cells.
This theory is supported by evidence from adenoviral infection of the respiratory tract
[125]. In that study, it was shown that the release of cytokines from infected
macrophages causes the migration of integrins to the apical surface of cultured polarized
epithelial cells, giving opportunity for adenovirus to infect the epithelium. It is possible
that injury in the eye causes a release of cytokines that act on the neural retinal cells,
allowing them to become susceptible to infection.
It is also possible that the barrier to infection is physical. The retina consists of the neural
retina, sandwiched by two limiting membranes; the inner limiting membrane is in contact
with the vitreous while the outer limiting faces the sub-retinal space and the RPE. The
outer limiting membrane forms a barrier between Müller cells and photoreceptor inner
segments, leaving the outer segments exposed to the sub-retinal space (Section 1.1.1,
Figure 2). From the complete transduction of the RPE, we can surmise that there is a very
large number of vector particles present in the sub-retinal space between the RPE and the
170
outer limiting membrane. The presence of these patches of transduced cells indicates that
the vector particles are capable of transducing the neural retina, including photoreceptor
cells. It seems that the vector is unable to transduce photoreceptor cells by entering via
the photoreceptor cell segments. Rather, the vector particles interact with the cell-body in
the outer nuclear layer in order to establish transduction. Meanwhile, the barrier formed
by the outer limiting membrane results in the inability of the HDAd vector to travel into
the outer nuclear layer. In other words, the lack of transduction may result from a lack of
access to the susceptible parts of the retina.
If we are to accept the premise that physical injury provides the vector with access to the
neural retina, one must then question why the injection site, where there is clearly
physical damage, does not also exhibit the same degree of transduction. A 33 gauge
needle as used in our sub-retinal injections has an outer diameter of 0.21 mm or 210 µm.
Although not all eyes were examined at the same distance between sections, the eye
shown in Section 3.4.3.1, Figure 18 was sectioned at 100 µm spacing with no noticeable
transduction patch. None of the other eyes demonstrated neural retinal transduction at the
expected injection site. As such, it’s highly unlikely that the injection sites have been
repeatedly missed in all eyes.
In order to test this injury hypothesis, it would be ideal to be able to precisely place the
needle within the neural retina, between the two limiting membranes, and inject the
CAG-EGFP vector, keeping in mind that the lack of space will not allow for the same
volume to be delivered as in the sub-retinal space. However, as the equipment and
171
methods employed in our study did not allow for precision guidance into the retina,
especially in the depth of needle penetration, it was impossible to conduct such a study.
Alternatively, it may be possible to purposely damage the retina by scratching it with the
needle tip. Care would have to be taken to ensure the location of the injury is precise
enough that it can be located when sectioning the animal.
It may be possible to determine whether accidental retinal injury had occurred by
sacrificing the animal shortly after injection to look for evidence of retinal damage away
from the injection site. However, this poses two separate problems. The first is that a
short incubation after injection would not allow for sufficient time for transduced cells to
express detectable levels of EGFP. In addition, the sub-retinal injection will have caused
retinal detachment as a result of the injected material. Given a short incubation time, the
material will not have been fully absorbed and the retinal detachment will not have been
resolved. As a result, when cryosectioned, the detached neural retina will likely break as
it is unsupported by the rest of the eye and is not supported in the sub-retinal space by
freezing media. Therefore, a retinal break would not necessarily be indicative of retinal
injury.
In addition, it may be possible to stain for the morphology of the outer limiting
membrane and inner limiting membrane using anti-GFAP [105] and anti-CD44 [28]
antibodies respectively. Doing so on sections that demonstrate neural retina transduction
may reveal damage to the inner and/or outer limiting membrane in the immediate vicinity
of the transduced patch, thus validating the theory that such areas are caused by injury.
While recovery of the membranes is likely to have occurred by the time the animals are
172
sacrificed, evidence of the previous damage in the membrane structures may still be
visible, although no disorganization of the nuclear layers could be observed.
Finally, as an interventional rather than observational study, we propose the injection of
α-aminoadipic acid (AAA) with the vector. AAA has been documented as a method by
which the outer limiting membrane can be disrupted to allow for increased integration of
transplanted stem cell precursors from the sub-retinal space [224]. Therefore, the
injection of AAA before or along with the vector would allow for the transient, reversible
disruption of the outer limiting membrane, thus providing access for the vector to
transduce the photoreceptors [92]. Because of the differences between the size and
diffusion abilities of stem cells versus the comparatively small HDAd particle, the
application time and dose may differ in this application and requires refinement beyond
that which was previously documented. The finding that the outer limiting membrane
was an impediment to movement of materials between the sub-retinal space and the outer
nuclear layer is further evidence for the possibility that our vector was unable to access
the photoreceptor cells from the sub-retinal space. Successful disruption of the outer
limiting membrane with AAA should conclusively prove or disprove the theory that the
membrane is preventing transduction of the neural retina.
The presence of these patches is encouraging as it gives strong evidence that the lack of
transduction of the neural retina is the result of deficiencies in the surgical delivery
technique rather than vector incompatibility. Furthermore, the presence of patches where
only the photoreceptor cells are transduced when Rho-EGFP vectors were injected
provides confirmation that the rhodopsin promoter is photoreceptor cell specific in vivo.
173
5. Conclusion
It is clear from the results that helper-dependent adenoviral vectors are highly effective
for delivering genes to the RPE at a very low dose, resulting in prolonged expression
lasting for a minimum of 4 months. However, it is disappointing that effective,
widespread transduction of the neural retina could not be achieved using our methods.
Based on the presence of the patches of transduction observed, there appears to be an
issue with access to the relevant cells by the vector rather than the ability of the vector to
transduce such cells. With a method of delivery other than sub-retinal injection, it may be
possible to transduce the neural retina. The results with Rho-EGFP vector have shown
that if a method of delivery could be found to introduce the vector to the neural retina,
the IRBP enhancer – rhodopsin promoter construct is capable of limiting gene expression
to only the photoreceptors. Additionally, the results have shown the helper-dependent
adenoviral vectors can deliver the large ABCA4 expression cassette that is well beyond
the capacity of AAV vectors.
Moving forward in the application of helper-dependent adenoviral vectors in retinal gene
therapy, the focus should shift towards the use of this unique vector to deliver genes to
the RPE as the results herein have proven HDAd to be highly effective with long
duration of transgene expression. While work using other vectors to treat the RPE may
have a lead, the performance observed by others is significantly inferior to the data
presented herein and helper-dependent adenoviral vectors should not be discounted.
The data presented herein demonstrates that HDAd is a powerful vector for the delivery
of large genes and can completely transduce the RPE of the retina at high efficacy using
174
very low doses. If an alternative method of delivery can be developed for introducing the
vector to the neural retina, it would allow for the treatment of retinal diseases that involve
genes too large to be packaged in AAV. Such progress in the study of HDAd would give
hope to the patients of a variety of retinal degenerative diseases for whom there is no
present cure.
175
6. References
1. Gene Therapy Clinical Trials World Wide. 2014 [cited 2014 2014-08-18]; Available from: http://www.abedia.com/wiley/vectors.php.
2. Al-Dosari, M.S. and X. Gao, Nonviral gene delivery: principle, limitations, and recent progress. The AAPS journal, 2009. 11(4): p. 671-81.
3. Albini, A., et al., Hypomethylation of the interphotoreceptor retinoid-binding protein (IRBP) promotor and first exon is linked to expression of the gene. Nucleic Acids Res, 1990. 18(17): p. 5181-7.
4. Allocca, M., et al., Serotype-dependent packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice. J Clin Invest, 2008. 118(5): p. 1955-64.
5. Arnberg, N., et al., Adenovirus type 37 binds to cell surface sialic acid through a charge-dependent interaction. Virology, 2002. 302(1): p. 33-43.
6. Aurnhammer, C., et al., Universal real-time PCR for the detection and quantification of adeno-associated virus serotype 2-derived inverted terminal repeat sequences. Human gene therapy methods, 2012. 23(1): p. 18-28.
7. Bai, M., B. Harfe, and P. Freimuth, Mutations that alter an Arg-Gly-Asp (RGD) sequence in the adenovirus type 2 penton base protein abolish its cell-rounding activity and delay virus reproduction in flat cells. Journal of virology, 1993. 67(9): p. 5198-205.
8. Batten, M.L., et al., Pharmacological and rAAV gene therapy rescue of visual functions in a blind mouse model of Leber congenital amaurosis. PLoS medicine, 2005. 2(11): p. e333.
9. Bennett, J., et al., AAV2 gene therapy readministration in three adults with congenital blindness. Science translational medicine, 2012. 4(120): p. 120ra15.
10. Bennett, J., D. Sun, and K. Kariko, Sequence analysis of the 5.34-kb 5' flanking region of the human rhodopsin-encoding gene. Gene, 1995. 167(1-2): p. 317-20.
11. Bennett, J., et al., Adenovirus vector-mediated in vivo gene transfer into adult murine retina. Investigative ophthalmology & visual science, 1994. 35(5): p. 2535-42.
176
12. Bergelson, J.M., et al., Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science, 1997. 275(5304): p. 1320-3.
13. Bergelson, J.M., et al., Identification of the integrin VLA-2 as a receptor for echovirus 1. Science, 1992. 255(5052): p. 1718-20.
14. Bianchi, M., et al., A potent enhancer element in the 5'-UTR intron is crucial for transcriptional regulation of the human ubiquitin C gene. Gene, 2009. 448(1): p. 88-101.
15. Binley, K., et al., Transduction of photoreceptors with equine infectious anemia virus lentiviral vectors: safety and biodistribution of StarGen for Stargardt disease. Investigative ophthalmology & visual science, 2013. 54(6): p. 4061-71.
16. Bora, N.S., et al., Differential expression of the complement regulatory proteins in the human eye. Investigative ophthalmology & visual science, 1993. 34(13): p. 3579-84.
17. Borst, D.E., et al., Structural characterization and comparison of promoter activity of mouse and bovine interphotoreceptor retinoid-binding protein (IRBP) gene 5' flanking regions in WERI, Y79, chick retina cells, and transgenic mice. Curr Eye Res, 2001. 23(1): p. 20-32.
18. Boye, S.E., et al., A comprehensive review of retinal gene therapy. Molecular therapy : the journal of the American Society of Gene Therapy, 2013. 21(3): p. 509-19.
19. Brown, M., H.L. Wilson-Friesen, and F. Doane, A block in release of progeny virus and a high particle-to-infectious unit ratio contribute to poor growth of enteric adenovirus types 40 and 41 in cell culture. Journal of virology, 1992. 66(5): p. 3198-205.
20. Brunner, S., et al., Cell cycle dependence of gene transfer by lipoplex, polyplex and recombinant adenovirus. Gene therapy, 2000. 7(5): p. 401-7.
21. Bryant, L.M., et al., Lessons learned from the clinical development and market authorization of Glybera. Human gene therapy. Clinical development, 2013. 24(2): p. 55-64.
22. Bukrinsky, M.I. and O.K. Haffar, HIV-1 nuclear import: in search of a leader. Frontiers in bioscience : a journal and virtual library, 1999. 4: p. D772-81.
177
23. Bunt-Milam, A.H. and J.C. Saari, Immunocytochemical localization of two retinoid-binding proteins in vertebrate retina. The Journal of cell biology, 1983. 97(3): p. 703-12.
24. Campos, S.K. and M.A. Barry, Current advances and future challenges in Adenoviral vector biology and targeting. Current gene therapy, 2007. 7(3): p. 189-204.
25. Cashman, S.M., L. McCullough, and R. Kumar-Singh, Improved retinal transduction in vivo and photoreceptor-specific transgene expression using adenovirus vectors with modified penton base. Mol Ther, 2007. 15(9): p. 1640-6.
26. Cashman, S.M., D.J. Morris, and R. Kumar-Singh, Adenovirus type 5 pseudotyped with adenovirus type 37 fiber uses sialic acid as a cellular receptor. Virology, 2004. 324(1): p. 129-39.
27. Chai, L. and J.E. Morris, Distribution of heparan sulfate proteoglycans in embryonic chicken neural retina and isolated inner limiting membrane. Current eye research, 1994. 13(9): p. 669-77.
28. Chaitin, M.H., H.S. Wortham, and A.M. Brun-Zinkernagel, Immunocytochemical localization of CD44 in the mouse retina. Experimental eye research, 1994. 58(3): p. 359-65.
29. Chaudhuri, S.R., et al., Modulation of adenoviral transduction in vitro and in vivo by hyaluronan and its receptor CD44. Mol Ther, 2007. 15(3): p. 566-70.
30. Chen, Y., et al., Systems pharmacology identifies drug targets for Stargardt disease-associated retinal degeneration. The Journal of clinical investigation, 2013. 123(12): p. 5119-34.
31. Chesnoy, S. and L. Huang, Structure and function of lipid-DNA complexes for gene delivery. Annual review of biophysics and biomolecular structure, 2000. 29: p. 27-47.
32. Chiu, C.Y., et al., Structural analysis of a fiber-pseudotyped adenovirus with ocular tropism suggests differential modes of cell receptor interactions. Journal of virology, 2001. 75(11): p. 5375-80.
33. Choi, T., et al., A generic intron increases gene expression in transgenic mice. Mol Cell Biol, 1991. 11(6): p. 3070-4.
34. Cideciyan, A.V., et al., Human gene therapy for RPE65 isomerase deficiency activates the retinoid cycle of vision but with slow rod kinetics. Proc Natl Acad Sci U S A, 2008. 105(39): p. 15112-7.
178
35. Cideciyan, A.V., et al., Rod and cone visual cycle consequences of a null mutation in the 11-cis-retinol dehydrogenase gene in man. Visual neuroscience, 2000. 17(5): p. 667-78.
36. Cideciyan, A.V., et al., Vision 1 year after gene therapy for Leber's congenital amaurosis. The New England journal of medicine, 2009. 361(7): p. 725-7.
37. Ciuffi, A., Mechanisms governing lentivirus integration site selection. Current gene therapy, 2008. 8(6): p. 419-29.
38. Coburn, J., S.W. Barthold, and J.M. Leong, Diverse Lyme disease spirochetes bind integrin alpha IIb beta 3 on human platelets. Infection and immunity, 1994. 62(12): p. 5559-67.
39. Cohen, C.J., et al., The coxsackievirus and adenovirus receptor is a transmembrane component of the tight junction. Proceedings of the National Academy of Sciences of the United States of America, 2001. 98(26): p. 15191-6.
40. Cohen, D. and I. Nir, Sialic acid on the surface of photoreceptors and pigment epithelium in RCS rats. Investigative ophthalmology & visual science, 1984. 25(11): p. 1342-5.
41. Commons, W. File:Eyesection.svg. 2014 [cited 2014 2014-07-02]; Image of eye section]. Available from: http://commons.wikimedia.org/wiki/File:Eyesection.svg.
42. commons, W. File:Visual cycle v2.png. 2014 [cited 2014 2014-07-01]; visual cycle].
43. Coura Rdos, S. and N.B. Nardi, The state of the art of adeno-associated virus-based vectors in gene therapy. Virology journal, 2007. 4: p. 99.
44. Cuevas, P., et al., Treatment of Stargardt disease with dobesilate. BMJ case reports, 2012. 2012.
45. Cwerman-Thibault, H., et al., Gene therapy for mitochondrial diseases: Leber Hereditary Optic Neuropathy as the first candidate for a clinical trial. Comptes rendus biologies, 2014. 337(3): p. 193-206.
46. D'Ambrosio, E., et al., Neutralizing antibodies against 33 human adenoviruses in normal children in Rome. The Journal of hygiene, 1982. 89(1): p. 155-61.
179
47. Davison, A.J., M. Benko, and B. Harrach, Genetic content and evolution of adenoviruses. The Journal of general virology, 2003. 84(Pt 11): p. 2895-908.
48. de Silva, S. and W.J. Bowers, Herpes Virus Amplicon Vectors. Viruses, 2009. 1(3): p. 594-629.
49. Dechecchi, M.C., et al., Heparan sulfate glycosaminoglycans are receptors sufficient to mediate the initial binding of adenovirus types 2 and 5. Journal of virology, 2001. 75(18): p. 8772-80.
50. Dechecchi, M.C., et al., Heparan sulfate glycosaminoglycans are involved in adenovirus type 5 and 2-host cell interactions. Virology, 2000. 268(2): p. 382-90.
51. Deng, W.T., et al., Tyrosine-mutant AAV8 delivery of human MERTK provides long-term retinal preservation in RCS rats. Investigative ophthalmology & visual science, 2012. 53(4): p. 1895-904.
52. Doyle, J.W., R.K. Dowgiert, and S.M. Buzney, Retinoic acid metabolism in cultured retinal pigment epithelial cells. Investigative ophthalmology & visual science, 1995. 36(3): p. 708-17.
53. Duguid, J.G., et al., A physicochemical approach for predicting the effectiveness of peptide-based gene delivery systems for use in plasmid-based gene therapy. Biophysical journal, 1998. 74(6): p. 2802-14.
54. Dureau, P., et al., Quantitative analysis of subretinal injections in the rat. Graefes Arch Clin Exp Ophthalmol, 2000. 238(7): p. 608-14.
55. Durieux, A.C., et al., In vivo gene electrotransfer into skeletal muscle: effects of plasmid DNA on the occurrence and extent of muscle damage. The journal of gene medicine, 2004. 6(7): p. 809-16.
56. Eldred, G.E. and M.R. Lasky, Retinal age pigments generated by self-assembling lysosomotropic detergents. Nature, 1993. 361(6414): p. 724-6.
57. Ellis, J., Silencing and variegation of gammaretrovirus and lentivirus vectors. Human gene therapy, 2005. 16(11): p. 1241-6.
58. Engelhardt, J.F., et al., Ablation of E2A in recombinant adenoviruses improves transgene persistence and decreases
180
inflammatory response in mouse liver. Proceedings of the National Academy of Sciences of the United States of America, 1994. 91(13): p. 6196-200.
59. Engelman, A., The roles of cellular factors in retroviral integration. Current topics in microbiology and immunology, 2003. 281: p. 209-38.
60. Ewert, K., et al., Cationic lipid-DNA complexes for gene therapy: understanding the relationship between complex structure and gene delivery pathways at the molecular level. Current medicinal chemistry, 2004. 11(2): p. 133-49.
61. Felgner, P.L., et al., Lipofection: a highly efficient, lipid-mediated DNA-transfection procedure. Proceedings of the National Academy of Sciences of the United States of America, 1987. 84(21): p. 7413-7.
62. Ferguson, T.A., J. Choi, and D.R. Green, Armed response: how dying cells influence T-cell functions. Immunological reviews, 2011. 241(1): p. 77-88.
63. Fett, A.L., et al., Immunohistochemical localization of complement regulatory proteins in the human retina. Histology and histopathology, 2012. 27(3): p. 357-64.
64. Fields, B.N., D.M. Knipe, and P.M. Howley, Fields virology. 5th ed2007, Philadelphia: Wolters Kluwer Health/Lippincott Williams & Wilkins.
65. Fisher, K.J., et al., Recombinant adenovirus deleted of all viral genes for gene therapy of cystic fibrosis. Virology, 1996. 217(1): p. 11-22.
66. Fregien, N. and N. Davidson, Activating elements in the promoter region of the chicken beta-actin gene. Gene, 1986. 48(1): p. 1-11.
67. Fulton, A.B., REtinal dystrophies and degeneration. Archives of ophthalmology, 1989. 107(12): p. 1730-1731.
68. Gaggar, A., D.M. Shayakhmetov, and A. Lieber, CD46 is a cellular receptor for group B adenoviruses. Nature medicine, 2003. 9(11): p. 1408-12.
69. Gallaher, S.D. and A.J. Berk, A rapid Q-PCR titration protocol for adenovirus and helper-dependent adenovirus vectors that produces biologically relevant results. Journal of virological methods, 2013. 192(1-2): p. 28-38.
181
70. Goldman, M.J. and J.M. Wilson, Expression of alpha v beta 5 integrin is necessary for efficient adenovirus-mediated gene transfer in the human airway. Journal of virology, 1995. 69(10): p. 5951-8.
71. Gorziglia, M.I., et al., Elimination of both E1 and E2 from adenovirus vectors further improves prospects for in vivo human gene therapy. Journal of virology, 1996. 70(6): p. 4173-8.
72. Graham, F.L. and L. Prevec, Methods for construction of adenovirus vectors. Molecular biotechnology, 1995. 3(3): p. 207-20.
73. Grant, K.G., et al., Engineering cell lines for production of replication defective HSV-1 gene therapy vectors. Biotechnology and bioengineering, 2009. 102(4): p. 1087-97.
74. Grieger, J.C. and R.J. Samulski, Adeno-associated virus vectorology, manufacturing, and clinical applications. Methods in enzymology, 2012. 507: p. 229-54.
75. Griffith, T.S., et al., CD95-induced apoptosis of lymphocytes in an immune privileged site induces immunological tolerance. Immunity, 1996. 5(1): p. 7-16.
76. Gunther-Ausborn, S., A. Praetor, and T. Stegmann, Inhibition of influenza-induced membrane fusion by lysophosphatidylcholine. The Journal of biological chemistry, 1995. 270(49): p. 29279-85.
77. Hacein-Bey-Abina, S., et al., Insertional oncogenesis in 4 patients after retrovirus-mediated gene therapy of SCID-X1. The Journal of clinical investigation, 2008. 118(9): p. 3132-42.
78. Han, Z., et al., DNA nanoparticle-mediated ABCA4 delivery rescues Stargardt dystrophy in mice. The Journal of clinical investigation, 2012.
79. Han, Z., S.M. Conley, and M.I. Naash, Gene Therapy for Stargardt Disease Associated with ABCA4 Gene. Advances in experimental medicine and biology, 2014. 801: p. 719-24.
80. Hargrave, P.A., Rhodopsin structure, function, and topography the Friedenwald lecture. Investigative ophthalmology & visual science, 2001. 42(1): p. 3-9.
81. Hauswirth, W.W., et al., Treatment of leber congenital amaurosis due to RPE65 mutations by ocular subretinal injection of adeno-associated virus gene vector: short-term
182
results of a phase I trial. Human gene therapy, 2008. 19(10): p. 979-90.
82. Hecht, S., S. Shlaer, and M.H. Pirenne, Energy, Quanta, and Vision. The Journal of general physiology, 1942. 25(6): p. 819-40.
83. Hirsch, M.L., M. Agbandje-McKenna, and R.J. Samulski, Little vector, big gene transduction: fragmented genome reassembly of adeno-associated virus. Molecular therapy : the journal of the American Society of Gene Therapy, 2010. 18(1): p. 6-8.
84. Holz, F.G., et al., Inhibition of lysosomal degradative functions in RPE cells by a retinoid component of lipofuscin. Investigative ophthalmology & visual science, 1999. 40(3): p. 737-43.
85. Honda, T., et al., The coxsackievirus-adenovirus receptor protein as a cell adhesion molecule in the developing mouse brain. Brain research. Molecular brain research, 2000. 77(1): p. 19-28.
86. Hosoya, K. and M. Tachikawa, The inner blood-retinal barrier: molecular structure and transport biology. Advances in experimental medicine and biology, 2012. 763: p. 85-104.
87. Howarth, J.L., Y.B. Lee, and J.B. Uney, Using viral vectors as gene transfer tools (Cell Biology and Toxicology Special Issue: ETCS-UK 1 day meeting on genetic manipulation of cells). Cell biology and toxicology, 2010. 26(1): p. 1-20.
88. Hynes, R.O., Integrins: versatility, modulation, and signaling in cell adhesion. Cell, 1992. 69(1): p. 11-25.
89. Isberg, R.R. and G.T. Van Nhieu, The mechanism of phagocytic uptake promoted by invasin-integrin interaction. Trends in cell biology, 1995. 5(3): p. 120-4.
90. Ishibashi, Y., S. Claus, and D.A. Relman, Bordetella pertussis filamentous hemagglutinin interacts with a leukocyte signal transduction complex and stimulates bacterial adherence to monocyte CR3 (CD11b/CD18). The Journal of experimental medicine, 1994. 180(4): p. 1225-33.
91. Ishida, K., et al., Participation of pigment epithelium in ocular immune privilege. 3. Epithelia cultured from iris, ciliary body, and retina suppress T-cell activation by partially non-overlapping mechanisms. Ocular immunology and inflammation, 2003. 11(2): p. 91-105.
183
92. Johnson, T.V., N.D. Bull, and K.R. Martin, Identification of barriers to retinal engraftment of transplanted stem cells. Investigative ophthalmology & visual science, 2010. 51(2): p. 960-70.
93. Kaplan, H.J. and J.W. Streilein, Immune response to immunization via the anterior chamber of the eye. I. F. lymphocyte-induced immune deviation. Journal of immunology, 1977. 118(3): p. 809-14.
94. Kaplan, J., et al., A gene for Stargardt's disease (fundus flavimaculatus) maps to the short arm of chromosome 1. Nature genetics, 1993. 5(3): p. 308-11.
95. Kaufman, Y., L. Ma, and I. Washington, Deuterium enrichment of vitamin A at the C20 position slows the formation of detrimental vitamin A dimers in wild-type rodents. The Journal of biological chemistry, 2011. 286(10): p. 7958-65.
96. Kawazoe, Y., et al., Retinoic acid from retinal pigment epithelium induces T regulatory cells. Experimental eye research, 2012. 94(1): p. 32-40.
97. Kay, M.A., J.C. Glorioso, and L. Naldini, Viral vectors for gene therapy: the art of turning infectious agents into vehicles of therapeutics. Nature medicine, 2001. 7(1): p. 33-40.
98. Khani, S.C., et al., AAV-mediated expression targeting of rod and cone photoreceptors with a human rhodopsin kinase promoter. Invest Ophthalmol Vis Sci, 2007. 48(9): p. 3954-61.
99. Kobiler, O., et al., Virus strategies for passing the nuclear envelope barrier. Nucleus, 2012. 3(6): p. 526-39.
100. Kochanek, S., et al., A new adenoviral vector: Replacement of all viral coding sequences with 28 kb of DNA independently expressing both full-length dystrophin and beta-galactosidase. Proceedings of the National Academy of Sciences of the United States of America, 1996. 93(12): p. 5731-6.
101. Koehler, D.R., et al., A human epithelium-specific vector optimized in rat pneumocytes for lung gene therapy. Pediatr Res, 2000. 48(2): p. 184-90.
102. Koehler, D.R., et al., Aerosol delivery of an enhanced helper-dependent adenovirus formulation to rabbit lung using an intratracheal catheter. The journal of gene medicine, 2005. 7(11): p. 1409-20.
184
103. Koirala, A., S.M. Conley, and M.I. Naash, A review of therapeutic prospects of non-viral gene therapy in the retinal pigment epithelium. Biomaterials, 2013. 34(29): p. 7158-67.
104. Kolb, H., Circuitry for Rod Signals through the Retina, in Webvision: The Organization of the Retina and Visual System, H. Kolb, E. Fernandez, and R. Nelson, Editors. 1995: Salt Lake City (UT).
105. Kolb, H., Glial Cells of the Retina, in Webvision: The Organization of the Retina and Visual System, H. Kolb, E. Fernandez, and R. Nelson, Editors. 1995: Salt Lake City (UT).
106. Kolb, H., Gross Anatomy of the Eye, in Webvision: The Organization of the Retina and Visual System, H. Kolb, E. Fernandez, and R. Nelson, Editors. 1995: Salt Lake City (UT).
107. Kolb, H., Photoreceptors, in Webvision: The Organization of the Retina and Visual System, H. Kolb, E. Fernandez, and R. Nelson, Editors. 1995: Salt Lake City (UT).
108. Kolb, H., Simple Anatomy of the Retina, in Webvision: The Organization of the Retina and Visual System, H. Kolb, E. Fernandez, and R. Nelson, Editors. 1995: Salt Lake City (UT).
109. Kong, J., et al., Correction of the disease phenotype in the mouse model of Stargardt disease by lentiviral gene therapy. Gene Ther, 2008. 15(19): p. 1311-20.
110. Kremer, K.L., et al., Gene delivery to airway epithelial cells in vivo: a direct comparison of apical and basolateral transduction strategies using pseudotyped lentivirus vectors. The journal of gene medicine, 2007. 9(5): p. 362-8.
111. Kreppel, F., et al., Long-term transgene expression in the RPE after gene transfer with a high-capacity adenoviral vector. Investigative ophthalmology & visual science, 2002. 43(6): p. 1965-70.
112. Kretschmann, U., et al., Multifocal electroretinography in patients with Stargardt's macular dystrophy. The British journal of ophthalmology, 1998. 82(3): p. 267-75.
113. Krougliak, V. and F.L. Graham, Development of cell lines capable of complementing E1, E4, and protein IX defective adenovirus type 5 mutants. Human gene therapy, 1995. 6(12): p. 1575-86.
185
114. Lai, Y., Y. Yue, and D. Duan, Evidence for the failure of adeno-associated virus serotype 5 to package a viral genome > or = 8.2 kb. Mol Ther, 2009. 18(1): p. 75-9.
115. Lamartina, S., et al., Helper-dependent adenovirus for the gene therapy of proliferative retinopathies: stable gene transfer, regulated gene expression and therapeutic efficacy. J Gene Med, 2007. 9(10): p. 862-74.
116. Landers, R.A. and J.G. Hollyfield, Proteoglycans in the mouse interphotoreceptor matrix. VI. Evidence for photoreceptor synthesis of chondroitin sulfate proteoglycan using genetically fractionated retinas. Experimental eye research, 1992. 55(2): p. 345-56.
117. Lee, C.A., E. Berntorp, and K. Hoots, Textbook of hemophilia. 2nd ed2010, Chichester, West Sussex, UK ; Hoboken, NJ: Wiley-Blackwell. xii, 464 p.
118. Lee, S.A., et al., Overproduction of bioactive retinoic acid in cells expressing disease-associated mutants of retinol dehydrogenase 12. The Journal of biological chemistry, 2007. 282(49): p. 35621-8.
119. Lem, J., et al., Tissue-specific and developmental regulation of rod opsin chimeric genes in transgenic mice. Neuron, 1991. 6(2): p. 201-10.
120. Lentz, T.B., S.J. Gray, and R.J. Samulski, Viral vectors for gene delivery to the central nervous system. Neurobiology of disease, 2012. 48(2): p. 179-88.
121. Limberis, M., et al., Recovery of airway cystic fibrosis transmembrane conductance regulator function in mice with cystic fibrosis after single-dose lentivirus-mediated gene transfer. Human gene therapy, 2002. 13(16): p. 1961-70.
122. Lin, H. and D.O. Clegg, Integrin alphavbeta5 participates in the binding of photoreceptor rod outer segments during phagocytosis by cultured human retinal pigment epithelium. Investigative ophthalmology & visual science, 1998. 39(9): p. 1703-12.
123. Liu, C., et al., Lentiviral airway gene transfer in lungs of mice and sheep: successes and challenges. The journal of gene medicine, 2010. 12(8): p. 647-58.
186
124. Logan, S. and R.E. Anderson, Dominant Stargardt Macular Dystrophy (STGD3) and ELOVL4. Advances in experimental medicine and biology, 2014. 801: p. 447-53.
125. Lutschg, V., et al., Chemotactic antiviral cytokines promote infectious apical entry of human adenovirus into polarized epithelial cells. Nature communications, 2011. 2: p. 391.
126. MacLaren, R.E., et al., Retinal gene therapy in patients with choroideremia: initial findings from a phase 1/2 clinical trial. Lancet, 2014. 383(9923): p. 1129-37.
127. Maetzig, T., et al., Gammaretroviral vectors: biology, technology and application. Viruses, 2011. 3(6): p. 677-713.
128. Magin-Lachmann, C., et al., In vitro and in vivo delivery of intact BAC DNA -- comparison of different methods. The journal of gene medicine, 2004. 6(2): p. 195-209.
129. Maguire, A.M., et al., Age-dependent effects of RPE65 gene therapy for Leber's congenital amaurosis: a phase 1 dose-escalation trial. Lancet, 2009. 374(9701): p. 1597-605.
130. Maguire, A.M., et al., Safety and efficacy of gene transfer for Leber's congenital amaurosis. The New England journal of medicine, 2008. 358(21): p. 2240-8.
131. Mallam, J.N., et al., Efficient gene transfer into retinal cells using adenoviral vectors: dependence on receptor expression. Invest Ophthalmol Vis Sci, 2004. 45(6): p. 1680-7.
132. Manservigi, R., R. Argnani, and P. Marconi, HSV Recombinant Vectors for Gene Therapy. The open virology journal, 2010. 4: p. 123-56.
133. Marconi, P., R. Manservigi, and A.L. Epstein, HSV-1-derived helper-independent defective vectors, replicating vectors and amplicon vectors, for the treatment of brain diseases. Current opinion in drug discovery & development, 2010. 13(2): p. 169-83.
134. Mathias, P., M. Galleno, and G.R. Nemerow, Interactions of soluble recombinant integrin alphav beta5 with human adenoviruses. Journal of virology, 1998. 72(11): p. 8669-75.
135. Mathias, P., et al., Multiple adenovirus serotypes use alpha v integrins for infection. Journal of virology, 1994. 68(10): p. 6811-4.
136. May, L.A., C.M. Lai, and P.E. Rakoczy, In vitro comparison studies of truncated rhodopsin promoter fragments from various
187
species in human cell lines. Clin Experiment Ophthalmol, 2003. 31(5): p. 445-50.
137. McLaughlin, B.J., et al., Novel role for a complement regulatory protein (CD46) in retinal pigment epithelial adhesion. Investigative ophthalmology & visual science, 2003. 44(8): p. 3669-74.
138. Medina-Kauwe, L.K., Endocytosis of adenovirus and adenovirus capsid proteins. Advanced drug delivery reviews, 2003. 55(11): p. 1485-96.
139. Mitani, K., et al., Rescue, propagation, and partial purification of a helper virus-dependent adenovirus vector. Proceedings of the National Academy of Sciences of the United States of America, 1995. 92(9): p. 3854-8.
140. Mittereder, N., K.L. March, and B.C. Trapnell, Evaluation of the concentration and bioactivity of adenovirus vectors for gene therapy. Journal of virology, 1996. 70(11): p. 7498-509.
141. Miyazaki, J., et al., Expression vector system based on the chicken beta-actin promoter directs efficient production of interleukin-5. Gene, 1989. 79(2): p. 269-77.
142. Miyoshi, H., et al., Development of a self-inactivating lentivirus vector. Journal of virology, 1998. 72(10): p. 8150-7.
143. Mizuguchi, H. and T. Hayakawa, Adenovirus vectors containing chimeric type 5 and type 35 fiber proteins exhibit altered and expanded tropism and increase the size limit of foreign genes. Gene, 2002. 285(1-2): p. 69-77.
144. Molday, R.S., et al., Binding of N-retinylidene-PE to ABCA4 and a model for its transport across membranes. Adv Exp Med Biol, 2006. 572: p. 465-70.
145. Molday, R.S., M. Zhong, and F. Quazi, The role of the photoreceptor ABC transporter ABCA4 in lipid transport and Stargardt macular degeneration. Biochim Biophys Acta, 2009. 1791(7): p. 573-83.
146. Molnar, M.J., et al., Factors influencing the efficacy, longevity, and safety of electroporation-assisted plasmid-based gene transfer into mouse muscles. Molecular therapy : the journal of the American Society of Gene Therapy, 2004. 10(3): p. 447-55.
147. Mori, K., et al., Intraocular adenoviral vector-mediated gene transfer in proliferative retinopathies. Investigative ophthalmology & visual science, 2002. 43(5): p. 1610-5.
188
148. Mucida, D. and H. Cheroutre, TGFbeta and retinoic acid intersect in immune-regulation. Cell adhesion & migration, 2007. 1(3): p. 142-4.
149. Muller, G., et al., Interleukin-10-treated dendritic cells modulate immune responses of naive and sensitized T cells in vivo. The Journal of investigative dermatology, 2002. 119(4): p. 836-41.
150. Murillo-Lopez, F., et al., Proteoglycan synthesis in cultures of murine retinal neurons and photoreceptors. Cellular and molecular neurobiology, 1991. 11(6): p. 579-91.
151. Needham, L.K., R. Adler, and A.T. Hewitt, Proteoglycan synthesis in flat cell-free cultures of chick embryo retinal neurons and photoreceptors. Developmental biology, 1988. 126(2): p. 304-14.
152. Nemerow, G.R., et al., Insights into adenovirus host cell interactions from structural studies. Virology, 2009. 384(2): p. 380-8.
153. Neumann, E., et al., Gene transfer into mouse lyoma cells by electroporation in high electric fields. The EMBO journal, 1982. 1(7): p. 841-5.
154. Ng, P., R.J. Parks, and F.L. Graham, Preparation of helper-dependent adenoviral vectors. Methods in molecular medicine, 2002. 69: p. 371-88.
155. Nicoud, M., et al., Development of photoreceptor-specific promoters and their utility to investigate EIAV lentiviral vector mediated gene transfer to photoreceptors. J Gene Med, 2007. 9(12): p. 1015-23.
156. Niwa, H., K. Yamamura, and J. Miyazaki, Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene, 1991. 108(2): p. 193-9.
157. Palfi, A., et al., Adeno-associated virus-mediated rhodopsin replacement provides therapeutic benefit in mice with a targeted disruption of the rhodopsin gene. Hum Gene Ther. 21(3): p. 311-23.
158. Palmer, D. and P. Ng, Improved system for helper-dependent adenoviral vector production. Mol Ther, 2003. 8(5): p. 846-52.
159. Palmiter, R.D., et al., Heterologous introns can enhance expression of transgenes in mice. Proc Natl Acad Sci U S A, 1991. 88(2): p. 478-82.
189
160. Parks, R.J., et al., A helper-dependent adenovirus vector system: removal of helper virus by Cre-mediated excision of the viral packaging signal. Proceedings of the National Academy of Sciences of the United States of America, 1996. 93(24): p. 13565-70.
161. Persson, B.D., et al., Adenovirus type 11 binding alters the conformation of its receptor CD46. Nature structural & molecular biology, 2007. 14(2): p. 164-6.
162. Philip, R., et al., Gene modification of primary tumor cells for active immunotherapy of human breast and ovarian cancer. Clinical cancer research : an official journal of the American Association for Cancer Research, 1996. 2(1): p. 59-68.
163. Pires, P., et al., Interaction of cationic liposomes and their DNA complexes with monocytic leukemia cells. Biochimica et biophysica acta, 1999. 1418(1): p. 71-84.
164. Rao, N.M. and V. Gopal, Cell biological and biophysical aspects of lipid-mediated gene delivery. Bioscience reports, 2006. 26(4): p. 301-24.
165. Raper, S.E., et al., Fatal systemic inflammatory response syndrome in a ornithine transcarbamylase deficient patient following adenoviral gene transfer. Molecular genetics and metabolism, 2003. 80(1-2): p. 148-58.
166. Recchia, A. and F. Mavilio, Site-specific integration by the adeno-associated virus rep protein. Current gene therapy, 2011. 11(5): p. 399-405.
167. Ren, S., et al., Low-volume jet injection for intradermal immunization in rabbits. BMC biotechnology, 2002. 2: p. 10.
168. Riveiro-Alvarez, R., et al., Frequency of ABCA4 mutations in 278 Spanish controls: an insight into the prevalence of autosomal recessive Stargardt disease. Br J Ophthalmol, 2009. 93(10): p. 1359-64.
169. Roelvink, P.W., I. Kovesdi, and T.J. Wickham, Comparative analysis of adenovirus fiber-cell interaction: adenovirus type 2 (Ad2) and Ad9 utilize the same cellular fiber receptor but use different binding strategies for attachment. Journal of virology, 1996. 70(11): p. 7614-21.
170. Roelvink, P.W., et al., The coxsackievirus-adenovirus receptor protein can function as a cellular attachment protein for
190
adenovirus serotypes from subgroups A, C, D, E, and F. Journal of virology, 1998. 72(10): p. 7909-15.
171. Roelvink, P.W., et al., Identification of a conserved receptor-binding site on the fiber proteins of CAR-recognizing adenoviridae. Science, 1999. 286(5444): p. 1568-71.
172. Rogers, S., Gene therapy: a potentially invaluable aid to medicine and mankind. Research communications in chemical pathology and pharmacology, 1971. 2(4): p. 587-600.
173. Rohr, U.P., et al., Fast and reliable titration of recombinant adeno-associated virus type-2 using quantitative real-time PCR. Journal of virological methods, 2002. 106(1): p. 81-8.
174. Roivainen, M., et al., RGD-dependent entry of coxsackievirus A9 into host cells and its bypass after cleavage of VP1 protein by intestinal proteases. Journal of virology, 1991. 65(9): p. 4735-40.
175. Rosewell, A., F. Vetrini, and P. Ng, Helper-Dependent Adenoviral Vectors. Journal of genetic syndrome & gene therapy, 2011. Suppl 5.
176. Ruggiero, L., et al., alphavbeta5 integrin-dependent diurnal phagocytosis of shed photoreceptor outer segments by RPE cells is independent of the integrin coreceptor transglutaminase-2. Advances in experimental medicine and biology, 2012. 723: p. 731-7.
177. Ruoslahti, E. and M.D. Pierschbacher, New perspectives in cell adhesion: RGD and integrins. Science, 1987. 238(4826): p. 491-7.
178. Sakai, M., et al., Hepatocyte-targeted gene transfer by combination of vascularly delivered plasmid DNA and in vivo electroporation. Gene therapy, 2005. 12(7): p. 607-16.
179. Sambrook, J. and D.W. Russell, Molecular cloning : a laboratory manual. 3rd ed2001, Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press.
180. Sandig, V., et al., Optimization of the helper-dependent adenovirus system for production and potency in vivo. Proc Natl Acad Sci U S A, 2000. 97(3): p. 1002-7.
181. Sato, T., T. Ishii, and Y. Okahata, In vitro gene delivery mediated by chitosan. effect of pH, serum, and molecular mass of chitosan on the transfection efficiency. Biomaterials, 2001. 22(15): p. 2075-80.
191
182. Scaria, A., D.T. Curiel, and M.A. Kay, Complementation of a human adenovirus early region 4 deletion mutant in 293 cells using adenovirus-polylysine-DNA complexes. Gene therapy, 1995. 2(4): p. 295-8.
183. Shayakhmetov, D.M. and A. Lieber, Dependence of adenovirus infectivity on length of the fiber shaft domain. Journal of virology, 2000. 74(22): p. 10274-86.
184. Simonelli, F., et al., Gene therapy for Leber's congenital amaurosis is safe and effective through 1.5 years after vector administration. Mol Ther, 2010. 18(3): p. 643-50.
185. Smith, A.J., et al., AAV-Mediated gene transfer slows photoreceptor loss in the RCS rat model of retinitis pigmentosa. Molecular therapy : the journal of the American Society of Gene Therapy, 2003. 8(2): p. 188-95.
186. Smith, J.G., et al., Adenovirus. Current topics in microbiology and immunology, 2010. 343: p. 195-224.
187. Smith, R.H., Adeno-associated virus integration: virus versus vector. Gene therapy, 2008. 15(11): p. 817-22.
188. Smith, T.A., et al., Receptor interactions involved in adenoviral-mediated gene delivery after systemic administration in non-human primates. Human gene therapy, 2003. 14(17): p. 1595-604.
189. Smith, T.A., et al., Adenovirus serotype 5 fiber shaft influences in vivo gene transfer in mice. Human gene therapy, 2003. 14(8): p. 777-87.
190. Sonoda, K.H., et al., The analysis of systemic tolerance elicited by antigen inoculation into the vitreous cavity: vitreous cavity-associated immune deviation. Immunology, 2005. 116(3): p. 390-9.
191. Sparrow, J.R. and M. Boulton, RPE lipofuscin and its role in retinal pathobiology. Experimental eye research, 2005. 80(5): p. 595-606.
192. Sparrow, J.R., K. Nakanishi, and C.A. Parish, The lipofuscin fluorophore A2E mediates blue light-induced damage to retinal pigmented epithelial cells. Investigative ophthalmology & visual science, 2000. 41(7): p. 1981-9.
193. Stargardt, K., Über familiäre, progressive Degeneration in der Maculagegend des Auges. Albrecht von Graefes Archiv für Ophthalmologie, 1909. 71(3): p. 534-550.
192
194. Sugita, S., et al., Retinal and ciliary body pigment epithelium suppress activation of T lymphocytes via transforming growth factor beta. Experimental eye research, 2006. 83(6): p. 1459-71.
195. Sugita, S., et al., Retinal pigment epithelium-derived CTLA-2alpha induces TGFbeta-producing T regulatory cells. Journal of immunology, 2008. 181(11): p. 7525-36.
196. Sugita, S., et al., B7+ iris pigment epithelial cells convert T cells into CTLA-4+, B7-expressing CD8+ regulatory T cells. Investigative ophthalmology & visual science, 2006. 47(12): p. 5376-84.
197. Sugita, S., et al., T-cell suppression by programmed cell death 1 ligand 1 on retinal pigment epithelium during inflammatory conditions. Investigative ophthalmology & visual science, 2009. 50(6): p. 2862-70.
198. Sullivan, J.M., Focus on Molecules: ABCA4 (ABCR) - An import-directed photoreceptor retinoid flipase. Exp Eye Res, 2009.
199. Sun, H., P.M. Smallwood, and J. Nathans, Biochemical defects in ABCR protein variants associated with human retinopathies. Nature genetics, 2000. 26(2): p. 242-6.
200. Sun, M., et al., Comparison of the capability of GDNF, BDNF, or both, to protect nigrostriatal neurons in a rat model of Parkinson's disease. Brain research, 2005. 1052(2): p. 119-29.
201. Suomalainen, M. and U.F. Greber, Uncoating of non-enveloped viruses. Current opinion in virology, 2013. 3(1): p. 27-33.
202. Suzuki, Y. and R. Craigie, The road to chromatin - nuclear entry of retroviruses. Nature reviews. Microbiology, 2007. 5(3): p. 187-96.
203. Sweigard, J.H., S. Cashman, and R. Kumar-Singh, Adenovirus Vectors Targeting Distinct Cell Types in the Retina. Invest Ophthalmol Vis Sci, 2009.
204. Sweigard, J.H., S.M. Cashman, and R. Kumar-Singh, Adenovirus-mediated delivery of CD46 attenuates the alternative complement pathway on RPE: implications for age-related macular degeneration. Gene therapy, 2011. 18(6): p. 613-21.
193
205. Tang, M.X., C.T. Redemann, and F.C. Szoka, Jr., In vitro gene delivery by degraded polyamidoamine dendrimers. Bioconjugate chemistry, 1996. 7(6): p. 703-14.
206. Thomsen, D.R., et al., Promoter-regulatory region of the major immediate early gene of human cytomegalovirus. Proceedings of the National Academy of Sciences of the United States of America, 1984. 81(3): p. 659-63.
207. Tomko, R.P., R. Xu, and L. Philipson, HCAR and MCAR: the human and mouse cellular receptors for subgroup C adenoviruses and group B coxsackieviruses. Proceedings of the National Academy of Sciences of the United States of America, 1997. 94(7): p. 3352-6.
208. Tschernutter, M., et al., Long-term preservation of retinal function in the RCS rat model of retinitis pigmentosa following lentivirus-mediated gene therapy. Gene therapy, 2005. 12(8): p. 694-701.
209. Tsybovsky, Y., et al., Posttranslational modifications of the photoreceptor-specific ABC transporter ABCA4. Biochemistry, 2011. 50(32): p. 6855-66.
210. Usui, Y., et al., Functional expression of B7H1 on retinal pigment epithelial cells. Experimental eye research, 2008. 86(1): p. 52-9.
211. van Veen, T., et al., Retinal photoreceptor neurons and pinealocytes accumulate mRNA for interphotoreceptor retinoid-binding protein (IRBP). FEBS letters, 1986. 208(1): p. 133-7.
212. VandenDriessche, T., D. Collen, and M.K. Chuah, Gene therapy for the hemophilias. Journal of thrombosis and haemostasis : JTH, 2003. 1(7): p. 1550-8.
213. Vannucci, L., et al., Viral vectors: a look back and ahead on gene transfer technology. The new microbiologica, 2013. 36(1): p. 1-22.
214. Vogel, B.E., et al., A novel integrin specificity exemplified by binding of the alpha v beta 5 integrin to the basic domain of the HIV Tat protein and vitronectin. The Journal of cell biology, 1993. 121(2): p. 461-8.
215. Vollrath, D., et al., Correction of the retinal dystrophy phenotype of the RCS rat by viral gene transfer of Mertk. Proceedings of the National Academy of Sciences of the United States of America, 2001. 98(22): p. 12584-9.
194
216. Von Seggern, D.J., et al., In vivo transduction of photoreceptors or ciliary body by intravitreal injection of pseudotyped adenoviral vectors. Molecular therapy : the journal of the American Society of Gene Therapy, 2003. 7(1): p. 27-34.
217. Walters, R.W., et al., Adenovirus fiber disrupts CAR-mediated intercellular adhesion allowing virus escape. Cell, 2002. 110(6): p. 789-99.
218. Wang, A., et al., Identification and characterization of human genes encoding Hprp3p and Hprp4p, interacting components of the spliceosome. Human molecular genetics, 1997. 6(12): p. 2117-26.
219. Wang, Q., X.C. Jia, and M.H. Finer, A packaging cell line for propagation of recombinant adenovirus vectors containing two lethal gene-region deletions. Gene therapy, 1995. 2(10): p. 775-83.
220. Wang, W., et al., Non-viral gene delivery methods. Current pharmaceutical biotechnology, 2013. 14(1): p. 46-60.
221. Wang, Y., et al., Limitations of encapsidation of recombinant self-complementary adeno-associated viral genomes in different serotype capsids and their quantitation. Human gene therapy methods, 2012. 23(4): p. 225-33.
222. Wendell, D.M., et al., The effect of jet parameters on jet injection. Conference proceedings : ... Annual International Conference of the IEEE Engineering in Medicine and Biology Society. IEEE Engineering in Medicine and Biology Society. Conference, 2006. 1: p. 5005-8.
223. Wenkel, H. and J.W. Streilein, Analysis of immune deviation elicited by antigens injected into the subretinal space. Investigative ophthalmology & visual science, 1998. 39(10): p. 1823-34.
224. West, E.L., et al., Pharmacological disruption of the outer limiting membrane leads to increased retinal integration of transplanted photoreceptor precursors. Experimental eye research, 2008. 86(4): p. 601-11.
225. Westenskow, P.D., T. Kurihara, and M. Friedlander, Utilizing Stem Cell-Derived RPE Cells as A Therapeutic Intervention for Age-Related Macular Degeneration. Advances in experimental medicine and biology, 2014. 801: p. 323-9.
195
226. White, G.C., 2nd, Gene therapy in hemophilia: clinical trials update. Thrombosis and haemostasis, 2001. 86(1): p. 172-7.
227. Wickham, T.J., M.E. Carrion, and I. Kovesdi, Targeting of adenovirus penton base to new receptors through replacement of its RGD motif with other receptor-specific peptide motifs. Gene therapy, 1995. 2(10): p. 750-6.
228. Wickham, T.J., et al., Integrins alpha v beta 3 and alpha v beta 5 promote adenovirus internalization but not virus attachment. Cell, 1993. 73(2): p. 309-19.
229. Wolf, D.P., et al., In vitro fertilization-embryo transfer in nonhuman primates: the technique and its applications. Molecular reproduction and development, 1990. 27(3): p. 261-80.
230. Wolff, J.A., et al., Direct gene transfer into mouse muscle in vivo. Science, 1990. 247(4949 Pt 1): p. 1465-8.
231. Wu, E., et al., Flexibility of the adenovirus fiber is required for efficient receptor interaction. Journal of virology, 2003. 77(13): p. 7225-35.
232. Wu, G.Y. and C.H. Wu, Receptor-mediated in vitro gene transformation by a soluble DNA carrier system. The Journal of biological chemistry, 1987. 262(10): p. 4429-32.
233. Wu, X. and S.M. Burgess, Integration target site selection for retroviruses and transposable elements. Cellular and molecular life sciences : CMLS, 2004. 61(19-20): p. 2588-96.
234. Wu, Z., H. Yang, and P. Colosi, Effect of genome size on AAV vector packaging. Mol Ther, 2010 18(1): p. 80-6.
235. Xu, L., et al., CMV-beta-actin promoter directs higher expression from an adeno-associated viral vector in the liver than the cytomegalovirus or elongation factor 1 alpha promoter and results in therapeutic levels of human factor X in mice. Human gene therapy, 2001. 12(5): p. 563-73.
236. Xu, Y. and F.C. Szoka, Jr., Mechanism of DNA release from cationic liposome/DNA complexes used in cell transfection. Biochemistry, 1996. 35(18): p. 5616-23.
237. Yang, Y., et al., Inactivation of E2a in recombinant adenoviruses improves the prospect for gene therapy in cystic fibrosis. Nature genetics, 1994. 7(3): p. 362-9.
238. Yang, Z., et al., Mutant prominin 1 found in patients with macular degeneration disrupts photoreceptor disk
196
morphogenesis in mice. The Journal of clinical investigation, 2008. 118(8): p. 2908-16.
239. Zack, D.J., et al., Unusual topography of bovine rhodopsin promoter-lacZ fusion gene expression in transgenic mouse retinas. Neuron, 1991. 6(2): p. 187-99.
240. Zamiri, P., S. Sugita, and J.W. Streilein, Immunosuppressive properties of the pigmented epithelial cells and the subretinal space. Chemical immunology and allergy, 2007. 92: p. 86-93.
241. Zhang, S.H., et al., Distinctive gene transduction efficiencies of commonly used viral vectors in the retina. Current eye research, 2008. 33(1): p. 81-90.
242. Zhou, R., et al., A new look at immune privilege of the eye: dual role for the vision-related molecule retinoic acid. Journal of immunology, 2011. 187(8): p. 4170-7.
243. Zufferey, R., et al., Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. Journal of virology, 1998. 72(12): p. 9873-80.
197
Appendix
Appendix A – Curve fit for Section 3.4.2
The curve-fit function applied was
Y=Bmax · X / (ID50 + X)
X = VP/cell Y = percentage positive cells Bmax = infection maximum (assumed to be 100%) ID50 = infectious dose 50; number of particles required to achieve fluorescence in
50% of the cells as determined by flow cytometry
Curve fit was performed by the least squares method.
APRE-19 WERI-Rb ID50 92.40 230.1
95% Confidence Interval 77.84 to 107.0 191.7 to 268.4R2 0.9316 0.9082
198
When the curve-fit is applied to ARPE-19 and WERI-Rb cells transduced with CAG-
EGFP, the resulting R2 was 0.9316 and 0.9082 respectively. Interpreting the R2 value, the
dose of CAG-EGFP (VP/cell) applied accounts for 93% and 91% of the differences in
the number of fluoresence cells in ARPE-19 and WERI-Rb cells respectively. The high
R2 value validates the use of the curve-fit with the data.
199
Appendix B – List of abbreviations
A2E di-retinoid-pyridinium-ethanolamine
A2PE di-retinoid pyridinium phosphatidyl ethanolamine
ACAID anterior chamber-associated immune deviation
Ad adenovirus
AdV adenoviral vector
bp base pairs
BSA bovine serum albumin
CCD charge-coupled device
CD46 cluster of differentiation 46; membrane cofactor protein
cGMP cyclic guanosine monophosphate
CIAP calf intestinal alkaline phosphatase
CMV cytomegalovirus
CMV-IE cytomegalovirus immediate-early gene/promoter
CPE cytopathic effect
DAPI 4', 6-diamidino-2-phenylindole
DNA deoxyribonucleic acid
EIAV equine infectious anemia virus
FBS fetal bovine serum
FGAdV first-generation adenoviral vector
g gravitational acceleration
HDAd helper-dependent adenoviral vector
HSG heparan sulfate glycosaminoglycans
IL interleukin
ILM inner limiting membrane
INL inner nuclear layer
200
IPL inner plexiform layer
IRBPE interphotoreceptor retinoid-binding protein promoter enhancer
ITR inverted terminal repeat
IU infectious unit
LPC lysophosphatidylcholine
MFI mean fluorescence intensity
MOI multiplicity of infection
kb kilobase; 1000 basepairs of DNA or RNA
LRAT lecithin retinol acyltransferase
mRNA messenger RNA
OLM outer limiting membrane
ONL outer nuclear layer
OPL outer plexiform layer
ORF open reading frame
PCR polymerase chain reaction
PDE phosphodiesterase
PD-L1 programmed death-ligand 1
PE phosphatidyl ethanolamine
PFU plaque forming units
PR photoreceptor
qRT-PCR quantitative retrotranscription polymerase chain reaction
RDH retinol dehydrogenase
Rho rhodopsin (used to denote rhodopsin promoter constructs)
RPE retinal pigment epithelium
RPM revolutions per minute
TGF transforming growth factor
VP vector particles
201
Appendix C – List of Publications
Highly efficient retinal gene delivery with helper-dependent adenoviral vectors Lam S, Cao H, Duan R, Hu J Genes & Diseases (in press, accepted 4 September, 2014,) There have been significant advancements in the field of retinal gene therapy in the past several years. In particular, therapeutic efficacy has been achieved in three separate human clinical trials conducted to assess the ability of adeno-associated viruses (AAV) to treat of a type of Leber’s congenital amaurosis caused by RPE65 mutations. However, despite the success of retinal gene therapy with AAV, challenges remain for delivering large therapeutic genes or genes requiring long DNA regulatory elements for controlling their expression. For example, Stargardt’s disease, a form of juvenile macular degeneration, is caused by defects in ABCA4, a gene that is too large to be packaged in AAV. Therefore, we investigated the ability of helper dependent adenovirus (HD-Ad) to deliver genes to the retina as it has a much larger transgene capacity. Using an EGFP reporter, our results showed that HD-Ad can transduce the entire retinal epithelium of a mouse using a dose of only 1 x 105 infectious units and maintain transgene expression for at least 4 months. The results demonstrate that HD-Ad has the potential to be an effective vector for the gene therapy of the retina. rbm47, a novel RNA binding protein, regulates zebrafish head development. Guan R, El-Rass S, Spillane D, Lam S, Wang Y, Wu J, Chen Z, Wang A, Jia Z, Keating A, Hu J, Wen XY. Dev Dyn. 2013 Dec;242(12):1395-404. BACKGROUND: Vertebrate trunk induction requires inhibition of bone morphogenetic protein (BMP) signaling, whereas vertebrate head induction requires concerted inhibition of both Wnt and BMP signaling. RNA binding proteins play diverse roles in embryonic development and their roles in vertebrate head development remain to be elucidated. RESULTS: We first characterized the human RBM47 as an RNA binding protein that specifically binds RNA but not single-stranded DNA. Next, we knocked down rbm47 gene function in zebrafish using morpholinos targeting the start codon and exon-1/intron-1 splice junction. Down-regulation of rbm47 resulted in headless and small head phenotypes, which can be rescued by a wnt8a blocking morpholino. To further reveal the mechanism of rbm47's role in head development, microarrays were performed to screen genes differentially expressed in normal and knockdown embryos. epcam and a2ml were identified as the most significantly up- and down-regulated genes, respectively. The microarrays also confirmed up-regulation of several genes involved in head development, including gsk3a, otx2, and chordin, which are important regulators of Wnt signaling. CONCLUSIONS: Altogether, our findings reveal that Rbm47 is a novel RNA-binding protein critical for head formation and embryonic patterning during zebrafish embryogenesis which may act through a Wnt8a signaling pathway.
202
Overview of Gene Therapy for Retinal Diseases Lam S Inside Optics, April 2013 Lecture given as a part of the “Main Lecture” series for an accredited continuing education program at the Annual Meeting of the Ontario Opticians Association Knockdown of ZNF403 inhibits cell proliferation and induces G2/M arrest by modulating cell-cycle mediators. Guan R, Wen XY, Wu J, Duan R, Cao H, Lam S, Hou D, Wang Y, Hu J, Chen Z. Mol Cell Biochem. 2012 Jun;365(1-2):211-22 ZNF403, also known as GGNBP2 (gametogenetin binding protein 2), is a highly conserved gene implicated in spermatogenesis. However, the exact biological function of ZNF403 is not clear. In this study, we identified the role of ZNF403 in cell proliferation and cell-cycle regulation by utilizing short hairpin RNA (shRNA)-mediated knockdown. ZNF403-specific shRNA expressing helper-dependent adenoviral vector (HDAd-ZNF403-shRNA) was constructed and transduced human cell lines. ZNF403 mRNA and protein expression levels were inhibited as evidenced by real-time PCR and western blot analyses. Noticeably, we found that knockdown of ZNF403 expression suppressed cell proliferation compared to the non-target shRNA and vector controls. Furthermore, cell-cycle analysis demonstrated that downregulation of ZNF403 promoted G2/M cell-cycle arrest in a dose-dependent manner. Moreover, human cell-cycle real-time PCR array revealed that ZNF403 knockdown influenced the expression profile of genes in cell-cycle regulation. Among these genes, western blot analysis confirmed the protein up-regulation of p21 and down-regulation of MCM2 in response to the ZNF403 knockdown. Additionally, knockdown of ZNF403 also showed an anti-carcinogenetic effect on anchorage-independent growth by colony formation assay and tumor cell migration by wound-healing assay with human laryngeal cancer cell line Hep-2 cells. Altogether, our findings suggest an essential role of ZNF403 in cell proliferation and provide a new insight into the function of ZNF403 in regulating the G2/M cell-cycle transition. Sub-retinal gene delivery using helper-dependent adenoviral vectors. Wu L, Lam S, Cao H, Guan R, Duan R, van der Kooy D, Bremner R, Molday RS, Hu J. Cell Biosci. 2011 Apr 4;1(1):15 This study describes the successful delivery of helper-dependent adenoviral vectors to the mouse retina with long term and robust levels of reporter expression in the retina without apparent adverse effects. Since these vectors have a large cloning capacity, they have great potential to extend the success of gene therapy achieved using the adeno-associated viral vector.
203
Temporal and tissue specific regulation of RP-associated splicing factor genes PRPF3, PRPF31 and PRPC8--implications in the pathogenesis of RP. Cao H, Wu J, Lam S, Duan R, Newnham C, Molday RS, Graziotto JJ, Pierce EA, Hu J. PLoS One. 2011 Jan 19;6(1):e15860 Genetic mutations in several ubiquitously expressed RNA splicing genes such as PRPF3, PRP31 and PRPC8, have been found to cause retina-specific diseases in humans. To understand this intriguing phenomenon, most studies have been focused on testing two major hypotheses. One hypothesis assumes that these mutations interrupt retina-specific interactions that are important for RNA splicing, implying that there are specific components in the retina interacting with these splicing factors. The second hypothesis suggests that these mutations have only a mild effect on the protein function and thus affect only the metabolically highly active cells such as retinal photoreceptors. METHODOLOGY/PRINCIPAL FINDINGS: We examined the second hypothesis using the PRPF3 gene as an example. We analyzed the spatial and temporal expression of the PRPF3 gene in mice and found that it is highly expressed in retinal cells relative to other tissues and its expression is developmentally regulated. In addition, we also found that PRP31 and PRPC8 as well as snRNAs are highly expressed in retinal cells. CONCLUSIONS/SIGNIFICANCE: Our data suggest that the retina requires a relatively high level of RNA splicing activity for optimal tissue-specific physiological function. Because the RP18 mutation has neither a debilitating nor acute effect on protein function, we suggest that retinal degeneration is the accumulative effect of decades of suboptimal RNA splicing due to the mildly impaired protein.