Development of Helper-Dependent Adenoviral Vectors for Gene Therapy for

Inherited Retinal Diseases

by

Simon Lam

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy

Graduate Department of Laboratory Medicine and Pathobiology University of Toronto

© Copyright by Simon Lam 2015

ii

Development of Helper-Dependent Adenoviral Vectors for Gene Therapy for Inherited Retinal Diseases

Simon Lam Doctor of Philosophy

Laboratory Medicine and Pathobiology University of Toronto

2015

Abstract

There have been significant advancements in the field of retinal gene therapy in the past

decade. In particular, therapeutic efficacy has been achieved in three separate human

clinical trials using adeno-associated viruses (AAV) to treat a type of Leber’s congenital

amaurosis caused by RPE65 mutations. However, despite the success with AAV,

challenges remain for delivering large therapeutic genes or genes requiring long DNA

regulatory elements to the retina.

For example, Stargardt’s disease, a form of juvenile macular degeneration, is caused by

defects in ABCA4, a gene that is too large to be packaged in AAV. ABCA4 encodes an

ATP dependent flipase and when its function is lost, its substrate undergoes chemical

reactions that cause it to become toxic to the retinal pigment epithelium (RPE). This

leads to the apoptosis of the RPE and the subsequent loss of the photoreceptor (PR) cells.

Therefore, individuals born with mutations in both copies of ABCA4 eventually lose their

vision. Stargardt’s disease represents an attractive target for gene therapy because it is an

autosomal recessive disease, because PR cells are neuronal and thus do not exhibit cell

turnover, and because it is a very slow progressing disease, thus early detection and

treatment can abrogate much of the vision loss. Therefore, we investigated the ability of

helper dependent adenovirus (HDAd) to deliver genes to the retina as it has a much

larger transgene capacity.

iii

Our results indicate that HDAd vectors can transduce the entire width of the mouse

retinal epithelium using a very low dose, with high transgene expression, long duration,

and low toxicity. However, it was also observed that while the RPE was completely

transduced, very little of the neural retina was transduced. We discuss the potential

causes of this, with viral tropism and inability to penetrate the outer limiting membrane

of the retina as potential causes. We conclude that HDAd vectors are highly efficient for

gene delivery to the RPE, and that with modifications to the method of vector injection,

HDAd may prove to be an excellent gene delivery tool for the neural retina.

iv

Acknowledgments

I wish to thank Dr. Jim Hu for the opportunity of pursuing this degree, as well as his

valuable advice and guidance during the years I have been in his laboratory. I also wish

to thank my fellow lab members, in particular Dr. Huibi Cao and Jing Wu for their

technical assistance and advice, and Cathleen Duan for her assistance in vector

production.

I wish to thank my advisory committee members, Dr. Derek van der Kooy and Dr. Ming

Tsao, for their time, advice, and insight during the course of this degree.

I wish to thank Dr. Robert S. Molday (University of British Columbia), Laurie Molday,

and Hidayat Djajadi for their generosity and support while I learned their techniques for

tissue preparation, imaging, and working with the ABCA4 protein.

I wish to thank Dr. Ji-jing Pang (University of Florida) and Dr. Bo Chang (The Jackson

Laboratory) for teaching me their sub-retinal injection technique.

I wish to thank Dr. Rod Bremner (University of Toronto) for kindly providing the Y79

and WERI-Rb cell lines.

I also wish to thank my parents for their support through the many years and multiple

degrees I have pursued, and my friends for their emotional support throughout the years.

Finally, I wish to thank my partner who has made great sacrifices during these times, and

her family for their support, advice, and understanding.

v

Table of contents

1.  Introduction ....................................................................................................... 1 

1.1.  Eye physiology ............................................................................................................ 1 

1.1.1.  Anatomy .................................................................................................................. 1 

1.1.2.  Phototransduction .................................................................................................. 7 

1.1.3.  Immune privilege .................................................................................................. 10 

1.2.  Stargardt’s disease .................................................................................................... 11 

1.2.1.  Molecular etiology ................................................................................................ 12 

1.2.2.  Current treatment options and recent research................................................... 13 

1.3.  Gene Therapy ........................................................................................................... 14 

1.3.1.  Non‐viral gene therapy delivery methods ............................................................ 15 

1.3.2.  Viral vectors ........................................................................................................... 18 

1.3.3.  Adenovirus tropism ............................................................................................... 31 

1.3.4.  Retinal gene therapy ............................................................................................. 37 

1.3.5.  Gene Therapy for Stargardt’s disease ................................................................... 38 

1.4.  Hypothesis ................................................................................................................ 40 

2.  Materials and Methods .................................................................................... 41 

2.1.  Molecular Cloning ..................................................................................................... 41 

2.1.1.  Plasmid extraction ................................................................................................. 41 

2.1.2.  Transformation of competent E. coli DH5α .......................................................... 46 

2.1.3.  Polymerase Chain Reaction ................................................................................... 46 

2.1.4.  Restriction digest ................................................................................................... 51 

2.1.5.  Agarose gel electrophoresis .................................................................................. 52 

2.1.6.  Ligation .................................................................................................................. 52 

2.1.7.  Sequencing ............................................................................................................ 53 

2.2.  Tissue Culture ........................................................................................................... 53 

2.2.1.  Cell lines ................................................................................................................ 53 

2.2.2.  Transfection........................................................................................................... 55 

2.2.3.  Transduction.......................................................................................................... 55 

vi

2.2.4.  Flow Cytometry ..................................................................................................... 56 

2.2.5.  qRT‐PCR ................................................................................................................. 56 

2.2.6.  Western Blot ......................................................................................................... 57 

2.3.  HDAd vector production ........................................................................................... 61 

2.4.  Animal models .......................................................................................................... 64 

2.4.1.  Mydriasis and Anesthesia ...................................................................................... 64 

2.4.2.  Trans‐sclera sub‐retinal injection .......................................................................... 65 

2.4.3.  Trans‐corneal sub‐retinal injection ....................................................................... 66 

2.4.4.  Cryosection ............................................................................................................ 67 

2.4.5.  Immunofluorescence ............................................................................................ 69 

2.4.6.  Microscopy ............................................................................................................ 70 

3.  Results ............................................................................................................. 72 

3.1.  Promoter constructs ................................................................................................. 72 

3.1.1.  Ubiquitous promoters ........................................................................................... 72 

3.1.2.  Rhodopsin promoters ........................................................................................... 75 

3.1.3.  G protein‐coupled Receptor Kinase 1 promoter ................................................... 81 

3.2.  Introns....................................................................................................................... 83 

3.3.  ABCA4::EGFP fusion protein did not yield detectable fluorescence ........................ 89 

3.4.  Transduction efficacy and cell specificity of HDAd vectors carrying the reporter 

gene EGFP ................................................................................................................................. 90 

3.4.1.  HDAd is capable of delivering EGFP to cultured cells and the rhodopsin promoter 

confers fluorescence in a cell‐specific manner ..................................................................... 90 

3.4.2.  Vector particle to infectious unit ratio ................................................................ 102 

3.4.3.  in vivo injections of HDAd carrying the EGFP reporter gene .............................. 103 

3.5.  HDAd carrying the therapeutic gene is capable of transducing cells and conferring 

expression ............................................................................................................................... 133 

3.5.1.  Injections of HDAd vector carrying ABCA4 into mouse retina ............................ 140 

3.5.2.  mRNA, western blots and IF using different batches of CAG‐ABCA4 reveals 

variations in vector efficacy between batches .................................................................... 146 

4.  Discussion ..................................................................................................... 149 

4.1.  Anomalous protein bands observed when CAG‐ABCA4 vector is used to transduce 

WERI‐Rb cells is likely a result of RNA processing ................................................................... 149 

vii

4.2.  HDAd required to transduce the entire retinal epithelium is low, but is also difficult 

to quantitate precisely, and there are variations in VP:IU between batches ......................... 152 

4.3.  The tropism of the HDAd vector may be reducing the transduction of 

photoreceptor cells ................................................................................................................. 159 

4.4.  Potential application of HDAd in RPE diseases ....................................................... 165 

4.5.  Patches of complete retinal transduction .............................................................. 167 

5.  Conclusion ..................................................................................................... 173 

6.  References ..................................................................................................... 175 

Appendix ...................................................................................................................... 197 

Appendix A – Curve fit for Section 3.4.2 ........................................................................ 197 

Appendix B – List of abbreviations ................................................................................. 199 

Appendix C – List of Publications .................................................................................. 201 

viii

List of Tables

Table 1 – List of plasmids ................................................................................................ 42 

Table 2 – List of primers .................................................................................................. 48 

Table 3 – List of cell lines ................................................................................................ 54 

Table 4 – List of antibodies .............................................................................................. 60 

ix

List of Figures

Figure 1 – Schematic diagram of the cross-section of human eye [41] .............................. 5 

Figure 2 – Schematic diagram of the retina [108] .............................................................. 6 

Figure 3 – Schematic diagram of the visual cycle [42] ...................................................... 9 

Figure 4 – Schematic of the HDAd production technique with the Cre/Lox system [154]

............................................................................................................................ 30 

Figure 5 – Schematic figure of adenovirus structure [152] and fiber structure [138] ...... 35 

Figure 6 – Schematic diagram of adenovirus attachment and entry via CAR and integrin

binding [152] ...................................................................................................... 36 

Figure 7 – The CAG promoter is more active than CMV as measured by EGFP

expression ........................................................................................................... 74 

Figure 8 – Flow cytometry of transfected cells demonstrate the cell specificity of the Rho

promoter and the increase in transcription resulting from IRBPE ..................... 79 

Figure 9 – Rho-EGFP confers higher gene expression than GRK1-EGFP ...................... 82 

Figure 10 – BLAST search of hybrid intron sequence ..................................................... 86 

Figure 11 – The sequence of the template plasmid contains 9 differences compared with

the reference sequence in a segment of ~800 bp. ............................................... 88 

Figure 12 – HDAd can deliver EGFP to cultured cells, and the rhodopsin promoter is

cell-specific ......................................................................................................... 93 

Figure 13 – Confocal photomicrographs of ARPE-19, HeLa and WERI-Rb cells

transduced with either CAG-EGFP or Rho-EGFP ............................................. 95 

Figure 14 – Flow cytometry confirms fluorescence conferred by CAG-EGFP and cell

specificity of rhodopsin promoter ...................................................................... 99 

x

Figure 15 – Representative flow cytometry plots demonstrating the gating method used

to reduce false-positives caused by auto-fluorescence. .................................... 100 

Figure 16 – Representative flow cytometry histograms ................................................. 101 

Figure 17 – Microspheres injected into the sub-retinal space of mouse eyes ................ 106 

Figure 18 – Sequential sections of a mouse retina injected with CAG-EGFP HDAd ... 110 

Figure 19 – High magnification view of a retina injected with CAG-EGFP ................. 111 

Figure 20 – Low dose injections of CAG-EGFP confer expression down to 1 x 105 VP

.......................................................................................................................... 116 

Figure 21 – Long-term monitoring of CAG-EGFP injected mice .................................. 119 

Figure 22 – Patches of transduction of the neural retina after CAG-EGFP injection .... 121 

Figure 23 – Injections of FGAdV Ad5 and Ad5/F35 both with and without RGD deletion

results in no significant increase in PR transduction ........................................ 125 

Figure 24 – LPC does not increase photoreceptor transduction ..................................... 129 

Figure 25 – HDAd carrying Rho-EGFP injected into the sub-retinal space of mice ..... 132 

Figure 26 – mRNA from cell lines transduced with CAG-ABCA4 and Rho-ABCA4 .. 135 

Figure 27 – Western blot of cell lines transduced with CAG-ABCA4 and Rho-ABCA4

.......................................................................................................................... 137 

Figure 28 – Immunofluorescence imaging of cell lines transduced with either CAG-

ABCA4 or Rho-ABCA4 ................................................................................... 139 

Figure 29 – qRT-PCR for transgenic ABCA4 from injected mouse eyes ...................... 142 

Figure 30 – Immunofluorescence imaging of mouse eyes injected with CAG-ABCA4 144 

Figure 31 – Magnified view of the areas within the yellow box from Figure 30 ........... 145 

xi

Figure 32 – Comparison of batches of CAG-ABCA4 by qRT-PCR, immunofluorescence

and western blot ................................................................................................ 148 

1

1. Introduction

Gene therapy, in the simplest terms, is the use of DNA to treat diseases by delivering the

DNA to a patient’s cells. Over the last 5 decades, gene therapy has progressed from a

conceptual exercise to a therapy approved for clinical use. In the work herein, we made

progress towards the use of helper-dependent adenoviral vectors (HDAd) to treat

Stargardt’s disease, an inherited form of juvenile macular degeneration caused by a

defective gene in the photoreceptor cells of the retina. The results presented here

demonstrate the potential and the challenges involved in the use of HDAd in treating

retinal diseases.

1.1. Eye physiology

The eye is a complex organ that focuses, detects, and interprets light into the images

perceived by the brain. Not only is it anatomically complex to manipulate the incoming

light onto the retina, the retina is a complex layer of many cell-types with sophisticated

chemical relationships to convert the light into neurological signals that are processed

before transmission to the brain. The retina must also contain a range of supporting cells

to ensure the health and function of the cells involved in this process. Because of this

complexity, there is a wide range of diseases that affect the eye.

1.1.1. Anatomy

The eye’s anatomy revolves around two major objectives: the manipulation of incoming

light to project a focused image on the surface of the retina, and the detection and

processing of this light into an appropriate signal for transmission to the brain via the

optic nerve.

2

The overall physical structure (Figure 1) is contained by the sclera, a thick connective

tissue that forms the white globe of approximately 6.5 mL in volume, 25 mm in diameter

in an adult human [106]. The anterior side features a circular opening of approximately

60 degrees which houses the parts of the eye responsible for admitting and manipulating

light. This light first passes through the cornea, an outer protective layer. It then passes

though the pupil which controls the amount of light admitted, similar to the aperture of a

camera, and into the lens which focuses the light as appropriate via the ciliary muscles

which alter the shape of the lens. Within this anterior chamber of the eye between the

cornea and the lens is contained a liquid known as the aqueous humour. The light exits

the lens into the vitreous, a high viscosity liquid, and into the retina.

The retina’s primary function is to detect light, a role fulfilled by photoreceptor cells

(PR). Figure 2 shows the organization of the cells within the retina. There are two types

of PR cells, rods and cones, which detect light in general and specific wavelengths of

light respectively. Low-light vision is conferred by rods and colour vision is conferred by

combinations of cones with different sensitivities to different colours. Both types of PR

cells are physically separated into two distinct sections; the segments that contain the

mechanisms to detect light, and the cell bodies within the outer nuclear layer that

maintain the cell’s ability to function. As Section 1.2.1 describes in detail, these are the

cells of concern with Stargardt’s disease.

Moving towards the vitreous from the PR cells is the outer plexiform layer (OPL) where

connections between PR and neural cells take place. These neural cells have their cell

3

bodies within the inner nuclear layer (INL), and consist of horizontal cells, bipolar cells,

amacrine cells, and Müller cells [108].

The signals from both rods and cones are aggregated by bipolar cells or horizontal cells,

with the horizontal cells also making lateral connections to allow for cross-talk to

interpret and coalesce the signal. Some of these signals are transmitted to the amacrine

cells that further aggregate and simplify the signal by allowing for processing between

pathways before passing the signals onto the retinal ganglia. In brief, the combination of

bipolar cells, horizontal cells, and amacrine cells aggregate, interpret, and simplify the

signals from the PR cells to the ganglion cells via a complicated non-linear network of

lateral and vertical communication to reduce the amount of data that needs to be

transmitted. From these retinal ganglion cells, the information is passed via the optic

nerve to the brain. [104]

Like other neural cells, the neural retina cells require support from glial cells to provide

nutritional sustenance and physiological upkeep. In the neural retina, this is mainly

provided by Müller cells. However, in addition to typical functions of glial cells, Müller

cells also serve the additional function of providing barriers to the edges of the neural

retina. Like many other neural retina cells, although the Müller cell body sits in the INL,

the cell projects extensively in both directions towards the photoreceptors and the

vitreous. On the PR side, the Müller cell membrane flattens and connects with other

Müller cells as well as PR cells to form the outer limiting membrane (OLM). This serves

to seal the neural retina from the sub-retinal space while allowing PR cell’s outer

segments to project through and be accessible to retinal pigment epithelium cells. On the

4

side facing the vitreous, the Müller cell membranes also spread to form the inner limiting

membrane (ILM), serving as a barrier between the neural retina and the vitreous [105].

These are of significance in the discussion in Section 4.5, as they affect the distribution

and penetration of the gene therapy vector.

Looking towards the opposite side of the PR, away from the neural retina, is the retinal

pigment epithelium (RPE). The RPE is attached to the Bruch’s membrane and the

choroid. Bruch’s membrane serves as a medium through which the RPE can interact with

the choroid, transferring materials between the blood supply in the choroid and the RPE

cells. The RPE projects processes that interlace with the PR cells to ingest PR segments

that are shed as a normal function of the PR cells, and recycle substrates back into a

usable form for the PR. Although RPE and PR are normally essentially in contact with

each other, retinal detachment can occur with the PR cells separating away from the

RPE, forming a sub-retinal space. Injection into the sub-retinal space is a common

method of delivering material to the retina, especially the RPE. In the studies described

herein, the interaction between the RPE and PR is of particular importance as it plays a

key role in the progression of Stargardt’s diseases as well as other degenerative diseases

targeted by gene therapy.

5

Figure 1 – Schematic diagram of the cross-section of human eye [41]

This schematic cross-section of the eye shows the main features of the human eye. The

anatomy of the retina is shown in further detail in Figure 2. It is important to note that the

mouse eye contains a significantly larger lens, occupying approximately 50% of the

volume of the posterior chamber (vitreous humour). The implications of this on the

injection technique are described in Sections 2.4.2 and 2.4.3.

6

Figure 2 – Schematic diagram of the retina [108]

In this schematic diagram of the retina, the orientation is such that light enters from the

bottom of the diagram from the vitreous humour, separated from the retina by the inner

limiting membrane, towards the retinal pigment epithelium which is adjacent to the

choroid which is not shown in this figure as it is not strictly speaking a part of the retina.

The neural retina is the layers of cells encompassed by the outer and inner limiting

membrane (i.e. all parts of the retina except the retinal pigment epithelium). The sub-

retinal space is not labelled in this diagram as it does not exist until retinal detachment

which results in the neural retina separating from the retinal pigment epithelium.

7

1.1.2. Phototransduction

Phototransduction is the process by which light is converted to signals passed to the

neural retina for processing into images. It consists of a neurological side that causes

signalling to the neural retina, and a chemical side to recycle substrates. We are primarily

interested in the chemical side of phototransduction (Figure 3) as it participates in the

etiology of Stargardt’s disease.

Rhodopsin, present on the membranes of the discs of the PR cell segments, is sensitive to

light. It is bound to 11-cis retinal and isomerizes 11-cis retinal into all-trans retinal upon

activation. This causes rhodopsin to initiate a signal transduction cascade and release the

all-trans retinal. The signal transduction cascade is initiated by the activation of

transducin, which in turn activates phosphodiesterase (PDE). PDE then hydrolyzes

cGMP, leading to the closure of cGMP-gated channels on the plasma membrane of the

PR cell. The closure of these channels results in hyperpolarization of the membrane,

down-regulating the release of glutamate at the synaptic terminal. This change in

glutamate is the format in which signal transduction then occurs to the rest of the neural

retina [107]. Interestingly, each step of this cascade allows for significant amplification,

resulting in minimum detectable light sensitivity of 5-14 photons under extreme dark

adaptation [82].

Concurrently, the released all-trans retinal must be recycled back into 11-cis retinal for

binding to rhodopsin. It is hydrolyzed and reduced to all-trans retinol by all-trans retinol

dehydrogenase. In this form, it is transported into the RPE where lecithin retinol

acyltransferase (LRAT) esterifies all-trans retinol into all-trans retinyl ester. A crucial

8

enzyme, RPE65, then isomerizes and hydrolyses it into 11-cis retinol. 11-cis retinol

dehydrogenase then converts it back into 11-cis retinal which is transported back into the

PR cell for binding to rhodopsin, completing the cycle [107].

9

Figure 3 – Schematic diagram of the visual cycle [42]

In this diagram, the chemicals involved in the visual-cycle are in black. The green text

indicates the enzyme involved in the conversion. It is important to note that the

orientation of this figure is reversed from a typical presentation of the retina and the RPE

is show below the photoreceptors in this figure. ABCA4 transports N-retinylidene-PE

which is a result of all-trans retinal reacting with phosphatidyl ethanolamine, and thus is

not represented in this diagram as it is not a necessary enzyme for the visual cycle.

10

1.1.3. Immune privilege

The eye has long been known to be an immune privileged organ, and anterior chamber-

associated immune deviation (ACAID) was identified in 1977 [93]. Since then, immune

privilege has also been observed in the sub-retinal space [223] and the vitreous [190,

223]. As gene therapy for the eye mainly concerns the posterior chamber, more

specifically the retina, this summary of immune privilege of the eye will be primarily

regarding the posterior chamber.

As the retina is well protected from antigens from the anterior of the eye, the primary

concern for immune privilege is to prevent antigens being introduced via the blood

stream. The main defense against this is the blood-retinal barrier, formed by tight

junctions of the retinal capillary endothelial cells that prevents free diffusion while

supplying nutrients and removing waste products from the retina [86]. Beyond this, the

RPE has multiple pathways of down-regulating inflammatory cells [91, 240], including

changing the nature of the T-cells that find themselves in the micro-environment

surrounding the RPE [194-197]. RPE also expresses FAS ligand and PD-L1, thus

activated immune cells expressing FAS and PD-1 receptor become apoptotic when

bound to the RPE [210]. These apoptotic cells also produce IL-10, an

immunosuppressive cytokine, pushing the balance of the immune response towards the

suppressive side [62, 75, 149].

Within the sub-retinal space immediately adjacent to the RPE, TGF-β is present and acts

as an immunosuppressive neuropeptide and is responsible for much of the immune

privilege [195, 223]. Furthermore, retinoic acid, in particular all-trans-retinoic acid

11

derived from all-trans-retinol within the PR cells, is found within the RPE and sub-retinal

space [52, 118]. Retinoic acid appears to interact with the function of TGF-β and acts as

a cofactor for some of TGF-β’s immune-suppressive functions, potentially via

conversion of T-cells to Treg cells [96, 148, 242].

From this, it is clear that the retina benefits from multiple strategies to provide immune

privilege. This immune privilege is necessary as many of the neural retina cells are

incapable of regenerating, thus immune damage from an inflammatory response cannot

be repaired adequately and can be permanently damaging to the retina. As a result, an

abrogated response is preferable to the normal levels of immune response observed in

most other organs. The disastrous consequences of the loss of immune privilege can be

observed in autoimmune diseases such as sympathetic ophthalmia. In the context of gene

therapy, the immune privilege is exploited as the reduced immune response reduces the

adverse effects of the introduction of antigens in the form of the transgenic protein as

well as the vector itself. This allows for stronger transgene expression and longer

persistence of transduced cells.

1.2. Stargardt’s disease

Stargardt’s disease is an autosomal recessive form of juvenile macular degeneration first

described by Karl Stargardt in 1909 [193]. It has an estimated prevalence of 1 in 10,000

individuals [67], although this is dependent on the population examined and is higher in

certain populations [168]. Patients afflicted with this disease generally report gradual

bilateral decline in vision before 20 years of age. It can be diagnosed by ophthalmoscopic

examination by a lack of foveolar reflex and yellow flecks that appear in the macula. In

12

more progressed disease, the atrophy of the RPE may be visible within the macula. It can

also be diagnosed via electroretinography [112].

There are three known forms of Stargardt’s disease. Stargardt’s disease 1 (STGD1) is the

most common form of Stargardt’s disease and is the subject of the work herein Two

other forms of Stargardt’s also exist. Stargardt’s type 3 (STGD3) is a result of mutations

in ELOVL4, a gene involved in the synthesis of very long chain saturated and

polyunsaturated fatty acids [124]. Stargardt’s type 4 (STGD4) is a result of mutations in

PROM1, a transmembrane glycoprotein that plays a critical role in photoreceptor dis

membrane morphogenesis [238]. Both of these are very rare diseases, and are unrelated

to STGD1 and as such are beyond the scope of this work.

1.2.1. Molecular etiology

The gene causing Stargardt’s disease is the ATP-dependent flipase ABCA4 which is

closely tied to but not directly active in phototransduction. This gene is located on the

short arm of chromosome 1 in humans [94]. As phototransduction is initiated in the disc

lumen in PR cell segments with the rhodopsin being bound to the disc lumen membranes,

the all-trans retinal is transported across the membrane into the cytoplasm. However, a

portion of all-trans retinal will react with phosphatidyl ethanolamine (PE) to form N-

retinylidene-PE. In this form, it must be transported back to the cytoplasmic side of the

disc membrane by ABCA4, where the all-trans retinal can disassociate from PE and

continue its chemical cycle [144, 145, 198]. In the case of Stargardt’s disease, the

ABCA4 flipase is defective, causing N-retinylidene-PE to build up within the disc lumen.

N-retinylidene-PE can also react with a second molecule of all-trans retinal to form di-

13

retinoid-pyridinium-PE (A2PE). While this is not harmful per se, when the outer segment

of the PR cell is shed and phagocytosed by the RPE, A2PE present in the segment’s disc

lumen is also taken up. Lysosomal degradation of A2PE results in the hydrolytic product

di-retinoid-pyridinium-ethanolamine (A2E), which cannot be further degraded.

Consequently, A2E accumulates to form the lipofuscin deposits characteristic of

Stargardt’s disease. Lipofuscin acts as a detergent that compromises the membrane

integrity [56, 84], and converts into free radical epoxides that are capable of killing the

RPE cells [191, 192].

With the loss of the RPE, the corresponding PR cells lose the necessary support required

to sustain their function and cannot survive. As a result, a defect in ABCA4, a gene that

functions in the PR cells, results in the build-up of a toxic substrate that does not affect

the PR cells, but causes RPE apoptosis, thus indirectly causing the death of the PR cells.

As a result, Stargardt’s disease causes a progressive retinal degeneration.

1.2.2. Current treatment options and recent research

Currently, there are very few options available to patients of Stargardt’s disease. As with

many retinal diseases, recommendations are often made to minimize exposure to light,

especially strong sunlight, as it increases the metabolism in the retina, and thus

accelerates the progression of disease. While drugs are in development to treat

Stargardt’s disease and some show promise in delaying disease progression or improving

visual acuity [30, 44, 95], curing this disease would undoubtedly require the restoration

of gene function. It should be noted that while stem cell therapy towards regenerating the

RPE would also be beneficial [225], the photoreceptor cells are the causative agent in the

14

loss of RPE and replenishment of the RPE would not be a permanent solution. As such,

the cure to Stargardt’s disease rests in gene therapy.

1.3. Gene Therapy

In the simplest terms, gene therapy is the use of DNA as a therapeutic agent to deliver

genes to the host cell. Unlike conventional therapies where the therapeutic agent or a

precursor of the therapeutic agent is delivered, gene therapy relies on the host cell to

generate the therapeutic agent using the cell’s own machinery for transcribing and

translating the DNA into a therapeutic protein product. First conceptualized in 1971

[172], gene therapy has slowly developed from concept to application over the last 50

years. Although the majority of gene therapy studies are still experimental, several have

reached human clinical trials and commercialization of the first treatments has begun

[21].

A more recent development is the rise of ex vivo gene therapy where the patient’s cells

are extracted and then treated using gene therapy before being placed back into the

patient. For the work herein, we shall concentrate on its traditional, in vivo use as an ex

vivo application of gene therapy to Stargardt’s disease is not possible given that PR cells

are permanent and do not regenerate. In addition, the potential of generating an immune

response using the transgene to produce a DNA vaccine or DNA vector vaccine has also

been studied, although its purpose is significantly different from traditional gene therapy

and is beyond the scope of this work as it has no applications in the retina.

Gene therapy vectors can be separated into non-viral and viral vectors. Each individual

class of vectors has advantages and disadvantages as outlined below.

15

1.3.1. Non-viral gene therapy delivery methods

While much of the latest work in gene therapy delivery has concentrated on viral based

vectors gene therapy was first attempted using non-viral methods. These attempts were a

result of necessity as the molecular biological techniques for modifying viruses did not

yet exist, and thus many of the methods employed were carried over from in vitro work.

Generally speaking, these methods are less immunogenic and are less complicated.

While most have fallen out of favour due to their low efficacy, polymer based vectors

hold great promise for the future of non-viral gene therapy vectors.

1.3.1.1. Injection based methods

Microinjection is the direct injection of DNA into a single cell microscopically [229].

This simple mechanical process is effective but is only practical when a small number of

cells are targeted; it would be impractical to target an organ or even parts of an organ

using this technique. It also requires that the cell be accessible.

Direct local injection is the simple delivery of the DNA via direct injection to the target

area rather than to a specific cell [230]. While it holds potential for DNA based vaccines

[2], it yields low levels of gene expression, especially if the DNA is unaccompanied.

This mostly stems from the lack of a means by which the DNA can be delivered

intracellularly. More recent research has focused on injection of DNA conjugated to

polymers to improve efficacy (Section 1.3.1.4).

Jet injection using high-pressure gas as a carrier to carry a high-speed aerosol has been

examined as a means of needle-less sub-dermal delivery and is by no means a new

technology. However, it has gained traction in more recent times as the high-pressure jet

16

generates pores in the membrane of cells in the immediate area and thus can result in

intracellular delivery of DNA [222]. While many types of tissues can be treated, the

target area must be within a short distance from the skin [167], making it impractical for

many diseases. However, like other injection methods, it holds promise for DNA vaccine

delivery.

1.3.1.2. Electroporation

Alternative to injecting DNA into the area near the cells, or using a mechanical method

of delivering the DNA intracellularly, electroporation allows for delivery of the DNA

introduced to the target cells. Originally used as an in vitro technique, it is accomplished

by applying a high-voltage current to the target cells, causing transient pores to form in

the cell membrane which allows the DNA to enter the cell [153]. Interestingly, in an

experiment where the DNA was delivered systemically, transduction only took place in

the immediate area of the electroporation, indicating that targeting a specific organ is

possible without localized DNA delivery [178]. Very large DNA of up to 150 kb has

been studied to be efficiently delivered [128], with long term transgene expression of

over a year in vivo [146].

However, there are also significant limitations to electroporation. First, because it relies

on a voltage that can only be applied to a limited area, the gene transfer cannot be applied

to an entire organ in most cases. Second, for internal organs, surgical procedures are

required to appropriately place the electrodes. This is in addition to the need to deliver

the DNA to the desired area. Finally, the application of high voltage can induce tissue

damage [55]. This makes it unsuitable for organs that are sensitive to damage.

17

1.3.1.3. Liposomes

Liposomes are spheres consisting of cationic lipids. Each lipid molecule consists of a

hydrophilic head, a hydrophobic anchor, and a hydrophobic linker [31]. These lipid

molecules form a phospholipid bilayer similar to the cell membrane. This bilayer is

formed into spheres with the DNA contained within them.

The preparation of liposome complexes is highly sophisticated although the formation of

the complexes themselves is spontaneous [60]. The type of complexes created is based

on the chemical composition of the lipid, presence and properties of a co-lipid, salt

concentration, and incubation conditions, with the resulting complexes varying in size,

surface charge, structure and stability. Perhaps most importantly, the charge of the lipid

must be equal to or greater than the charge of the DNA to achieve complete

encapsulation [164].

Although the exact method by which the DNA enters the cell via lipofection is not

known, it likely occurs as a result of the liposome membrane fusing with the cell

membrane [61], or by endocytosis [163]. The presence of a lipid membrane has been

suggested to be disruptive to the lysosome and allows for the release of DNA into the

cytoplasm under the endocytosis model [236]. The process by which the DNA

dissociates from the oppositely charged liposome and enters the nucleus in the absence of

any external assistance is currently unknown and may contribute to the relatively low

efficacy of liposome mediated gene delivery in cells that are not actively dividing [20].

However, many groups are working on the various aspects of liposomal gene transfer and

many possibilities are yet to be explored.

18

1.3.1.4. Polymers

Recently, non-viral gene therapy has shifted significantly towards the use of cationic

polymers rather than liposomes. These polymers form complexes with the negatively

charged DNA forming small nanoparticles rather than large, hollow spheres. Many

natural and artificial polymers have been studied including chitosan [181],

polyamidoamine [205], and poly-(L)-lysine [232]. Although there have been reports of

toxicity stemming from the polymer [53], much work remains to determine the best type

and size for each application as well as chemical modifications which may reduce

toxicity, and improve efficacy. There is also the potential of conjugating multiple

polymers, combination with liposomes, or the synthesis of new polymers [220].

However, the use of polymers for gene therapy is very much in its infancy in comparison

with the other non-viral gene delivery methods and in comparison with viral vectors.

1.3.2. Viral vectors

Engineered viruses became the center of attention for potential vectors for gene therapy

as techniques evolved to better understand and manipulate viruses. This is because by

their very nature, viruses are designed to deliver and express their DNA payload in a host

cell in order to create more viruses and proliferate. Millions of years of evolution had

honed the skills of various viruses to accomplish this task and the wide variety of

different viruses each have varying ways to enter the host cell and reproduce. Given that

viruses are already ideally suited to deliver DNA to cells, the goal of viral vector gene

therapy development concentrates mostly on removing the harmful side of viral

19

infections while retaining and optimizing the virus’s ability to deliver and express the

DNA within.

The first and most obvious negative effect of a normal virus infection is illness. As the

natural life cycle of the virus progresses, it usurps the host cell’s machinery into

generating more virions (i.e. replicating). This process destroys the cell and damages the

tissues. However, a significant portion of the disease presentation stems from the

immune response as it recruits immune cells to the site, causing inflammation, and

destroying infected cells. Neither of these is desirable in a gene therapy vector as not

only is the tissue damage not desirable, the immune response will also help clear infected

cells and thus reduce the duration and therefore efficacy of the treatment. In addition, the

replication of the vector, and thus the possibility that it can spread beyond the treated

patient, is generally regarded as undesirable. As a result, often the first step to generating

a viral vector is to disable its ability to replicate.

Also related to the immune response is the fact that through co-evolution, the immune

response is designed to protect against viral infections. Therefore, it is highly desirable to

reduce the immunogenicity of the vector. This is often accomplished via the deletion of

viral genes to eliminate their expression inside the host cell, thus reducing the number of

antigens available to the immune system.

The above are just two of the many modifications that are involved in engineering a virus

for gene therapy use. Several of the most popular viral vectors and their properties are

discussed in depth individually below.

20

1.3.2.1. Retrovirus

Retroviruses are enveloped viruses with a genome consisting of ssRNA of 7-11 kb

containing three ORFs: capsid proteins, replication enzymes, and envelope glycoproteins.

The virus derives its name from the retrotranscription of its RNA into DNA using

reverse-transcriptase before being integrated into the host-cell genome. This integration

is permanent and is not site-specific [233].

Via deletion of the three ORFs, up to 8kb of DNA payload can be carried by retroviruses.

The ability to integrate into the host genome allows for long term expression of the gene

as it does not suffer from the dilution effects common to DNA in episomes as the

transgenes are replicated along with the host genome. Due to the low prevalence of

retroviruses in the human population, there is also low pre-existing immunity,

contributing to higher efficacy.

However, retroviral vectors suffer from two significant disadvantages. First, as the

retrotranscribed DNA lacks the ability to enter the nucleus, it can only transduce

replicating cells by taking advantage of the break-down in the nuclear envelope during

mitosis [202]. Second, and perhaps more importantly, is that the integration of the viral

DNA into random genomic sites represents not only a theoretical safety issue as with all

randomly integrating vectors, but in the case of retrovirus, actual harm has been

observed; in children treated for severe combined immunodeficiency disease linked to

the X-chromosome (SCID-X1), a clinical trial of 9 patients resulted in 4 cases of acute

leukemia and one death [77]. Although this was better accepted as a consequence

compared with the Gelsinger case (section 1.3.2.4), both due to the fact that the risk was

21

previously known and because of the severity of the disease being treated, it was

nonetheless an undesirable outcome. Work has since taken place towards the

development of self-inactivating (SIN) vectors where the risk of over-expression of gene

near the insertion site is reduced [57] and the safety of these vectors has improved [127].

Lentiviruses are a genus within retroviruses that are of particular interest for gene therapy

and exhibit several differences from other retroviruses. The primary advantage of

lentivirus is the ability to assemble a pre-integration complex using cellular proteins to

deliver the reverse transcribed viral genome to the nucleus, allowing for transduction of

non-dividing cells unlike other retroviruses [22]. Also, while retroviruses typically target

transcriptionally active promoters for integration into the host genome [59], lentiviruses

preferentially integrate away from such locations [37], thus increasing the safety over

other retroviral vectors. Furthermore, the development of self-inactivating lentiviral

vectors further improved the safety of lentiviral vector by minimizing the risk of

recombination as well as aberrant expression of host genes due to integration [127, 142,

243]. Apart from these particular benefits, lentivirus shares most other properties with

other retroviruses.

As a potential vector for carrying ABCA4, the 8 kb capacity of retroviruses would be the

bare minimum as it allows for only 1 kb of regulatory regions. As described in Section

3.1.2, the promoter used to restrict expression to photoreceptor cells, even without the

enhancer element, is already approximately 2 kb. Although the regulatory regions could

be designed to fit within the 1 kb limit, it was considered sub-optimal and would not

allow for a margin should the inclusion of additional components become desired.

22

1.3.2.2. Herpes virus

Herpes virus based vectors are usually based on herpes simplex virus (HSV) type 1, a

large DNA virus with a genome of 152 kb that targets neural cells and enters a latent

state. The large size of the virus allows for a very large DNA payload. Earlier versions of

herpes based vectors deleted only genes that resulted in pathogenicity, although later

developments followed with the deletion of genes for replication [73], and finally,

removal of all viral genes from the vector, requiring external sources of genes for DNA

replication, viral assembly, and DNA packaging [133].

As HSV vector does not integrate into the host cell genome, it carries a safety advantage

of not disrupting the host cell’s gene expression, although this comes at the cost of

having transient expression as the DNA is degraded or diluted by cell replication. Its

large carrying capacity has also allowed researchers to express combinations of genes

using a single vector as required for certain diseases [200].

However, as HSV-1 is a highly prevalent virus with a latent stage, most individuals have

an immune response against the virus, especially as the virus reactivates into the lytic

cycle intermittently, stimulating the immune system. This pre-existing immunity reduces

the vector’s efficacy in human use and may contribute towards its short duration of

transgene expression which is less than AAV, retroviral, and adenoviral vectors [120].

Associated with the presence of latent virus is the possibility that co-infection would

result in recombination with the wildtype virus to regain replication-competence,

although this is limited in the later versions of vectors which carry very little viral gene

sequences, thus reduced likelihood of homologous recombination [48, 132].

23

While HSV based vectors do fill a niche in being able to deliver large combinations of

genes, their short duration of expression and conflict with pre-existing immunity

relegates them to being ideal for transient use, such as for use as an anti-tumor or vaccine

agent, but not ideal for most other purposes including Stargardt’s disease.

1.3.2.3. Adeno-Associated Virus

Adeno-associated viruses (AAV) are small, non-enveloped viruses with an icosahedral

capsid. As they require co-infection with adenovirus or herpes simplex virus to replicate,

they were first discovered in association with adenovirus and hence the name. In the

absence of a co-infection, the viral genomes integrate into human chromosome 19 as a

pro-virus until a co-infection rescues the pro-virus into the lytic phase of viral replication.

The integration of AAV into this site has no-known ill effects [166]. It is a very small

virus, with a single-stranded DNA genome of 5 kb, containing only two ORFs: replicase

for genome replication, and capsid proteins [97].

Although AAV is highly prevalent, it is not known to cause human disease and has a

remarkably mild immune response [213]. This, in combination with its non-pathogenic

site specific integration, wide tropism, and ability to transduce cells regardless of their

cell cycle makes AAV a favourite amongst viral vector mediated gene therapy

candidates. There are over 100 human clinical trials in place using AAV as the vector of

choice [1, 74]. In particular, the human clinical trials using AAV to treat Leber’s

congenital amaurosis (LCA) will be discussed in detail in Section 1.3.3.

However, AAV is not without its disadvantages. The first and most obvious is that

AAV’s small genome limits the size of DNA that can be delivered. Many genes,

24

including ABCA4 which is the subject of the work herein, are too large to be packaged by

AAV. Second, the removal of the replicase results in loss of site specificity in integration

although it also greatly reduces the probability of integration, thus AAV delivered DNA

results mostly in episomal form [187]. This negates the advantage of safe, targeted

integration as seen in AAV without replicase deletion. In addition, AAV’s single-

stranded genome requires conversion to double-stranded DNA before the transgene can

be expressed, a process that introduces a time delay not necessarily acceptable to certain

applications [43].

While great progress is being made with AAV, there are some applications for which

AAV is unsuitable, and there exist limitations, in particular the packaging of large genes

including ABCA4, that appear to be insurmountable.

1.3.2.4. Adenovirus

Adenovirus (Ad) contains a single, linear, double-stranded genome of 36 kb. Its surface

is non-enveloped and is in the form of an icosahedral capsid. There are more than 50

serotypes that infect humans and have such a high prevalence that 75% of normal,

healthy children have antibodies for at least one serotype by 12 years of age [46, 47,

186]. Serotypes such as Ad2 and Ad5, with low natural pathogenicity, wide tropism, and

high levels of transgene expression, are popular candidates for gene therapy. This is in

part because adenoviral vectors (AdV) are capable of infecting post-mitotic cells due to

their ability to deliver the viral DNA to the nucleus, thus pose a significant advantage

over viral vectors that rely upon nuclear membrane breakdown during mitosis for nuclear

entry [87].

25

However, adenoviral vectors (AdV) also suffer from several drawbacks. First, the high

prevalence of Ad also means that there is significant pre-existing immunity against Ad in

most individuals. However, this can be partially circumvented by selecting non-human or

low-prevalence serotypes of Ad. Second, although the serotypes of Ad used in gene

therapy do not cause serious diseases in immunocompentent individuals, they can elicit a

significant immune response. Furthermore, DNA delivered by AdV exists in an episome

in the transduced cell that neither replicates, nor integrates into the host genome. While

this can be considered a safety advantage over integrating viruses such as retroviruses

(Section 1.3.2.1), it also results in dilution and eventual loss of transgene expression as

the transduced cells replicate and old cells are lost.

AdV have had a lengthy development process. The first AdV removed only the early

region 1A (E1A) to disable replication while also providing space for transgene insertion

[72]. Later developments involved mainly the deletion of the E1B and E3 regions to

reduce the immune response by reducing viral protein expression and to also reduce the

probability of recombination with wildtype Ad [24]. These are often referred to as first-

generation AdV (FG-AdV). Second generation AdV resulted from the deletion of E2A

and E4 regions, further improving the safety, efficacy, and carrying capacity of AdV [58,

71, 113, 182, 219, 237]. Following this path of viral gene deletion, the latest generation

of AdV, termed helper-dependent adenoviral vector (HDAd) or high-capacity adenoviral

vector is devoid of all viral genes and is the vector used in the work herein (Section

1.3.2.5).

26

However, in the long history of AdV, despite the successes enjoyed in improving the

vector and the many clinical trials employed using this vector, it is also known as the

agent that caused the first and most well-known gene therapy related death of a clinical

trial subject. In 1999, Jesse Gelsinger died from an overt immune response to an

excessive dose of AdV injected to his hepatic artery [165]. This resulted in a significant

setback for gene therapy, not only for AdV, but for the entire field in general as the

safety of the concept of gene therapy, and viral vector mediated gene therapy in

particular, underwent significant re-examination. The safety concerns may have been

exacerbated by the fact that Gelsinger’s ornithine transcarbamylase deficiency was

controlled by diet and medication and thus did not represent a condition that would have

been otherwise fatal. A decade and a half later, as work on gene therapy progresses, the

importance of safety over treatment efficacy has remained in the minds of researchers in

this field.

While AdV appears to be ideal for delivering ABCA4 to the retina, the lingering issues

surrounding toxicity and immune response to the vector caused us to choose the latest

development of AdV, namely HDAd, as our vector of choice (Section 1.3.2.5).

1.3.2.5. Helper-dependent Adenoviral vector

During the course of AdV development, it was proposed that the removal of all viral

proteins would lead to a decreased immunogenicity beyond what was being achieved

with the removal of only selected genes [139]. This helper-dependent adenoviral vector

(HDAd) was first developed simultaneously by two separate groups, one in hopes of

27

developing a vector for treating cystic fibrosis [65] and the second towards treating

muscular dystrophy [100].

To produce HDAd, DNA containing only the payload, inverted terminal repeats (ITR),

and packaging signal is transfected into the producer cell line. While this DNA is

produced in bacteria as a plasmid, the portion required for HDAd production is released

prior to transfection by restriction digest to remove the components required for growth

in bacteria and improve efficiency by exposing the ITRs. After transfection, helper virus

is added to provide the necessary viral genes for viral protein production, vector DNA

replication and virion assembly.

Because the DNA containing the payload is flanked by viral ITR sequences, this DNA is

replicated by viral proteins as if it was the viral genome. The presence of the packaging

signal in the payload-carrying DNA causes it to be packaged into virions. The cells are

lysed and the HDAd is purified from helper virus and cell debris by gradient

centrifugation. Any residual helper virus is not replication-competent as it requires the

E1 gene supplied by the HEK293 derived production cell line, much like first generation

adenoviral vectors.

This method was improved via the use of a Cre-Lox system whereby the packaging

signal of the helper virus was flanked by LoxP sites. The addition of Cre recombinase

into the production cell line resulted in the loss of the packaging signal from the helper

virus genome upon infection of the producer cell by the helper virus (Figure 4). The loss

of the packaging signal renders the helper virus genome incapable of being packaged into

virions. This change significantly reduces contamination by helper virus, thus reducing

28

the immunogenicity of the vector preparation [160]. The definitive modification of AdV

into HDAd involved the reversal of the packaging signal within the helper virus [158]. It

was previously noted that homologous recombination was observed between the helper

virus and the HDAd, giving rise to HDAd with rearranged genetic elements and escape

of recombined variants of the helper virus [180]. By reversing the direction of the

packaging signal in only one of these two constructs, homologous recombination would

now result in DNA far too large to be packaged into the virion. This change further

improved the purity, and thus safety and efficacy of the HDAd, as the reduced viral gene

expression in transduced cells also reduced the immune response.

Only one clinical trial has been documented using helper-dependent adenoviral vector in

delivering the F8 gene for treating hemophilia A, but the results were not available in a

peer-reviewed format [117, 175, 212, 226].

HDAd has several unique benefits when compared with other viral gene therapy vectors.

The first is its very large payload capacity; in the absence of any viral genes, almost all of

the packaging capacity of ~30 kb can be used towards carrying transgenes and regulatory

regions for those transgenes. In comparison with AAV which has a packaging capacity of

only 4.7 kb, this allows for the delivery of large genes such as ABCA4.

As an additional effect of the lack of viral genes, the efficacy of transduction is also

increased, resulting in a higher number of cells successfully transduced and increased

transgene expression for a given dose because the lack of viral genes equates with a lack

of viral proteins being produced within the transduced cell. The presence of viral proteins

would increase the immune response to transduced cells and cause them to be cleared by

29

the immune system, hence reducing the strength and duration of transgene expression

[160].

Upon viral entry, the adenovirus capsid undergoes a controlled disassembly. The viral

genome in complex with viral proteins is then transported to the nucleus and delivered

via the nuclear pore complex (Figure 6) [99]. This process of nuclear entry is missing in

certain viruses such as retroviruses, and they must rely on the cell to undergo mitosis and

the break-down of the nuclear-envelope before access to the nucleus can be gained. As

such, adenovirus is capable of transducing cells regardless of their cell-cycle status,

making them capable of transducing quiescent cells.

As previously discussed, the ability of a virus to integrate its DNA into the host genome

can be viewed as a benefit or a safety risk. In the case of gene therapy for Stargardt’s

disease, the ability to integrate into the host genome would be considered only as an

additional safety risk. This is because photoreceptor cells are neural cells that do not

regenerate or “turnover”, and thus any cells transduced would remain active indefinitely.

As there are no concerns regarding the dilution of the transgenes during mitosis, there is

no advantage to viral genome integration.

30

Figure 4 – Schematic of the HDAd production technique with the Cre/Lox system [154]

This figure shows schematically the DNA contribution from the helper virus and vector

plasmid. Of note are the loxP sites on the helper virus genome that flank the packaging

signal (ѱ). The production cell line, 293Cre, express the Cre recombinase that removes

the packaging signal such that the helper virus genome will not be packaged. The cell

line also provides the E1 adenoviral genes, as the helper virus lacks the E1 region,

ensuring the helper virus is unable to replicate in cells other than the producer cell line.

The foreign gene indicated in the figure corresponds to the EGFP and ABCA4 transgene

used in the work herein. The stuffer sequences consist of human non-coding genomic

sequences and serve to provide the appropriate length of DNA for viral packaging.

31

1.3.3. Adenovirus tropism

The tropism of a virus refers to the type of cells that the virus is capable of infecting.

Tropism is primarily a function of the types and quantity of the receptors present that are

compatible between the viral capsid and the cell surface. Note that in the context of this

section, tropism concerns the viral attachment and entry into the host cell, but does not

refer to the requirements of the virus life cycle.

(See Figure 5 for a schematic figure of viral structure and Figure 6 for a schematic

diagram of viral entry)

Adenovirus serotype 5 (Ad5) is part of species C [64]. As such, it uses the

Coxsackievirus B and adenovirus receptor (CAR), heparan sulfate glycosaminoglycans

(HSG), as receptors [137]. Clathrin mediated endocytosis then occurs to envelop the

virion into an endosome after binding between the RGD motif present on the penton-base

that forms part of the viral capsid and the cell-surface integrins [157, 188]. The

conditions within the endosome then trigger viral disassembly and escape from the

endosome [43, 77, 201].

The primary receptor for adenoviral tropism is CAR. This receptor functions as a

homophilic adhesion molecule during neuro-network formation [85], although it was first

discovered for its binding to Coxsackievirus and adenovirus, and hence its name. This

homophilic binding contributes to the integrity of tight junctions formed between

epithelial cells [39]. Almost all adenoviruses, except for species B, utilize CAR as a

receptor for cellular attachment to bind the virion onto the host cell [170]. It is the

trimeric, carboxy-terminal knob of the fibers projecting from the surface of the viral

32

capsid that binds to the CAR, and is a known factor in gene therapy viral vector tropism,

specifically in applications involving Ad5 [171]. Previous studies have demonstrated that

the length and flexibility of the fiber is crucial for CAR dependent viral attachment and

entry, with viruses carrying short fibers having much lower binding affinity for CAR

expressing epithelial cells [231]. In addition, the disruption of CAR by adenovirus fiber

mediates the escape of newly created virions from the epithelial cell layers [217].

Integrins are a diverse family of heterodimeric receptors that serve a wide range of

cellular functions, including cell adhesion, cell growth and differentiation, cell motility,

wound repair, and phagocytosis [88]. Many cellular and extra-cellular proteins contain an

RGD motif that binds to integrins for such purposes [177]. Because integrins are so

widely expressed, many viruses and bacteria of diverse backgrounds and widely varying

targets all express such RGD motifs, including enterovirus [13] Coxsackievirus [174],

HIV [214], as well as Borrelia sp. [38], Yersinia sp. [89] and Bordetella sp. [90]

bacteria. Sequence analysis and modification experiments have revealed that while the

RGD motif is required for integrin interaction, it is the flanking sequences that specify

which integrin the RGD motif will interact with [227].

In the context of adenovirus, an interaction between the RGD motif in the penton base of

the viral capsid [135] and the integrins present on the host-cell surface mediates viral

entry [7, 12, 135, 207, 228]. Although the presence of the RGD motif is not necessary for

successful transduction, it greatly increases the efficiency of infection [70].

Heparan sulfate glycosaminoglycans (HSG) have been observed to contribute to Ad2 and

Ad5 viral attachment in a CAR independent manner such that when both CAR and HSG

33

binding have been blocked, neither serotype is able to establish viral attachment and

entry [49, 50]. Experiments involving the mutation of the fiber have shown that a motif

present in the proximal part of the Ad5 fiber is necessary and sufficient for HSG binding.

When CAR interaction, integrin binding, and the HSG binding have all been disabled,

Ad5 cannot infect animal models [188, 189].

In summary, the viral tropism is largely influenced by the fiber-knob – CAR interaction

for viral attachment, and RGD motif – integrin interaction for viral entry. Interestingly,

there is a synergistic effect in play as a long, flexible fiber in the presence of the RGD

motif allows for simultaneous interaction of both components, resulting in higher

infection efficiency [169].

34

35

Figure 5 – Schematic figure of adenovirus structure [152] and fiber structure [138]

This schematic figure of the adenovirus and fiber demonstrate the icosahedral shape of

the viral capsid formed by the hexons. The fibers of the adenovirus project from the

vertices where the facets of the protein capsid intersect. Of particular note in this diagram

is are the penton base, fiber, and fiber knob as expanded at the bottom of the figure as

they determine the tropism of the virus as discussed in Section 1.3.3.

36

Figure 6 – Schematic diagram of adenovirus attachment and entry via CAR and integrin

binding [152]

The initial step of adenovirus entry involves the binding of the fiber knob to its cell-

surface receptor which is CAR or CD46 in most serotypes. The integrin on the cell

surface then comes in contact with the RGD motif present in the penton base of the fiber,

and triggers endocytosis via a clatherin coated pit. After endosomal escape, the viral

genome is directed to the nucleus via the cell’s microtubule network, making nuclear

entry possible despite the presence of a nuclear envelope.

37

1.3.4. Retinal gene therapy

The first and most well-known success with retinal gene therapy involved the use of

AAV to treat Leber’s congenital amaurosis sub-type 2 (LCA2). Three separate but

simultaneous human clinical trials were conducted to assess the ability of AAV to treat

this disease caused by RPE65 mutations. All three trials reported no safety concerns after

treatment and noticeable but not dramatic increases in visual function [34, 81, 130].

Improvements in visual perception compared to the baseline was still observed 1 year

after treatment [129] and immune response continued to be minimal [184]. The group

with the largest cohort of 12 then selected three patients for administration of the vector

into the contra-lateral eye that was not treated in the initial trial [9]. Both subjective

visual function assessments and objective measurements demonstrated improved visual

abilities in the newly treated eye and minimal immune response.

This data was very encouraging in the development of retinal gene therapy as it

demonstrated the possibility of retinal gene therapy mediated by viral vectors. It also

proved that the immune response is minimal, likely due to the immune privileged status

of the eye. Consequently, researchers have been emboldened to pursue retinal gene

therapy, with a clinical trial underway for choroideremia [126] and another planned for

Leber’s hereditary optic neuropathy [45]. Notably, both employ AAV as their vector

which is understandable given the proven efficacy of AAV in the retina. Also of interest

is that of the three diseases, Leber’s hereditary optic neuropathy is the only one that

involves the neural retina, and it will be interesting to learn how well the AAV can

38

deliver therapeutic genes to the neural retina, and whether there will be an immune

response.

1.3.5. Gene Therapy for Stargardt’s disease

Studies towards applying gene therapy to treat Stargardt’s disease have been conducted

by several groups. AAV has been a particularly hot topic in ocular gene therapy

especially given the progression of the human clinical trials in the treatment of Lebers

congenital amaurosis (Section 1.3.4). However the size of ABCA4 clearly exceeds that of

the packaging capacity of AAV at 4.6 kb. Despite this contradiction, one group has

claimed success in expressing ABCA4 via AAV [4]. However, this finding was not

commonly accepted and three individual groups have followed up to find that the

original study likely observed an aberration of multiple, incomplete parts of ABCA4

being carried by separate virions and that co-transduction within the host cell led to

random recombination. As such, AAV cannot confer expression of the ABCA4 protein to

host cells [83, 114, 234].

Others have investigated the use of lentivirus for delivering ABCA4. Unlike AAV, their

carrying capacity allows for the delivery of an intact ABCA4. Kong et al. used an equine

infectious anemia virus (EIAV) based vector, a sub-category within lentiviral vectors, to

demonstrate reduced A2E accumulation in knock-out mice. However, functional

phenotypes were not assessed and the transduction levels, even when using a CMV

promoter, were very low [109]. Nonetheless, this group has conducted non-human

primate studies with good morphological results, despite the lack of functional assays or

39

biochemical assays [15]. The results have led to human clinical trials (NCT01367444)

although the trials are still in progress and the results are as yet unpublished.

Nanoparticle-based gene therapy (Section 1.3.1.4) using DNA bound lysine polymers has

also been conducted and showed some function recovery, although the distribution of the

expression is poor [78] as the authors have conceded themselves [79].

Although the studies describe herein were initiated before the publication of the EIAV

and the nanoparticle trials, we nonetheless believe there is value in the work as lentivirus

contains safety concerns still under study. In addition, neither the lentivirus nor the

nanoparticles established the same level of transduction distribution as we demonstrated

using helper-dependent adenoviral vectors (Section 3.4.1).

40

1.4. Hypothesis

Given the potential advantages to the use of HDAd, we hypothesized that HDAd could

be used to deliver ABCA4 to the photoreceptor cells of the retina in an animal model.

To test this hypothesis, we proposed two main objectives:

Determine whether HDAd can deliver reporter genes to transduce the retina with

control over cell-specificity via transcriptional regulation

Determine whether replacement of the reporter gene with an ABCA4 expression

cassette can confer ABCA4 expression in cell culture and in vivo using mouse

models.

This work would represent a significant step towards retinal gene therapy as it would

validate the use of HDAd in this application as there have been no studies of the use of

HDAd in the retina, and would circumvent the problems of carrying capacity associated

with AAV which is currently popular in retinal gene therapy.

41

2. Materials and Methods

2.1. Molecular Cloning

2.1.1. Plasmid extraction

For plasmid minipreps, each culture was first plated on 1.5% w/v LB Lennox agar and

incubated at 37˚C in an incubator. Single colonies were picked using a sterile toothpick

and transferred into 1 mL of LB Lennox broth and incubated at 37˚C with shaking at 200

RPM for 8 hours. 50 μL of this was used to inoculate 5 mL of LB Lennox broth and

incubated at 37˚C with shaking at 200 RPM for 16 hours. Plasmid extraction was

performed using the QIAprep Spin Miniprep Kit (QIAGEN Inc. Canada, Mississauga)

with the microfuge protocol as per manufacturer’s instructions. Elution was performed

using 50 μL of Elution Buffer, yielding approximately 500 ng/μL. In all growth media,

ampicillin at 200 μg/mL (Sigma-Aldrich Canada Ltd., Oakville) was used for selection

and for maintaining the plasmid. All microbiological growth media were purchased from

Difco (Becton, Dickinson and Company, Mississauga) unless otherwise stated.

A list of plasmids can be found in Table 1.

42

Table 1 – List of plasmids

Plasmid name Construct Notes pBluescript II SK (+)

Common cloning construct

pBSIIPubcHAHprp3CodingBGHpA

From previous work in Hu Lab; source of Ubiquitin C intron

pC4HSU Plasmid for HDAd vector production (Sections 1.3.2.5, 2.3)

pcDNA3 Used as source of bovine growth hormone polyA tail

pEGFP-C1 Used as source of EGFP after addition of stop codon

pMP6A Used as source of hybrid intron (Section 3.2)

pRK5-ABCR Source of ABCA4 [199] pSL001 BGH polyA BGH polyA PCR from pcDNA3 pSL002 EGFP – BGH polyA pSL003 Hybrid intron – EGFP –

BGH polyA

pSL004 PCMVIE – Hybrid intron – EGFP – BGH polyA

pSL005 EGFP EGFP PCR from pEGFP-C1 with stop codon insertion

pSL006 Hybrid intron Hybrid intron PCR from pMP6A pSL007 PCMVIE CMVIE promoter from phCMV1 pSL008 PCMVIE – Hybrid intron pSL010 PRho323 – hybrid intron –

EGFP – BGH polyA 323 bp rhodopsin promoter PCR from RP11-529F4

pSL011 PRho1553 – hybrid intron – EGFP – BGH polyA

1553 bp rhodopsin promoter PCR from RP11-529F4

pSL012 IRBPE - PRho323 –Hybrid intron – EGFP – BGH polyA

IRBP Enhancer PCR from genomic HEK293 DNA

pSL013 IRBPE - PRho1553 –Hybrid intron – EGFP – BGH polyA

IRBP Enhancer PCR from genomic HEK293 DNA

pSL014 PCMVIE – Hybrid intron – adaptor – BGH polyA

PstI-AgeI-PacI-BamHI adaptor put in place of EGFP for ABCA4 insertion

pSL015 PRho323 –Hybrid intron – adaptor – BGH polyA

PstI-AgeI-PacI-BamHI adaptor put in place of EGFP for ABCA4 insertion

pSL016 PRho1553 –Hybrid intron – PstI-AgeI-PacI-BamHI adaptor

43

adaptor – BGH polyA put in place of EGFP for ABCA4 insertion

pSL017 IRBPE - PRho323 –Hybrid intron – adaptor – BGH polyA

PstI-AgeI-PacI-BamHI adaptor put in place of EGFP for ABCA4 insertion

pSL018 IRBPE - PRho1553 –Hybrid intron – adaptor – BGH polyA

PstI-AgeI-PacI-BamHI adaptor put in place of EGFP for ABCA4 insertion

pSL019 PCMVIE – Hybrid intron – ABCA4 – BGH polyA

ABCA4 inserted using adaptor

pSL020 PRho323 – Hybrid intron – ABCA4 – BGH polyA

ABCA4 inserted using adaptor

pSL021 PRho1553 –Hybrid intron – adaptor – BGH polyA

ABCA4 inserted using adaptor

pSL022 IRBPE - PRho323 – Hybrid intron – ABCA4 – BGH polyA

ABCA4 inserted using adaptor

pSL023 IRBPE - PRho1553 – Hybrid intron – ABCA4 – BGH polyA

ABCA4 inserted using adaptor

pSL024 PCMVIE – Hybrid intron – EGFP – BGH polyA in pC4HSU

From pSL004

pSL025 IRBPE - PRho1553 –Hybrid intron – EGFP – BGH polyA in pC4HSU

From pSL013

pSL026 PCMVIE – Hybrid intron – ABCA4 – BGH polyA in pC4HSU

From pSL019

pSL027 IRBPE - PRho1553 – Hybrid intron – ABCA4 – BGH polyA in pV4HSU

From pSL023

pSL028 PCMVIE – Hybrid intron – ABCA4::EGFP – BGH polyA

Fusion protein of ABCA4 and EGFP

pSL029 PRho323 – hybrid intron – ABCA4::EGFP – BGH polyA

Fusion protein of ABCA4 and EGFP

pSL030 PRho1553 – hybrid intron – ABCA4::EGFP – BGH polyA

Fusion protein of ABCA4 and EGFP

pSL031 IRBPE - PRho323 –Hybrid intron – ABCA4::EGFP – BGH polyA

Fusion protein of ABCA4 and EGFP

pSL032 IRBPE - PRho1553 –Hybrid Fusion protein of ABCA4 and

44

intron – ABCA4::EGFP – BGH polyA

EGFP

pSL033 PCMVIE – Hybrid intron – ABCA4::EGFP – BGH polyA in pC4HSU

From pSL028; Did not proceed with virus production

pSL035 PRho1553 – hybrid intron – ABCA4::EGFP – BGH polyA in pC4HSU

From pSL030; Did not proceed with virus production

pSL044 PCMVIE – EGFP – BGH polyA

Hybrid intron removed

pSL045 IRBPE - PRho1553 –EGFP – BGH polyA

Hybrid intron removed

pSL046 PCMVIE – EGFP – BGH polyA in pC4HSU

From pSL044; For vector production of CMV-EGFP

pSL047 IRBPE - PRho1553 –EGFP – BGH polyA in pC4HSU

From pSL045; For vector production of Rho-EGFP

pSL048 PCMVIE –CMV Intron A – EGFP – BGH polyA

CMV Intron A inserted from PCR of phCMV1

pSL049 IRBPE - PRho1553 – CMV Intron A – EGFP – BGH polyA

CMV Intron A inserted from PCR of phCMV1

pSL050 PCMVIE –CMV Intron A – EGFP – BGH polyA

Did not proceed with virus production

pSL051 IRBPE - PRho1553 – CMV Intron A – EGFP – BGH polyA in pC4HSU

Did not proceed with virus production

pSL052 IRBPE - PRho1553 – UBC Intron – EGFP – BGH polyA

UBC intron inserted from p pBSIIPubcHAHprp3CodingBGHpA

pSL053 IRBPE - PRho1553 – UBC Intron – Adaptor – BGH polyA

pSL054 IRBPE - PRho1553 – UBC Intron – ABCA4 – BGH polyA

pSL056 IRBPE - PRho323 –EGFP – BGH polyA

pSL057 PCMVIE – Adaptor – BGH polyA

pSL058 PCMVIE – CMV Intron A – Adaptor – BGH polyA

pSL059 PCMVIE – ABCA4 – BGH polyA

pSL060 PCMVIE –ABCA4::EGFP – BGH polyA

45

pSL061 PCMVIE – CMV Intron A – ABCA4 – BGH polyA

pSL062 PCMVIE – CMV Intron A – ABCA4::EGFP – BGH polyA

pSL065 IRBPE - PRho1553 – CMV Intron A – ABCA4::EGFP – BGH polyA

pSL066 IRBPE - PRho1553 – CMV Intron A – ABCA4 – BGH polyA

pSL067 IRBPE - PRho1553 –ABCA4 – BGH polyA

pSL068 IRBPE - PRho1553 –ABCA4 – BGH polyA in pC4HSU

From pSL067; For vector production; Rho-ABCA4

pSL069 PCMVIE – ABCA4 – BGH polyA in pC4HSU

From pSL059; For vector production; CMV-ABCA4

pSL070 PCAG – EGFP – BGH polyA pSL071 PCAG – EGFP – BGH polyA

in pC4HSU From pSL070; For vector production; CAG-EGFP

pSL072 PCAG – adaptor – BGH polyA

pSL073 PCAG – ABCA4 – BGH polyA

pSL074 PCAG – ABCA4 – BGH polyA in C4HSU

From pSL073; For vector production; CAG-ABCA4

RP11-529F4 BAC library clone containing rhodopsin promoter, purchased from The Center for Applied Genomics, Toronto

46

2.1.2. Transformation of competent E. coli DH5α

Competent E. coli DH5α was prepared using the calcium chloride method [179]. DNA

used for transformation was prepared by plasmid miniprep as per Section 2.1.1. An

individual 100 μL aliquot of the competent bacteria was removed from -80˚C storage and

thawed on ice for 10 minutes. 10 μL of DNA at approximately 500 ng/μL was added to the

bacteria and incubated further on ice for 30 minutes. The cells were then heat-shocked in a

42°C water-bath for 45 seconds and placed on ice for 2 minutes. 1 mL of LB broth was

added to each aliquot and incubated at 37°C for 45 minutes. 10 μL and 100 μL aliquots were

plated onto agar with the appropriate antibiotic. A separate 10 μL aliquot was plated onto

agar without antibiotic to demonstrate the viability of the culture. The remainder was

centrifuged at 3,000 x g for 5 minutes. Most of the supernatant was removed, the pellet was

resuspended, and plated.

2.1.3. Polymerase Chain Reaction

Polymerase chain reactions (PCR) were conducted using a Geneamp PCR System 2400

thermocycler (PerkinElmer Inc, Woodbridge). The Finnzyme Phusion High-Fidelity PCR

Kit (New England Biolabs Ltd., Whitby) was used, including all associated reagents.

Each 200 μL tube contained 25 to 50 μL of the reaction mixture (For 50 μL reaction: 37

μL water, 1 μL dNTP at 10 mM, 0.5 μL of each primer, 0.5 μL DNA template at 250

ng/μL, 10 μL of 5x HF Buffer, 0.5 μL polymerase). The primers used are listed in Table

2.

Where required for subsequent manipulations, post-PCR clean-up was conducted using

the QIAquick PCR Purification Kit (QIAGEN Inc. Canada, Mississauga) with the

47

microfuge protocol as per manufacturer’s instructions. Elution was performed using 20

μL of Elution Buffer per 50 μL of PCR reaction.

48

Table 2 – List of primers

Name Construct Sequence Notes

20090205-01 PstI-EGFP Forward ATCTGCAGCGCCACCATGGTGA

For PCR of EGFP from pEGFP-C1

20090205-02 EGFP-BamHI Reverse

ATGGATCCTCACTTGTACAGCTCGTCC

20090206-01 BamHI-BGH polyA Forward

ATGGATCCTATTCTATAGTGTCACCTAAATGCTAGAG

For PCR of BGH polyA tail from pcDNA3

20090206-02 BGH polyA-NotI Revserse

ATGCGGCCGCTCCCCAGCATGCCT

20090206-03 EcoRV-ExIntron Forward

ATGATATCGCCTGGAGACGCCA For PCR of hybrid

intron from pMP6A 20090206-04

ExIntron-PstI Reverse

ATCTGCAGGTTGGACCTGGGAGTGG

20090209-01 XhoI-PCMVIE Forward

ATCTCGAGTAGTTATTAATAGTAATCAATTACGGGG For PCR of CMVIE

promoter from phCMV1

20090209-02 PCMVIE-EcoRV Reverse

ATGATATCGATCTGACGGTTCACTAAACC

20090320-02 Xho-PRHO500 Forward

ATGCCTCGAGCAATTCCATGCAACAAGGA

For PCR of rhodopsin promoter from RP11-529F4; single reverse promoter, multiple forward promoters to create different promoter lengths

20090320-03 Xho-PRHO1000 Forward

ATCGCTCGAGCAGTGCCCTGTCTGCTG

20090320-04 Xho-PRHO2000 Forward

ATCGCTCGAGCTGCTAAGCTGTGTGGGAT

20090414-01 PRHO-EcoRV Reverse 2

GCATGATATCGGCTGTGGCCCTTG

20090414-02 XhoI-PRHO323 Forward

GTACCTCGAGAGTTAGGGGACCTTCTCCTC

20090414-03 XhoI-PRHO1553 Forward

GCATCTCGAGTGTTTGTGGTCCCTGTG

20090415-01 KpnI-IRBP Enhancer Forward

GCATGGTACCTGGAGGCAGAGGAGAAG For PCR of IRBP

enhancer 20090415-02

IRBP-XhoI Enhancer Reverse

GCATCTCGAGGCTTTATGAAGGCCAA

49

AGA

20090506-01 AgeI-ABCA4 Forward

CGATACCGGTCGCCACCATGGGCTTCGTGAGACAGATAC For PCR of ABCA4

from pRK5-ABCA4 20090506-02

ABCA4-PacI Reverse

CGATTTAATTAATCAGTCCTGGGCTTGTCG

20090506-03 PstI-AgeI-PacI-BamHI Adaptor Forward

GCGATACCGGTCGATTTAATTAACGATG

Joined without PCR to form an adaptor. Used in place of EGFP to add restriction sites for ABCA4 insertion

20090506-04 PstI-AgeI-PacI-BamHI Adaptor Reverse

GGATCCATCGTTAATTAAATCGACCGGTATCGCTGCAG

20091210-01 SalI-ABCA4-EGFP Forward

ATCGGTCGACAAGCCCAGGACATGGTGAGCAAGGGCG

Used to PCR with pRK5-ABCA4 to form an ABCA4 mega-primer and then PCR with pSL005 to form ABCA4::EGFP fusion

20091210-02 EGFP-PacI Reverse ATCGTTAATTAATCACTTGTACAGCTCGTCCATG

20100707-01 CMV Intron A-EcoRV Reverse

ATCGGATATCCTGCAGAAAAGACCCAGG

For PCR of CMV Intron A from phCMV1

20100707-02 EcoRV - CMV Exon 1 Forward

ATGCGATATCCAGATCGCCTGGAGAC

20100809-03 UBC Intron Corr Forward

AGCCCGCTACTCACCAA

For PCR of UBC intron from pBSIIPubcHAHprp3CodingBGHpA

20100809-04 UBC Intron Corr Reverse

TTGGTGAGTAGCGGGCT

20100809-05 AgeI-EGFP Forward

GTACACCGGTCGCCACCATGGTGAGC

For PCR of EGFP from pEGFP-C1 with a different added restriction site

20101018-01 Mid-IRBPE Forward

CAGCAGGGCTAAGGATATG

For use in sequencing

20101018-02 Mid-BGH PolyA Reverse

AGCATGCCTGCTATTGTC

For use in sequencing

20101018-03 Late-PRHO Forward

GAGGTCACTTTATAAGGGTCTG

For use in sequencing

20101018-04 Late-EGFP Reverse GCTCAGGTAGTGGTTGTCG

For use in sequencing

20101018-05 Early-PCMV Forward

CATAGCCCATATATGGAGTTCC

For use in sequencing

50

20101018-06 Late-PCMV Forward

CGGTGGGAGGTCTATATAAGC

For use in sequencing

20111014-01 hABCA4-F CGGAGGATTCTGATTCAGGAC

For qRT-PCR of ABCA4

20111014-02 hABCA4-R GGGAGCAGACATTGGAGTC

For qRT-PCR of ABCA4

20111014-03 ABCA4-End Forward

TGCTCATCGAGGAGTACTCAG

For use in sequencing

20111014-04 ABCA4-PolyA Gap Reverse

GGTGACACTATAGAATAGGATCCATC

For use in sequencing

51

2.1.4. Restriction digest

Restriction digests were performed as per manufacturer supplied protocols. All reactions

consisted of 5% of the enzyme mixture in the appropriate buffer, supplemented with 100

μg/mL bovine serum albumin (BSA). The DNA content of the reaction consisted of up to

50% of the volume of the reaction when derived from plasmid miniprep (Section 2.1.1)

or from PCR after clean-up (Section 2.1.3). The remainder of the reaction consisted of

water and the supplied reaction buffer. For reactions where phosphate removal from the

cleavage sites was desired, 1 μL of calf intestinal alkaline phosphatase was added to the

reaction.

Where blunt-ending after restriction digest was desired, the reaction was first cleaned-up

using the QIAquick PCR Purification Kit (QIAGEN Inc. Canada, Mississauga) with the

microfuge protocol as per manufacturer’s instructions for post-enzymatic reaction

cleanup. Mung bean nuclease was used as per manufacturer’s instructions. Temperature

control for the blunt-ending reaction was accomplished by incubating inside an

appropriately programmed thermocycler.

Where alkaline phosphatase treatment was desired to prevent self-ligation, calf intestinal

phosphatase (CIAP) was used as per manufacturer’s instructions. It was added with the

restriction enzyme in most cases, but added after the digest and further incubated if the

restriction enzyme required an incubation temperature other than 37 ˚C.

All restriction digest enzymes, CIAP, BSA, and mung bean nuclease were purchased

from New England Biolabs (New England Biolabs Ltd., Whitby).

52

2.1.5. Agarose gel electrophoresis

Agarose gels were cast at 0.8% agarose (BioShop Canada Inc., Burlington) by mass and

run at 80 volts for 90 minutes in tris-acetate EDTA buffer (TAE: 40 mM Tris-base, 1

mM EDTA, 20mM CH3COOH). Visualization of DNA was accomplished staining the

gel in 0.5 μg/mL ethidium bromide (Sigma-Aldrich Canada Ltd., Oakville ) solution in

TAE, and then photographed under UV transillumination. For resolving DNA below

2,000 bp, 1.5% agarose gels were used while 0.5% agarose gels were used for separating

DNA larger than 8,000 bp.

Where required, the DNA was extracted from the gel using the QIAquick Gel Extraction

Kit (QIAGEN Inc. Canada, Mississauga) with the microfuge protocol as per

manufacturer’s instructions. Elution with 10 μL of elution buffer was performed twice to

maximize DNA concentration and recovery.

2.1.6. Ligation

Ligations were performed with 100 ng of vector DNA per reaction, with the insert DNA

at molar ratios of 3, 5, and 10 times relative to the vector. The combination of vector

DNA, insert DNA, and water was placed in a PCR tube and heated in the thermocycler to

80°C, then reduced to 16°C at 1°C per minute. Buffer and T4 DNA ligase (New England

Biolabs Ltd., Whitby) were then added as per manufacturer recommendations and

incubated at 16°C for 4 hours, then stored at 4°C until transformation.

53

2.1.7. Sequencing

DNA for sequencing was prepared by plasmid miniprep (Section 2.1.1) or by PCR

(Section 2.1.3). The DNA was then diluted to 250 ng for plasmid DNA, or 50 ng for PCR

products, both in 7 μL of sterile water. 5 pmols of primer in 0.7 μL of sterile water was

added. A list of the primers used can be found in Table 2. All sequencing was performed

by The Center for Applied Genomics at The Hospital for Sick Children. The resulting

electrophoretograms were reviewed manually using GENtle (SourceForge,

http://sourceforge.net/projects/gentle-m/).

2.2. Tissue Culture

2.2.1. Cell lines

The mammalian tissue cell lines used are listed in Table 3 along with the media used and

sources. The cells were grown in either 75 cm2 or 25 cm2 ventilated tissue culture flasks

(BD Biosciences, Mississauga) at 37°C in 5% CO2, 95% room-air atmosphere. When the

cells exceeded 80% confluence, the medium was removed by aspiration. The cells were

washed three times in 5 mL sterile PBS (Wisent Inc., St. Bruno). All liquid was removed

before 1 mL of 0.25% trypsin with 2.21 mM EDTA (Wisent Inc., St. Bruno) was applied.

When the cells detached, 5 mL of medium was added and the entire volume was

transferred to a 15 mL conical-bottom centrifuge tube. The cells were centrifuged for 5

minutes at 1200 x g, and the supernatant was discarded. The pellet was then resuspended

in 5 mL of medium. A 0.5mL volume of this suspension was seeded to 20 mL of medium

in a new 75 cm2 flask and incubated. Unless otherwise stated, all media were

supplemented with penicillin-streptomycin (Wisent Inc., St. Bruno).

54

Table 3 – List of cell lines

Cell line Media Notes

116

MEM (Joklik modified), 10% FBS, Penicillin/Streptomycin; Hygromycin 100 μg/mL

Suspension adapted, Cre expressing cell line for vector production [158] MEM from Sigma-Aldrich Canada Ltd., Oakville; FBS from Gibco (Life Technologies Inc., Burlington)

ARPE-19 DMEM-F12, 10% FBS, Penicillin/Streptomycin

RPE like cell line DMEM-F12 from Wisent Inc., St. Bruno

HeLa RPMI 1640, 10% FBS, Penicillin/Streptomycin

Cervical epithelial cell line RPMI 1640 from Wisent Inc., St. Bruno

WERI-Rb RPMI 1640, 10% FBS, Penicillin/Streptomycin

Retinoblastoma cell line, used for in vitro studies with cell-type specific promoters Kind gift of Dr. Rod Bremner (University of Toronto, Toronto)

Y79 RPMI 1640, 10% FBS, Penicillin/Streptomycin

Retinoblastoma cell line, used for in vitro studies with cell-type specific promoters; Later replaced with WERI-Rb; Kind gift of Dr. Rod Bremner (University of Toronto, Toronto)

55

2.2.2. Transfection

1 x 106 cells per well were seeded into 6-well tissue culture treated plates (BD

Biosciences, Mississauga) in 1 mL of transfection medium (complete tissue culture

medium without antibiotics). The cells were incubated until approximately 80%

confluence. For each well, 800 ng of DNA from DNA miniprep (Section 2.1.1) was

suspended in 50 μL of plain media. At the same time, 2 μL of Invitrogen Lipofectamine

2000 (Life Technologies Inc., Burlington) was suspended in 50 μL of basal media. Both

were incubated at room temperature for 5 min before being combined. This was further

incubated at room temperature for 20 minutes before the mixture was added to the cells.

The cells were then incubated for 16 hours, after which the medium was aspirated. The

cells were washed and incubated in complete medium.

2.2.3. Transduction

2.5 x 105 cells per well were seeded into a 6-well tissue culture treated plate in 1 mL of

medium and incubated overnight. The medium was removed and the attached cells were

washed twice with plain medium without antibiotics and FBS. 300 μL of plain medium

was added per well and the viral vector, appropriately diluted in 100 μL of plain medium

for the desired titer, was added. The plates were gently agitated to ensure the suspension

was well mixed, and incubated for 2 hours under normal culture conditions. Each well

was then supplemented with 2.6 mL of complete media to restore normal FBS and

antibiotics concentrations.

56

2.2.4. Flow Cytometry

Cells in each well from a 24 well plate were trypsinized using 200 μL of 0.25% trypsin

with 2.21 mM EDTA (Wisent Inc., St. Bruno). 800 μL of PBS were then added to the

well and the entire volume transferred to a test tube and analysed on a BD FACSCalibur

(BD Biosciences, Mississauga). Data analysis was performed using FlowJo software

(Tree Star Inc, Ashland).

2.2.5. qRT-PCR

Quantitative real-time PCR was performed using RNA isolated from tissue culture cells

using the Illustra RNAspin Mini Kit (GE Healthcare Life Sciences, Baie d’Urfe) as per

manufacturer’s instructions. For eye tissues, the eye was prepared by enucleation and

dissection in the same manner as for cryosection for imaging (Section 2.4.4). This leaves

the eye-cup containing the retina, with the lens and cornea removed. After dissection, the

remaining musculature was resected and homogenized in lysis buffer using a bead-beater

with sterile stainless beads of 5 mm diameter. Complete homogenization was confirmed

by visual inspection. RNA extraction then proceeded as per manufacturer’s instruction.

The RNA was quantified by photospectrometry after elution.

For reverse transcription into cDNA, Invitrogen SuperScript II Reverse Transcriptase

was used (Life Technologies Inc., Burlington) as per manufacturer’s instructions. 1 μg of

the RNA was used as template with random hexamer primer (Fisher Scientific – Canada,

Ottawa) and 1 μL of RNaseOUT ribonuclease inhibitor (Life Technologies Inc.,

Burlington) in a 20 μL reaction. The reaction was incubated in a Geneamp PCR System

57

2400 thermocycler (PerkinElmer Inc, Woodbridge) under conditions specified by the

manufacturer’s instructions.

The resultant cDNA was diluted by 5-fold before use in qPCR. Power SYBR Green PCR

Master Mix was used as per manufacturer’s instructions for 25 μL reactions. 1.5 μL of 20

μM of each primer was added. The primers used can be found in Table 2. The instrument

used was a 7500 Real-Time PCR System. Both the reagent and the instrument were

purchased from Applied Biosystems (Life Technologies Inc., Burlington).

2.2.6. Western Blot

Protein for western blotting was harvested by washing the cells in PBS and lysing in a

detergent buffer (50 mM HEPES pH 7.4, 50 mM NaCl, 2 mM MgCl2, 26 mM CHAPS, 1

mM DTT; NaCl and MgCl2 from BioShop Canada Inc., Burlington, all other chemicals

from Sigma-Aldrich Canada Ltd., Oakville), containing Complete Protease Inhibitor

(Hoffmann-La Roche Limited, Mississauga) as per manufacturer’s instructions. 300 μL

of buffer was added to each well of a 6-well plate and incubated on ice for 10 minutes

before each sample was transferred to a microcentrifuge tube and centrifuged at 12,000 g

for 60 minutes at 4 ˚C. 30 μL of the supernatant was combined with 30 μL of sample

buffer then loaded into a well of an 8% SDS poly-acrylamide mini-gel. The gel and

buffer were as follows:

2x sample buffer: 10% SDS 400 μL/mL, 0.5M Tris pH 6.8 250 μL/mL, glycerol 200

μL/mL, 0.2% bromophenol blue 50 μL/mL, 2-mercaptoethanol 100 μL/mL

4x separating gel buffer: Tris base 181.6 g/L, SDS 1g/L, pH 6.6

4x stacking gel buffer: Tris base 60.54 g/L, SDS 1g/L, pH 6.8

58

8% SDS separating gel: 30% acrylamide/bisacrylamide 5.33 mL, 4x separating gel buffer

5 mL, water 9.57 mL, 10% APS 100 μL, TEMED, 10 μL

Stacking gel: 30% acrylamide/bisacrylamide 1.33 mL, 4x stacking gel buffer 2.5 mL,

water 6.06 mL, 10% APS 100 μL, TEMED, 10 μL

(30% acrylamide/bisacrylamide solution, APE, and TEMED from Bio-Rad Life Science,

Mississauga; 2-mercaptoethanol from Sigma-Aldrich Canada Ltd., Oakville; All other

chemicals from BioShop Canada Inc., Burlington)

The gel was run at 200 volts for 2 hours or until the bromophenol blue reached the

bottom of the gel. The gel running buffer consisted of Tris base 2.9 g/L, glycine 14.4 g/L,

SDS 1g/L.

After separation, the proteins were transferred onto a Protran nitrocellulose membrane

(Sigma-Aldrich Canada Ltd., Oakville) in transfer buffer (Tris base 3.3 g/L, glycine 14.4

g/L, methanol 20% v/v). The transfer was performed at 200 volts for 1 hour with the

entire apparatus chilled with ice.

After transfer, the membrane was blocked with 1% skim milk in PBS for 1 hour. The

solution was discarded and the primary antibody diluted in PBS was added. After

incubation at room temperature for 1 hour with gentle rocking, the membrane was

washed 3 times in PBS with 0.05% Tween-20 (Sigma-Aldrich Canada Ltd., Oakville) for

15 minutes each time. The horseradish peroxidase secondary antibody was then applied

after dilution in PBS with 0.1% Tween-20 and 0.1% skim milk and incubated with

rocking for 1 hour before washing 3 times as previously described. Amersham ECL

Prime (GE Healthcare Life Sciences, Baie d’Urfe) was then applied as per

manufacturer’s instructions and the membrane was imaged using an Odyssey FC

Imaging System (Li-Cor Biosciences, Lincoln).

59

A list of antibodies can be found in Table 4.

60

Table 4 – List of antibodies

Target Type/Conjugate Notes

ABCA4 Mouse IgG

Rim 3F4;Targets C-terminal of ABCA4; hybridoma fluid; Used at 1:3 dilution for immunofluorescence and 1:5 dilution for Western blot Kind gift of Dr. Robert S. Molday (University of British Columbia, Vancouver)

GAPDH Rabbit IgG (polyclonal) Used for Western blotting at 1:3000 dilution; Trevigen, Gaithersburg

Mouse IgG Alexa Fluor 488

Used for immunofluorescence at 1:3000 dilution; Molecular Probes (Life Technologies Inc., Burlington)

Mouse IgG Horseradish Peroxidase Used for Western blotting at 1:3000 dilution; Bio-Rad Life Science, Mississauga

Rabbit IgG Cy3

Used for immunofluorescence at 1:500 dilution; Jackson ImmunoResearch Laboratories, West Grove

Rabbit IgG Horseradish Peroxidase Used for Western blotting at 1:3000 dilution; Bio-Rad Life Science, Mississauga

Rhodopsin Rabbit IgG (polyclonal)

Used for immunofluorescence at 1:100 dilution; Imgenex, San Diego

61

2.3. HDAd vector production

Viral vector production was accomplished based on previously published protocols [154,

158]. All HDAd production was based on the C4HSU plasmid [154, 158] as the

backbone for gene insertion. 10 μg of the plasmid was digested with PmeI to remove the

portions of the plasmid required for bacterial propagation, and expose the inverted

terminal repeats. A 6 cm diameter tissue culture plate of 116 cells (293-derived, Cre

expressing, suspension adapted production cell line; Table 3) seeded at 20% confluence

was transfected using the CellPhect Transfection Kit (GE Healthcare Life Sciences, Baie

d’Urfe) as per manufacturer’s instructions when the culture reached 90% confluence.

After 24 hours of additional incubation, the medium was changed and 4 x 108 PFU of

NG163 helper virus was added. The culture was incubated for a further 4-5 days and

monitored for cytopathic effect (CPE).

When CPE was present, the cells were harvested by repeatedly pipetting up and down to

detach the cells. The cells in the mixture were lysed by freezing in dry ice chilled

ethanol, and thawed. The lysate in medium was aliquoted and stored in 4% sucrose at -

80˚C and referred to as passage 0 (P0). 20% of the lysate was then used to inoculate

another 6 cm plate of 116 cells at 90% confluence, while simultaneously adding 1.6 x 108

PFU of NG163 helper virus. After 4-5 days of incubation or upon appearance of CPE,

the cells were again harvested and lysed by freezing and thawing as for P0. This mixture

of lysate and media was also aliquoted, stored, and referred to as passage 1 (P1). This

was repeated to obtain passages 2, 3, and 4.

62

For large scale amplification, 10x 15 cm diameter tissue culture plates of 116 cells at

90% confluence were harvested and incubated in a 3 L Celstir flask (Wheaton, Millville)

with 1 liter of media at 60 RPM. At 3 x 105 cells/mL, 500 mL of media is added. On the

2 subsequent days, 500 mL and 1000 mL of media were added. One day after the final

media addition, the cell suspension was centrifuged at 2000 RPM (700 g) at 4 ˚C for 10

minutes in 500 mL polypropylene centrifuge bottles, using a J2-HC centrifuge with a JA-

10 rotor. The centrifuge, rotor, and centrifuge bottles were all purchased from Beckman

Coulter Canada (Mississauga). The cell pellet was resuspended in 150 mL of the

supernatant (conditioned media).

The cell-suspension and 1.1 x 1011 PFU of NG163 were combined in a 250 mL Celstir

flask (Wheaton, Millville). Either the entire volume of passage 3 or 4 from the small

scale vector production, or 2.2 x 1013 vector particles (VP) of previously purified HDAd

vector was also added and incubated for 2 hours with stirring at 60 RPM. If the

previously purified HDAd was of a known infectious titre (IU), 1.1 x 1011 IU was used.

This was then transferred into a 3 L Celstir flask containing 460 mL of conditioned

media from previous cell amplification and 1370 mL of fresh media, and incubated for

72 hours with stirring. The cells were harvested by centrifugation as previously

described, and resuspended in 17 mL of 10 mM Tris-HCl at pH 8.0 (storage buffer) and

stored at -80 ˚C.

To lyse the cell suspension, it was thawed on ice and 1.5 ml of 5% sodium deoxycholate

was added, disrupting lipid membranes without affecting the viral capsid. It was

incubated at room temperature for 30 minutes with gentle rocking. 100 μL of Benzonase

63

nuclease (Sigma-Aldrich Canada Ltd., Oakville) was added and incubated at room

temperature for 30 minutes with gentle rocking. Cell debris was eliminated by

centrifugation at 5500 RPM (2400 g) at 4 ˚C for 15 minutes. This centrifugation

employed 50 mL thick-walled polypropylene centrifuge bottles and a JA-20 rotor, both

from Beckman Coulter Canada (Mississauga), using a J2-HC centrifuge.

To purify the vector, a CsCl gradient was formed in a thin wall, ultra-clear, open top, 14

mL centrifuge tube containing 3 mL of 1.25 g/mL, 3 mL of 1.35 g/mL, and 0.5 mL of 1.5

g/mL CsCl in 10mM Tris-HCl at pH 8.0 (storage buffer). The vector suspension was

placed on the top of this gradient. The mixture was centrifuged at 35,000 RPM (151,000

g) at 4 ˚C for 60 minutes using a SW41 swinging bucket rotor in an Optima

ultracentrifuge, both from Beckman Coulter Canada (Mississauga). Two bands are

typically visible, and the band containing the HDAd vector can be identified as the more

abundant band, while the less abundant band is comprised of residual helper virus.

Identification can also be confirmed by comparing the relative packaged DNA content.If

the HDAd contains a larger packaged DNA than the helper virus genome, HDAd would

be expected to be in the lower, denser portion of the gradient. If the packaged DNA size

is smaller than the helper virus genome, it would be expected to be the higher band. The

appropriate band was harvested by puncturing the tube with a 20 gauge needle and

aspirating the band. This was then transferred into a 15 mL conical bottom tube with an

equal volume of storage buffer. A second gradient centrifugation was done layering the

extracted band from the first centrifugation step on 7 mL of 1.3 g/mL CsCl, with the

remaining volume filled with storage buffer. It was centrifuged overnight at 35,000 RPM

64

(151,000 g) at 4 ˚C, and the visible band was harvested. The equipment was identical to

the previous step.

To dialyze the vector, the harvested band was injected into a 10k molecular weight cut-

off Slide-A-Lyzer dialysis cassette (Fisher Scientific – Canada, Ottawa). This was

dialyzed in 500 mL of storage buffer at 4 ˚C for 24 hours with 2 changes of buffer. The

final product was extracted from the dialysis cassette and stored in aliquots containing

10% glycerol. A small portion was used for measuring the DNA content at OD260. An

estimate of the virus particle density is then calculated based on the packaged DNA size

and OD260. The formula for determining the titre [154] is as follows:

OD260 • dilution factor • 1.1 x 1012 • 36 / (size of vector in kb)

The typical size of the vector genome is approximately 37 kb.

Much of the vector production was performed by Cathleen Duan in our laboratory. Her

contribution was very much appreciated.

2.4. Animal models

All animal work described herein was performed at the Laboratory Animal Services of

the Hospital for Sick Children with supervision by the veterinary staff and with the

approval of the Animal Care Committee. All animals were mice of CD1 strain, and

purchased through Charles River Laboratories (Sherbrooke).

2.4.1. Mydriasis and Anesthesia

24 hours before injection, the right eye of each mouse was administered 1 drop of 1%

atropine sulfate. Within 30 minutes of injection, 1 drop of 1% tropicamide and 1 drop of

65

2.5% phenylephrine HCl were administered to the right eye, and readministered

immediately before injection if the pupil dilation was deemed inadequate. The above

ophthalmic solutions were purchased from Alcon (Alcon Canada Inc., Mississauga). To

protect the eye and improve visualization into the eye, the right eye was covered using a

solution of 2.5% hypromellose (Akorn, Lake Forest). The surface tension of the solution

provided a smooth surface, avoiding the optical distortion that resulted from viewing

through the relatively rough surface of the eye.

For anesthesia, a mixture of 1 mg ketamine and 0.1 mg xylazine per 10 g body weight

was administered by intraperitoneal injection. These were sourced from Zoetis (Zoetis

Canada, Kirkland) and Bayer (Bayer HealthCare, Toronto) respectively.

2.4.2. Trans-sclera sub-retinal injection

All injections took place when the mice were 3 to 6 weeks of age. Before injection,

fluorescein (Sigma-Aldrich Canada Ltd., Oakville) was added to a final concentration of

0.1 mg/mL to give colour to the vector suspension such that the injection could be better

visualized.

(See Figure 1 for a schematic diagram of the eye)

For the trans-sclera method of sub-retinal injection, a 32 gauge needle (BD – Canada,

Mississauga) was used to make an incision distal to the corneal limbus, medial to the

head and parallel to the sagittal plane. This is identified externally as the “whites” of the

eye, near the edge where the iris begins. A custom 33 gauge, 1 inch, blunt-point needle,

mounted to a Model 85, 5 μL syringe (Hamilton Company, Reno) loaded with 1 μL of

66

the vector was inserted into this opening. It was guided by dissection microscope (M-

series; Leica Microsystems Inc., Concord) through the eye to the portion of the retina

directly opposite the incision site. The needle was pressed against the retina with gentle

pressure to ensure penetration across the neural retina without exceeding beyond the

choroid. The plunger was then depressed at a rate of less than 1 μL / minute. If excessive

leakage was observed by the presence of colour in the vitreous humour, the injection was

paused and the needle was repositioned and the rate of injection reduced. After the

plunger had been fully depressed, the needle was held in place for an additional 60

seconds as early withdrawal of the needle from the injection site resulted in reflux of the

vector from the sub-retinal space into the vitreous.

After the needle had been withdrawn, a small amount of Cortimyxin antibiotic ointment

(Sandoz Canada, Boucherville) was applied. The animal was allowed to recover in a

heated, oxygen rich environment.

The animal and equipment were hand-held during the injection. One person performed

the injection with an assistant who pushed the plunger. No additional equipment was

used to secure the animal or the syringe.

2.4.3. Trans-corneal sub-retinal injection

Preparation, post-operative treatment, and the equipment used were identical for the

trans-corneal method of sub-retinal injection. However, the initial incision was made in

the cornea, proximal to the limbus, rather than in the sclera, distal to the limbus. This

area is identified externally as the edge of the clear portion of the eye. This incision was

made at a very shallow angle to avoid penetrating beyond the anterior chamber and

67

damaging the lens. The tip of the needle containing the vector was then inserted into the

anterior chamber through this opening at a shallow angle to avoid damaging the lens. The

needle was then rotated with the tip within the anterior chamber such that the needle was

pointed perpendicular to the cornea. The needle was then inserted into the vitreous, close

to but not penetrating the lens. By advancing the needle such that the tip was close to the

periphery of the vitreous chamber, the tip of the needle did not penetrate the lens. Rather,

as the needle was advanced, the shaft of the needle displaced the lens medially. When the

needle tip was approximately at the opposite side of the eye relative to the injection site,

the tip was pressed against the retina and the rest of the injection proceeded as previously

described.

2.4.4. Cryosection

Animals were sacrificed using CO2 as per the protocols of the Laboratory Animal

Services of the Hospital for Sick Children. After sacrifice, the top of each eye was

marked using a water-proof marker to locate the superior side of the sclera and provide

orientation after enucleation from the orbit.

To enucleate the eyes, the eye lids were pulled back to expose the space between the

orbit and the eye. The extraocular muscles were severed using curved iris scissors.

Further pulling back the eye lids resulted in the proptosis of the eye, extending it beyond

the orbit. The neurovascular bundle was then cut using curved iris scissors and removed.

The eye was immediately placed in 4% paraformaldehyde (Sigma-Aldrich Canada Ltd.,

Oakville) in PBS (Wisent Inc., St. Bruno), and fixed for 2 hours.

68

After fixation, the eye was dissected. The cornea was cut away using straight 2 mm

Vannas spring scissors (Fine Science Tools Inc., North Vancouver). The lens was then

extracted slowly using forceps, taking care not to pull the retina away with the lens. The

remaining tissue was washed 3 times with PBS for 5 minutes each, and an increasing

concentration of sucrose (Fisher Scientific – Canada, Ottawa) up to 20% w/v in 5% steps

with 15 minutes between each step at room temperature.

To embed the tissue, a polyethylene 16 mm x 8 mm embedding mold was filled with

PolyFreeze tissue freezing medium (both from Polysciences, In., Warrington). The tissue

was removed from the sucrose and excess liquid was absorbed with a laboratory wipe.

The tissue was then placed in the freezing medium with the marked superior side of the

sclera facing upwards. This allowed for proper orientation of the tissue upon sectioning.

The contra-lateral (left) eye was also embedded in the same block to serve as a control.

Both tissues were placed on one half of the embedding cassette when viewed

longitudinally, leaving the other half empty. This block was then frozen in a mixture of

dry ice and ethanol.

A Leica Cryostat CM3050S (Leica Microsystems Inc., Concord) was set for -24 ˚C

cabinet and object temperature and 12 μm thick sections. The block was mounted such

that the first half of the block to be cut contained no tissues. For every section, the empty

half was cut first and paused. This section was then folded over the section with the

tissues and adhered by heating with friction by repeated brushing. The cut was then

finished and the section mounted onto frosted glass slides (Fisher Scientific – Canada,

Ottawa) that have been pre-cooled to the cryostat cabinet temperature. By folding the

69

section over onto itself, the added structural integrity greatly reduced curling of the

section, ensuring it was mounted as flat as possible onto the slide. The use of cooled

slides prevented the section from melting onto the glass quickly, distorting the

morphology. 4 sections were taken and mounted onto the same slide before the block

was advanced by 50 μm and the process repeated.

2.4.5. Immunofluorescence

A list of antibodies used can be found in Table 4.

Sections mounted on glass slides were isolated using an ImmEdge hydrophobic barrier

pen (Vector Laboratories Canada Inc., Burlington). After allowing to dry, PBS at pH 7.4

was applied, followed by a block/permeablize buffer containing 10% goat serum (Wisent

Inc., St. Bruno) and 0.2% Triton X-100 (Sigma-Aldrich Canada Ltd., Oakville) in PBS,

and incubated at room temperature for 15 minutes before being removed by aspiration.

The primary antibody was diluted in PBS with 2.5% goat serum and 0.1% Triton X-100,

applied to the section, and allowed to incubate for 2 hours at room temperature. This was

then washed with PBS containing 0.1% Tween-20 (Sigma-Aldrich Canada Ltd.,

Oakville) for 3 times, 15 minutes each. The secondary antibody, diluted in the same

buffer as the primary antibody, was then applied and allowed to incubate for a duration

appropriate for the antibody, typically 2 hours at room temperature. The wash cycle was

repeated as previously described, and the sections were mounted using DAPI Hard-Set

mounting medium (Vector Laboratories Canada Inc., Burlington) and a no. 0 glass

coverslip.

70

For immunofluorescence of tissue culture cells, glass coverslips were sterilized and

treated with 1 mg/mL of poly-D-lysine (Sigma-Aldrich Canada Ltd., Oakville) for 2

hours inside wells of 6-well plates. The coating solution was washed off with PBS before

adding cells and growth media. The cells adhered to the cover-slip after overnight

incubation and were handled in a similar way to cells grown directly in 6-well plates.

To prepare the cells for imaging, the coverslips were washed with PBS and the cells were

fixed with 4% paraformaldehyde for 30 minutes. The coverslips were then washed with

PBS 3 times for 15 minutes each. The blocking, permeabilization and antibody staining

was then carried out as with tissue sections. The coverslips were then mounted using

DAPI Hard-Set directly onto the glass slide. Where direct fluorescence to observe EGFP

was used, the cells or tissues were fixed and mounted as described above directly after

washing with PBS.

2.4.6. Microscopy

For epifluorescence microscopy, a Leica DM IL inverted microscope was used with a

Leica DFC300F colour CCD camera (Leica Microsystems Inc., Concord).

For confocal microscopy, a Nikon A1R Si point scanning confocal microscope (Nikon

Instruments Inc., Melville) was used. To obtain high resolution while covering the large

area of an entire mouse eye, each image consists of many individual confocal images,

stitched together by software to form a single image. A 40x water immersion objective

was used, with the raster scan set to 1024 x 1024 pixel resolution per image. Before

scanning the large image, each section was mapped for location and a focus map formed

to compensate for levelling. Up to 120 images (10 x 12 fields) were then acquired by the

71

acquisition software Nikon NIS Elements, and stitched with 15% overlap. This resulted

in images of approximately 120 megapixels per eye section. 2 to 4 channels were used,

depending on the number of fluorescent signals expected. Typically, the green channel

was used to detect either EGFP or ABCA4 expression, while red was used for detecting

auto-fluorescence. In some cases, red was used for anti-rhodopsin staining, in which case

the blue channel was used for detecting auto-fluorescence. A “transmitted” channel was

also used initially to provide a pseudo differential interference contrast image, although

this was omitted from later images due to excessive file sizes exceeding the processing

capability of the software. Each channel was acquired at 12-bits colour depth (4096

levels). The resulting file sizes for 2-channel images were between 500 to 900 megabytes

and 4-channel images exceeded 1 gigabyte.

After acquisition and stitching, image manipulation was performed using Volocity 6.1

(PerkinElmer Inc, Woodbridge). The images were exported into Tagged Image File

Format (.TIF) at 1% of original resolution, resulting in images of approximately 1

megapixel per eye section. Adobe Photoshop CS6 (Adobe Systems Canada, Ottawa) was

used to convert the file into Joint Photographic Experts Group format (.JPG). This was

necessary because the exported .TIF files were not compatible with Adobe Illustrator

CS6 (Adobe Systems Canada, Ottawa) used to assemble the figures.

72

3. Results

3.1. Promoter constructs

A large number of potential promoter constructs were initially examined for fulfilling the

goal of a high-expression, ubiquitously active promoter, and a photoreceptor-cell specific

promoter with maximum expression without sacrificing specificity. Four promoters were

tested for expression levels, two ubiquitously active, and two photoreceptor-cell specific.

The use of a photoreceptor cell specific enhancer element and a synthetic intron were

also examined for their ability to increase expression levels.

3.1.1. Ubiquitous promoters

A ubiquitously active promoter was sought to provide a means of determining which

cells were transduced by the vector, and serving as a comparison to a cell-specific

promoter to demonstrate the efficacy of the cell-specific promoter.

The cytomegalovirus immediate early (CMV-IE) promoter, refered to as PCMVIE in this

work, was an obvious choice for a high-expression, ubiquitously active promoter. Since

its discovery in 1984 [206], it has been studied extensively and used for non-cell specific

expression of transgenes in many cell types. Expression of transgenes in the RPE and

photoreceptor cells has been observed under its control [11]. The plasmids cloned to

express genes under control of PCMVIE can be found in Table 1. In brief, PCMVIE was

cloned from the commercially sourced phCMV1 (Genlantis, San Diego). PCMVIIE was

cloned in place to produce EGFP and ABCA4 initially with the presence of a hybrid

intron (pSL004 for EGFP and pSL019 for ABCA4; see Section 3.2 for the hybrid intron).

73

The expression cassette was also cloned into pC4HSU for HDAd production (pSL 024

for EGFP and pSL0026 for ABCA4). When the hybrid intron was rejected (Section 3.2),

the plasmids had to be rebuilt without an intron (pSL044 for EGFP and pSL059 for

ABCA4), as did the corresponding pC4HSU based HDAd production plasmids (pSL046

and pSL059 respectively). The intermediate plasmids not mentioned here can also be

found in Table 1.

Transduction of a CMV-EGFP containing HDAd vector into different cell-types

demonstrated robust expression of EGFP and the efficacy of the HDAd vector (see

Figure 7).

The chicken beta-actin gene was also determined to have high-expression, ubiquitously

active promoter shortly after PCMVIE was identified [66]. Later work on this promoter

yielded the AG promoter, consisting of the promoter, first exon, and first intron of the

chicken beta-actin gene (A), altered by replacing the 3’intron splice-site with that from

the rabbit beta-globin gene (G) [141]. The addition of the CMV early enhancer element

(C) yielded the final CAG promoter [156], although it is not strictly speaking only a

promoter. This construct has resulted in an expression level over 100-fold higher than

with the traditional CMV promoter-enhancer combination [235].

Most of the in vitro and in vivo work described herein had been conducted using both the

CMV and CAG promoters but only the results using the CAG promoter have been

included as the CAG promoter confers higher levels of EGFP fluorescence than CMV

(Figure 7), implying higher transcription levels. A full list of plasmids using this

promoter (PCAG) can be found in Table 1.

74

Figure 7 – The CAG promoter is more active than CMV as measured by EGFP

expression

WERI-Rb (retinoblastoma) cells were transduced with HDAd carrying either CMV-

EGFP or CAG-EGFP. Epifluorescence microscopy reveals that the CAG construct

confers significantly higher levels of fluorescence but does not result in a higher number

of fluorescent cells. Both images were taken with very short exposure times (100 ms) as

CAG-EGFP yielded fluorescence levels that saturated the sensor under normal settings.

The use of short exposure times for both vectors allowed for the comparison of the

relative fluorescence intensities. A normal exposure (1 second) shows CMV-EGFP

yields a bright fluorescence signal similar to the CAG-EGFP image shown here. (8000

VP/cell; 3 days post-transduction, corresponding with a plateau in the level of observed

fluorescence.)

75

3.1.2. Rhodopsin promoters

Cell-specificity was desired in expression of the transgene as expression of ABCA4 into

cell-types that cannot process NR-PE into vitamin A would result in its accumulation in

the cell, potentially causing toxic effects. For example, if ABCA4 was expressed in RPE

cells, ABCA may increase RPE uptake of NR-PE, increasing the rate of lipofuscin

deposit formation, thus accelerate the progress of Stargardt’s disease.

Cell specificity can be achieved by physically targeting the virus for a specific cell-type,

limiting transcription to the appropriate cell type, or preventing translation into protein in

undesired cell types. While it is theoretically possible to physically target the virus to

photoreceptor cells over other cell types, it is practically impossible to modify the viral

tropism to such an extent that the virus would be unable to transduce RPE cells.

Translational regulation is relatively poorly understood and quantification of translational

regulation by Western blot is less sensitive than quantification of mRNA by qRT-PCR.

As such, it was decided to seek a photoreceptor-cell specific promoter to limit expression

of the transgene to photoreceptor cells.

An obvious choice for a photoreceptor specific promoter is rhodopsin. It is the most

abundant protein in the photoreceptor cell and accounts for 90% of the protein content in

photoreceptor disc membranes [80]. Many of the initial studies involving photoreceptor

specific expression of transgenes used murine or bovine rhodopsin upstream sequences

to limit gene expression [119, 239]. Therefore, we selected the rhodopsin promoter for

restricting transgene expression to photoreceptor cells.

76

A significant amount of work has been committed to the analysis of the rhodopsin

upstream sequence which showed significant homology between species for up to 5 kb

upstream of transcriptional start [10]. On the other hand, in vitro experiments have

shown that sequences as short as ~300 bp can confer cell specific expression in

retinoblastoma cells [155]. As no data is available on upstream sequences shorter than

300 bp, this was taken as the lower limit of what we could consider as specific. While the

use of vectors with small carrying capacity such as AAV would necessitate short

promoters to allow for longer protein encoding regions (Section 1.3.2.3), the use of

HDAd gives significant flexibility in promoter length.

It is difficult to predict the specific functions of the upstream sequences as the specific

interactions between the sequence and the relevant transcription factors are not well

elucidated. While it was possible to use the full 5 kb upstream sequence, it would be

cumbersome in cloning the sequence, and the sequence homology observed between

species does not indicate that the entire sequence is necessary to preserve photoreceptor

specificity. On the other hand, it is possible that sequences further upstream than the

minimum ~300 bp may help limit expression to photoreceptor cells. Therefore, it was

decided to clone two versions; a long version containing 1553 bp upstream of the

transcriptional start, and a short version containing 323 bp immediately upstream of the

transcriptional start site.

The interphotoreceptor retinoid binding protein (IRBP), also known as interstitial retinol-

binding protein, is an extracellular protein that is found in high concentration only in

photosensitive tissues [23]. IRBP mRNA is found to accumulate in these tissues [211]

77

and sequence analysis found a CpG rich island 1578 to 1108 bp upstream of

transcriptional start [3]. Sequence homology between species underlined the importance

of this region and experiments demonstrated that the segment in question binds to a

protein found in the nuclei of bovine retina and Y79 cells [17]. In vitro studies combining

this segment with the rhodopsin promoter demonstrated a 2-fold increase in protein

expression over the same promoter in the absence of this enhancer segment [136]. The

data also indicated that the addition of the IRBP enhancer does not affect the cell-

specificity of the rhodopsin promoter [155]. This enhancer was then cloned directly

upstream of the long and short rhodopsin promoter constructs. This resulted in four

promoter versions in total, a short and a long promoter, each with and without the

enhancer.

All four versions were cloned upstream of EGFP. Plasmids containing each expression

cassette were transfected into a retinoblastoma cell line (Y79) and a retinal epithelium

derived cell line (ARPE-19) and the cells were analyzed by flow cytometry (Figure 8). In

the absence of the enhancer element, both rhodopsin promoter lengths yielded similar

mean fluorescence intensities (MFI). The addition of the enhancer element significantly

increased the MFI with both the long and short promoter lengths. With the enhancer in

place, the difference between the long and short promoters did not result in a statistically

significant difference in MFI. In addition, neither version of the promoter produced

fluorescence in APRE-19, thus confirming the cell-specificity conferred by the rhodopsin

promoters.

78

Cell specificity of the rhodopsin promoters was evident by EGFP expression only in Y79

and not in APRE-19 cells with all rhodopsin promoter constructs. The addition of the

IRBPE significantly increases gene expression (Figure 8). Therefore, subsequent

experiments using the rhodopsin promoter utilized the long, 1553 bp promoter with the

IRBP enhancer element directly upstream, denoted by “Rho”.

Of note is the low expression observed with both cell lines with the CMV promoter;

while it is clearly and consistently above the background level, it is much lower than

expected and barely observable under epifluorescence microscopy (data not shown). The

low expression was likely a result of the hybrid intron used which will be discussed in

Section 3.2. With the exception of Figure 8, the data contained herein does not contain

constructs containing this hybrid intron.

79

Figure 8 – Flow cytometry of transfected cells demonstrate the cell specificity of the Rho

promoter and the increase in transcription resulting from IRBPE

Flow cytometry of ARPE-19 and Y79 cells transfected with plasmid DNA containing the

short or long versions of the rhodopsin promoter or the CMV promoter, all controlling

the production of EGFP. The results demonstrate that there is no significant difference in

the mean fluorescence intensity, indicating that there is no loss in expression when using

the long version. The addition of the IRBP enhancer results in a large increase in mean

fluorescence intensity, indicating that the IRBP enhancer increases expression. The low

expression level observed with the CMV promoter likely indicates inefficiencies as a

result of the hybrid intron as discussed in section 3.2.

80

(Error bars represent standard error of the mean. 2-way ANOVA showed statistically

significant interaction between cell-type and promoter. * indicates p < 0.01 in

comparison with Control Y79 by pairwise t-test with Bonferroni correction. Other

pairwise comparisons were not tested. n = 3)

81

3.1.3. G protein-coupled Receptor Kinase 1 promoter

Another commonly used promoter for photoreceptor specific expression is the G protein-

coupled receptor kinase 1 (GRK1) promoter. GRK1 serves as the kinase that

phosphorylates rhodopsin and is specifically expressed in photoreceptor cells. Unlike

rhodopsin, GRK1 is expressed in both rod and cone cells, thus there is an advantage to

using GRK1 over rhodopsin. It had been previously examined for in vivo photoreceptor

specific expression using AAV vectors, although expression levels appear to be lower

than that observed with the rhodopsin promoter [98].

In order to ascertain whether GRK1 would be superior to rhodopsin in our use with

HDAd vectors, it was cloned in place of the rhodopsin-IRBPE combination. Initial

plasmid transfection experiments demonstrated that the level of fluorescence was not

stronger than with Rho-EGFP as determined by epifluorescence microscopy.

Nonetheless, a significant amount of work was undertaken to make the construct into an

HDAd viral vector as it was our belief that the promoter activity in plasmid and in viral

vector delivered forms may be different. Epifluorescence microscopy demonstrated that

Rho-EGFP does confer significantly stronger fluorescence compared to GRK1-EGFP

even in the context of HDAd transduction (Figure 9), thus confirming that GRK1 is a

weaker promoter as indicated by the literature. Consequently, the work contained herein

concentrates on the Rho-EGFP construct.

82

Figure 9 – Rho-EGFP confers higher gene expression than GRK1-EGFP

Epifluorescence microscopy demonstrates that the level of expression conferred by the

rhodopsin promoter is significantly higher than that conferred by the GRK1-EGFP.

HDAd vectors carrying either construct were transduced into WERI-Rb cells at 32,000

VP/cell. The results are epifluorescence photomicrographs taken after 5 days of

incubation. Earlier time points resulted in lower fluorescence while later fluorescence

resulted in the cells growing beyond confluence.

83

3.2. Introns

The addition of an intron is well known to increase transgenic gene expression [33, 159].

As such, our initial constructs included introns immediately before the start codon in

hopes that they would improve gene expression. A list of the constructs and whether or

not they included an intron can be found in Table 1.

The hybrid intron was initially developed and characterized for use in studies of cancer

gene therapy via AAV[162]. This sequence consisted of a combination adenovirus major

late gene intron and mouse immunoglobulin intron, hence “hybrid” intron. It had been

previously used in our laboratory for the purposes of increasing expression levels of

transgenes [101]. Due to this previous success, all the initial plasmid constructs were

built incorporating this hybrid intron (plasmids pSL003, pSL004, pSL008 through

pSL032 and the corresponding HDAd vectors vSL014 through vSL035).

Attention was drawn to a problem in experiments involving the transfection of cultured

cells with the constructs in a plasmid background, when epifluorescent microscopy failed

to show fluorescence at levels expected from the high expression promoter of CMV.

Flow cytometry analysis of transfected cells detected only minimal levels of fluorescence

(See section 3.1.2, Figure 8). Transfection parameters that were explored included host

cell type, transfection agents, DNA mass, ratio of transfection agent vs DNA mass,

duration of transfection, media type, and incubation period but all were unsuccessful in

improving EGFP expression

Under the premise that the transfected plasmid may result in different promoter activity

than DNA delivered by the viral vector, work was undertaken to generate the series of

84

HDAd vectors containing these constructs. However, transduction of cultured cells with

these vectors also failed to demonstrate fluorescence despite numerous attempts.

Transduction parameters included host cell type, duration of transduction, media used,

concentration of FBS, multiplicity of infection, and incubation period. Satisfactory levels

of fluorescence could not be obtained with the CMV promoter + intron construct under

any of the conditions. (data not shown)

Examination then turned to the sequences of the expression cassettes of the constructs to

ensure that they matched the designs and expectations from in silico cloning. DNA

sequencing revealed that all of the sequences are precisely as expected with no errors or

mutations (data not shown). Attention then turned to the individual components that

comprised the expression cassette to ensure their functions. The only component that was

not fully documented and not directly cloned from popular commercially available

cloning vectors was the hybrid intron, although the sequence matched the sequence and

map provided by the previous users of the hybrid intron in our laboratory.

A BLAST search of the sequence that was provided showed that it was not as one would

expect of the combination adenovirus major late gene intron and mouse immunoglobulin

intron (Figure 10). The sequence contained the CMV major immediate early gene’s 5’

UTR, a 3’ truncated CMV intron A, and a synthetic intron truncated at both the 5’ and 3’

ends. This synthetic intron is commercially available in vectors such as pIRES3hyg

(Clontech Laboratories Inc., Mountain View). This partial synthetic intron is likely part

of the hybrid intron as the hybrid intron sequence provided contains portions of both

intron components as described by the original authors and aligns to portions of

85

pIRES3hyg. However, in the hybrid intron, it has been truncated at both ends, thus is

possibly missing the splice sites.

The problem encountered with the hybrid intron was likely an issue with the

recombination of the intron in the source plasmid and not the intron itself as the synthetic

intron is in common commercial use. Regardless of the specific details as to why this

particular intron resulted in a major reduction in protein production, the intron was the

most suspect and was the only portion of the construct that was not cloned from a

popular, commercially available vector. While the evaluation of the intron took place

using the CMV promoter + intron combination, the rhodopsin promoters also contained

the same intron. As such, work was immediately undertaken to remove the intron from

all constructs, although all the plasmid had been otherwise completed (pSL004, pSL010 -

pSL013, pSL019- pSL027). Because ABCA4 is a large protein, encoded by a 7kb ORF

and thus contained many restriction enzyme sites, it was decided early in the in silico

design stages to have all the other components assembled before inserting ABCA4 via an

adaptor segment, producing the intermediate plasmids pSL014 to pSL018. The intron

was inserted very early in the process (pSL003), and as a result, it became impossible to

remove the intron from subsequent plasmids (pSL019-pSL027). All constructs were

abandoned and cloning had to be started anew.

The need to replace the intron led to several simultaneous approaches with no intron, and

ubiquitin C intron (section 3.2) being cloned and examined.

86

Sequence of the cloned hybrid intron GCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCGGGAACGGTGCATTGGAACGCGGATTCCCCGTGCCAAGAGTGACGTAAGTACCGCCTATAGAGTCTATAGGCCCACCCCCTTGGCTTCTTATGCGACGGATCAATTCGCTGTCTGCGAGGGCCAGCTGTTGGGGTGAGTACTCCCTCTCAAAAGCGGGCATGACTTCTGCGCTAAGATTGTCAGTTTCCAAAAACGAGGAGGATTTGATATTCACCTGGCCCGCGGTGATGCCTTTGAGGGTGGCCGCGTCCATCTGGTCAGAAAAGACAATCTTTTTGTTGTCAAGCTTGAGGTGTGGCAGGCTTGAGATCTGGCCATACACTTGAGTGACAATGACATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGGTCCAAC Legend:

Expected: 5’ UTR; Intron

BLAST search:

CMV major immediate early gene 5’ UTR CMV Intron A (partial, major 3’ truncation, no 3’ splice site) Synthetic Intron (7 bp 5’ truncation, 9 bp 3’ truncation)

Figure 10 – BLAST search of hybrid intron sequence

The BLAST result from the hybrid intron revealed that the sequence contained

components beyond that which was expected. Perfect identity was found in the sequence

of the CMV immediate early 5’ UTR, a truncated CMV intron A, and an incomplete

synthetic intron truncated at both ends.

87

Shortly after the problem with the hybrid intron was identified, an article was published

on the potent expression enhancing functions of the ubiquitin C 5’ UTR intron [14]. The

ubiquitin C intron was already available as a result of earlier work in our lab [218]. Work

was then undertaken to incorporate this intron into our constructs.

Repeated attempts to clone this intron by PCR failed to yield the correct sequence under

a wide variety of PCR and cloning conditions. PCR using different enzymes, salt

concentrations, and annealing temperatures were attempted, all yielded the same

incorrect sequence. Sequencing of these cloned introns revealed that there were multiple

differences between the clones and the reference sequence (GenBank accession:

NC_000012; Figure 11) . As many cloned introns from different PCRs all yielded the

same sequencing results, making a PCR error unlikely, the template plasmid

(pBSIIPubcHAHprp3CodingBGHpA) was also sequenced to reveal that the differences

were inherent in the template used. Comparison of the sequencing data with the expected

sequence from our lab reveals that the sequence of the cloned intron is consistent with

expectations but different from the GenBank reference sequence. While the differences

did not involve the splicing junctions and may not have affected splicing efficiency nor

protein expression levels, the decision was made to avoid complications by cloning the

constructs again without an intron.

Unless specifically noted, the results in the subsequent sections employed plasmids and

viral vectors that do not contain an intron sequence.

88

Sequence of Ubiquitin C intron from the template plasmid

GTGAGTT1GCGGGCTGCTGGGCTGGCCGGGGCTTTCGTGGCCGCCGGGCCGCTCGGTGGGACGGAA2GCGTGTGGAGAGACCGCCAAGGGCTGTAGTCTGGGTCCGCGAGCAAGGTTGCCCTGAACTGGGGGTTGGGGGGAGCGCA3CAAAATGGCGGCTGTTCCCGAGTCTTGAATGGAAGACGCTTGTA4AGGCGGGCTGTGAGGTCGTTGAAACAAGGTGGGGGGCATGGTGGGCGGCAAGAACCCAAGGTCTTGAGGCCTTCGCTAATGCGGGAAAGCTCTTATTCGGGTGAGATGGGCTGGGGCACCATCTGGGGACCCTGACGTGAAGTTTGTCACTGACTGGAGAACTCGGG5TTTGTCGTCTGG6TTGCGGGGGCGGCAGTTATG7CGGTGCCGTTGGGCAGTGCACCCGTACCTTTGGGAGCGCGCGCC8TCGTCGTGTCGTGACGTCACCCGTTCTGTTGGCTTATAATGCAGGGTGGGGCCACCTGCCGGTAGGTGTGCGGTAGGCTTTTCTCCGTCGCAGGACGCAGGGTTCGGGCCTAGGGTAGGCTCTCCTGAATCGACAGGCGCCGGACCTCTGGTGAGGGGAGGGATAAGTGAGGCGTCAGTTTCTT9TGGTCGGTTTTATGTACCTATCTTCTTAAGTAGCTGAAGCTCCGGTTTTGAACTATGCGCTCGGGGTTGGCGAGTGTGTTTTGTGAAGTTTTTTAGGCACCTTTTGAAATGTAATCATTTGGGTCAATATGTAATTTTCAGTGTTAGACTAGTAAATTGTCCGCTAAATTCTGGCCGTTTTTGGCTTTTTTGTTAG

5’ splice site 3’ splice site Differences:

1 – A in reference sequence 2 – G in reference sequence 3 – additional G in reference sequence 4 – G in reference sequence 5 – extra nucleotide compared to reference sequence 6 – extra nucleotide compared to reference sequence 7 – missing G compared to reference sequence 8 – missing C compared to reference sequence 9 – C in reference sequence

Figure 11 – The sequence of the template plasmid contains 9 differences compared with

the reference sequence in a segment of ~800 bp.

89

3.3. ABCA4::EGFP fusion protein did not yield detectable

fluorescence

Simultaneous with the work to insert the ABCA4 coding sequence, an attempt to create

an ABCA4::EGFP fusion protein was also made. This comprised plasmids pSL028

through pSL035 which included the hybrid intron, and pSL060 which did not. The DNA

was formed by PCR of the ABCA4 gene from pSL019 with a primer overlapping EGFP

to generate a mega-primer, which was then used to amplify the rest of EGFP (Forward

primer: 20090506-01; Mid-primer with overlap: 20091210-01; Reverse primer for

EGFP: 20091210-02). This resulted in the C-terminal fusion of ABCA4 to EGFP. As the

primers contained restriction sites compatible with the adaptor segment used for ABCA4

insertion, the plasmids containing ABCA4 were restriction digested and ligated with the

ABCA4::EGFP fusion protein. Restriction digest and DNA sequencing were performed

to ensure the proper in-frame joining of the segments.

Transfection of cultured cells with the CMV promoter based expression plasmid

(pSL028) failed to yield any detectable levels of fluorescence under a wide variety of

transfection conditions. Subsequent to the discoveries regarding the hybrid intron

(Section 3.2), a version without an intron was also made (pSL060) which also did not

yield any detectable fluorescence. While it is possible that the lack of a linker-segment

prevented the folding of EGFP or the proper inclusion of transmembrane domains of

ABCA4 into the membrane, it was decided that antibody studies would suffice for the

detection and localization of the ABCA4 transgene, and work with the fusion protein was

abandoned.

90

3.4. Transduction efficacy and cell specificity of HDAd vectors

carrying the reporter gene EGFP

As the constructs containing the ABCA4 gene do not carry any reporter genes, it was

decided to first work with constructs that were carrying EGFP, but otherwise identical to

the ABCA4 constructs, in order to assess and optimize the transduction. Before using the

viral vectors in vivo, experiments in cell culture were first carried out to assess the

relative activities of the different promoters and cell specificity as well as confirming the

infectivity of the vector particles.

3.4.1. HDAd is capable of delivering EGFP to cultured cells and

the rhodopsin promoter confers fluorescence in a cell-specific

manner

To determine whether the HDAd vectors are able to confer reporter gene expression to

cultured cells, HDAd carrying CAG-EGFP was transduced into ARPE-19, HeLa, and

WERI-Rb cells. As the cell types differed in their sensitivity to the toxicity caused by the

presence of HDAd, transduction experiments were carried out to determine the maximum

tolerable dose of vector particles for each cell type. Three different doses were selected

as determined by the minimum dose required to confer detectable fluorescence, and the

maximum dose tolerated by the most sensitive cell type before cell death is observed.

These doses are represented in Figure 12 to demonstrate dose response.

CAG, being a ubiquitously expressed promoter, confers gene expression to all three cell

lines even at the lowest dose of 500 VP/cell. The high level of fluorescence is not

91

apparent in the figure as all the images are taken at equal settings, and thus the exposure

time had to be reduced to prevent over-saturation at the higher doses. In all three cell

lines, the number of cells transduced and the intensity of fluorescence increased with

dose, likely indicating that at the lowest dose, not all cells have been transduced, and that

at high doses, a large portion of the cells will have been transduced by multiple virus

particles.

Also of interest is that the intensity of fluorescence varies with the cell lines used. WERI-

Rb is particularly high in the intensity of fluorescence observed and this pattern was

repeatedly observed regardless of the vector used and whether the cells were analyzed by

epifluorescence microscopy (Figure 12), confocal microscopy (Figure 13), or flow

cytometry (Figure 14). The intensity of fluorescence observed may be a result of the

efficacy of transduction in WERI-Rb cells, or the level of protein production inherent in

WERI-Rb cells. Because of this particular property of WERI-Rb, the use of Y79 was

discontinued in favour of WERI-Rb for experiments in cell culture.

When HDAd vector carrying Rho-EGFP was used, fluorescence could not be observed in

ARPE-19 nor HeLa cells. Fluorescence was also not observed in HEK293 cells when

transduced with Rho-EGFP (data not shown). However, when transduced into WERI-Rb

cells, fluorescence could be observed. This result indicates that the Rho-EGFP construct,

with the additional IRBP enhancer, expressed EGFP in a cell-specific manner. However,

due to the relative efficiencies of the different promoters, the fluorescence observed with

Rho-EGFP is weaker than with CAG-EGFP at the same dose. When higher amounts of

vector were used, cell-specificity was maintained up to 16,000 VP/cell with very intense

92

fluorescence observed from WERI-Rb cells while no fluorescence could be detected

when using other cell lines. When using doses higher than 32,000 VP/cell, cell death

could be observed which may be a result of the enormous number of vector particles

present overwhelming the cell. The maximum tolerable dose is cell-specific as cell-death

was observed in HeLa cells at doses 16-fold higher, while HEK293 cells reacted

adversely at doses as low as 8000 VP/cell (Data not shown).

Confocal microscopy confirmed the same pattern, with the EGFP well distributed

throughout the cytoplasm (Figure 13). There was no nuclear localization of the EGFP,

although the images do show overlap as each image is an “extended focus” (i.e. merged)

representation of a Z-stack. Despite the increased sensitivity of confocal microscopy over

epifluorescence microscopy, there was no detectable fluorescence from ARPE-19 nor

HeLa cells transduced with Rho-EGFP.

93

Figure 12 – HDAd can deliver EGFP to cultured cells, and the rhodopsin promoter is

cell-specific

Epifluorescence microscopy shows that HDAd is capable of delivering EGFP to cultured

cells to confer fluorescence in a dose dependent manner. The CAG-EGFP construct

confers ubiquitous expression while the use of the rhodopsin promoter (Rho-EGFP)

restricts expression to retinoblastoma cells (WERI-RB) and not epithelial cells (ARPE-19

94

and HeLa). All images were taken at identical settings, using a 5x objective, 5 days after

transduction.

All images were taken with very short exposure times (100 ms) as WERI-Rb transduced

with CAG-EGFP yielded fluorescence levels that saturated the sensor under normal

settings. The use of short exposure times allowed for the comparison of the relative

fluorescence intensities between the different cell lines and vectors.

95

Figure 13 – Confocal photomicrographs of ARPE-19, HeLa and WERI-Rb cells

transduced with either CAG-EGFP or Rho-EGFP

Confocal microscopy confirms that CAG-EGFP confers EGFP fluorescence to all cell

types while transduction with Rho-EGFP results in fluorescence only in WERI-Rb cells.

Note that the intensity of fluorescence cannot be compared as each cell type requires

different sensitivity settings to avoid over/under saturation (Scale bar = 10 μm; 5 days

post-transduction)

96

In addition to qualitative analysis by microscopy, ARPE-19 and WERI-Rb cells

transduced with either CAG-EGFP or Rho-EGFP HDAd were analysed by flow

cytometry in order to obtain a quantitative comparison. In order to increase the sensitivity

of detecting EGFP-positive cells and to avoid false-positives that result from auto-

fluorescence, cells were gated by plotting the EGFP channel against the adjacent channel.

Only cells that had increased EGFP fluorescence without an equally proportioned

increase in the adjacent channel were considered positive (Figure 15). Using this method,

it is clear that even at a low dose of 500 VP/cell, approximately 80% of ARPE-19 cells

were transduced by CAG-EGFP, leading to detectable levels of fluorescence (Figure

14a). The difference in minimal dose for detectable fluorescence between the microscopy

results (Figure 12) and flow cytometry is attributed to the higher level of sensitivity of

flow cytometry. The minimal dose needed for detectable fluorescence by flow cytometry

demonstrates the high efficacy of the HDAd vector. The data with CAG-EGFP indicates

that the percentage of positively gated cells increased with dose (Figure 14a) and it is

important to note that the increase was not linear as the percentage of positive cells

reaches a plateau. The reaching of the plateau is particularly visible with ARPE-19 cells,

although it can also be mathematically shown with WERI-Rb cells. As the number of

vector particles increases, the probability of a cell being infected by more than one vector

particle increases. On the basis of probability, increasing the vector particles by two-fold

results in the reduction of uninfected cells by half, but that does not equate to a two-fold

increase in infected cells. This statistical calculation can be used to give an estimate of

the number of active virus particles (infectious units; IU) per vector particle (Section

3.4.2).

97

Interestingly, it is apparent that there was absolutely no EGFP production from Rho-

EGFP transduced ARPE-19 cells despite the high doses applied (Figure 14a, Figure 15).

This indicates that the rhodopsin promoter has sufficient cell-specificity that no leakage

was observed, unlike the situation with many inducible promoters.

Figure 14b demonstrates that the mean fluorescence intensity (MFI) increased with dose

in a linear manner when either cell-type was transduced with CAG-EGFP. The MFI of

ARPE-19 cells did not change when transduced with Rho-EGFP while the MFI of

WERI-Rb changed in a dose dependent manner (Figure 14c), again demonstrating the

tight control that the rhodopsin promoter exerts over transgene expression. Note,

however, that the relative fluorescence intensity between the two cell types was not

directly comparable as the settings had to be adjusted between the cell types to ensure

proper gating and to stay within the dynamic range of the instrument.

Figure 15 shows representative flow cytometry plots demonstrating the gating method

used to reduce false positives caused by auto-fluorescence. It differs from traditional

gating by histogram (Figure 16) in that it employs the adjacent channel to reduce false-

positives stemming from auto-fluorescence.

98

99

Figure 14 – Flow cytometry confirms fluorescence conferred by CAG-EGFP and cell

specificity of rhodopsin promoter

Flow cytometry indicates that (a) the percentage of positively gated cells increased in

dose dependent manner when either cell type was transduced with CAG-EGFP. As

expected, only WERI-Rb but not ARPE-19 responded to Rho-EGFP. (b, c) Similar

results were obtained when examining the mean fluorescence intensity with increases

observed with dose in all cases except for when ARPE-19 was transduced with Rho-

EGFP, again confirming the cell-specificity of Rho-EGFP. Statistical analyses to

compare the percentage of positive cells were not necessary as they were clearly dose

dependent, as were the mean fluorescence intensities. The dose-dependencies revealed by

curve-fit were calculated to be 0.9316 and 0.9082 for ARPE-19 and WERI-Rb cells

respectively. (The numbers following CAG/Rho indicate VP/cell applied. n=3 Error bars

represent standard error of the mean. 2-way ANOVA of the CAG promoter (B) found

statistically significant difference on dose only while 2-way ANOVA of the Rho

promoter found statistically significant interaction between dose and cell-type. Pairwise

comparisons were not conducted.)

100

Figure 15 – Representative flow cytometry plots demonstrating the gating method used

to reduce false-positives caused by auto-fluorescence.

101

Grey – C4HSU (control) Red – RHO-EGFP (2500 VP/cell) Green – CAG-EGFP (2500 VP/cell)

Figure 16 – Representative flow cytometry histograms

Representative flow cytometry plots showing the difference in mean intensity as a result

of transduction with RHO-EGFP or CAG-EGFP and the differences between cell lines.

The quantified results are shown in Figure 14 B and C.

102

3.4.2. Vector particle to infectious unit ratio

From the flow cytometry data (Figure 14a), we could extrapolate the number of VP/cell

that yields 50% transduction by curve fitting. From that, it was mathematically possible

to estimate the number of infectious vector particles (infectious units, IU) compared to

total viral particles (VP), assuming the transduction process allowed for all active

particles to function. This calculated value (IU) is similar to the titre in plaque forming

units (PFU) that is usually used to quantify viruses. IU is necessary in place of PFU in

HDAd because HDAd are replication incompetent and thus cannot form plaques.

The details of the curve fit applied can be found in Appendix B.

For ARPE-19 cells transduced with CAG-EGFP, the dose required for infection of 50%

of the cells (ID50) was calculated to be 92.40 (77.84 to 107.0, 95% CI) and 230.1 (191.7

to 268.4, 95% CI) for WERI-Rb cells transduced with CAG-EGFP. This value

corresponds to the number of vector particles per cell (VP/cell) required to transduce

50% of the cells. The difference between cell lines is indicative of the differences in the

ability of each cell-type to be transduced (i.e. transduction efficiency). As ARPE-19

demonstrated a 2.5 fold higher transduction efficiency than WERI-Rb, the calculations

below were based on a Kd of 92.40 from ARPE-19. However, the Kd at 100%

transduction efficiency is likely to be even lower as there may be cell lines with even

higher transduction efficiency than ARPE-19.

Mathematically, as defined by the Poisson distribution, the theoretical multiplicity of

infection (VP/cell) required to infect 50% of the cells is -ln(0.5) or 0.693. Since 92.4

VP/cell transduced 50% of the cells, a conservative estimate of the number of active

103

vector particles per total number of vector particles was calculated to be approximately

92.4 / 0.69 or 133. In other words, 1 in 133 vector particles could transduce an ARPE-19

cell under these particular transduction conditions, or there is 1 infectious unit per 133

vector particle. However, keeping in mind the difference observed in ARPE-19 and

WERI-Rb, it is likely that the actual number of infectious particles per vector particle

was even lower as there were multiple assumptions and simplifications involved and that

transduction of ARPE-19 did not occur at 100% efficiency. Therefore, we estimated that

approximately 1 in 100 vector particles were capable of delivering their genome to the

cell and express transgenes. The implications of this calculation will be discussed in

depth in Section 4.2.

3.4.3. in vivo injections of HDAd carrying the EGFP reporter gene

Having confirmed the infectivity and cell-specificity of the vectors in cell culture, we

applied the vector to wildtype CD1 mouse.

There are multiple methods of introducing the vector to the retina. The simplest method

involves direct injection of the vector into the vitreous with the expectation that the

vector will diffuse through the inner limiting membrane and all the retinal cell layers to

reach the photoreceptor layer as shown previously [216]. This method was rejected on

the basis that the HDAd vector is significantly larger physically compared with the AAV.

Nonetheless, it was attempted several times using the CAG-EGFP vector without success

(2 groups of mice, n=10 each).

A method of injecting the vector directly into the sub-retinal space involves making an

incision in the sclera of the eye, through which a fine needle is inserted until it rests

104

against the choroid across the vitreous from the injection site [54, 81]. This was the

method employed in this section and is referred herein as the trans-sclera method.

(Section 2.4.2)

Before proceeding to performing sub-retinal injections to deliver the HDAd vector, 1 μm

diameter fluorescent microspheres were used to determine whether the trans-sclera

method was feasible and reliable for delivering particles to the sub-retinal space. Injected

mice were sacrificed one week after injection to allow for recovery of retinal detachment

caused by the injection. Initial injections of the microspheres into mouse retinas using the

trans-sclera method did not result in microspheres in the sub-retinal space after the mice

were sacrificed and the retinas examined by microscopy (2 groups, n=10 each; data not

shown). Instead, the microspheres were found to be sparsely dispersed throughout the

eye, indicating that the microspheres had failed to enter the sub-retinal space and had

been excreted from the vitreous as part of the normal fluid flow within the vitreous

chamber of the eye.

Because the microspheres were provided at 2% (w/v), a subsequent attempt was made

after diluting the microspheres to 0.2% by mass. Successful injections demonstrated that

the microspheres were found almost exclusively along the RPE as expected given the

phagocytic properties of the RPE cells (Figure 17). However, microspheres were found

in only 20% of the eyes injected (n=10), indicating that while the technique is viable,

further refinement of the technique was required.

Other methods of introducing material to the sub-retinal space have been documented.

Using trans-sclera injections, one group had previously used a pressurized method to

105

produce a liquid jet to avoid the difficulty involved in making and maintaining physical

contact with the retina during injection [147]. However, the need for specialized

equipment made it impractical to implement in our laboratory.

Alternatively, in order to avoid passing through the lens and to gain a more oblique angle

for maintaining contact with the retina, an alternative approach was used whereby the

initial incision is made in the cornea, and the needle is guided from the anterior chamber

into the vitreous chamber. This approach resulted in significantly higher success rate

(Section 3.4.3.1) and is described in detail in Section 2.4.3. This trans-corneal method

replaced the trans-sclera method. As such, the results described herein, with the

exception of Figure 17, used the trans-corneal method.

Over the course of the work described herein, the successful injection rate for the trans-

corneal method increased gradually from 20% to a plateau of 80%. As the described

method remained the same, the difference in success rate can only be attributed to an

increase in the technical skill gained through the injection of several hundred mice over a

period of several years. After having reached the 80% plateau and no further

improvement in the injections was apparent, all the in vivo experiments were repeated to

ensure consistency of the data. As such, the data presented herein represent the latter,

repeated experiments.

106

Figure 17 – Microspheres injected into the sub-retinal space of mouse eyes

Injection of fluorescent microspheres into mouse eyes demonstrate that trans-sclera sub-

retinal injection is feasible for delivering substances into the sub-retinal space. (RPE –

retinal pigment epithelium; OS – outer segment (photoreceptors); ONL – outer nuclear

layer; INL – inner nuclear layer)

107

3.4.3.1. CAG-EGFP consistently confers expression of EGFP

throughout the entire retinal epithelium

After having confirmed the possibility of delivering materials to the sub-retinal space via

sub-retinal injection, we proceeded to assay the function and distribution of HDAd

vectors delivered by the same method. Vectors carrying CAG-EGFP were used to

determine what cell types can be transduced by HDAd.

As previously mentioned, the earlier methods of injection yielded limited success, as did

the earlier methods of cryosectioning (Sections 3.4.3 and 2.4.4 respectively). 1 x 1010 VP

in 1 μL volume of CAG-EGFP was injected into the sub-retinal space of mice with

sacrifice taking place one week post-injection. The trans-sclera method of injection

yielded approximately 20% success (6 groups, n=10 each), comparable to the success

rate with microspheres. Using the trans-cornea method, the initial rate of success

increased to 67% (5 groups, n=28 total). The technique was further refined over time,

resulting in a higher success rate in more recent experiments. Later experiments with

varying dose, modified vectors, and different incubation periods have reached a

consistent 80% success rate.

After injection, each eye was cryosectioned and visualized by confocal microscopy. The

sections are made across the transverse plane, each section being 12 μm thick. The

technique is described in detail in section 2.4.4. Figure 18 demonstrates the typical

results of CAG-EGFP injection. 10 separate sections were taken approximately 100 μm

apart, progressing from the inferior to the superior side. The relative size is kept the same

across all sections, hence the change in size of the eye observed as the sections progress

108

through the center of the eye where the diameter is the largest. It is clear from this set of

images that the RPE has been completely transduced across all three dimensions.

These confocal images of an entire eye section were generated by merging approximately

100 fields-of-view at approximately 1 megapixel resolution for each field of view, thus it

is possible to examine a small area of the retina without any loss of resolution. The

technique is described in detail in section 2.4.6. Such high magnification examination

reveals that the fluorescence exists exclusively in the RPE, indicating that the vector

failed to transduce the photoreceptor layer, or any other layer of the retina except the

RPE (Figure 19).

109

110

Figure 18 – Sequential sections of a mouse retina injected with CAG-EGFP HDAd

Sequential sections of CAG-EGFP injected mice reveal that the RPE was transduced

across the entire retina. The sections are 12 μm each, separated by approximately 100

μm. The sections are in the transverse plane, progressing from the inferior to the superior

side. The eye was injected with 1 x 1010 VP in 1 μL of HDAd encoding CAG-EGFP. The

animal was sacrificed 1 week post-injection. (Scale bar = 500 μm)

111

Figure 19 – High magnification view of a retina injected with CAG-EGFP

A high magnification view of the retina after injection with CAG-EGFP reveals that the

fluorescence was exclusive to the RPE layer, indicating that the vector failed to transduce

the photoreceptor cells. (RPE – retinal pigment epithelium; OS – outer segment

112

(photoreceptors); ONL – outer nuclear layer; INL – inner nuclear layer; 1 x 1010 VP in 1

μL of HDAd encoding CAG-EGFP; 1 week post-injection; Scale bar = 50 μm)

113

3.4.3.2. Efficient gene delivery can be accomplished with as

few as 1x105 particles

The use of 1 x 1010 VP for the injections in section 3.4.3.1 was predicated on the

concentration of vector available from vector production and the limits to the volume of

vector that can be injected. Specifically, the highest concentration of the CAG-EGFP

vector available was 1 x 1013 VP / mL. As the largest volume we could inject into the eye

was 1 μL, that yielded a maximum of 1 x 1010 VP per injection. However, with more

experience and a gradually increasing reliability in injection, it became clear that while 1

x 1010 VP represented the maximum dose, the minimum dose was unknown. It was

theorized that a lower dose should allow for a lower immune response to the vector.

Therefore, work was undertaken to determine the minimum dose that would allow for a

complete transduction of the retinal epithelium. 10-fold dilutions of the vector were

made, down to 1 x 105 VP per μL, allowing for the same volume to be injected at each

dose, thus giving the same volume for each dose to diffuse and spread within the sub-

retinal space. (n=5 at each dose, 5 doses)

The results indicate that fluorescence can be detected at doses as low as 1 x 105 VP,

although the number of cells transduced becomes visibly less with a lower density

despite the spread across the retinal epithelium (Figure 20). Doses lower than 1 x 105 VP

were not tested. At 1 x 106 VP, fluorescence could still be observed in the RPE across the

entire retinal epithelium. (Note that a section of the RPE on the posterior side of the eye

was lost during tissue processing and does not represent a lack of reporter gene

114

expression in that area.) Although a complete transduction was observed at 1 x 106 VP,

the latter long term experiments used 1 x 107 VP in order to obtain an adequate margin.

115

116

Figure 20 – Low dose injections of CAG-EGFP confer expression down to 1 x 105 VP

Injections of low doses of CAG-EGFP reveals that the fluorescence is detectable in the

RPE across the entire retina at 1 x 107 VP but became more sparse with lower doses. (All

doses at 1 μL of HDAd encoding CAG-EGFP; 1 week post-injection; Scale bar = 500

μm)

117

3.4.3.3. Long term fluorescence can be observed in injected

mouse retinas for a minimum of 4 months

As with any other uses of gene therapy, the duration of transgene expression was of

interest as re-administration of the gene therapy vector, especially when it involves

microsurgical manipulation of the eye, is undesirable.

Initial work delivering 1 x 1010 VP of the vector showed excellent expression at 3 weeks,

but no expression at 3 months (n=5 for each). In addition, extensive retinal damage was

observed, indicating that an immune response had likely occurred. (Data not shown,

identical in appearance to Figure 21 labelled as “Damaged Retina”) As the immune

response may have been a result of the vector’s toxicity rather than injection damage, and

injection of the carrier liquid (10mM Tris-HCl, pH 8.0) only did not result in retinal

damage, we sought to repeat the long-term expression studies using a minimal amount of

viral vector.

After having determined the minimal dose for a reliable, complete transduction across

the retinal epithelium (1 x 106 VP, Section 3.4.3.2), work was undertaken to determine

the duration for which expression can persist using 1 x 107 VP. These animals were

sacrificed at 1 month, 2 month, and 4 month intervals (Figure 21; n=5 each), using

previous results as representative of 1 week (Figure 20). The results indicate that strong

reporter gene expression could still be detected in most of the retinal epithelium as long

as 4 months after vector injection. Of the 5 mice injected with CAG-EGFP, 2 showed no

transgene expression, nor any morphological changes. These likely represented failed

injections where the vector failed to reach the sub-retinal space. A third mouse showed

118

trace amounts of EGFP expression, but it was accompanied by massive retinal damage

(Figure 21, labelled as “Damaged Retina”), with no discernible separation of the inner

and outer nuclear layers. The fourth mouse exhibited retinal damage without any

detectable fluorescence. The fifth mouse demonstrated complete transduction of the RPE

across the entire retina and did not exhibit any retinal damage, demonstrating that long-

term expression of transgenes is possible after delivery by HDAd vectors without

apparent retinal damage. The differences in retinal damage were likely due to differing

amounts of injection trauma, thus while some had caused a breach in the immune

privilege status of the retina, some had not caused such a breach and resulted in no retinal

damage.

Longer incubation periods after injection were not tested due to time limitations.

119

Figure 21 – Long-term monitoring of CAG-EGFP injected mice

Long-term monitoring of CAG-EGFP injected mice indicate that strong transgene

expression can be detected for a minimum of 4 months in the majority of the retinal

epithelium, although retinal damage can be observed in some cases. (1 x 107 VP in 1 μL

of HDAd encoding CAG-EGFP; Scale bar = 500 μm)

120

3.4.3.4. Although the expression is largely limited to the RPE,

there are some isolated patches where all layers within the

retina are transduced.

The results presented thus far show that transduction across the retina was robust, but

was only observed in the RPE in the vast majority of cases. However, occasionally, cells

in the neural retina could be observed to give a strong fluorescent signal. This occasional

neural retina transduction had been observed in sporadic single cells, and in large patches

of cells, covering up to 20% of the retina (Figure 22 A and B respectively). From a sub-

set of the later experiments where the imaging technique was more refined, transduction

of the neural retina was observed in 20% of successful CAG-EGFP injections (n=11).

There is no obviously discernible pattern of where these patches occur as they are

random in location and not localized to the injection site nor anatomical feature. Possible

origins of these patches are discussed in Section 4.5

121

Figure 22 – Patches of transduction of the neural retina after CAG-EGFP injection

Confocal microscopy of CAG-EGFP injected mice reveal that occasional transduction of

cells other than the RPE can be observed. These can occur as individual cells (A) or as

122

patches where many cell-types are transduced across the retinal layers (B). (1 x 107 VP in

1 μL of HDAd encoding CAG-EGFP; 1 week post-injection; Scale bar = 100 μm)

123

3.4.3.5. Injections of First-Generation, pseudotyped Ad5/F35

vector carrying CMV-EGFP did not appreciably skew

transduction towards photoreceptor cells

Previous work by others has suggested that the use of a pseudotyped adenovirus serotype

5 with fiber from serotype 35 (Ad5/F35) could skew the tropism of the adenovirus in

such a way that may be beneficial to photoreceptor transduction [143]. The rationale for

the fiber replacement stems from the binding of Ad5 fiber knob to CAR receptors which

are highly abundant on the RPE, while the Ad35 fiber (F35) knob binds to CD4 [131].

In addition, it has been suggested that the RGD domain in the penton base of the viral

capsid facilitates the uptake of the vector by the RPE, thus depleting the vector from the

sub-retinal space and preventing photoreceptor transduction [25, 203].

As the majority of the transduction observed in our experiments occurred in the RPE, it

was desirable to test Ad5/F35 in the eye to determine if HDAd would benefit from such

modifications. However, given the technical difficulty in producing a pseudotyped

HDAd, it was necessary to first confirm these findings using adenoviral vectors (AdV)

provided by our collaborators.

First-generation adenoviral vectors (FGAdV) generated from Ad5 and Ad5/F35, each

with and without the RGD domain deletion, were introduced by sub-retinal injection (1 x

108 PFU, 4 treatment groups, n=5 each). Each vector contained identical constructs

producing EGFP under the control of the CMV immediate early gene enhancer/promoter.

To serve as a comparison, an injection of 1 x 1010 VP of HDAd CAG-EGFP has also

124

been included in the figure. In all cases, large portions of the retina were found to be

fluorescent, although the expression was exclusively found within the RPE (Figure 23).

The results were not substantially different between Ad5, Ad5/F35, nor any combination

with the RGD deletion. Note that in these images, an earlier method of sample

preparation was used. As a result, there was significantly more unintentional separation

of the RPE from the neural retina than in other figures in this work. The tearing of the

RPE away from the neural retina results in the RPE processes to be separated from the

main cell body of the RPE, and are left intertwined with the photoreceptor segments.

While this may be mistaken for photoreceptor cell expression of EGFP, actual

transduction of photoreceptor cells are significantly different in appearance, with

fluorescence being observed in the outer nuclear layer as well as the photoreceptor

segments. Actual photoreceptor cell transduction can be seen in Section 3.4.3.7, Figure

25, for comparison.

While precise quantitation is not available, the lack of a significant shift towards

transduction of the photoreceptor cells was sufficient to conclude that modifications of

the HDAd5 in this manner would not yield the desired result.

125

Figure 23 – Injections of FGAdV Ad5 and Ad5/F35 both with and without RGD deletion

results in no significant increase in PR transduction

Injections of first generation adenoviral vectors of serotype 5 (Ad5), serotype 5 with

fibers from serotype 35 (Ad5/F35), and each with the RGD domain deleted from the

penton base (ΔRGD), failed to demonstrate a significant increase in the transduction of

126

photoreceptor cells. The HDAd image serves as a basis of comparison. (AdV carrying

CMV-EGFP were injected at 1 x 108 PFU in 1 μL; HDAd carrying CAG-EGFP was

injected at 1 x 1010 VP in 1μL;1 week post injection; n=5 for each treatment group;

Scale bar = 50 μm)

127

3.4.3.6. LPC does not result in improved transduction of the

PR cells.

Lysophosphatidylcholine (LPC) had been used previously to improve vector uptake in

various lung gene therapy studies [110, 121, 123], including work in our laboratory

[102]. However, studies by others have suggested that LPC has an inhibitory effect on

adenoviral entry by interfering with viral protein-host cell binding [76].

In order to determine whether LPC has any effect on photoreceptor transduction, mice

were injected with CAG-EGFP HDAd vector mixed with 0%, 0.005% or 0.010% LPC

by volume (3 groups, n=5 each). The results indicate no apparent difference when LPC is

used as the photoreceptor cells remain un-transduced (Figure 24). Note that as the

method used for sample preparation was a less refined technique, like Figure 23 from

Section 3.4.3.5, there are visible RPE processes intertwined with the photoreceptor cells

but they do not represent photoreceptor cell transduction.

128

129

Figure 24 – LPC does not increase photoreceptor transduction

The addition of LPC at 0.005% or 0.010% yields no appreciable difference to the

transduction of the photoreceptor cells compared with the control. (CAG-EGFP HDAd

vector at 1 x 1010 VP in 1 μL;1 week post injection; Scale bar = 50 μm)

130

3.4.3.7. Injections of HDAd Rho-EGFP results in sporadic,

limited transduction restricted to photoreceptor cells only

In order to assess the photoreceptor specificity of the Rho-EGFP construct in vivo, HDAd

vectors carrying the construct were injected into the sub-retinal space using methods

identical to CAG-EGFP injections (section 3.4.3.1). In the majority of cases, no

transduction could be detected in the retina (Figure 25A). However, in approximately

20% of the cases, small areas of transduction can be found (Figure 25B and D;6 groups,

total n = 28; The presence of these areas could be reliably detected only using a method

of tissue preparation and imaging used in the later part in the work herein, thus earlier

experiments were not included.) Under high magnification, it became apparent that in

these areas, fluorescence is restricted exclusively to the photoreceptor cells (Figure 25C

and E). These areas of transduction indicate that the rhodopsin promoter construct (IRBP

Enhancer with 1553 bp rhodopsin promoter, Section 3.1.2) confers cell-specific

fluorescence. This is confirmed with the complete lack of transduction of the RPE, even

in areas where successful photoreceptor transduction can be found.

131

132

Figure 25 – HDAd carrying Rho-EGFP injected into the sub-retinal space of mice

Injections of Rho-EGFP usually resulted in no visible transduction (A). However, in

approximately 20% of the cases, areas of transduction can be found (B and D; each from

different mice). High magnification views of these areas reveal that transduction is

exclusive to photoreceptor cells (C and E, corresponding to the red boxed area of B and

D respectively). (Scale bars = 500 μm (A, B, D), Scale bars = 100 μm (C and E); 1 x 1010

VP in 1 μL of HDAd vector carrying Rho-EGFP; 1 week post-injection)

133

3.4.3.8. Injection of the GRK1-EGFP vector results in no

detectable fluorescence.

Although the GRK1 promoter had proven to be weaker than the rhodopsin promoter in

cell culture (Section 3.1.3), we decided to attempt to use GRK1-EGFP in equivalent

mouse studies in case the difference was caused by peculiarities in the cell lines. Work

was undertaken to generate HDAd vectors based on the plasmid constructs. However, no

transduction could be detected in any part of the retina after GRK1-EGFP injection.

Furthermore, no sporadic areas of transduction could be observed, unlike the results with

Rho-EGFP. (3 groups, total n = 15)

3.5. HDAd carrying the therapeutic gene is capable of

transducing cells and conferring expression

Having confirmed the function in vivo of the vectors using the EGFP reporter gene,

vector constructs carrying ABCA4 rather than EGFP were used in cell culture and in vivo

to confirm HDAd’s ability to deliver large genes with the expectation that their

behaviour would be otherwise identical.

CAG-ABCA4 transduction resulted in ABCA4 mRNA production in both ARPE-19 and

WERI-Rb cells as determined by qRT-PCR (Figure 26). Rho-ABCA4 transduction

resulted in ABCA4 mRNA production in WERI-Rb cells only. The results are consistent

with the data produced with reporter genes (Section 3.4.1), indicating that the rhodopsin

promoter construct retained cell-specificity despite the change in the gene expressed.

134

Of interest is the consistently higher expression levels observed in WERI-Rb, which is in

agreement with the observations from the reporter gene assays (Section 3.4.1). As the

increased levels of expression detected here was in the mRNA, it stands to reason that the

explanation for WERI-Rb expressing more protein was not because of higher translation,

but due to differences in transcription.

This experiment was repeated using different doses of vector. The results from 8000

VP/cell, 16,000 VP/cell, and 32,000 VP/cell showed the same pattern of relative

expression as the data presented in Figure 26.

135

Figure 26 – mRNA from cell lines transduced with CAG-ABCA4 and Rho-ABCA4

qRT-PCR shows that CAG-ABCA4 transduction results in ABCA4 mRNA production

regardless of cell type, while Rho-ABCA4 results in mRNA production in WERI-Rb but

not in ARPE-19 cells. (32,000 VP/cell; 2 days post-transduction)

136

In order to confirm that the results from the mRNA experiments correlate with protein

produced, HeLa, ARPE-19 and WERI-Rb were transduced with 8000 VP/cell of CAG-

ABCA4 or Rho-ABCA4 (Figure 27). The results indicate that all three cell lines produce

detectable levels of ABCA4 protein of the appropriate ~256 kDa size (indicated by the

red box). Furthermore, only WERI-Rb produced ABCA4 when transduced with Rho-

ABCA4, confirming that cell-specificity was not lost when the EGFP reporter gene was

replaced with ABCA4.

In addition, two bands of approximately ~130 kDa can be observed when WERI-Rb was

transduced with CAG-ABCA4. Repeated experiments have shown that these bands are

consistent under a variety of conditions for protein extraction and separation. A dilution

series showed that these bands are present even at very low doses and because they are

more abundant than the expected 256 kDa band, they appear before the expected band as

the dose is increased through the detectable limit. (Data not shown)

137

Figure 27 – Western blot of cell lines transduced with CAG-ABCA4 and Rho-ABCA4

Western blot analysis of 3 cell lines transduced with CAG-ABCA4 and Rho-ABCA4

reveal that the CAG-ABCA4 confers ABCA4 protein expression to all 3 cell lines while

Rho-ABCA4 produces protein only in WERI-Rb cells. In addition, there are two

prominent bands of lower molecular weight that appear only when WERI-Rb cells are

transduced with CAG-ABCA4. (Red box indicates the expected size of ABCA4 at ~256

kDa; 8000 VP/cell; 5 days post-transduction)

138

To further confirm the presence of the protein in transduced cells, cultured cells (ARPE-

19, HeLa, and WERI-Rb) transduced with CAG-ABCA4 or Rho-ABCA4 (8000 VP/cell)

were stained with anti-ABCA4 antibody and imaged for immunofluorescence (Figure

28). The results are fully consistent with previous data; CAG-ABCA4 transduction

resulted in production of ABCA4 in all three cell lines while Rho-ABCA4 did not elicit

ABCA4 production in any cell line other than WERI-Rb.

139

Figure 28 – Immunofluorescence imaging of cell lines transduced with either CAG-

ABCA4 or Rho-ABCA4

Immunofluorescence imaging of cell lines transduced with either CAG-ABCA4 or Rho-

ABCA4 shows the same pattern of expression as earlier observed, with CAG-ABCA4

conferring expression in all cell lines while Rho-ABCA4 confers expression only to

WERI-Rb cells. (5 days post-transduction; Scale bar = 10 µm)

140

3.5.1. Injections of HDAd vector carrying ABCA4 into mouse

retina

Having confirmed the function of the vector in cell culture, HDAd carrying the ABCA4

expression cassettes was injected into mouse retina to assay for function and distribution.

To assay the delivery of ABCA4 by HDAd in vivo, mouse eyes were injected with CAG-

ABCA4 (1 x 1010 VP). The animals were sacrificed at 7 days post-injection, and the

tissue was processed for assay of mRNA by qRT-PCR. The results from human-specific

ABCA4 primers indicate that hABCA4 is detectable from injected eyes but not from

control eyes (Figure 29).

141

142

Figure 29 – qRT-PCR for transgenic ABCA4 from injected mouse eyes

Mouse eyes injected with CAG-ABCA4 were processed for assay of mRNA by qRT-

PCR. The relative abundance graph (A) is derived from data obtained by qRT-PCR (B).

The results indicate that CAG-ABCA4 elicits ABCA4 mRNA production in vivo. (n=4;

Error bars represent the standard error of the mean; the difference is statistically

significant based on t-test p<0.05; 1 week post-injection)

143

3.5.1.1. Immunofluorescence imaging of CAG-ABCA4

injected mice indicate ABCA4 expression within the RPE.

Mouse eyes injected with 1x1010 VP of CAG-ABCA4 were stained with anti-ABCA4

and imaged for immunofluorescence (Figure 30 and Figure 31). The results show a

fluorescent signal in some areas of the RPE in approximately 20% of mice (n=10).

Fluorescence was not observed in control mice nor in antibody controls. Furthermore, no

fluorescence was observed in the photoreceptor cell layers even though the antibody used

is cross-reactive between mouse and human ABCA4, and the mice were wildtype and

thus should express ABCA4.

This lack of fluorescence from the photoreceptor cells in these wildtype mice indicates

that the antibody staining is not sufficiently sensitive to detect endogenous ABCA4

expression. The presence of fluorescence signal from the RPE of injected mice, given

that the RPE does not naturally express ABCA4, therefore must represent exogenous

expression conferred upon the RPE by HDAd carrying CAG-ABCA4. The fluorescence

in the RPE but not in the photoreceptor cells also implies that the expression levels of

ABCA4 conferred upon the RPE cells by the vector exceeds that of the photoreceptor’s

endogenous levels.

A more definitive experiment to confirm the function of the CBA-ABCA4 vector would

involve the use of ABCA4-/- knockout mice whereby any detectable ABCA4 expression

can only arise as a result of successful transduction. However, this experiment could not

be performed as such knockout mice were not available to our laboratory.

144

Figure 30 – Immunofluorescence imaging of mouse eyes injected with CAG-ABCA4

Immunofluorescence imaging of mouse eyes injected with CAG-ABCA4 indicate

ABCA4 expression in the RPE cells in some areas within the retina. A magnified view of

the area within the yellow box showing RPE transduction can be seen in Figure 31. (1 x

1010 VP; 1 week post-injection; DAPI – blue; ɑABCA4 – green; ɑRhodopsin – red)

145

Figure 31 – Magnified view of the areas within the yellow box from Figure 30

Magnified view of the areas within the yellow box from Figure 30 demonstrating the

presence of ABCA4 within the RPE of CAG-ABCA4 injected mice. (Scale bar = 250

μm; 1 x 1010 VP; 1 week post-injection; DAPI – blue; ɑABCA4 – green; ɑRhodopsin –

red)

146

3.5.2. mRNA, western blots and IF using different batches of

CAG-ABCA4 reveals variations in vector efficacy between

batches

In order to refine HDAd vector based gene delivery, it would be helpful to quantify the

variations between batches of vector produced. Because of the low quantity of CAG-

ABCA4 vector produced per production run, varying from 1 x 108 VP to 2 x 1013 VP, 5

separate runs were made, resulting in separate batches of varying concentration and

possibly varying quality. Note that repeated production runs was not necessary with the

EGFP reporter vectors as the yield from a single production run was adequate for a large

number of experiments, thus fewer different batches were used for examination.

mRNA extracted from HeLa cells transduced with 32,000 VP/cell of each batch was

examined by qRT-PCR (Figure 32A). The results indicate a large variation between

batches and not correlated with the storage duration of each batch. This experiment was

repeated with 8000 VP/cell and 16,000 VP/cell, resulting in the same pattern of relative

abundances. To confirm that the difference in mRNA results in a variation in protein

production, the first three batches were examined by immunofluorescence and by

western blot (Figure 32B). The protein expression confirms the results observed by

mRNA.

It is important to note that all the data presented herein of CAG-ABCA4 were conducted

using a single final batch of the vector (Batch 4) to ensure consistency within the data.

147

148

Figure 32 – Comparison of batches of CAG-ABCA4 by qRT-PCR, immunofluorescence

and western blot

mRNA extracted from HeLa cells transduced with different batches of CAG-ABCA4, all

at 32,000 VP/cell, reveal that the amount of mRNA produced as a result of transduction

is highly variable (A; 3 days post-transduction). This variation is seen in protein

production by immunofluorescence imaging and western blot (B; 5 days post-

transduction).

149

4. Discussion

Adenoviral gene therapy has been in development for many decades, and this study was

not the first in attempting to apply adenoviral gene therapy for the treatment of retinal

disease. However, the hypothesis of applying helper dependent adenoviral vectors to

treat Stargardt’s disease had not been previously tested. Unfortunately, we encountered

several obstacles to the in vivo application of the vector that have not been described

previously in cell culture and in vivo studies. However, we did succeed in establishing

excellent transduction of the retinal epithelium at very low doses, and prove that strict

cell specificity can be obtained using transcriptional regulation. Below the knowledge

gained and the possible future directions for applying HDAd to retinal gene therapy are

discussed.

4.1. Anomalous protein bands observed when CAG-ABCA4

vector is used to transduce WERI-Rb cells is likely a result of

RNA processing

In the western blot experiments, we observed that the combination of CAG-ABCA4

vector and WERI-Rb cells gave two anomalous bands at approximately 130 kDa in

greater concentration than the expected band at 250 kDa (Section 3.5.1, Figure 27).

When WERI-Rb cells were transduced with very low doses of CAG-ABCA4, the two

lower-mass bands appeared before the expected band. Furthermore, these bands were not

observed with any other combination of vector and cell line.

The possible sources of these bands can be summarized as errors in the vector, post-

translational modifications, protein cleavage, or alternative mRNA products. It is also

150

important to note that the Rim3F4 antibody used for detection targets the C-terminus of

the protein, thus both bands contain the C-terminus and therefore the bands do not

represent two separate parts that add up to the complete protein. In other words, the

bands do not represent the cleavage of the intact protein unless there are two separate

cleavage events, each resulting in an N-terminal product.

It is highly unlikely for errors in the vector to cause the observed bands as the sequence

of vector portions carrying ABCA4 was confirmed in its entirety. The same cassette was

also used to construct Rho-ABCA4, which does not result in the additional bands.

Furthermore, the use of the same vector yields only faint bands of the same unexpected

size when used in cell lines other than WERI-Rb. As such, errors in the vector are highly

unlikely.

Post-translational modifications have been well studied by our collaborators (Dr. Robert

S. Molday, University of British Columbia) [209]. Post-translational modifications were

also discussed as a potential source of these bands, as it is possible that the high levels of

expression from the combination of CAG promoter and WERI-Rb’s high transcriptional

activity could result in post-translational modification mechanisms not being able to

maintain pace with protein production. Although several glycosylation sites and five

phosphorylation sites were found, none of these modifications explain the additional

bands observed as both bands are significantly smaller than the expected protein size. In

addition, although a disease-associated mutation in one of the phosphorylation sites was

observed to lead to protein misfolding and degradation, a western blot of the affected

protein did not result in a size-shift corresponding to the bands we observed.

151

Degradation products of proteins often result in western blot smears or bands of smaller

sizes. The same vector used in other cell lines does not result in degradation, thus the

aberrant band does not appear to be normal degradation caused by the protein or by the

vector used. Additionally, the same cell line transduced with Rho-ABCA4 does not result

in the same bands of comparable intensity, thus this could not be a result of degradation

inherent in the cell line. It could be argued that the high levels of protein production

resulting from this combination of promoter and cell line may have triggered an

unidentified protein degradation mechanism due to excess protein accumulation.

However, when minimum amounts of vector were used to minimize instances of

multiple-infection, the anomalous bands appear well before the expected band emerges,

thus it does not appear to be dependent on protein over-production. As such, it is difficult

to justify the bands as degradation products.

Finally, it is possible that the bands reflect alternative mRNA products. As the cloned

sequence contains no introns within ABCA4, splicing cannot account for shortened

products preserving the antibody-binding C-terminus. However, it is possible that

translation of the mRNA started at a site other than the one expected. There are multiple

in-frame ATG near the middle of the mRNA that would result in proteins of the observed

size and provide the C-terminus for antibody binding. This errant translation is not a

result of an error in the expression cassette of the vector construct as the same vector

performs normally in other cell lines. Also, because WERI-Rb transduced with Rho-

ABCA4 vector does not yield the anomalous bands, it is not a feature inherent in WERI-

Rb cells. The only explanation is that the high transcriptional activity of WERI-Rb cells,

in conjunction with the CAG-ABCA4, is causing such errant translation as to result in

152

two N-terminal truncated proteins. This errant translation is not observed in Rho-

ABCA4 as the promoter results in much less mRNA production. As mentioned

previously, even when minimum amounts of vector were used, the anomalous bands

appear earlier than the expected band. This observation could be a result of a single

transduction event per cell being sufficient to produce a high level of mRNA, even

though as a population the majority of cells are not transduced. As a result, there is a

fixed ratio between complete and truncated proteins being produced, and as more cells

are transduced via increasing the dose, the complete protein becomes more abundant and

detectable.

It is unlikely that these aberrant proteins are produced in vivo. In future studies, after

neural retinal transduction can be established reliably, an animal model could be used to

determine whether the transgene is performing as expected via physiological or

phenotypic studies.

4.2. HDAd required to transduce the entire retinal epithelium is

low, but is also difficult to quantitate precisely, and there are

variations in VP:IU between batches

Although uncommon, lentiviruses have been studied for use in the retina. In two such

studies, there was only partial transduction of the RPE and sparse transduction of the

neural retina at 1 x 106 PFU [155, 241]. Studies with AAV typically use doses ranging

from 1 x 108 VP to 2 x 109 VP [29, 98, 131], although doses as high as 1 x 1013 VP have

also been used [157]. While doses above 1 x 1010 VP are reported consistently as giving

effective transduction, lower doses have been observed at times to be inadequate [241].

153

Previous dosage studies with first-generation (E1 deletion only) adenoviral vectors in

mice have shown that 1 x 107 PFU is the minimum dose required to obtain complete RPE

transduction of a CMV-LacZ expression cassette [11]. Other studies subsequently used

this dose as an absolute minimum, often with doses as high as 1 x 109 PFU and have

demonstrated repeatedly that doses under 1 x 107 PFU are inadequate for complete

transduction [204, 241].

A few other studies have attempted to use HDAd vectors in the retina with very limited

effect. In one study, only very sporadic, small points of the retina could be seen to

express the GFP reporter gene at doses of 1 x 108 VP [115]. A separate group first

quantitated their vector based on the number of fluorescent cultured HeLa cells obtained

after transduction with vector encoding EGFP to determine the volume required to obtain

a set number of infectious units (IU), similar to the plaque forming units (PFU) that

would otherwise be used to quantitate virus [111]. That study found approximately 50%

transduction within the RPE of the retina when 5 x 104 IU was used. The authors also

stated that “virtually complete transduction” was obtained at 5 x 105 IU and that higher

titre did not improve transduction, although the images presented were similar to the

incomplete transduction results we obtained at a dose 10 to 100 times below that required

for complete transduction (Figure 20, CAG-EGFP 1 x 105 VP).

From our own data, Figure 20 clearly demonstrates that complete transduction can be

obtained at a dose of 1 x 107 VP (1 x 105 IU) or lower. The high magnification

examination of these injected retinas reveal that there are no breaks or untransduced

areas across the entire retinal epithelium, identical in appearance to that of Figure 13 and

154

thus likely indicates that even 1 x 107 VP (1 x 105 IU) is above saturation and well

beyond the minimum required. The doses used in this study achieved a high level of

transduction using doses lower than those previously documented.

However, it is important to note that there is considerable difficulty in precisely

quantifying non-replicative viral vectors in the absence of a reporter gene. Replicative

viral vectors, or viral vectors which can replicate in specialized production cell lines, can

be easily assessed by plaque forming assays. However, with vectors such as AAV and

helper-dependent adenovirus, indirect methods of quantification must be used.

If a vector carries a reporter gene, it is also easily quantifiable. This can be done via

several methods including flow cytometry after transduction in cell culture as

demonstrated in Section 3.4.2. However, there are many scenarios in which a reporter

gene may not be desirable as it may adversely affect monitoring of the results, or may

trigger additional immune effects. In the absence of a reporter gene, antibody staining

could be used to determine the percentage of transduced cells, but this method introduces

the possibility of transduced cells not being detected as a result of weak antibody

staining, and thus yield an underestimate of the infectious units.

Quantification of non-replicating vectors not carrying reporter genes relies on

quantifying the DNA content within the vector preparation, after purification steps have

been taken to remove DNA not packaged within the virion. In its most basic form, it can

be accomplished by simple photospectrometry to estimate DNA concentration [140,

154]. A more precise quantification can be obtained via qPCR targeting either the

transgene [173] or the inverted terminal repeats [6]. However, qPCR only measures the

155

viral particle-associated DNA. It neither confirms the entirety of the vector DNA, nor

does it assay for the ability of the vector to actually transduce cells. It was shown in a

previous study using AAV, detecting certain portions of the packaged DNA can result in

an over-representation of how many virions have packaged the entirety of the DNA

successfully [221]. While AAV and adenovirus have different methods of packaging, the

possibility of incomplete DNA packaging exists in adenovirus as well. A further

refinement is available by detecting adenovirus in cell culture after transduction to

quantify the viral genome DNA [69]. The cells are carefully washed after incubation with

the virus to remove unattached virus. The cells are lysed and qPCR is used to determine

the number of vector genome copies present in the lysate. However, the argument can be

made that virions that have attached onto the cells may be defective in viral entry, and

such protocols are unable to determine whether the viral DNA is intracellular or attached

but extracellular.

Ideally, to confirm transduction without the use of a reporter gene, the mRNA produced

by the vector payload must be assayed by qRT-PCR. However, as mRNA accumulates

over time as a result of continuous transcription from the viral template, strict temporal

controls must be in place to ensure that the data is consistent. The mRNA level would

then need to be correlated with a plaque forming assay using a replication competent

vector, such as first-generation adenovirus in a producer cell line, carrying the same

construct in order to serve as a comparison. If performed under identical conditions, a

standard curve of the qRT-PCR from the replication competent vector can then be drawn

against the resultant PFU. The use of different promoters would require a new standard

curve due to differing transcription activity. Also, the assay must be conducted in the

156

same cell line even if a more physiologically relevant cell line is desired as cell lines

differ in transcriptional activity. In addition, the time of incubation before analysis must

be short enough to occur before viral genome replication in the replication competent

vector and yet long enough for sufficient mRNA to allow for qRT-PCR analysis. Finally,

it makes the assumption that there are no cis-acting elements present in the replication

competent vector that might affect the transcriptional activity of the gene of interest.

This, in conjunction with the obvious practicality concerns as each construct must be

made into separate vectors, makes it of questionable value.

Unfortunately, as can be seen in Section 3.5.2, despite the extensive experience in our lab

in vector production, the quality of each batch of vector still varies significantly. For non-

replicative viral vectors to succeed, an accurate way of determining titre and improved

methods to optimize vector quality must both be employed.

Associated with the difficulty in quantitation is the variation found between batches of

HDAd which affects the particle to IU ratio. As shown in Section 3.4.2, we found a

particle to IU ratio of approximately 1:100. This result is approximately double that of

previously published ratios between the number of virus particles and infectious units

using wildtype Ad5 grown in 293 cells (1:60) [19]. The presence of non-infectious

particles is attributable to viral production, specifically the packaging of incorrect DNA,

contamination from helper virus, and the presence of defective virions carrying the

desired DNA payload. Although a portion of the defective virus is unavoidable, some of

it can be attributed to the production techniques employed.

157

As shown in Section 3.5.2, Figure 32, there is a variation of approximately 5-fold

between the least and most efficacious batches of CAG-ABCA4 vector as determined by

qRT-PCR for measurement of ABCA4 mRNA.

The presence of helper virus contamination can adversely affect experimental results as

they would act as first-generation adenoviral vectors, expressing multiple viral genes that

contribute to immunogenicity in vivo. In addition, quantitation by optical density is

unable to distinguish between HDAd and helper virus, thus the presence of helper virus

would also contribute towards an apparent reduction in infectivity.Higher quality and

reliability in helper-dependent adenoviral vector production would contribute towards the

ease and reproducibility of experiments.

The method used for our HDAd production is a commonly accepted method involving

multiple rounds of small-scale production using tissue culture plates, followed by several

rounds of large-scale production using stirring flasks, each round requiring co-infection

with helper [154]. The key problem with this method is that the products of each round

of amplification may be impure, containing incorrectly packaged DNA, recombined

vector genomes, as well as helper virus contamination. These undesired components are

then carried over and, if inverted terminal repeats are present, are amplified along with

the desired product. In addition, the helper virus carried over contributes to the titer of

additional helper virus that must be added during each round, and therefore adversely

skews the ratio between helper and helper-dependent particles.

Multiple strategies are already in place to help reduce helper virus contamination. The

earliest involved the addition of LoxP sites flanking the packaging signal of the helper

158

virus and the addition of Cre recombinase to the cell line to render helper virus DNA

unable of being packaged [160]. Further refinements led to the reversal of the direction

of the packaging signal, thus rendering homologous recombination products between the

helper DNA and helper-dependent DNA too long to be packaged. Although these genetic

changes reduce the helper virus contamination between rounds of replication, they do not

eliminate the problem, nor do they address the carry-over of contamination other than

helper virus.

The imprecise method by which production occurs also contributes towards the lack of

reliability. The published method requires 6-8 serial passages on small plates, each done

blindly without knowledge of how much helper virus is being carried over and how much

of the helper-dependent vector is present. The lysate is then used to inoculate the

suspension-cell culture for large scale production. While the passage with highest helper-

dependent genome DNA, and thus highest yield of helper-dependent virus, can be

identified by Southern blot after the passages, the helper virus is added at the beginning

of each serial passage without quantifying the amount of carried-over virus. There is also

no monitoring of the helper virus and helper-dependent virus present at the end of each

passage to optimize the subsequent round. Furthermore, the actual quantity of helper

virus present in the inoculum is not known, only that it was a fraction of the highest

yielding of the serial passages.

Ideally, after the serial passages, the vector should be purified by ultra-centrifugation to

minimize helper virus contamination. Quantitation by optical density would then allow

for an estimate of the titre for inoculating the large suspension production culture. Doing

159

so would allow for a much better controlled inoculum of helper virus as it removes carry-

over from previous amplifications. It also provides a precise, repeatable inoculum of

helper-dependent virus, as insufficient inoculum would lead to under production while

excessive inoculum may lead to earlier cell-death and thus also reduce yield.

Alternatively, the integration of the entire helper virus genome into a production cell line

would completely eliminate all issues of helper virus contamination. As this modified

cell line would be capable of making complete albeit empty virions, the modifications

would require that the production be strictly controlled. Similar to the first generation

virus where the E1 gene is deleted, thus disrupting the initiation of virus production, E1

could also be placed under a strict inducible promoter to prevent virus production and

cell-death until chemical induction.

Despite these issues, it is important to keep in mind that although the viral vector

production in the laboratory setting may be sub-optimal, helper-dependent adenoviral

vectors for clinical trials would require GMP production and much improved purity to

permit its use. It is likely that with such improved production, the retinal degradation

observed in Section 3.4.3.3 would not be of significant concern and would not represent

a significant hurdle in the use of helper-dependent adenoviral vectors for retinal gene

therapy.

4.3. The tropism of the HDAd vector may be reducing the

transduction of photoreceptor cells

Section 3.4.3 demonstrated conclusively that HDAd is highly effective in transducing the

RPE of the retina. However, these high magnification views also demonstrate that there

160

is no transduction in cell types other than the RPE. This pattern of transduction seems to

indicate that the vector is unable to transduce the other cell types, including our target

photoreceptor cells, by sub-retinal injection. The possible reasons why the vector cannot

transduce these cells must be due to the tropism of the viral vector, the inability of the

vector to access the relevant cells, or the inability of the cells to express the reporter

gene. This section discusses the tropism of the viral vector. The possibility of the viral

vector being unable to access the relevant cells as a cause of the lack of neural retinal

transduction is discussed in Section 4.5 as part of the discussion relating to the patches of

transduction described in Section 3.4.3.4.

Adenovirus serotype 5 (Ad5) is primarily a respiratory virus and thus has a tropism for

epithelial cells, particularly those found within the respiratory tract. Upon injection into

the sub-retinal space, it is expected that the tropism of the virus results in the preferential

infection of the RPE. As the HDAd vector has a viral capsid identical to that of

adenovirus, it would be logical to expect the vector to preferentially transduce the RPE.

This is apparent by the results observed with CAG-EGFP vectors where complete

transduction of the RPE is observed without transduction of other cells (Section 3.4.3.1).

While information is not available to skew the viral vector tropism towards photoreceptor

cells, it is possible to skew the tropism away from the RPE.

Ad5 infection of the eye is known and targets multiple sites within the eye, including the

corneal epithelial cells, corneal stromal fibroblasts, and conjunctival epithelial cells [8].

However, there are no known infections of the eye that are specific to the photoreceptor

as the cells are well protected and thus infections only occur in the anterior portion of the

161

eye. As such, the receptors for viral binding and infection of photoreceptor cells are

unknown. It would be logical to surmise that skewing the viral tropism away from

epithelial cells in general would increase the proportion of injected viral vector available

to transduce photoreceptor cells. Since, it is known that CAR is absent on photoreceptors,

and CD46 is present [131], it would be desirable to alter the viral vector such that the

fiber-knob can no longer bind to CAR. It would also be desirable to delete the RGD-

motif such that it can no longer bind to ɑvβ5 integrin as it is also commonly expressed on

epithelial cells [39, 227], thus reducing attachment and viral entry to the epithelial cells

respectively. However, the heparan sulfate associated binding to the fiber should be left

undisturbed as HSG are expressed within the retina’s neural cells and photoreceptors [27,

150].

Previous works have examined the effects of pseudotyping adenoviral vectors to alter

their tropism. A study using a variety of mutated adenoviral vectors to skew tropism has

been observed to alter the effects of systemic vector delivery as the organs of non-human

primates are affected differently [188]. For example, the removal of the HSG binding site

from the fiber shaft significantly decreased liver transduction. The same group also

studied the same effects in mice and observed effects in differential tropism after these

modifications [189], although both studies viewed differences between organs but not

between different cell types.

In a study specific to the use of adenoviral transduction of photoreceptors, a vector of

Ad5 expressing Ad17 fibers revealed that the shorter fibers of the species D virus failed

to improve photoreceptor transduction [25], despite the expectation that Ad17 fibers

162

would reduce epithelial cell transduction by making the vector less-able to

simultaneously engage the CAR via the fiber knob and the integrins via RGD. The

authors also deleted the RGD motif from the penton base and claimed improved

photoreceptor cell transduction, although the fluorescence images look doubtful with

significant background fluorescence and very poor morphology. Furthermore, the authors

had noted that the expression was patchy and the morphology did not allow for adequate

assessment of how much of the retina was transduced.

A more recent study pseudotyped Ad5 with fibers from Ad35 which targets CD46 and

from Ad37 which targets sialic acid, and also included Ad5 with the RGD motif deleted

[203]. The fibers of both Ad35 and Ad37 are short [231], and thus should result in

reduction in RPE transduction. However, Ad5/F35 showed a reduction in neural retina

transduction while Ad5/F37 showed a marginal improvement. This effect was also

observed by others, although the level of transduction was poor [131], necessitating anti-

GFP staining as fluorescent observation alone was insufficiently sensitive. Deletion of

the RGD domain showed no apparent effect. This difference between Ad35 and Ad37

fibers is likely due to the inability of Ad37 fiber to bind to CAR [26]. Rather, sialic acid

is used for cell-surface attachment, and the increased transduction of Ad5/F37 into

photoreceptor cells may be attributable to this [5]. In fact, sialic acid has been determined

to be present in the photoreceptor cell surfaces, although it is also present in the RPE

[40]. It is interesting to note that in both studies, the expression beyond the RPE was

observed to be patchy. This will be further discussed in Section 4.5

163

In summary, very few high quality studies have been conducted in the pseudotyping of

adenovirus, and the data for skewing adenoviral tropism for the photoreceptor is scarce at

best. As such, any effort to intensively modify the HDAd for photoreceptor tropism

would rely on very limited knowledge and much speculation. That said, in designing an

optimized helper-dependent adenoviral vector specifically for the photoreceptors, one

should aim towards reducing the viral tropism for epithelial cells, while increasing

affinity for the sialic acid found on photoreceptor cells. In terms of the fiber knob, one

would desire changing the knob such that it carries the Ad37 sequence and thus binds to

sialic acid rather than CAR.

Given that ɑvβ5 integrins are known to be on the RPE, the interaction between the RGD

motif and RPE integrins is clearly to be avoided. This can be accomplished via the

modification of the sequences flanking the RGD motif to skew the affinity towards

another integrin type as previously shown [227]. However, as it is not known what type

of integrin is present on the photoreceptor, we are left with the options of either deleting

the RGD entirely, or altering the sequences without the knowledge of what type of

integrin should be targeted. As such, it would be necessary to engage in a proper study

employing a range of different modified vectors to determine what flanking sequences

are optimal for binding to photoreceptor cells, if there is any effect to be found beyond

RGD deletion. Note that in our experiments using first-generation adenoviral vectors, we

did not observe an effect with RGD deletion (Section 3.4.3.5, Figure 23). The lack of

effect is likely because the CAR targeted by the Ad5 fiber and the CD46 targeted by the

Ad35 fiber were sufficiently abundant on the RPE that any effects of RGD deletion was

164

overwhelmed in Ad5ΔRGD and Ad5/F35ΔRGD respectively, and had entered the cells

via an integrin-independent pathway.

As for the length of the fiber, it is difficult to determine whether a long fiber, such as that

of Ad5, would be preferable to a short fiber, such as that of Ad 37. While it is known that

a long fiber with a CAR compatible knob increases viral entry in cell culture [183], and

that integrin binding improves viral entry, it is possible that a long fiber may prove to be

beneficial when a sialic acid compatible knob is present as it would allow for the same

simultaneous binding that has been proposed to improve viral transduction [169]. This

would depend on whether integrins are present on the photoreceptor cells, whether the

integrins are accessible from the sub-retinal space; and if the integrin is different from the

ɑvβ5 found on the RPE [122, 176]. Given the lack of knowledge of the presence or

absence of integrins on the photoreceptor cells, there would be no benefit in using a long

fiber. However, if the fiber knob can no longer bind CAR, there would also be no

detriment in using the long fiber. As previously mentioned, given that there is no

information available on the integrins of photoreceptor cells, there is no rationale for

selecting a short versus long fiber. However, as HSPG binds to the proximal shaft area of

the Ad5 fiber [189], and such proteoglycans exist in the photoreceptor cells [116, 150,

151], it would be beneficial to use a long Ad5 fiber with an unmodified shaft to facilitate

such interaction.

Finally, it should be noted that CD46 is a receptor for some species B adenoviruses such

as Ad35 [68]. Conflicting information exists on the presence or absence of CD46 in

photoreceptor cells [63, 131]. This would indicate that CD46 may be present in

165

photoreceptors but at a very low level whereby some groups are unable to detect it, as

supported by a separate study comparing its expression in other parts of the eye [16].

Although it may be beneficial to include affinity for CD46, doing so would require the

sacrifice of affinity to sialic acid as it is also targeted by the fiber knob [161]. In addition,

increasing affinity to CD46 may prove to have a negative effect as CD46 is also

abundant on the RPE [137]. The presence of CD46 on the RPE likely accounts for the

lack of improvement observed with the first generation Ad5/F35 in our in vivo

experiments involving reporter genes (Section 3.4.3.5, Figure 23).

Given that Ad37 has a fiber knob that binds to sialic acid and not to CAR, and that the

effect of fiber length is unknown given the lack of known integrin interaction, it is logical

to suggest that rather than pseudotyping Ad5, a helper-dependent version of Ad37 could

be generated instead. However, Ad37 has much stronger integrin binding than Ad5

[134], an interaction that was confirmed by studies blocking integrin via antibodies [32].

As such, a HDAd version of Ad37 is precluded.

An ideal HDAd vector for targeting photoreceptors would require the modification of the

fiber knob to that of Ad37 so that it can bind to sialic acid, without modifying the shaft

such that it can still bind to HSPG. It would also require either modification of the penton

base to remove the RGD motif, or if more information is available, modify the sequences

flanking the RGD motif to alter the integrin it has affinity for.

4.4. Potential application of HDAd in RPE diseases

Our ability to transduce the entire retinal epithelium at very low doses (Section 3.4.3.2)

suggests the possibility of ocular gene therapy using HDAd to target the RPE. Of the

166

many causes of inherited retinopathies, the RPE-specific genes that may be responsible

are RPE65, LRAT, RDH5 [35], and MERTK [18].

RPE65 has been well studied and is well into human clinical trials using AAV as

mentioned previously (Section 1.3.4) [9, 34, 36, 81, 129, 184]. Because of the small size

of the RPE65 gene does not necessitate the use of a larger vector and the already

demonstrated safety and efficacy of AAV in its treatment, the most expedient path

towards clinical application remains with AAV.

Mutations in LRAT causes a form of Leber’s congenital amaurosis [103]. The gene

encodes a lecithin retinol acyltransferase, a key enzyme in the visual cycle (Section

1.1.2). LRAT gene therapy has been studied using AAV with significant electro-

physiological results but poor distribution of gene expression [8]. Furthermore, it has

been argued that the regulatory regions required for LRAT expression cannot be

packaged within the limits of the AAV vector despite the small size of the gene [103].

Given the very preliminary results and lack of widespread transduction observed in

studies thus far, there is the potential that HDAd may be a more efficacious vector for

delivering LRAT to the RPE.

Fundus albipunctatus is a rare disease that has been identified to be caused by the gene

RDH5, a retinal-pigment epithelial specific gene that can cause retinal degeneration with

no known treatment [35]. RDH5 is a crucial gene in the visual cycle (Section 1.1.2), but

the possibility of treating this disease using gene therapy has yet to be studied. As an

autosomal recessive disease of the RPE, HDAd is an ideal vector for delivering a

functional copy of RDH5 for the treatment of this disease.

167

Of these four genes, only MERTK is not directly involved in the visual cycle (Section

1.1.2). MERTK is a gene associated with the phagocytosis of the shed photoreceptor

segments by the RPE, and its dysfunction causes a form of retinitis pigmentosa. MERTK

has been treated in animal studies using lentivirus [208], adenovirus [215], as well as

AAV [51, 185]. The positive results have led to human clinical trial using AAV which

has been initiated but the results are as yet unpublished [18]. As with RPE65, because of

the advanced development of therapy with AAV, the most expedient path towards

clinical application remains with AAV.

Although two of these diseases have progressed to clinical trials with AAV, and the third

has had preliminary studies with AAV, this does not necessarily preclude studies in

HDAd. Our studies with the minimum dose required for complete transduction of the

RPE is many folds lower than that observed with other vectors (Section 4.2), and as such

HDAd may have a role should the toxicity associated with high doses of AAV prove

problematic.

4.5. Patches of complete retinal transduction

In the majority of injection of vectors carrying CAG-EGFP, no transduction of the neural

retina could be observed while the entirety of the RPE was fluorescent. However, in

some cases, patches of transduction within the neural retina could be observed (Section

3.4.3.4). Similarly, injections of vectors carrying Rho-EGFP displayed no fluorescence in

the majority of cases, although occasional patches of fluorescence limited to the

photoreceptor cells could be observed (Figure 25). These patches were very interesting as

it showed that the HDAd vector is capable of transducing the neural retina, suggesting

168

that viral tropism is not the limiting factor in neural retinal transduction. Rather, some

other mechanism is preventing the vector present in the sub-retinal space from

transducing the neural retina.

The sub-retinal injections for vector delivery targets the posterior portion of the retina,

approximately 30˚ offset laterally in parallel with the transverse plane (Figure 1). Due to

the limitations of the equipment and techniques employed, it is difficult to obtain higher

precision. However, it is clear that the patches of transduction seen in Figure 22 and

Figure 25 are not close to the injection site. Because the location of these patches varies,

it is also apparent that the patches do not correspond to any particular anatomical feature

in the eye.

Although these patches do not correspond to the injection site, it is nonetheless possible

that they arise from injection injury. In particular, as the use of a dissection microscope

gave only limited depth perception and the physical resistance provided by the eye is

minimal, it is possible that the needle tip had scraped and damaged the retina in those

areas unintentionally. The most likely explanation is that the accidental injury causes a

large tear on the vitreous side of the retina, during which the vector present on and

around the tip of the needle is transferred to the wound. In the actual injection site, the

needle is carefully pressed against the retina with minimal movement, causing a much

smaller break in the retina. This smaller break in the retina, with a clean edge as a result

of intentional injection, likely permitted the retina to seal the gap upon withdrawal of the

needle, thus reducing the ability of the vector to diffuse past the outer limiting

169

membrane. However, in the case of accidental injury, the wound caused was much larger

and thus the vector could enter the neural retina.

This indicates that HDAd is able to, if not efficient at, transducing the photoreceptor

cells. If we consider the possibility that these patches indicate areas where there was

inadvertent injury to the retina, the logical explanation would be that the lack of

transduction in other cases represents an inability to access and/or infect the cells, while

the physical injury provided a route of infection to the neural retina.

It is possible that the trauma caused a release of cytokines that resulted in the movement

of receptors and/or co-receptors to become accessible on the surface of the target cells.

This theory is supported by evidence from adenoviral infection of the respiratory tract

[125]. In that study, it was shown that the release of cytokines from infected

macrophages causes the migration of integrins to the apical surface of cultured polarized

epithelial cells, giving opportunity for adenovirus to infect the epithelium. It is possible

that injury in the eye causes a release of cytokines that act on the neural retinal cells,

allowing them to become susceptible to infection.

It is also possible that the barrier to infection is physical. The retina consists of the neural

retina, sandwiched by two limiting membranes; the inner limiting membrane is in contact

with the vitreous while the outer limiting faces the sub-retinal space and the RPE. The

outer limiting membrane forms a barrier between Müller cells and photoreceptor inner

segments, leaving the outer segments exposed to the sub-retinal space (Section 1.1.1,

Figure 2). From the complete transduction of the RPE, we can surmise that there is a very

large number of vector particles present in the sub-retinal space between the RPE and the

170

outer limiting membrane. The presence of these patches of transduced cells indicates that

the vector particles are capable of transducing the neural retina, including photoreceptor

cells. It seems that the vector is unable to transduce photoreceptor cells by entering via

the photoreceptor cell segments. Rather, the vector particles interact with the cell-body in

the outer nuclear layer in order to establish transduction. Meanwhile, the barrier formed

by the outer limiting membrane results in the inability of the HDAd vector to travel into

the outer nuclear layer. In other words, the lack of transduction may result from a lack of

access to the susceptible parts of the retina.

If we are to accept the premise that physical injury provides the vector with access to the

neural retina, one must then question why the injection site, where there is clearly

physical damage, does not also exhibit the same degree of transduction. A 33 gauge

needle as used in our sub-retinal injections has an outer diameter of 0.21 mm or 210 µm.

Although not all eyes were examined at the same distance between sections, the eye

shown in Section 3.4.3.1, Figure 18 was sectioned at 100 µm spacing with no noticeable

transduction patch. None of the other eyes demonstrated neural retinal transduction at the

expected injection site. As such, it’s highly unlikely that the injection sites have been

repeatedly missed in all eyes.

In order to test this injury hypothesis, it would be ideal to be able to precisely place the

needle within the neural retina, between the two limiting membranes, and inject the

CAG-EGFP vector, keeping in mind that the lack of space will not allow for the same

volume to be delivered as in the sub-retinal space. However, as the equipment and

171

methods employed in our study did not allow for precision guidance into the retina,

especially in the depth of needle penetration, it was impossible to conduct such a study.

Alternatively, it may be possible to purposely damage the retina by scratching it with the

needle tip. Care would have to be taken to ensure the location of the injury is precise

enough that it can be located when sectioning the animal.

It may be possible to determine whether accidental retinal injury had occurred by

sacrificing the animal shortly after injection to look for evidence of retinal damage away

from the injection site. However, this poses two separate problems. The first is that a

short incubation after injection would not allow for sufficient time for transduced cells to

express detectable levels of EGFP. In addition, the sub-retinal injection will have caused

retinal detachment as a result of the injected material. Given a short incubation time, the

material will not have been fully absorbed and the retinal detachment will not have been

resolved. As a result, when cryosectioned, the detached neural retina will likely break as

it is unsupported by the rest of the eye and is not supported in the sub-retinal space by

freezing media. Therefore, a retinal break would not necessarily be indicative of retinal

injury.

In addition, it may be possible to stain for the morphology of the outer limiting

membrane and inner limiting membrane using anti-GFAP [105] and anti-CD44 [28]

antibodies respectively. Doing so on sections that demonstrate neural retina transduction

may reveal damage to the inner and/or outer limiting membrane in the immediate vicinity

of the transduced patch, thus validating the theory that such areas are caused by injury.

While recovery of the membranes is likely to have occurred by the time the animals are

172

sacrificed, evidence of the previous damage in the membrane structures may still be

visible, although no disorganization of the nuclear layers could be observed.

Finally, as an interventional rather than observational study, we propose the injection of

α-aminoadipic acid (AAA) with the vector. AAA has been documented as a method by

which the outer limiting membrane can be disrupted to allow for increased integration of

transplanted stem cell precursors from the sub-retinal space [224]. Therefore, the

injection of AAA before or along with the vector would allow for the transient, reversible

disruption of the outer limiting membrane, thus providing access for the vector to

transduce the photoreceptors [92]. Because of the differences between the size and

diffusion abilities of stem cells versus the comparatively small HDAd particle, the

application time and dose may differ in this application and requires refinement beyond

that which was previously documented. The finding that the outer limiting membrane

was an impediment to movement of materials between the sub-retinal space and the outer

nuclear layer is further evidence for the possibility that our vector was unable to access

the photoreceptor cells from the sub-retinal space. Successful disruption of the outer

limiting membrane with AAA should conclusively prove or disprove the theory that the

membrane is preventing transduction of the neural retina.

The presence of these patches is encouraging as it gives strong evidence that the lack of

transduction of the neural retina is the result of deficiencies in the surgical delivery

technique rather than vector incompatibility. Furthermore, the presence of patches where

only the photoreceptor cells are transduced when Rho-EGFP vectors were injected

provides confirmation that the rhodopsin promoter is photoreceptor cell specific in vivo.

173

5. Conclusion

It is clear from the results that helper-dependent adenoviral vectors are highly effective

for delivering genes to the RPE at a very low dose, resulting in prolonged expression

lasting for a minimum of 4 months. However, it is disappointing that effective,

widespread transduction of the neural retina could not be achieved using our methods.

Based on the presence of the patches of transduction observed, there appears to be an

issue with access to the relevant cells by the vector rather than the ability of the vector to

transduce such cells. With a method of delivery other than sub-retinal injection, it may be

possible to transduce the neural retina. The results with Rho-EGFP vector have shown

that if a method of delivery could be found to introduce the vector to the neural retina,

the IRBP enhancer – rhodopsin promoter construct is capable of limiting gene expression

to only the photoreceptors. Additionally, the results have shown the helper-dependent

adenoviral vectors can deliver the large ABCA4 expression cassette that is well beyond

the capacity of AAV vectors.

Moving forward in the application of helper-dependent adenoviral vectors in retinal gene

therapy, the focus should shift towards the use of this unique vector to deliver genes to

the RPE as the results herein have proven HDAd to be highly effective with long

duration of transgene expression. While work using other vectors to treat the RPE may

have a lead, the performance observed by others is significantly inferior to the data

presented herein and helper-dependent adenoviral vectors should not be discounted.

The data presented herein demonstrates that HDAd is a powerful vector for the delivery

of large genes and can completely transduce the RPE of the retina at high efficacy using

174

very low doses. If an alternative method of delivery can be developed for introducing the

vector to the neural retina, it would allow for the treatment of retinal diseases that involve

genes too large to be packaged in AAV. Such progress in the study of HDAd would give

hope to the patients of a variety of retinal degenerative diseases for whom there is no

present cure.

175

6. References

1. Gene Therapy Clinical Trials World Wide. 2014 [cited 2014 2014-08-18]; Available from: http://www.abedia.com/wiley/vectors.php.

2. Al-Dosari, M.S. and X. Gao, Nonviral gene delivery: principle, limitations, and recent progress. The AAPS journal, 2009. 11(4): p. 671-81.

3. Albini, A., et al., Hypomethylation of the interphotoreceptor retinoid-binding protein (IRBP) promotor and first exon is linked to expression of the gene. Nucleic Acids Res, 1990. 18(17): p. 5181-7.

4. Allocca, M., et al., Serotype-dependent packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice. J Clin Invest, 2008. 118(5): p. 1955-64.

5. Arnberg, N., et al., Adenovirus type 37 binds to cell surface sialic acid through a charge-dependent interaction. Virology, 2002. 302(1): p. 33-43.

6. Aurnhammer, C., et al., Universal real-time PCR for the detection and quantification of adeno-associated virus serotype 2-derived inverted terminal repeat sequences. Human gene therapy methods, 2012. 23(1): p. 18-28.

7. Bai, M., B. Harfe, and P. Freimuth, Mutations that alter an Arg-Gly-Asp (RGD) sequence in the adenovirus type 2 penton base protein abolish its cell-rounding activity and delay virus reproduction in flat cells. Journal of virology, 1993. 67(9): p. 5198-205.

8. Batten, M.L., et al., Pharmacological and rAAV gene therapy rescue of visual functions in a blind mouse model of Leber congenital amaurosis. PLoS medicine, 2005. 2(11): p. e333.

9. Bennett, J., et al., AAV2 gene therapy readministration in three adults with congenital blindness. Science translational medicine, 2012. 4(120): p. 120ra15.

10. Bennett, J., D. Sun, and K. Kariko, Sequence analysis of the 5.34-kb 5' flanking region of the human rhodopsin-encoding gene. Gene, 1995. 167(1-2): p. 317-20.

11. Bennett, J., et al., Adenovirus vector-mediated in vivo gene transfer into adult murine retina. Investigative ophthalmology & visual science, 1994. 35(5): p. 2535-42.

176

12. Bergelson, J.M., et al., Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science, 1997. 275(5304): p. 1320-3.

13. Bergelson, J.M., et al., Identification of the integrin VLA-2 as a receptor for echovirus 1. Science, 1992. 255(5052): p. 1718-20.

14. Bianchi, M., et al., A potent enhancer element in the 5'-UTR intron is crucial for transcriptional regulation of the human ubiquitin C gene. Gene, 2009. 448(1): p. 88-101.

15. Binley, K., et al., Transduction of photoreceptors with equine infectious anemia virus lentiviral vectors: safety and biodistribution of StarGen for Stargardt disease. Investigative ophthalmology & visual science, 2013. 54(6): p. 4061-71.

16. Bora, N.S., et al., Differential expression of the complement regulatory proteins in the human eye. Investigative ophthalmology & visual science, 1993. 34(13): p. 3579-84.

17. Borst, D.E., et al., Structural characterization and comparison of promoter activity of mouse and bovine interphotoreceptor retinoid-binding protein (IRBP) gene 5' flanking regions in WERI, Y79, chick retina cells, and transgenic mice. Curr Eye Res, 2001. 23(1): p. 20-32.

18. Boye, S.E., et al., A comprehensive review of retinal gene therapy. Molecular therapy : the journal of the American Society of Gene Therapy, 2013. 21(3): p. 509-19.

19. Brown, M., H.L. Wilson-Friesen, and F. Doane, A block in release of progeny virus and a high particle-to-infectious unit ratio contribute to poor growth of enteric adenovirus types 40 and 41 in cell culture. Journal of virology, 1992. 66(5): p. 3198-205.

20. Brunner, S., et al., Cell cycle dependence of gene transfer by lipoplex, polyplex and recombinant adenovirus. Gene therapy, 2000. 7(5): p. 401-7.

21. Bryant, L.M., et al., Lessons learned from the clinical development and market authorization of Glybera. Human gene therapy. Clinical development, 2013. 24(2): p. 55-64.

22. Bukrinsky, M.I. and O.K. Haffar, HIV-1 nuclear import: in search of a leader. Frontiers in bioscience : a journal and virtual library, 1999. 4: p. D772-81.

177

23. Bunt-Milam, A.H. and J.C. Saari, Immunocytochemical localization of two retinoid-binding proteins in vertebrate retina. The Journal of cell biology, 1983. 97(3): p. 703-12.

24. Campos, S.K. and M.A. Barry, Current advances and future challenges in Adenoviral vector biology and targeting. Current gene therapy, 2007. 7(3): p. 189-204.

25. Cashman, S.M., L. McCullough, and R. Kumar-Singh, Improved retinal transduction in vivo and photoreceptor-specific transgene expression using adenovirus vectors with modified penton base. Mol Ther, 2007. 15(9): p. 1640-6.

26. Cashman, S.M., D.J. Morris, and R. Kumar-Singh, Adenovirus type 5 pseudotyped with adenovirus type 37 fiber uses sialic acid as a cellular receptor. Virology, 2004. 324(1): p. 129-39.

27. Chai, L. and J.E. Morris, Distribution of heparan sulfate proteoglycans in embryonic chicken neural retina and isolated inner limiting membrane. Current eye research, 1994. 13(9): p. 669-77.

28. Chaitin, M.H., H.S. Wortham, and A.M. Brun-Zinkernagel, Immunocytochemical localization of CD44 in the mouse retina. Experimental eye research, 1994. 58(3): p. 359-65.

29. Chaudhuri, S.R., et al., Modulation of adenoviral transduction in vitro and in vivo by hyaluronan and its receptor CD44. Mol Ther, 2007. 15(3): p. 566-70.

30. Chen, Y., et al., Systems pharmacology identifies drug targets for Stargardt disease-associated retinal degeneration. The Journal of clinical investigation, 2013. 123(12): p. 5119-34.

31. Chesnoy, S. and L. Huang, Structure and function of lipid-DNA complexes for gene delivery. Annual review of biophysics and biomolecular structure, 2000. 29: p. 27-47.

32. Chiu, C.Y., et al., Structural analysis of a fiber-pseudotyped adenovirus with ocular tropism suggests differential modes of cell receptor interactions. Journal of virology, 2001. 75(11): p. 5375-80.

33. Choi, T., et al., A generic intron increases gene expression in transgenic mice. Mol Cell Biol, 1991. 11(6): p. 3070-4.

34. Cideciyan, A.V., et al., Human gene therapy for RPE65 isomerase deficiency activates the retinoid cycle of vision but with slow rod kinetics. Proc Natl Acad Sci U S A, 2008. 105(39): p. 15112-7.

178

35. Cideciyan, A.V., et al., Rod and cone visual cycle consequences of a null mutation in the 11-cis-retinol dehydrogenase gene in man. Visual neuroscience, 2000. 17(5): p. 667-78.

36. Cideciyan, A.V., et al., Vision 1 year after gene therapy for Leber's congenital amaurosis. The New England journal of medicine, 2009. 361(7): p. 725-7.

37. Ciuffi, A., Mechanisms governing lentivirus integration site selection. Current gene therapy, 2008. 8(6): p. 419-29.

38. Coburn, J., S.W. Barthold, and J.M. Leong, Diverse Lyme disease spirochetes bind integrin alpha IIb beta 3 on human platelets. Infection and immunity, 1994. 62(12): p. 5559-67.

39. Cohen, C.J., et al., The coxsackievirus and adenovirus receptor is a transmembrane component of the tight junction. Proceedings of the National Academy of Sciences of the United States of America, 2001. 98(26): p. 15191-6.

40. Cohen, D. and I. Nir, Sialic acid on the surface of photoreceptors and pigment epithelium in RCS rats. Investigative ophthalmology & visual science, 1984. 25(11): p. 1342-5.

41. Commons, W. File:Eyesection.svg. 2014 [cited 2014 2014-07-02]; Image of eye section]. Available from: http://commons.wikimedia.org/wiki/File:Eyesection.svg.

42. commons, W. File:Visual cycle v2.png. 2014 [cited 2014 2014-07-01]; visual cycle].

43. Coura Rdos, S. and N.B. Nardi, The state of the art of adeno-associated virus-based vectors in gene therapy. Virology journal, 2007. 4: p. 99.

44. Cuevas, P., et al., Treatment of Stargardt disease with dobesilate. BMJ case reports, 2012. 2012.

45. Cwerman-Thibault, H., et al., Gene therapy for mitochondrial diseases: Leber Hereditary Optic Neuropathy as the first candidate for a clinical trial. Comptes rendus biologies, 2014. 337(3): p. 193-206.

46. D'Ambrosio, E., et al., Neutralizing antibodies against 33 human adenoviruses in normal children in Rome. The Journal of hygiene, 1982. 89(1): p. 155-61.

179

47. Davison, A.J., M. Benko, and B. Harrach, Genetic content and evolution of adenoviruses. The Journal of general virology, 2003. 84(Pt 11): p. 2895-908.

48. de Silva, S. and W.J. Bowers, Herpes Virus Amplicon Vectors. Viruses, 2009. 1(3): p. 594-629.

49. Dechecchi, M.C., et al., Heparan sulfate glycosaminoglycans are receptors sufficient to mediate the initial binding of adenovirus types 2 and 5. Journal of virology, 2001. 75(18): p. 8772-80.

50. Dechecchi, M.C., et al., Heparan sulfate glycosaminoglycans are involved in adenovirus type 5 and 2-host cell interactions. Virology, 2000. 268(2): p. 382-90.

51. Deng, W.T., et al., Tyrosine-mutant AAV8 delivery of human MERTK provides long-term retinal preservation in RCS rats. Investigative ophthalmology & visual science, 2012. 53(4): p. 1895-904.

52. Doyle, J.W., R.K. Dowgiert, and S.M. Buzney, Retinoic acid metabolism in cultured retinal pigment epithelial cells. Investigative ophthalmology & visual science, 1995. 36(3): p. 708-17.

53. Duguid, J.G., et al., A physicochemical approach for predicting the effectiveness of peptide-based gene delivery systems for use in plasmid-based gene therapy. Biophysical journal, 1998. 74(6): p. 2802-14.

54. Dureau, P., et al., Quantitative analysis of subretinal injections in the rat. Graefes Arch Clin Exp Ophthalmol, 2000. 238(7): p. 608-14.

55. Durieux, A.C., et al., In vivo gene electrotransfer into skeletal muscle: effects of plasmid DNA on the occurrence and extent of muscle damage. The journal of gene medicine, 2004. 6(7): p. 809-16.

56. Eldred, G.E. and M.R. Lasky, Retinal age pigments generated by self-assembling lysosomotropic detergents. Nature, 1993. 361(6414): p. 724-6.

57. Ellis, J., Silencing and variegation of gammaretrovirus and lentivirus vectors. Human gene therapy, 2005. 16(11): p. 1241-6.

58. Engelhardt, J.F., et al., Ablation of E2A in recombinant adenoviruses improves transgene persistence and decreases

180

inflammatory response in mouse liver. Proceedings of the National Academy of Sciences of the United States of America, 1994. 91(13): p. 6196-200.

59. Engelman, A., The roles of cellular factors in retroviral integration. Current topics in microbiology and immunology, 2003. 281: p. 209-38.

60. Ewert, K., et al., Cationic lipid-DNA complexes for gene therapy: understanding the relationship between complex structure and gene delivery pathways at the molecular level. Current medicinal chemistry, 2004. 11(2): p. 133-49.

61. Felgner, P.L., et al., Lipofection: a highly efficient, lipid-mediated DNA-transfection procedure. Proceedings of the National Academy of Sciences of the United States of America, 1987. 84(21): p. 7413-7.

62. Ferguson, T.A., J. Choi, and D.R. Green, Armed response: how dying cells influence T-cell functions. Immunological reviews, 2011. 241(1): p. 77-88.

63. Fett, A.L., et al., Immunohistochemical localization of complement regulatory proteins in the human retina. Histology and histopathology, 2012. 27(3): p. 357-64.

64. Fields, B.N., D.M. Knipe, and P.M. Howley, Fields virology. 5th ed2007, Philadelphia: Wolters Kluwer Health/Lippincott Williams & Wilkins.

65. Fisher, K.J., et al., Recombinant adenovirus deleted of all viral genes for gene therapy of cystic fibrosis. Virology, 1996. 217(1): p. 11-22.

66. Fregien, N. and N. Davidson, Activating elements in the promoter region of the chicken beta-actin gene. Gene, 1986. 48(1): p. 1-11.

67. Fulton, A.B., REtinal dystrophies and degeneration. Archives of ophthalmology, 1989. 107(12): p. 1730-1731.

68. Gaggar, A., D.M. Shayakhmetov, and A. Lieber, CD46 is a cellular receptor for group B adenoviruses. Nature medicine, 2003. 9(11): p. 1408-12.

69. Gallaher, S.D. and A.J. Berk, A rapid Q-PCR titration protocol for adenovirus and helper-dependent adenovirus vectors that produces biologically relevant results. Journal of virological methods, 2013. 192(1-2): p. 28-38.

181

70. Goldman, M.J. and J.M. Wilson, Expression of alpha v beta 5 integrin is necessary for efficient adenovirus-mediated gene transfer in the human airway. Journal of virology, 1995. 69(10): p. 5951-8.

71. Gorziglia, M.I., et al., Elimination of both E1 and E2 from adenovirus vectors further improves prospects for in vivo human gene therapy. Journal of virology, 1996. 70(6): p. 4173-8.

72. Graham, F.L. and L. Prevec, Methods for construction of adenovirus vectors. Molecular biotechnology, 1995. 3(3): p. 207-20.

73. Grant, K.G., et al., Engineering cell lines for production of replication defective HSV-1 gene therapy vectors. Biotechnology and bioengineering, 2009. 102(4): p. 1087-97.

74. Grieger, J.C. and R.J. Samulski, Adeno-associated virus vectorology, manufacturing, and clinical applications. Methods in enzymology, 2012. 507: p. 229-54.

75. Griffith, T.S., et al., CD95-induced apoptosis of lymphocytes in an immune privileged site induces immunological tolerance. Immunity, 1996. 5(1): p. 7-16.

76. Gunther-Ausborn, S., A. Praetor, and T. Stegmann, Inhibition of influenza-induced membrane fusion by lysophosphatidylcholine. The Journal of biological chemistry, 1995. 270(49): p. 29279-85.

77. Hacein-Bey-Abina, S., et al., Insertional oncogenesis in 4 patients after retrovirus-mediated gene therapy of SCID-X1. The Journal of clinical investigation, 2008. 118(9): p. 3132-42.

78. Han, Z., et al., DNA nanoparticle-mediated ABCA4 delivery rescues Stargardt dystrophy in mice. The Journal of clinical investigation, 2012.

79. Han, Z., S.M. Conley, and M.I. Naash, Gene Therapy for Stargardt Disease Associated with ABCA4 Gene. Advances in experimental medicine and biology, 2014. 801: p. 719-24.

80. Hargrave, P.A., Rhodopsin structure, function, and topography the Friedenwald lecture. Investigative ophthalmology & visual science, 2001. 42(1): p. 3-9.

81. Hauswirth, W.W., et al., Treatment of leber congenital amaurosis due to RPE65 mutations by ocular subretinal injection of adeno-associated virus gene vector: short-term

182

results of a phase I trial. Human gene therapy, 2008. 19(10): p. 979-90.

82. Hecht, S., S. Shlaer, and M.H. Pirenne, Energy, Quanta, and Vision. The Journal of general physiology, 1942. 25(6): p. 819-40.

83. Hirsch, M.L., M. Agbandje-McKenna, and R.J. Samulski, Little vector, big gene transduction: fragmented genome reassembly of adeno-associated virus. Molecular therapy : the journal of the American Society of Gene Therapy, 2010. 18(1): p. 6-8.

84. Holz, F.G., et al., Inhibition of lysosomal degradative functions in RPE cells by a retinoid component of lipofuscin. Investigative ophthalmology & visual science, 1999. 40(3): p. 737-43.

85. Honda, T., et al., The coxsackievirus-adenovirus receptor protein as a cell adhesion molecule in the developing mouse brain. Brain research. Molecular brain research, 2000. 77(1): p. 19-28.

86. Hosoya, K. and M. Tachikawa, The inner blood-retinal barrier: molecular structure and transport biology. Advances in experimental medicine and biology, 2012. 763: p. 85-104.

87. Howarth, J.L., Y.B. Lee, and J.B. Uney, Using viral vectors as gene transfer tools (Cell Biology and Toxicology Special Issue: ETCS-UK 1 day meeting on genetic manipulation of cells). Cell biology and toxicology, 2010. 26(1): p. 1-20.

88. Hynes, R.O., Integrins: versatility, modulation, and signaling in cell adhesion. Cell, 1992. 69(1): p. 11-25.

89. Isberg, R.R. and G.T. Van Nhieu, The mechanism of phagocytic uptake promoted by invasin-integrin interaction. Trends in cell biology, 1995. 5(3): p. 120-4.

90. Ishibashi, Y., S. Claus, and D.A. Relman, Bordetella pertussis filamentous hemagglutinin interacts with a leukocyte signal transduction complex and stimulates bacterial adherence to monocyte CR3 (CD11b/CD18). The Journal of experimental medicine, 1994. 180(4): p. 1225-33.

91. Ishida, K., et al., Participation of pigment epithelium in ocular immune privilege. 3. Epithelia cultured from iris, ciliary body, and retina suppress T-cell activation by partially non-overlapping mechanisms. Ocular immunology and inflammation, 2003. 11(2): p. 91-105.

183

92. Johnson, T.V., N.D. Bull, and K.R. Martin, Identification of barriers to retinal engraftment of transplanted stem cells. Investigative ophthalmology & visual science, 2010. 51(2): p. 960-70.

93. Kaplan, H.J. and J.W. Streilein, Immune response to immunization via the anterior chamber of the eye. I. F. lymphocyte-induced immune deviation. Journal of immunology, 1977. 118(3): p. 809-14.

94. Kaplan, J., et al., A gene for Stargardt's disease (fundus flavimaculatus) maps to the short arm of chromosome 1. Nature genetics, 1993. 5(3): p. 308-11.

95. Kaufman, Y., L. Ma, and I. Washington, Deuterium enrichment of vitamin A at the C20 position slows the formation of detrimental vitamin A dimers in wild-type rodents. The Journal of biological chemistry, 2011. 286(10): p. 7958-65.

96. Kawazoe, Y., et al., Retinoic acid from retinal pigment epithelium induces T regulatory cells. Experimental eye research, 2012. 94(1): p. 32-40.

97. Kay, M.A., J.C. Glorioso, and L. Naldini, Viral vectors for gene therapy: the art of turning infectious agents into vehicles of therapeutics. Nature medicine, 2001. 7(1): p. 33-40.

98. Khani, S.C., et al., AAV-mediated expression targeting of rod and cone photoreceptors with a human rhodopsin kinase promoter. Invest Ophthalmol Vis Sci, 2007. 48(9): p. 3954-61.

99. Kobiler, O., et al., Virus strategies for passing the nuclear envelope barrier. Nucleus, 2012. 3(6): p. 526-39.

100. Kochanek, S., et al., A new adenoviral vector: Replacement of all viral coding sequences with 28 kb of DNA independently expressing both full-length dystrophin and beta-galactosidase. Proceedings of the National Academy of Sciences of the United States of America, 1996. 93(12): p. 5731-6.

101. Koehler, D.R., et al., A human epithelium-specific vector optimized in rat pneumocytes for lung gene therapy. Pediatr Res, 2000. 48(2): p. 184-90.

102. Koehler, D.R., et al., Aerosol delivery of an enhanced helper-dependent adenovirus formulation to rabbit lung using an intratracheal catheter. The journal of gene medicine, 2005. 7(11): p. 1409-20.

184

103. Koirala, A., S.M. Conley, and M.I. Naash, A review of therapeutic prospects of non-viral gene therapy in the retinal pigment epithelium. Biomaterials, 2013. 34(29): p. 7158-67.

104. Kolb, H., Circuitry for Rod Signals through the Retina, in Webvision: The Organization of the Retina and Visual System, H. Kolb, E. Fernandez, and R. Nelson, Editors. 1995: Salt Lake City (UT).

105. Kolb, H., Glial Cells of the Retina, in Webvision: The Organization of the Retina and Visual System, H. Kolb, E. Fernandez, and R. Nelson, Editors. 1995: Salt Lake City (UT).

106. Kolb, H., Gross Anatomy of the Eye, in Webvision: The Organization of the Retina and Visual System, H. Kolb, E. Fernandez, and R. Nelson, Editors. 1995: Salt Lake City (UT).

107. Kolb, H., Photoreceptors, in Webvision: The Organization of the Retina and Visual System, H. Kolb, E. Fernandez, and R. Nelson, Editors. 1995: Salt Lake City (UT).

108. Kolb, H., Simple Anatomy of the Retina, in Webvision: The Organization of the Retina and Visual System, H. Kolb, E. Fernandez, and R. Nelson, Editors. 1995: Salt Lake City (UT).

109. Kong, J., et al., Correction of the disease phenotype in the mouse model of Stargardt disease by lentiviral gene therapy. Gene Ther, 2008. 15(19): p. 1311-20.

110. Kremer, K.L., et al., Gene delivery to airway epithelial cells in vivo: a direct comparison of apical and basolateral transduction strategies using pseudotyped lentivirus vectors. The journal of gene medicine, 2007. 9(5): p. 362-8.

111. Kreppel, F., et al., Long-term transgene expression in the RPE after gene transfer with a high-capacity adenoviral vector. Investigative ophthalmology & visual science, 2002. 43(6): p. 1965-70.

112. Kretschmann, U., et al., Multifocal electroretinography in patients with Stargardt's macular dystrophy. The British journal of ophthalmology, 1998. 82(3): p. 267-75.

113. Krougliak, V. and F.L. Graham, Development of cell lines capable of complementing E1, E4, and protein IX defective adenovirus type 5 mutants. Human gene therapy, 1995. 6(12): p. 1575-86.

185

114. Lai, Y., Y. Yue, and D. Duan, Evidence for the failure of adeno-associated virus serotype 5 to package a viral genome > or = 8.2 kb. Mol Ther, 2009. 18(1): p. 75-9.

115. Lamartina, S., et al., Helper-dependent adenovirus for the gene therapy of proliferative retinopathies: stable gene transfer, regulated gene expression and therapeutic efficacy. J Gene Med, 2007. 9(10): p. 862-74.

116. Landers, R.A. and J.G. Hollyfield, Proteoglycans in the mouse interphotoreceptor matrix. VI. Evidence for photoreceptor synthesis of chondroitin sulfate proteoglycan using genetically fractionated retinas. Experimental eye research, 1992. 55(2): p. 345-56.

117. Lee, C.A., E. Berntorp, and K. Hoots, Textbook of hemophilia. 2nd ed2010, Chichester, West Sussex, UK ; Hoboken, NJ: Wiley-Blackwell. xii, 464 p.

118. Lee, S.A., et al., Overproduction of bioactive retinoic acid in cells expressing disease-associated mutants of retinol dehydrogenase 12. The Journal of biological chemistry, 2007. 282(49): p. 35621-8.

119. Lem, J., et al., Tissue-specific and developmental regulation of rod opsin chimeric genes in transgenic mice. Neuron, 1991. 6(2): p. 201-10.

120. Lentz, T.B., S.J. Gray, and R.J. Samulski, Viral vectors for gene delivery to the central nervous system. Neurobiology of disease, 2012. 48(2): p. 179-88.

121. Limberis, M., et al., Recovery of airway cystic fibrosis transmembrane conductance regulator function in mice with cystic fibrosis after single-dose lentivirus-mediated gene transfer. Human gene therapy, 2002. 13(16): p. 1961-70.

122. Lin, H. and D.O. Clegg, Integrin alphavbeta5 participates in the binding of photoreceptor rod outer segments during phagocytosis by cultured human retinal pigment epithelium. Investigative ophthalmology & visual science, 1998. 39(9): p. 1703-12.

123. Liu, C., et al., Lentiviral airway gene transfer in lungs of mice and sheep: successes and challenges. The journal of gene medicine, 2010. 12(8): p. 647-58.

186

124. Logan, S. and R.E. Anderson, Dominant Stargardt Macular Dystrophy (STGD3) and ELOVL4. Advances in experimental medicine and biology, 2014. 801: p. 447-53.

125. Lutschg, V., et al., Chemotactic antiviral cytokines promote infectious apical entry of human adenovirus into polarized epithelial cells. Nature communications, 2011. 2: p. 391.

126. MacLaren, R.E., et al., Retinal gene therapy in patients with choroideremia: initial findings from a phase 1/2 clinical trial. Lancet, 2014. 383(9923): p. 1129-37.

127. Maetzig, T., et al., Gammaretroviral vectors: biology, technology and application. Viruses, 2011. 3(6): p. 677-713.

128. Magin-Lachmann, C., et al., In vitro and in vivo delivery of intact BAC DNA -- comparison of different methods. The journal of gene medicine, 2004. 6(2): p. 195-209.

129. Maguire, A.M., et al., Age-dependent effects of RPE65 gene therapy for Leber's congenital amaurosis: a phase 1 dose-escalation trial. Lancet, 2009. 374(9701): p. 1597-605.

130. Maguire, A.M., et al., Safety and efficacy of gene transfer for Leber's congenital amaurosis. The New England journal of medicine, 2008. 358(21): p. 2240-8.

131. Mallam, J.N., et al., Efficient gene transfer into retinal cells using adenoviral vectors: dependence on receptor expression. Invest Ophthalmol Vis Sci, 2004. 45(6): p. 1680-7.

132. Manservigi, R., R. Argnani, and P. Marconi, HSV Recombinant Vectors for Gene Therapy. The open virology journal, 2010. 4: p. 123-56.

133. Marconi, P., R. Manservigi, and A.L. Epstein, HSV-1-derived helper-independent defective vectors, replicating vectors and amplicon vectors, for the treatment of brain diseases. Current opinion in drug discovery & development, 2010. 13(2): p. 169-83.

134. Mathias, P., M. Galleno, and G.R. Nemerow, Interactions of soluble recombinant integrin alphav beta5 with human adenoviruses. Journal of virology, 1998. 72(11): p. 8669-75.

135. Mathias, P., et al., Multiple adenovirus serotypes use alpha v integrins for infection. Journal of virology, 1994. 68(10): p. 6811-4.

136. May, L.A., C.M. Lai, and P.E. Rakoczy, In vitro comparison studies of truncated rhodopsin promoter fragments from various

187

species in human cell lines. Clin Experiment Ophthalmol, 2003. 31(5): p. 445-50.

137. McLaughlin, B.J., et al., Novel role for a complement regulatory protein (CD46) in retinal pigment epithelial adhesion. Investigative ophthalmology & visual science, 2003. 44(8): p. 3669-74.

138. Medina-Kauwe, L.K., Endocytosis of adenovirus and adenovirus capsid proteins. Advanced drug delivery reviews, 2003. 55(11): p. 1485-96.

139. Mitani, K., et al., Rescue, propagation, and partial purification of a helper virus-dependent adenovirus vector. Proceedings of the National Academy of Sciences of the United States of America, 1995. 92(9): p. 3854-8.

140. Mittereder, N., K.L. March, and B.C. Trapnell, Evaluation of the concentration and bioactivity of adenovirus vectors for gene therapy. Journal of virology, 1996. 70(11): p. 7498-509.

141. Miyazaki, J., et al., Expression vector system based on the chicken beta-actin promoter directs efficient production of interleukin-5. Gene, 1989. 79(2): p. 269-77.

142. Miyoshi, H., et al., Development of a self-inactivating lentivirus vector. Journal of virology, 1998. 72(10): p. 8150-7.

143. Mizuguchi, H. and T. Hayakawa, Adenovirus vectors containing chimeric type 5 and type 35 fiber proteins exhibit altered and expanded tropism and increase the size limit of foreign genes. Gene, 2002. 285(1-2): p. 69-77.

144. Molday, R.S., et al., Binding of N-retinylidene-PE to ABCA4 and a model for its transport across membranes. Adv Exp Med Biol, 2006. 572: p. 465-70.

145. Molday, R.S., M. Zhong, and F. Quazi, The role of the photoreceptor ABC transporter ABCA4 in lipid transport and Stargardt macular degeneration. Biochim Biophys Acta, 2009. 1791(7): p. 573-83.

146. Molnar, M.J., et al., Factors influencing the efficacy, longevity, and safety of electroporation-assisted plasmid-based gene transfer into mouse muscles. Molecular therapy : the journal of the American Society of Gene Therapy, 2004. 10(3): p. 447-55.

147. Mori, K., et al., Intraocular adenoviral vector-mediated gene transfer in proliferative retinopathies. Investigative ophthalmology & visual science, 2002. 43(5): p. 1610-5.

188

148. Mucida, D. and H. Cheroutre, TGFbeta and retinoic acid intersect in immune-regulation. Cell adhesion & migration, 2007. 1(3): p. 142-4.

149. Muller, G., et al., Interleukin-10-treated dendritic cells modulate immune responses of naive and sensitized T cells in vivo. The Journal of investigative dermatology, 2002. 119(4): p. 836-41.

150. Murillo-Lopez, F., et al., Proteoglycan synthesis in cultures of murine retinal neurons and photoreceptors. Cellular and molecular neurobiology, 1991. 11(6): p. 579-91.

151. Needham, L.K., R. Adler, and A.T. Hewitt, Proteoglycan synthesis in flat cell-free cultures of chick embryo retinal neurons and photoreceptors. Developmental biology, 1988. 126(2): p. 304-14.

152. Nemerow, G.R., et al., Insights into adenovirus host cell interactions from structural studies. Virology, 2009. 384(2): p. 380-8.

153. Neumann, E., et al., Gene transfer into mouse lyoma cells by electroporation in high electric fields. The EMBO journal, 1982. 1(7): p. 841-5.

154. Ng, P., R.J. Parks, and F.L. Graham, Preparation of helper-dependent adenoviral vectors. Methods in molecular medicine, 2002. 69: p. 371-88.

155. Nicoud, M., et al., Development of photoreceptor-specific promoters and their utility to investigate EIAV lentiviral vector mediated gene transfer to photoreceptors. J Gene Med, 2007. 9(12): p. 1015-23.

156. Niwa, H., K. Yamamura, and J. Miyazaki, Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene, 1991. 108(2): p. 193-9.

157. Palfi, A., et al., Adeno-associated virus-mediated rhodopsin replacement provides therapeutic benefit in mice with a targeted disruption of the rhodopsin gene. Hum Gene Ther. 21(3): p. 311-23.

158. Palmer, D. and P. Ng, Improved system for helper-dependent adenoviral vector production. Mol Ther, 2003. 8(5): p. 846-52.

159. Palmiter, R.D., et al., Heterologous introns can enhance expression of transgenes in mice. Proc Natl Acad Sci U S A, 1991. 88(2): p. 478-82.

189

160. Parks, R.J., et al., A helper-dependent adenovirus vector system: removal of helper virus by Cre-mediated excision of the viral packaging signal. Proceedings of the National Academy of Sciences of the United States of America, 1996. 93(24): p. 13565-70.

161. Persson, B.D., et al., Adenovirus type 11 binding alters the conformation of its receptor CD46. Nature structural & molecular biology, 2007. 14(2): p. 164-6.

162. Philip, R., et al., Gene modification of primary tumor cells for active immunotherapy of human breast and ovarian cancer. Clinical cancer research : an official journal of the American Association for Cancer Research, 1996. 2(1): p. 59-68.

163. Pires, P., et al., Interaction of cationic liposomes and their DNA complexes with monocytic leukemia cells. Biochimica et biophysica acta, 1999. 1418(1): p. 71-84.

164. Rao, N.M. and V. Gopal, Cell biological and biophysical aspects of lipid-mediated gene delivery. Bioscience reports, 2006. 26(4): p. 301-24.

165. Raper, S.E., et al., Fatal systemic inflammatory response syndrome in a ornithine transcarbamylase deficient patient following adenoviral gene transfer. Molecular genetics and metabolism, 2003. 80(1-2): p. 148-58.

166. Recchia, A. and F. Mavilio, Site-specific integration by the adeno-associated virus rep protein. Current gene therapy, 2011. 11(5): p. 399-405.

167. Ren, S., et al., Low-volume jet injection for intradermal immunization in rabbits. BMC biotechnology, 2002. 2: p. 10.

168. Riveiro-Alvarez, R., et al., Frequency of ABCA4 mutations in 278 Spanish controls: an insight into the prevalence of autosomal recessive Stargardt disease. Br J Ophthalmol, 2009. 93(10): p. 1359-64.

169. Roelvink, P.W., I. Kovesdi, and T.J. Wickham, Comparative analysis of adenovirus fiber-cell interaction: adenovirus type 2 (Ad2) and Ad9 utilize the same cellular fiber receptor but use different binding strategies for attachment. Journal of virology, 1996. 70(11): p. 7614-21.

170. Roelvink, P.W., et al., The coxsackievirus-adenovirus receptor protein can function as a cellular attachment protein for

190

adenovirus serotypes from subgroups A, C, D, E, and F. Journal of virology, 1998. 72(10): p. 7909-15.

171. Roelvink, P.W., et al., Identification of a conserved receptor-binding site on the fiber proteins of CAR-recognizing adenoviridae. Science, 1999. 286(5444): p. 1568-71.

172. Rogers, S., Gene therapy: a potentially invaluable aid to medicine and mankind. Research communications in chemical pathology and pharmacology, 1971. 2(4): p. 587-600.

173. Rohr, U.P., et al., Fast and reliable titration of recombinant adeno-associated virus type-2 using quantitative real-time PCR. Journal of virological methods, 2002. 106(1): p. 81-8.

174. Roivainen, M., et al., RGD-dependent entry of coxsackievirus A9 into host cells and its bypass after cleavage of VP1 protein by intestinal proteases. Journal of virology, 1991. 65(9): p. 4735-40.

175. Rosewell, A., F. Vetrini, and P. Ng, Helper-Dependent Adenoviral Vectors. Journal of genetic syndrome & gene therapy, 2011. Suppl 5.

176. Ruggiero, L., et al., alphavbeta5 integrin-dependent diurnal phagocytosis of shed photoreceptor outer segments by RPE cells is independent of the integrin coreceptor transglutaminase-2. Advances in experimental medicine and biology, 2012. 723: p. 731-7.

177. Ruoslahti, E. and M.D. Pierschbacher, New perspectives in cell adhesion: RGD and integrins. Science, 1987. 238(4826): p. 491-7.

178. Sakai, M., et al., Hepatocyte-targeted gene transfer by combination of vascularly delivered plasmid DNA and in vivo electroporation. Gene therapy, 2005. 12(7): p. 607-16.

179. Sambrook, J. and D.W. Russell, Molecular cloning : a laboratory manual. 3rd ed2001, Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press.

180. Sandig, V., et al., Optimization of the helper-dependent adenovirus system for production and potency in vivo. Proc Natl Acad Sci U S A, 2000. 97(3): p. 1002-7.

181. Sato, T., T. Ishii, and Y. Okahata, In vitro gene delivery mediated by chitosan. effect of pH, serum, and molecular mass of chitosan on the transfection efficiency. Biomaterials, 2001. 22(15): p. 2075-80.

191

182. Scaria, A., D.T. Curiel, and M.A. Kay, Complementation of a human adenovirus early region 4 deletion mutant in 293 cells using adenovirus-polylysine-DNA complexes. Gene therapy, 1995. 2(4): p. 295-8.

183. Shayakhmetov, D.M. and A. Lieber, Dependence of adenovirus infectivity on length of the fiber shaft domain. Journal of virology, 2000. 74(22): p. 10274-86.

184. Simonelli, F., et al., Gene therapy for Leber's congenital amaurosis is safe and effective through 1.5 years after vector administration. Mol Ther, 2010. 18(3): p. 643-50.

185. Smith, A.J., et al., AAV-Mediated gene transfer slows photoreceptor loss in the RCS rat model of retinitis pigmentosa. Molecular therapy : the journal of the American Society of Gene Therapy, 2003. 8(2): p. 188-95.

186. Smith, J.G., et al., Adenovirus. Current topics in microbiology and immunology, 2010. 343: p. 195-224.

187. Smith, R.H., Adeno-associated virus integration: virus versus vector. Gene therapy, 2008. 15(11): p. 817-22.

188. Smith, T.A., et al., Receptor interactions involved in adenoviral-mediated gene delivery after systemic administration in non-human primates. Human gene therapy, 2003. 14(17): p. 1595-604.

189. Smith, T.A., et al., Adenovirus serotype 5 fiber shaft influences in vivo gene transfer in mice. Human gene therapy, 2003. 14(8): p. 777-87.

190. Sonoda, K.H., et al., The analysis of systemic tolerance elicited by antigen inoculation into the vitreous cavity: vitreous cavity-associated immune deviation. Immunology, 2005. 116(3): p. 390-9.

191. Sparrow, J.R. and M. Boulton, RPE lipofuscin and its role in retinal pathobiology. Experimental eye research, 2005. 80(5): p. 595-606.

192. Sparrow, J.R., K. Nakanishi, and C.A. Parish, The lipofuscin fluorophore A2E mediates blue light-induced damage to retinal pigmented epithelial cells. Investigative ophthalmology & visual science, 2000. 41(7): p. 1981-9.

193. Stargardt, K., Über familiäre, progressive Degeneration in der Maculagegend des Auges. Albrecht von Graefes Archiv für Ophthalmologie, 1909. 71(3): p. 534-550.

192

194. Sugita, S., et al., Retinal and ciliary body pigment epithelium suppress activation of T lymphocytes via transforming growth factor beta. Experimental eye research, 2006. 83(6): p. 1459-71.

195. Sugita, S., et al., Retinal pigment epithelium-derived CTLA-2alpha induces TGFbeta-producing T regulatory cells. Journal of immunology, 2008. 181(11): p. 7525-36.

196. Sugita, S., et al., B7+ iris pigment epithelial cells convert T cells into CTLA-4+, B7-expressing CD8+ regulatory T cells. Investigative ophthalmology & visual science, 2006. 47(12): p. 5376-84.

197. Sugita, S., et al., T-cell suppression by programmed cell death 1 ligand 1 on retinal pigment epithelium during inflammatory conditions. Investigative ophthalmology & visual science, 2009. 50(6): p. 2862-70.

198. Sullivan, J.M., Focus on Molecules: ABCA4 (ABCR) - An import-directed photoreceptor retinoid flipase. Exp Eye Res, 2009.

199. Sun, H., P.M. Smallwood, and J. Nathans, Biochemical defects in ABCR protein variants associated with human retinopathies. Nature genetics, 2000. 26(2): p. 242-6.

200. Sun, M., et al., Comparison of the capability of GDNF, BDNF, or both, to protect nigrostriatal neurons in a rat model of Parkinson's disease. Brain research, 2005. 1052(2): p. 119-29.

201. Suomalainen, M. and U.F. Greber, Uncoating of non-enveloped viruses. Current opinion in virology, 2013. 3(1): p. 27-33.

202. Suzuki, Y. and R. Craigie, The road to chromatin - nuclear entry of retroviruses. Nature reviews. Microbiology, 2007. 5(3): p. 187-96.

203. Sweigard, J.H., S. Cashman, and R. Kumar-Singh, Adenovirus Vectors Targeting Distinct Cell Types in the Retina. Invest Ophthalmol Vis Sci, 2009.

204. Sweigard, J.H., S.M. Cashman, and R. Kumar-Singh, Adenovirus-mediated delivery of CD46 attenuates the alternative complement pathway on RPE: implications for age-related macular degeneration. Gene therapy, 2011. 18(6): p. 613-21.

193

205. Tang, M.X., C.T. Redemann, and F.C. Szoka, Jr., In vitro gene delivery by degraded polyamidoamine dendrimers. Bioconjugate chemistry, 1996. 7(6): p. 703-14.

206. Thomsen, D.R., et al., Promoter-regulatory region of the major immediate early gene of human cytomegalovirus. Proceedings of the National Academy of Sciences of the United States of America, 1984. 81(3): p. 659-63.

207. Tomko, R.P., R. Xu, and L. Philipson, HCAR and MCAR: the human and mouse cellular receptors for subgroup C adenoviruses and group B coxsackieviruses. Proceedings of the National Academy of Sciences of the United States of America, 1997. 94(7): p. 3352-6.

208. Tschernutter, M., et al., Long-term preservation of retinal function in the RCS rat model of retinitis pigmentosa following lentivirus-mediated gene therapy. Gene therapy, 2005. 12(8): p. 694-701.

209. Tsybovsky, Y., et al., Posttranslational modifications of the photoreceptor-specific ABC transporter ABCA4. Biochemistry, 2011. 50(32): p. 6855-66.

210. Usui, Y., et al., Functional expression of B7H1 on retinal pigment epithelial cells. Experimental eye research, 2008. 86(1): p. 52-9.

211. van Veen, T., et al., Retinal photoreceptor neurons and pinealocytes accumulate mRNA for interphotoreceptor retinoid-binding protein (IRBP). FEBS letters, 1986. 208(1): p. 133-7.

212. VandenDriessche, T., D. Collen, and M.K. Chuah, Gene therapy for the hemophilias. Journal of thrombosis and haemostasis : JTH, 2003. 1(7): p. 1550-8.

213. Vannucci, L., et al., Viral vectors: a look back and ahead on gene transfer technology. The new microbiologica, 2013. 36(1): p. 1-22.

214. Vogel, B.E., et al., A novel integrin specificity exemplified by binding of the alpha v beta 5 integrin to the basic domain of the HIV Tat protein and vitronectin. The Journal of cell biology, 1993. 121(2): p. 461-8.

215. Vollrath, D., et al., Correction of the retinal dystrophy phenotype of the RCS rat by viral gene transfer of Mertk. Proceedings of the National Academy of Sciences of the United States of America, 2001. 98(22): p. 12584-9.

194

216. Von Seggern, D.J., et al., In vivo transduction of photoreceptors or ciliary body by intravitreal injection of pseudotyped adenoviral vectors. Molecular therapy : the journal of the American Society of Gene Therapy, 2003. 7(1): p. 27-34.

217. Walters, R.W., et al., Adenovirus fiber disrupts CAR-mediated intercellular adhesion allowing virus escape. Cell, 2002. 110(6): p. 789-99.

218. Wang, A., et al., Identification and characterization of human genes encoding Hprp3p and Hprp4p, interacting components of the spliceosome. Human molecular genetics, 1997. 6(12): p. 2117-26.

219. Wang, Q., X.C. Jia, and M.H. Finer, A packaging cell line for propagation of recombinant adenovirus vectors containing two lethal gene-region deletions. Gene therapy, 1995. 2(10): p. 775-83.

220. Wang, W., et al., Non-viral gene delivery methods. Current pharmaceutical biotechnology, 2013. 14(1): p. 46-60.

221. Wang, Y., et al., Limitations of encapsidation of recombinant self-complementary adeno-associated viral genomes in different serotype capsids and their quantitation. Human gene therapy methods, 2012. 23(4): p. 225-33.

222. Wendell, D.M., et al., The effect of jet parameters on jet injection. Conference proceedings : ... Annual International Conference of the IEEE Engineering in Medicine and Biology Society. IEEE Engineering in Medicine and Biology Society. Conference, 2006. 1: p. 5005-8.

223. Wenkel, H. and J.W. Streilein, Analysis of immune deviation elicited by antigens injected into the subretinal space. Investigative ophthalmology & visual science, 1998. 39(10): p. 1823-34.

224. West, E.L., et al., Pharmacological disruption of the outer limiting membrane leads to increased retinal integration of transplanted photoreceptor precursors. Experimental eye research, 2008. 86(4): p. 601-11.

225. Westenskow, P.D., T. Kurihara, and M. Friedlander, Utilizing Stem Cell-Derived RPE Cells as A Therapeutic Intervention for Age-Related Macular Degeneration. Advances in experimental medicine and biology, 2014. 801: p. 323-9.

195

226. White, G.C., 2nd, Gene therapy in hemophilia: clinical trials update. Thrombosis and haemostasis, 2001. 86(1): p. 172-7.

227. Wickham, T.J., M.E. Carrion, and I. Kovesdi, Targeting of adenovirus penton base to new receptors through replacement of its RGD motif with other receptor-specific peptide motifs. Gene therapy, 1995. 2(10): p. 750-6.

228. Wickham, T.J., et al., Integrins alpha v beta 3 and alpha v beta 5 promote adenovirus internalization but not virus attachment. Cell, 1993. 73(2): p. 309-19.

229. Wolf, D.P., et al., In vitro fertilization-embryo transfer in nonhuman primates: the technique and its applications. Molecular reproduction and development, 1990. 27(3): p. 261-80.

230. Wolff, J.A., et al., Direct gene transfer into mouse muscle in vivo. Science, 1990. 247(4949 Pt 1): p. 1465-8.

231. Wu, E., et al., Flexibility of the adenovirus fiber is required for efficient receptor interaction. Journal of virology, 2003. 77(13): p. 7225-35.

232. Wu, G.Y. and C.H. Wu, Receptor-mediated in vitro gene transformation by a soluble DNA carrier system. The Journal of biological chemistry, 1987. 262(10): p. 4429-32.

233. Wu, X. and S.M. Burgess, Integration target site selection for retroviruses and transposable elements. Cellular and molecular life sciences : CMLS, 2004. 61(19-20): p. 2588-96.

234. Wu, Z., H. Yang, and P. Colosi, Effect of genome size on AAV vector packaging. Mol Ther, 2010 18(1): p. 80-6.

235. Xu, L., et al., CMV-beta-actin promoter directs higher expression from an adeno-associated viral vector in the liver than the cytomegalovirus or elongation factor 1 alpha promoter and results in therapeutic levels of human factor X in mice. Human gene therapy, 2001. 12(5): p. 563-73.

236. Xu, Y. and F.C. Szoka, Jr., Mechanism of DNA release from cationic liposome/DNA complexes used in cell transfection. Biochemistry, 1996. 35(18): p. 5616-23.

237. Yang, Y., et al., Inactivation of E2a in recombinant adenoviruses improves the prospect for gene therapy in cystic fibrosis. Nature genetics, 1994. 7(3): p. 362-9.

238. Yang, Z., et al., Mutant prominin 1 found in patients with macular degeneration disrupts photoreceptor disk

196

morphogenesis in mice. The Journal of clinical investigation, 2008. 118(8): p. 2908-16.

239. Zack, D.J., et al., Unusual topography of bovine rhodopsin promoter-lacZ fusion gene expression in transgenic mouse retinas. Neuron, 1991. 6(2): p. 187-99.

240. Zamiri, P., S. Sugita, and J.W. Streilein, Immunosuppressive properties of the pigmented epithelial cells and the subretinal space. Chemical immunology and allergy, 2007. 92: p. 86-93.

241. Zhang, S.H., et al., Distinctive gene transduction efficiencies of commonly used viral vectors in the retina. Current eye research, 2008. 33(1): p. 81-90.

242. Zhou, R., et al., A new look at immune privilege of the eye: dual role for the vision-related molecule retinoic acid. Journal of immunology, 2011. 187(8): p. 4170-7.

243. Zufferey, R., et al., Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. Journal of virology, 1998. 72(12): p. 9873-80.

197

Appendix

Appendix A – Curve fit for Section 3.4.2

The curve-fit function applied was

Y=Bmax · X / (ID50 + X)

X = VP/cell Y = percentage positive cells Bmax = infection maximum (assumed to be 100%) ID50 = infectious dose 50; number of particles required to achieve fluorescence in

50% of the cells as determined by flow cytometry

Curve fit was performed by the least squares method.

APRE-19 WERI-Rb ID50 92.40 230.1

95% Confidence Interval 77.84 to 107.0 191.7 to 268.4R2 0.9316 0.9082

198

When the curve-fit is applied to ARPE-19 and WERI-Rb cells transduced with CAG-

EGFP, the resulting R2 was 0.9316 and 0.9082 respectively. Interpreting the R2 value, the

dose of CAG-EGFP (VP/cell) applied accounts for 93% and 91% of the differences in

the number of fluoresence cells in ARPE-19 and WERI-Rb cells respectively. The high

R2 value validates the use of the curve-fit with the data.

199

Appendix B – List of abbreviations

A2E di-retinoid-pyridinium-ethanolamine

A2PE di-retinoid pyridinium phosphatidyl ethanolamine

ACAID anterior chamber-associated immune deviation

Ad adenovirus

AdV adenoviral vector

bp base pairs

BSA bovine serum albumin

CCD charge-coupled device

CD46 cluster of differentiation 46; membrane cofactor protein

cGMP cyclic guanosine monophosphate

CIAP calf intestinal alkaline phosphatase

CMV cytomegalovirus

CMV-IE cytomegalovirus immediate-early gene/promoter

CPE cytopathic effect

DAPI 4', 6-diamidino-2-phenylindole

DNA deoxyribonucleic acid

EIAV equine infectious anemia virus

FBS fetal bovine serum

FGAdV first-generation adenoviral vector

g gravitational acceleration

HDAd helper-dependent adenoviral vector

HSG heparan sulfate glycosaminoglycans

IL interleukin

ILM inner limiting membrane

INL inner nuclear layer

200

IPL inner plexiform layer

IRBPE interphotoreceptor retinoid-binding protein promoter enhancer

ITR inverted terminal repeat

IU infectious unit

LPC lysophosphatidylcholine

MFI mean fluorescence intensity

MOI multiplicity of infection

kb kilobase; 1000 basepairs of DNA or RNA

LRAT lecithin retinol acyltransferase

mRNA messenger RNA

OLM outer limiting membrane

ONL outer nuclear layer

OPL outer plexiform layer

ORF open reading frame

PCR polymerase chain reaction

PDE phosphodiesterase

PD-L1 programmed death-ligand 1

PE phosphatidyl ethanolamine

PFU plaque forming units

PR photoreceptor

qRT-PCR quantitative retrotranscription polymerase chain reaction

RDH retinol dehydrogenase

Rho rhodopsin (used to denote rhodopsin promoter constructs)

RPE retinal pigment epithelium

RPM revolutions per minute

TGF transforming growth factor

VP vector particles

201

Appendix C – List of Publications

Highly efficient retinal gene delivery with helper-dependent adenoviral vectors Lam S, Cao H, Duan R, Hu J Genes & Diseases (in press, accepted 4 September, 2014,) There have been significant advancements in the field of retinal gene therapy in the past several years. In particular, therapeutic efficacy has been achieved in three separate human clinical trials conducted to assess the ability of adeno-associated viruses (AAV) to treat of a type of Leber’s congenital amaurosis caused by RPE65 mutations. However, despite the success of retinal gene therapy with AAV, challenges remain for delivering large therapeutic genes or genes requiring long DNA regulatory elements for controlling their expression. For example, Stargardt’s disease, a form of juvenile macular degeneration, is caused by defects in ABCA4, a gene that is too large to be packaged in AAV. Therefore, we investigated the ability of helper dependent adenovirus (HD-Ad) to deliver genes to the retina as it has a much larger transgene capacity. Using an EGFP reporter, our results showed that HD-Ad can transduce the entire retinal epithelium of a mouse using a dose of only 1 x 105 infectious units and maintain transgene expression for at least 4 months. The results demonstrate that HD-Ad has the potential to be an effective vector for the gene therapy of the retina. rbm47, a novel RNA binding protein, regulates zebrafish head development. Guan R, El-Rass S, Spillane D, Lam S, Wang Y, Wu J, Chen Z, Wang A, Jia Z, Keating A, Hu J, Wen XY. Dev Dyn. 2013 Dec;242(12):1395-404. BACKGROUND: Vertebrate trunk induction requires inhibition of bone morphogenetic protein (BMP) signaling, whereas vertebrate head induction requires concerted inhibition of both Wnt and BMP signaling. RNA binding proteins play diverse roles in embryonic development and their roles in vertebrate head development remain to be elucidated. RESULTS: We first characterized the human RBM47 as an RNA binding protein that specifically binds RNA but not single-stranded DNA. Next, we knocked down rbm47 gene function in zebrafish using morpholinos targeting the start codon and exon-1/intron-1 splice junction. Down-regulation of rbm47 resulted in headless and small head phenotypes, which can be rescued by a wnt8a blocking morpholino. To further reveal the mechanism of rbm47's role in head development, microarrays were performed to screen genes differentially expressed in normal and knockdown embryos. epcam and a2ml were identified as the most significantly up- and down-regulated genes, respectively. The microarrays also confirmed up-regulation of several genes involved in head development, including gsk3a, otx2, and chordin, which are important regulators of Wnt signaling. CONCLUSIONS: Altogether, our findings reveal that Rbm47 is a novel RNA-binding protein critical for head formation and embryonic patterning during zebrafish embryogenesis which may act through a Wnt8a signaling pathway.

202

Overview of Gene Therapy for Retinal Diseases Lam S Inside Optics, April 2013 Lecture given as a part of the “Main Lecture” series for an accredited continuing education program at the Annual Meeting of the Ontario Opticians Association Knockdown of ZNF403 inhibits cell proliferation and induces G2/M arrest by modulating cell-cycle mediators. Guan R, Wen XY, Wu J, Duan R, Cao H, Lam S, Hou D, Wang Y, Hu J, Chen Z. Mol Cell Biochem. 2012 Jun;365(1-2):211-22 ZNF403, also known as GGNBP2 (gametogenetin binding protein 2), is a highly conserved gene implicated in spermatogenesis. However, the exact biological function of ZNF403 is not clear. In this study, we identified the role of ZNF403 in cell proliferation and cell-cycle regulation by utilizing short hairpin RNA (shRNA)-mediated knockdown. ZNF403-specific shRNA expressing helper-dependent adenoviral vector (HDAd-ZNF403-shRNA) was constructed and transduced human cell lines. ZNF403 mRNA and protein expression levels were inhibited as evidenced by real-time PCR and western blot analyses. Noticeably, we found that knockdown of ZNF403 expression suppressed cell proliferation compared to the non-target shRNA and vector controls. Furthermore, cell-cycle analysis demonstrated that downregulation of ZNF403 promoted G2/M cell-cycle arrest in a dose-dependent manner. Moreover, human cell-cycle real-time PCR array revealed that ZNF403 knockdown influenced the expression profile of genes in cell-cycle regulation. Among these genes, western blot analysis confirmed the protein up-regulation of p21 and down-regulation of MCM2 in response to the ZNF403 knockdown. Additionally, knockdown of ZNF403 also showed an anti-carcinogenetic effect on anchorage-independent growth by colony formation assay and tumor cell migration by wound-healing assay with human laryngeal cancer cell line Hep-2 cells. Altogether, our findings suggest an essential role of ZNF403 in cell proliferation and provide a new insight into the function of ZNF403 in regulating the G2/M cell-cycle transition. Sub-retinal gene delivery using helper-dependent adenoviral vectors. Wu L, Lam S, Cao H, Guan R, Duan R, van der Kooy D, Bremner R, Molday RS, Hu J. Cell Biosci. 2011 Apr 4;1(1):15 This study describes the successful delivery of helper-dependent adenoviral vectors to the mouse retina with long term and robust levels of reporter expression in the retina without apparent adverse effects. Since these vectors have a large cloning capacity, they have great potential to extend the success of gene therapy achieved using the adeno-associated viral vector.

203

Temporal and tissue specific regulation of RP-associated splicing factor genes PRPF3, PRPF31 and PRPC8--implications in the pathogenesis of RP. Cao H, Wu J, Lam S, Duan R, Newnham C, Molday RS, Graziotto JJ, Pierce EA, Hu J. PLoS One. 2011 Jan 19;6(1):e15860 Genetic mutations in several ubiquitously expressed RNA splicing genes such as PRPF3, PRP31 and PRPC8, have been found to cause retina-specific diseases in humans. To understand this intriguing phenomenon, most studies have been focused on testing two major hypotheses. One hypothesis assumes that these mutations interrupt retina-specific interactions that are important for RNA splicing, implying that there are specific components in the retina interacting with these splicing factors. The second hypothesis suggests that these mutations have only a mild effect on the protein function and thus affect only the metabolically highly active cells such as retinal photoreceptors. METHODOLOGY/PRINCIPAL FINDINGS: We examined the second hypothesis using the PRPF3 gene as an example. We analyzed the spatial and temporal expression of the PRPF3 gene in mice and found that it is highly expressed in retinal cells relative to other tissues and its expression is developmentally regulated. In addition, we also found that PRP31 and PRPC8 as well as snRNAs are highly expressed in retinal cells. CONCLUSIONS/SIGNIFICANCE: Our data suggest that the retina requires a relatively high level of RNA splicing activity for optimal tissue-specific physiological function. Because the RP18 mutation has neither a debilitating nor acute effect on protein function, we suggest that retinal degeneration is the accumulative effect of decades of suboptimal RNA splicing due to the mildly impaired protein.