Analytical Biochemistry 481 (2015) 27–32

Contents lists available at ScienceDirect

Analytical Biochemistry

journal homepage: www.elsevier .com/locate /yabio

Development of an enzyme-linked immunosorbent assay for thiaclopridin soil and agro-products with phage-displayed peptide

http://dx.doi.org/10.1016/j.ab.2015.04.0150003-2697/� 2015 Elsevier Inc. All rights reserved.

⇑ Corresponding author at: College of Plant Protection, Nanjing AgriculturalUniversity, Nanjing 210095, China. Fax: +86 25 84395479.

E-mail address: wangmha@njau.edu.cn (M. Wang).1 These authors contributed equally to this article.

Wei Yin a,b,1, Xiude Hua a,b,1, Xiaofeng Liu a,b, Haiyan Shi a,b, Shirley J. Gee c, Minghua Wang a,b,⇑,Bruce D. Hammock c

a College of Plant Protection, Nanjing Agricultural University, Nanjing 210095, Chinab State and Local Joint Engineering Research Center of Green Pesticide Invention and Application, Nanjing 210095, Chinac Department of Entomology and UCD Cancer Center, University of California, Davis, Davis, CA 95616, USA

a r t i c l e i n f o a b s t r a c t

Article history:Received 29 January 2015Received in revised form 8 April 2015Accepted 14 April 2015Available online 20 April 2015

Keywords:ThiaclopridEnzyme-linked immunosorbent assayPhage-displayed peptidePhage peptide libraryMimotope

A monoclonal antibody (3A5) that can recognize thiacloprid was produced, and a linear 8-residue peptidephage library was constructed. Six phage-displayed peptides were isolated from the linear 8-residue pep-tide phage library and a cyclic 8-residue peptide phage library. A phage enzyme-linked immunosorbentassay (ELISA) was developed to detect thiacloprid using a phage-displayed peptide. Under the optimalconditions, the half-maximal inhibition concentration (IC50) and the limit of detection (IC10) of the devel-oped phage ELISA were 8.3 and 0.7 lg/L, respectively. Compared with the conventional ELISA, the sensi-tivity was improved more than 3-fold. The cross-reactivity (CR) was less than 0.08% for the testedstructural analogues and was regarded as negligible. The recoveries of thiacloprid ranged from 80.3%to 116.3% in environmental and agricultural samples, which conformed to the requirements for residuedetection. The amount of thiacloprid detected by phage ELISA in the samples was significantly correlatedwith that detected by high-performance liquid chromatography. The current study indicates that isolat-ing phage-displayed peptides from phage display libraries is an alternative method for the developmentof a sensitive immunoassay and that the developed assay is a potentially useful tool for detecting thia-cloprid in environmental and agricultural samples.

� 2015 Elsevier Inc. All rights reserved.

Thiacloprid is a systemic and broad-spectrum neonicotinoidinsecticide against sucking and chewing insects and is the secondmember of Bayer’s chloronicotinyl family. Because neonicotinoidinsecticides have greater systemic activity, lower acute mam-malian toxicity, and no cumulative long-term toxicity, they arewidely used in agriculture [1]. However, many studies have provedthat neonicotinoid insecticides have high toxicity to bees and otherpollinating insects [2] and contaminate the ecosystem [3]. In 2013,the European Commission decided that three kinds of neonicoti-noid insecticides were banned in some blossom crops for 2 years.Therefore, monitoring the residual thiacloprid in environmentaland agricultural samples is significant.

A variety of analytical methods have been successfully used andare available for thiacloprid detection, among which immunoassay

is practical due to its simplicity, fast detection, low cost, andlarge parallel-processing capacity [4–6]. Thiacloprid is a low-molecular-weight chemical, so it is necessary to use a thiacloprid–protein conjugate to raise antibodies. It is also necessary to use acompetitor (a competing hapten conjugated with a carrier protein,enzyme, fluorophore, etc.) in assay development. In general, thecompeting hapten is the same as the immunizing hapten used to eli-cit the analyte-specific antibodies (homologous assay). However,the sensitivity of the immunoassay can be improved by orders ofmagnitude if structural variants of the immunizing hapten are usedas heterologous competitors (heterologous assay) [7–10]. In somecase, the chemical synthesis of competing hapten, depending onthe analyte, may be difficult, expensive, and potentially hazardous.Thus, a simple, low-cost, and nontoxic approach to the preparationof competitors is important.

Phage-displayed peptide libraries have been a powerful tool forisolating analyte peptidomimetic, which can be used as surrogate

28 Phage-displayed peptidomimetics of thiacloprid / W. Yin et al. / Anal. Biochem. 481 (2015) 27–32

competing haptens in both monoclonal antibody (mAb)2–basedimmunoassays and polyclonal antibody (pAb)-based immunoassays[11–14]. This strategy also enables the fast generation of severalcompeting haptens for the rapid development of sensitive heterolo-gous immunoassays. Some investigators have successfully obtainedphage-displayed peptides that can be used as a competitor forlow-molecular-weight compounds from a phage display peptidelibrary [15–18], but few pesticides or their metabolites have beenreported. To the best of our knowledge, only molinate, atrazine,organophosphorus pesticide, and two metabolites of pyrethroidinsecticides have been studied [12,13,19]. Kim and coworkersreported a heterologous enzyme-linked immunosorbent assay(ELISA) based on a phage-displayed peptide with 100-fold highersensitivity than the homologous assay [13]. Hua and coworkersreported a phage ELISA with 120- and 2-fold higher sensitivity thanconventional homologous and heterologous ELISAs, respectively[20]. These articles demonstrate that phage-displayed peptides arean alternative competitor for the development of highly sensitivecompetitive immunoassays.

In this study, a mAb (3A5) that can recognize thiacloprid wasproduced, and a linear 8-residue peptide phage library was con-structed. Six phage-displayed peptides were isolated from the lin-ear and cyclic 8-residue peptide phage libraries. A phage ELISA wasdeveloped to detect thiacloprid in environmental and agriculturalproducts using the optimal phage-displayed peptide. Comparedwith the conventional ELISA, the sensitivity was improved morethan 3-fold.

Materials and methods

Reagents

All reagents were of analytical grade unless specified otherwise.Thiacloprid and the pesticide standards used for cross-reactivitystudies were supplied by Jiangsu Pesticide Research Institute(Jiangsu, China). Bovine serum albumin (BSA), ovalbumin (OVA),complete and incomplete Freund adjuvants, N-hydroxysuccinimide(NHS), N,N’-dicyclohexylcarbodiimide (DCC), tetramethylbenzidine(TMB), isopropyl-b-D-thiogalactoside (IPTG), 5-bromo-4-chloro-3-indolyl-b-D-galactoside (Xgal), and Tween 20 were purchased fromSigma–Aldrich Chemical (St. Louis, MO, USA). Horseradish peroxi-dase (HRP)-labeled goat anti-mouse IgG was purchased fromDingguo Changsheng Biotechnology (Beijing, China). Mouseanti-M13 mAb–HRP conjugate was purchased from GE Healthcare(Piscataway, NJ, USA). Escherichia coli ER2738 and Ph.D. PeptideDisplay Cloning System (containing M13KE gIII Cloning Vector andM13KE Extension Primer), Klenow fragment, EagI, and Acc65I werepurchased from New England Biolabs (Ipswich, MA, USA). E. coliER2738 electrocompetent cells were purchased from Lucigen(Middleton, WI, USA). The immunogenic hapten (Fig. 1) and the cyclic8-amino-acid random peptide library (the transducing unit (TU) andtiter were 5.52 � 109 pfu/lg and 3.4� 1013 pfu/ml, respectively)were developed previously [4,21]. The BALB/c mice were purchasedfrom the Center of Comparative Medicine of Yangzhou University(Jiangsu, China). All of the animal studies were performed inaccordance with institutional guidelines.

2 Abbreviations used: mAb, monoclonal antibody; pAb, polyclonal antibody; ELISA,enzyme-linked immunosorbent assay; BSA, bovine serum albumin; OVA, ovalbumin;NHS, N-hydroxysuccinimide; DCC, N,N0-dicyclohexylcarbodiimide; TMB, tetramethyl-benzidine; IPTG, isopropyl-b-D-thiogalactoside; Xgal, 5-bromo-4-chloro-3-indolyl-b-D-galactoside; HRP, horseradish peroxidase; TU, transducing unit;ic-ELISA, indirect competitive ELISA; PBS, phosphate-buffered saline; HAT, hypoxanthine–aminopterin–thymidine; PCR, polymerase chain reaction; PBST, PBS con-taining Tween 20; CR, cross-reactivity; HPLC, high-performance liquid chromatogra-phy; RSD, relative standard deviation; MRL, maximum residue limit.

Immunization and mAb preparation

Six-week-old female BALB/c mice were immunized withimmunogen via an intraperitoneal injection according to themethod described by Kishiro and coworkers [22]. The dosage ofthe first immunogen for each mouse was 100 lg of immunogen(8.28 g/L) dissolved in physiological saline and emulsified withan equal volume of Freund’s complete adjuvant. After 3 weeks,the subsequent four injections were given at 2-week intervalsusing immunogen emulsified with Freund’s incomplete adjuvant.The antisera were obtained from the tail vein of the mouse 1 weekafter the immunization, and the sera were tested by indirect com-petitive ELISA (ic-ELISA) to determine their ability to conjugatewith thiacloprid. The mouse that exhibited the strongest responsewas used for peritoneal cavity injections of 200 lg immunogen inphosphate-buffered saline (PBS) 1 week after the last immuniza-tion. Three days after the booster injection, cell fusion was per-formed according to Nowinski and coworkers [23]. Mouse spleenlymphocytes were fused with SP2/0 myeloma cells in a 5:1 ratio.The fused cells were cultured in a hypoxanthine–aminopterin–thymidine (HAT) medium at 37 �C in an atmosphere of 5% CO2.Fourteen days after cell fusion, the HAT medium was changed toHT medium. Culture supernatants were screened for their abilityto recognize thiacloprid, and hybridoma cells in the ELISA positivewells were cloned using the limiting dilution method. Stableantibody-producing clones were expanded. Ascites obtained fromBALB/c mice were purified using saturated ammonium sulfate pre-cipitation and stored at �20 �C after freeze-drying.

Construction of linear 8-amino-acid random peptide library

The linear 8-amino-acid random peptide library was con-structed by using the Ph.D. Peptide Display Cloning System accord-ing to the manufacturer’s instructions. The library was made byligating a synthetic 33-bp fragment into the M13KE vector andtransfecting E. coli cells with the ligation product by electropora-tion. Within the fragment was the degenerate coding sequence50-(NNK)8GGTGGAGGT-30; N stands for an equimolar mixture ofG, A, T, and C, whereas K is an equimolar mixture of G and T. Thesingle-strand degenerate oligonucleotide is converted to doublestrand by polymerase chain reaction (PCR) using the extension pri-mer 50-CATGCCCGGGTACCTTTCTATTCTC-30. The PCR was per-formed (heat to 95 �C and then cool slowly to less than 37 �C;10 min, 37 �C; 15 min, 65 �C) with 5 lg of template, 3 mol eq ofextension primer, and 15 U of Klenow fragment.

A 196-ll aliquot of the PCR-amplified oligonucleotide mixturewas digested (3 h, 37 �C) with 5 ll of EagI (10 U/ll) and 5 ll ofAcc65I (10 U/ll) in a total volume of 400 ll. The digested duplexwas purified by phenol/chloroform extraction and ligated into adigested M13KE vector at 16 �C overnight.

Electroporation of 1 ll ligation product into electrocompetentER2738 cells (100 ll) was performed by discharging a 25 lF capac-itor charged to 2.5 kV across a 0.2 cm gap in parallel with a 200 Xresistance. After 30 min of incubation in SOC medium (LB mediumwith 0.01 M MgCl2 and 0.02 M glucose) at 37 �C, serial dilution ofthe cells was mixed with 5 ml of top agar and 200 ll of amid-log culture of ER2738 and pooled on an LB/IPTG/Xgal plate.The remaining cells were added to 1 L of early log cells(OD600 = 0.01–0.05) and grown at 37 �C with shaking for amplifica-tion. After 5 h of shaking, the culture was centrifuged at 5000g for20 min at 4 �C. The supernatant was collected, and 1/6 volume of20% polyethylene glycol (PEG)/2.5 M NaCl solution was added.Phage virions were collected by centrifugation as above. The finalphage library was suspended in TBS (50 mM Tris–HCl and150 mM NaCl, pH 7.5) containing 0.02% NaN3.

Fig.1. Structures of thiacloprid (A) and the immunogenic hapten (B).

Phage-displayed peptidomimetics of thiacloprid / W. Yin et al. / Anal. Biochem. 481 (2015) 27–32 29

Phage selection by biopanning

Three wells of one microtiter plate were coated with purified3A5 mAb (10 mg/L) in 100 ll of PBS by overnight incubation at4 �C. Nonspecific binding was blocked by incubation with 300 ll ofPBS containing 3% BSA for 1.5 h at 37 �C. To eliminate nonspecificbinding of phage to BSA, another plate coated with 100 ll of 3%BSA in PBS was used for preabsorption. For the panning–elution pro-cedure, the phage library (1 � 1010 pfu/ml) diluted with PBS wasfirst added to the preabsorption plate and incubated at room tem-perature for 1 h. Then, the supernatant was transferred to the platecoated with 3A5 mAb and incubated with shaking at room temper-ature for 1 h. The wells were washed 10 times with PBS containing0.1% (v/v) Tween 20 (PBST). To elute the bound phage using compet-itive elution, 100 ll of thiacloprid (10 mg/L in PBS) was added toeach well with shaking for 1 h to compete the binding phage fromthe coating antibody. The elution solution was then collected andused to infect E. coli ER2738 for amplification and titration. Theamplified phage was used for a subsequent round of panning. Inthe second and third rounds of panning, the concentration of coatingantibody was reduced to 5 and 1 mg/L, whereas the elution bufferwas 1 and 0.1 mg/L thiacloprid, respectively. After three rounds ofpanning–elution selection, individual plaques were picked up fromLB/IPTG/Xgal plates and tested for their ability to bind to the mAb byphage ELISA. Positive clones were further selected by titration andsubmitted for DNA sequencing using the primer 96 gIII(CCCTCATAGTTAGCGTAACG) (GenScript Nanjing, Jiangsu, China).

Screening of phage eluate by phage ELISA

After three rounds of panning, 180 ll of ER2738 cell culture(mid-log phase, OD600 = 0.5 AU) was mixed with 10 ll of dilutedphage eluates. Then, the infected cells were transferred to culturetubes containing 5 ml of 45 �C top agar and poured on anLB/IPTG/Xgal plate. The plates were incubated overnight at 37 �C.A total of 20 clones were picked, transferred to diluted ER2738 cul-ture, and grown at 37 �C with shaking for 4.5 h. Cells were pelletedby centrifugation at 10,000 rpm for 10 min, and the supernatantswere collected for phage ELISA. To select the positive clones, amicrotiter plate was coated with 3A5 mAb and blocked asdescribed above for panning–elution selection. Then, 50 ll ofphage supernatant of each clone was mixed with 50 ll of 10 lg/mlthiacloprid in 10% methanol–PBS or pure dilution buffer. The mix-tures were added to the wells, and the preparations were incu-bated at room temperature for 1 h with shaking. After the wellswere washed six times with 0.1% PBST, 100 ll of anti-M13 phageantibody conjugated with HRP (1:5000 dilution in PBS) was added.After 1 h of incubation and washing six times, the amount of boundenzyme was determined by adding 100 ll of peroxidase substrate(25 ml of 0.1 M citrate acetate buffer [pH 5.5], 0.4 ml of 6 mg/mlTMB in dimethyl sulfoxide [DMSO], and 0.1 ml of 1% H2O2). Theabsorbance at 450 nm was determined after the reaction wasstopped by adding 50 ll of 2 M H2SO4 per well.

Selection of phage-displayed peptide

The optimal concentrations of phage-displayed peptide andantibody were confirmed using the two-dimensional checkerboard

method [24]. Selection of the phage-displayed peptide was per-formed by phage ELISA. A series of concentrations (0.001–10 lg/ml) of thiacloprid was prepared in 10% methanol–PBS andtested using the phage ELISAs. The evaluations of thephage-displayed peptides were based on Amax/IC50 (the ratio ofAmax to IC50) and IC50, and the combination of low IC50 and highAmax/IC50 was the most desirable [25].

Optimization of phage ELISA

The experimental parameters, including the ionic strength, pHvalue, and organic solvent, were sequentially studied to determinethe optimal conditions to achieve the maximum sensitivity.Competitive curves of thiacloprid were run in PBS solutions con-taining different concentrations of NaCl (from 0.035 to 3.2 mol/L)and methanol (5–40%, v/v) as well as solutions with various pHvalues (4.5–9.5). The evaluations of the parameters were basedon the Amax/IC50 ratio and IC50.

Specificity of phage ELISA

A series of concentrations (0.001–10 mg/L) of the analogueswere prepared in 10% methanol–PBS and tested using the phageELISA. To evaluate the specificity of the phage ELISA, thecross-reactivity (CR) was calculated based on the IC50 values usingthe following formula: CR = [IC50 (thiacloprid)/IC50 (com-pound)] � 100%. Here, the CR of thiacloprid was defined as 100%.

Accuracy (analysis of spiked agricultural samples)

Four different agricultural samples (soil, pear, tomato, and cab-bage) were chosen to evaluate the performance of the phage ELISA.Soil was collected from a farm in Nanjing, China. Pear, tomato, andcabbage were purchased from local markets. All samples were cutinto pieces and homogenized. The homogenized samples werespiked with known concentrations of thiacloprid in methanol (finalconcentrations of 0.025–1 mg/kg). The spiked samples were thor-oughly mixed and allowed to stand at room temperature for 2 h.

All samples (10 g) were extracted twice by sonication in 20 mlof PBS containing 50% methanol for 5 min and centrifuged for10 min at 4000 rpm. The supernatant was transferred into a25-ml volumetric flask and adjusted to 25 ml with PBS. Afterappropriate dilution with PBS, the solutions were analyzed viathe phage ELISA. Each sample was spiked and analyzed intriplicate.

HPLC analysis and validation

For high-performance liquid chromatography (HPLC), the sam-ples were extracted by vigorously shaking for 1 h with 30 ml ofmethanol and then centrifuged for 10 min at 4000 rpm. The super-natants (15 ml) were filtered through anhydrous sodium sulfateand evaporated in vacuo. The remainder was dissolved with 2 mlof methanol and confirmed by HPLC (Agilent 1260) with anEclipse XDB2-C18 column (250 � 4.6 mm, 5 lm) using a mixtureof water (0.2% phosphoric acid) and acetonitrile (70:30, v/v) asthe mobile phase at a flow rate of 1.0 ml/min at 30 �C. The

Table 1Peptide sequences, IC50, and Amax/IC50 of six competitive clones.

Clone name Sequence IC50 (lg/L) Amax/IC50

C8-1a LHSKHTYE (12) 13.9 0.174C8-2 PNPKSKTI (3) 44.3 0.055C8-3 PTKAGIQS (5) 28.7 0.087L8-1b

AKSLEIDQ (5) 20.5 0.118

L8-2 LEIRSTVV (8) 55.7 0.044

L8-3 EYQYQTGL (7) 77.9 0.031

a C means the phage-displayed peptides obtained from the cyclic library.b L means the phage-displayed peptides obtained from the linear-library.

Fig.2. Standard curves for thiacloprid by conventional ELISA and phage ELISA(n = 3).

30 Phage-displayed peptidomimetics of thiacloprid / W. Yin et al. / Anal. Biochem. 481 (2015) 27–32

detection wavelength was 245 nm, and the injection volume was20 ll. The measured results were compared with the ELISA results.

Results and discussion

Production of mAb

Three hybridoma cell lines that stably produced mAbs againstthiacloprid were obtained and named 3A5, 5C2, and 6F10. In thisstudy, 3A5 exhibited higher sensitivity than 5C2 and 6F10 andwas used in future study (data not shown).

Characterization of phage library

Phage display library is a powerful tool to select high-affinitypeptides that bind to particular targets. Capacity and diversityare critical to the success of biopanning. The greater the diversityof the library, the more chances to obtain the target ligands. TheTU of the linear 8-residue peptide phage library was determinedby infecting E. coli ER2738 cells and pooling on LB/IPTG/Xgal plates.The calculated TU was 8.7 � 108 pfu/lg. To identify the diversity ofpeptide sequences in the library, 20 clones were selected from thelibrary for sequencing. The results showed that there were no iden-tical inserted sequences among them. The titer of the library was1.6 � 1012 pfu/ml.

Panning–elution selection of specific phages

After three rounds of panning, randomly chosen clones (20clones) for each library were analyzed by phage ELISA in the pres-ence (100 lg/L) or absence of thiacloprid. All clones showed signif-icant differences in signal with or without thiacloprid in the assay(see Fig. S1 in online supplementary material). Phage DNA from thepositive clones was isolated, and the nucleotide sequence of eachof them was determined. Six different sequences (designated asC8-1, C8-2, C8-3, L8-1, L8-2, and L8-3) were identified from thetwo libraries (Table 1). According to the reported articles [15–18,26,27], the octapeptides L8-1 and L8-2 could be assigned tothe same family because they contained the consensus sequenceLEI with no similarity to other octapeptides by comparing theamino acid sequences. We assumed that LEI might be the keysequence to determine the two peptides bound to the antibody.

Selection of phage-displayed peptide

After amplification, the titers of the phage-displayed peptidesC8-1, C8-2, C8-3, L8-1, L8-2, and L8-3 were 7.5 � 1012, 8.2 � 1012,1.2 � 1013, 2.1 � 1013, 7.7 � 1012, and 1.1 � 1013 pfu/ml, respec-tively. Three individual plaques of each peptide were picked upfrom LB/IPTG/Xgal plates and submitted for DNA sequencing. Thesequences of the three plaques were consistent for each peptide.These results indicated that the six phage-displayed peptides werestabile and reproducible. The Amax/IC50 and IC50 values of the sixphage ELISAs for thiacloprid are shown in Table 1. The sensitivityof the six phage ELISAs decreased in the following order:C8-1 > L8-1 > C8-3 > C8-2 > L8-2 > L8-3. C8-1 was superior to theother phage-displayed peptides in terms of sensitivity when usedas a competitor. Because the phage-displayed peptide C8-1 yieldedthe most sensitive assays, it was used for the next study.

Optimization of phage ELISA

Phage ELISA is based on antigen–antibody interactions, and theionic strength and pH value are additional factors influencing theequilibrium constant [28]. Therefore, the ionic strength and pH

value of the working solution were optimized. The 0.14-M NaCland pH 8.5 PBS buffer was selected for the phage ELISA because itexhibited superior sensitivity (see Tables S1 and S2 in supplemen-tary material). Organic solvent can not only improve the solubilityof the analyte but also extract the analyte in the pretreatment.Based on its weaker effect on antigen antibody binding, methanolis commonly selected as an organic co-solvent in immunoassays.When the final concentration of methanol was less than or equalto 5% (50 ll of phage supernatant in PBS was mixed with 50 ll ofanalyte in 10% methanol–PBS), the effect of methanol on the phageELISA was negligible (Fig. S2). In conclusion, the optimized workingsolution was 0.14 M NaCl and pH 8.5 PBS buffer containing 5%methanol.

Sensitivity of phage ELISA

Under the optimal conditions, the standard curve of thiaclopridwas obtained using the relationship between the OD450 and theconcentration of thiacloprid shown in Fig. 2. The IC50, limit ofdetection (LOD, IC10), and linear range (IC20–IC80) of the assay were8.3, 0.7, and 1.2 to 61.1 lg/L, respectively. The mAb (3A5) was alsoused to develop a conventional ELISA (see supplementary materialfor details), and the IC50 and LOD of this were 26.3 and 1.4 lg/L,respectively (Fig. 2). The sensitivity of the phage ELISA wasimproved more than 3-fold compared with the mAb (3A5)-basedconventional ELISA and was higher than the pAb-based conven-tional ELISA (IC50 was 10 lg/L) [4]. This result indicated that thephage-displayed peptide was an alternative competitor for thedevelopment of immunoassay, and the assay had a higher sensitiv-ity compared with the chemically synthesized competitor assay.

Specificity of phage ELISA

Table 2 shows the CR results for the analogues of thiacloprid.The ELISAs exhibited negligible cross-reactivity (CR < 0.08%) for

Table 2IC50 values and cross-reactivity of a set of analogues structurally related to thiaclopridby phage ELISA.

Compound Structure IC50 (lg/L) CR (%)

Thiacloprid

N Cl

NS

N CN 8.3 100

Acetamiprid

N Cl

N

N CN >10,000 <0.08

Imidacloprid N NO2

HN N

N Cl

>10,000 <0.08

Clothianidin

NH

O2N

N

NHN

S Cl

>10,000 <0.08

Dinotefuran O2NNH

HN

NO

>10,000 <0.08

Nitenpyram

N Cl

N

HNO2N

>10,000 <0.08

Imidaclothiz N NO2

HN N

N

SCl

>10,000 <0.08

Pymetrozine

NNHN

ON

N

>10,000 <0.08

Fig.3. Correlation between the phage ELISA and HPLC for the spiked samples.

Phage-displayed peptidomimetics of thiacloprid / W. Yin et al. / Anal. Biochem. 481 (2015) 27–32 31

the analogues even when their concentrations were up to1000 lg/L. Therefore, the assays exhibited a strong specificity forthiacloprid. Based on the same mAb (3A5), the conventionalELISA also showed no CR with the analogues (data not shown).However, the pAb-based conventional ELISA showed CR with acet-amiprid, imidacloprid, clothianidin, and dinotefuran (the CRs

Table 3Average recoveries of samples spiked with thiacloprid by phage ELISA and HPLC (n = 3).

Sample Spiked concentration (mg/kg) Phage ELISA

Mean recovery ± SD (

Soil 1 91.0 ± 2.80.5 116.3 ± 2.30.1 106.0 ± 4.1

Pear 0.5 91.1 ± 4.90.05 93.6 ± 7.70.025 105.3 ± 5.6

Tomato 0.5 80.3 ± 2.20.05 90.0 ± 7.70.025 107.7 ± 5.0

Cabbage 0.5 81.6 ± 6.00.05 87.0 ± 2.50.025 108.3 ± 10.6

ranged from 0.02 to 0.72%) [4]. The different results were causedby the variant performances of the mAb and pAb, with mAbs oftenexhibiting higher specificity than pAbs in immunoassays.

Analysis of spiked samples

Matrix interference is one of the most common challenges indeveloping an immunoassay. It can be reduced in a number of ways,and dilution with buffer is a commonly used procedure. When theextracts of the soil, pear, tomato, and cabbage were diluted 4-fold(the total dilution was 20-fold: 2-fold by mixing with phage inthe phage ELISA procedure, 2.5-fold during extraction, and 4-foldto remove the matrix interference), the absorbance values of thestandard curves prepared during the matrix dilution were similarto those in the matrix-free buffer (Fig. S3). Therefore, the finalextract of the spiked samples was diluted 4-fold before the phageELISA analysis.

As shown in Table 3, the phage ELISA had acceptable recoveriesfrom 80.3 to 116.3%, and the relative standard deviations (RSDs)ranged from 2.0 to 9.8%. These data demonstrated that acceptablerecoveries were obtained for this immunoassay. The maximumresidue limits (MRLs) of thiacloprid in agro-products set by theMinistry of Codex Alimentarius Commission (CAC) range from0.02 to 10 mg/kg (the MRL of tomato is 0.5 mg/kg). Thus, the phageELISA met the requirement for detecting thiacloprid residues inagricultural samples.

HPLC

%) RSD (%) Mean recovery ± SD (%) RSD (%)

3.1 95.4 ± 2.7 2.92.0 106.2 ± 2.4 2.23.8 105.3 ± 3.7 3.5

5.3 94.2 ± 3.6 3.88.3 104.3 ± 4.3 4.25.3 101.2 ± 4.6 4.6

2.7 90.5 ± 2.1 2.38.5 96.2 ± 5.6 5.84.7 101.6 ± 4.1 4.0

7.4 90.8 ± 5.7 6.22.9 94.5 ± 3.5 3.79.8 99.6 ± 4.2 4.3

32 Phage-displayed peptidomimetics of thiacloprid / W. Yin et al. / Anal. Biochem. 481 (2015) 27–32

Validation of phage ELISA

To confirm the accuracy and applicability of the phage ELISA,the spiked samples were analyzed by HPLC. The average recoveriesby HPLC for all samples ranged from 90.5 to 106.2%, and the RSDswere less than or equal to 6.2% (Table 3). The line equation and cor-relation coefficient obtained by a linear regression of the combinedELISA and HPLC data were y = 1.0267x + 0.0015 and R2 = 0.9931,respectively (Fig. 3). The phage ELISA and HPLC techniques yieldedcomparable results, indicating that the developed phage ELISA wasreliable and accurate.

Conclusions

In this study, a specific mAb that can recognize thiacloprid wasproduced, and a linear 8-residue peptide phage library was con-structed. Six phage-displayed peptides were isolated from the lin-ear 8-residue peptide phage library and a cyclic 8-residue peptidephage library. A phage ELISA was developed to detect thiacloprid inenvironmental and agricultural products using the optimalphage-displayed peptide. Compared with the conventional ELISA,the sensitivity was improved more than 3-fold. The accuracy andprecision of the assay were validated by HPLC, and the agreementbetween the phage ELISA and HPLC was high. Therefore, the con-structed linear 8-residue peptide phage library is a powerful mate-rial for isolating mimotopes of thiacloprid and other pesticides, andthe phage ELISA presented in this study is suitable as a convenientquantitative tool for the rapid screening of thiacloprid in agricul-tural products.

Acknowledgments

This work was supported by the Doctoral Program of HigherEducation Research Fund (20130097120006), the YouthInnovation Fund in Science and Technology of NanjingAgricultural University (KJ2013008), and the National NaturalScience Foundation of China (31301690).

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.ab.2015.04.015.

References

[1] J.E. Casida, K.A. Durkin, Neuroactive insecticides: targets, selectivity,resistance, and secondary effects, Annu. Rev. Entomol. 58 (2013) 99–117.

[2] A. Tapparo, C. Giorio, L. Soldà, S. Bogialli, D. Marton, M. Marzaro, V. Girolami,UHPLC–DAD method for the determination of neonicotinoid insecticides insingle bees and its relevance in honeybee colony loss investigations, Anal.Bioanal. Chem. 405 (2013) 1007–1014.

[3] M.A. Beketov, B.J. Kefford, R.B. Schafer, M. Liess, Pesticides reduce regionalbiodiversity of stream invertebrates, Proc. Natl. Acad. Sci. U.S.A. 110 (2013)11039–11043.

[4] Z.J. Liu, M. Li, H.Y. Shi, M.H. Wang, Development and evaluation of an enzyme-linked immunosorbent assay for the determination of thiacloprid inagricultural samples, Food Anal. Methods 6 (2013) 691–697.

[5] Z.J. Liu, X. Yan, X.Y. Xu, M.H. Wang, Development of a chemiluminescenceenzyme-linked immunosorbent assay for the simultaneous detection ofimidaclothiz and thiacloprid in agricultural samples, Analyst 138 (2013)3280–3286.

[6] Z.J. Liu, X. Yan, X.D. Hua, M.H. Wang, Time-resolved fluoroimmunoassay forquantitative determination of thiacloprid in agricultural samples, Anal.Methods 5 (2013) 3572–3576.

[7] G.M. Shan, H.Z. Huang, D.W. Stoutamire, S.J. Gee, G. Leng, B.D. Hammock, Asensitive class specific immunoassay for the detection of pyrethroidmetabolites in human urine, Chem. Res. Toxicol. 17 (2004) 218–225.

[8] K.C. Ahn, T. Watanabe, S.J. Gee, B.D. Hammock, Hapten and antibodyproduction for a sensitive immunoassay determining a human urinarymetabolite of the pyrethroid insecticide permethrin, J. Agric. Food Chem. 52(2004) 4583–4594.

[9] W.Y. Lee, E.K. Lee, Y.J. Kim, W.C. Park, T. Chung, Y.T. Lee, Monoclonal antibody-based enzyme-linked immunosorbent assays for the detection of theorganophosphorus insecticide isofenphos, Anal. Chim. Acta 557 (2006) 169–178.

[10] X.D. Hua, J.F. Yang, L.M. Wang, Q.K. Fang, G.P. Zhang, F.Q. Liu, Development ofan enzyme linked immunosorbent assay and an immunochromatographicassay for detection of organophosphorus pesticides in different agriculturalproducts, PLoS One 7 (2012) e53099.

[11] F. Felici, A. Luzzago, A. Folgori, R. Cortese, Mimicking of discontinuous epitopesby phage-displayed peptides: II selection of clones recognized by a protectivemonoclonal antibody against the Bordetella pertussis toxin from phage peptidelibraries, Gene 128 (1993) 21–27.

[12] S. Cardozo, A. González-Techera, J.A. Last, B.D. Hammock, G.G. González-Sapienza, Analyte peptidomimetics selected from phage display peptidelibraries: a systematic strategy for the development of environmentalimmunoassays, Environ. Sci. Technol. 39 (2005) 4234–4241.

[13] H.J. Kim, A. González-Techera, G.G. González-Sapienza, K.C. Ahn, S.J. Gee, B.D.Hammock, Phage-borne peptidomimetics accelerate the development ofpolyclonal antibody-based heterologous immunoassays for the detection ofpesticide metabolites, Environ. Sci. Technol. 42 (2008) 2047–2053.

[14] A. Menendez, J.K. Scott, The nature of target-unrelated peptides recovered inthe screening of phage-displayed random peptide libraries with antibodies,Anal. Biochem. 336 (2005) 145–157.

[15] K. Thirumala-Devi, J.S. Miller, G. Reddy, D.V.R. Reddy, M.A. Mayo, Phage-displayed peptides that mimic aflatoxin B1 in serological reactivity, J. Appl.Microbiol. 90 (2001) 330–336.

[16] R.R. Liu, Z. Yu, Q.H. He, Y. Xu, An immunoassay for ochratoxin A without themycotoxin, Food Control 18 (2007) 872–877.

[17] Q.H. He, Y. Xu, Y.H. Huang, R.R. Liu, Z.B. Huang, Y.P. Li, Phage-displayedpeptides that mimic zearalenone and its application in immunoassay, FoodChem. 126 (2011) 1312–1315.

[18] J. Wang, Z.P. Liu, G.Q. Li, J. Li, H.J. Kim, W.L. Shelver, Q.X. Li, T. Xu, Simultaneousdevelopment of both competitive and noncompetitive immunoassays for2,20 ,4,40-tetrabromodiphenyl ether using phage-displayed peptides, Anal.Bioanal. Chem. 405 (2013) 9579–9583.

[19] X.D. Hua, W. Yin, H.Y. Shi, M. Li, Y.R. Wang, H. Wang, Y.H. Ye, H.J. Kim, S.J. Gee,M.H. Wang, F.Q. Liu, B.D. Hammock, Development of phage immuno-loop-mediated isothermal amplification assays for organophosphorus pesticides inagroproducts, Anal. Chem. 86 (2014) 8441–8447.

[20] X.D. Hua, X.F. Liu, H.Y. Shi, Y.R. Wang, H.J. Kim, S.J. Gee, M.H. Wang, F.Q. Liu,B.D. Hammock, Development of a heterologous enzyme-linkedimmunosorbent assay for organophosphorus pesticides with phage-bornepeptide, RSC Adv. 4 (2014) 42445–42453.

[21] Y.R. Wang, H. Wang, P.W. Li, Q. Zhang, H.J. Kim, S.J. Gee, B.D. Hammock, Phage-displayed peptide that mimics aflatoxins and its application in immunoassay,J. Agric. Food Chem. 61 (2013) 2426–2433.

[22] Y. Kishiro, M. Kagawa, I. Naito, Y. Sado, A novel method of preparing rat–monoclonal antibody-producing hybridomas by using rat medial iliac lymphnode cells, Cell Struct. Funct. 20 (1995) 151–156.

[23] R.C. Nowinski, M.E. Lostrom, M.R. Tam, M.R. Stone, W.N. Burnette, Theisolation of hybrid cell lines producing monoclonal antibodies against thep15(E) protein of ecotropic murine leukemia viruses, Virology 93 (1979) 113–126.

[24] G.M. Shan, I. Wengatz, D.W. Stoutamire, S.J. Gee, B.D. Hammock, An enzyme-linked immunosorbent assay for the detection of esfenvalerate metabolites inhuman urine, Chem. Res. Toxicol. 12 (1999) 1033–1041.

[25] R.Y. Jin, Y.R. Guo, C.M. Wang, J.X. Wu, G.N. Zhu, Development of a bispecificmonoclonal antibody to pesticide carbofuran and triazophos using hybridhybridomas, Food Sci. 74 (2009) T1–T6.

[26] Q.L. Lang, F. Wang, L. Yin, M.J. Liu, V.A. Petrenko, A.H. Liu, Specific probeselection from landscape phage display library and its application in enzyme-linked immunosorbent assay of free prostate-specific antigen, Anal. Chem. 86(2014) 2767–2774.

[27] X.K. Ding, W. Zhang, D. Cheng, J.Z. He, K.L. Yang, Oligopeptides functionalizedsurface plasmon resonance biosensors for detecting thiacloprid andimidacloprid, Biosens. Bioelectron. 35 (2012) 271–276.

[28] R. Reverberi, L. Reverberi, Factors affecting the antigen–antibody reaction,Blood Transfus. 5 (2007) 227–240.

Supporting information

Conventional ELISA

The concentrations of antibody and coating antigen were optimized by checkerboard titration. The

conventional ELISA was performed as follow. Microtiter plates were coated with optimized

concentrations of hapten-ovalbumin (OVA) in carbonate–bicarbonate buffer (50 mM, pH 9.6) by

incubating for 2 h. Plates were then blocked by incubating with 1% OVA in PBS (200 μL/well) for

1.5 h. Aliquots of 50 μL per well of analyte dissolved in working solution (0.2 M pH 7.4 PBS

containing 5% methanol) and 50 μL per well of antibody diluted with working solution were

added to the blocked plate. After incubating for 1 h, 100 μL per well of diluted (1:20,000) goat

anti-mouse IgG-HRP was added to the plate. The mixture was incubated for 1 h, followed by the

addition of 100 μL per well of a TMB solution (100 μL of 1% hydrogen peroxide and 400 μL of

0.6% TMB in dimethyl sulfoxide added to 25 mL of citrate acetate buffer, pH 5.5). After

incubating for 15 min, the reaction was stopped by adding 50 μL of 2 M H2SO4 and the solution

absorbance was measured at 450 nm. All incubations were performed at 37 °C and the plates were

washed five times with PBST (10 mM PBS containing 0.05% Tween 20, pH 7.4) after each

incubation, unless otherwise specified.

Table S1 Average IC50 and Amax/IC50 values of the phage ELISA in PBS solutions

containing different concentrations of NaCl.

Ionic strength (M) IC50 (µg/L) Amax Amax/IC50

0.035 84.6 2.130 0.025

0.07 63.0 2.250 0.036

0.14 11.8 2.408 0.204

0.2 12.1 2.410 0.199

0.4 12.4 2.427 0.196

0.8 13.9 2.487 0.179

1.6 22.9 2.536 0.111

3.2 35.8 2.672 0.075

Table S2 Average IC50 and Amax/IC50 values of the phage ELISA in PBS solutions of

various pH.

pH IC50(µg/L) Amax IC50/Amax

4.5 23.9 2.456 0.103

5.5 18.5 2.455 0.133

6.5 12.8 2.481 0.194

7.4 12.5 2.440 0.195

8.5 9.6 1.942 0.202

9.5 8.1 0.536 0.066

Fig. S1. A, screening of positive clones by phage ELISA from a linear 8-residue peptide

phage library; B, screening of positive clones by phage ELISA from a cyclic 8-residue

peptide phage library.

Fig. S2. Effect of methanol on the phage ELISA. Thiacloprid was run in PBS solutions

containing different concentrations of methanol (n=3).

Fig. S3. Standard inhibition curves of thiacloprid in PBS and different matrices by phage

ELISA (n=3). The extracts of soil, pear, tomato and cabbage samples were diluted 4-fold.