Destabilization of IL-8 mRNA by Anthrax Lethal Toxin:

Demonstration of the Requirement for TTP and Examination of its Cellular Interactions

by

M.C. Edith Chow

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy

Laboratory Medicine and Pathobiology University of Toronto

© Copyright by M.C. Edith Chow (2011)

ii

Destabilization of IL-8 mRNA by Anthrax Lethal Toxin: Demonstration of the Requirement for TTP and Examination of its Cellular Interactions

M.C. Edith Chow

Doctor of Philosophy

Department of Laboratory Medicine and Pathobiology University of Toronto

2011

Abstract

Control of mRNA stability is an important aspect in the regulation of gene expression. A

well studied signal for rapid transcript decay in mammalian cells is the AU-rich element (ARE),

which is found in the 3’ untranslated region (UTR) of many labile transcripts. These sequence

elements confer destabilization of transcripts by binding to AU-binding proteins (AUBPs) that

can recruit cellular decay enzymes. The stability of ARE-containing mRNAs can be regulated

by extracellular stimuli, which allows for cells to adapt to the changing environment. AREs are

found in many transcripts that encode for inflammatory genes, including TNFα, GM-CSF, and

IL-8. Pathogens evolve and devise mechanisms to subvert the immune response of the host to

aid in its infection. Bacillus anthracis is one such infectious agent that can disable numerous

arms of the host immune response. Its secreted toxin, anthrax lethal toxin (LeTx), causes the

accelerated decay of the IL-8 mRNA. IL-8 is a dual function cytokine and chemokine that can

recruit and activate neutrophils at the site of infection. Through the inactivation of MAPK

pathways, LeTx activity causes the destabilization of IL-8 transcripts through its ARE. In this

thesis, I show that an AUBP, TTP, is dephosphorylated by LeTx and MAPK inhibitors, and

knock-down of its expression stabilized IL-8 transcripts. LeTx activity also increased the

iii

colocalization of TTP to P-bodies, cytoplasmic sites concentrated with RNA decay enzymes.

This suggests that the post-translational modification of TTP induced by LeTx led to its

enhanced destabilization function. Identified TTP-associated proteins, non-muscle myosin heavy

chain 9 (myosin-9) and HSC-70, were examined for their role in IL-8 transcript decay. Knock-

down of each protein led to a slower rate of IL-8 mRNA destabilization. However, treatment of

LeTx continued to mediate accelerated destabilization of IL-8 in these siRNA-transfected cells.

This suggests that LeTx, myosin-9, and HSC-70 modulate the destabilization function of TTP

independently.

iv

Acknowledgements

It is a pleasure to thank all the people who have supported and inspired me during my

doctoral study.

First and foremost, I would like to express my deepest gratitude to my supervisor, Dr.

Jeremy Mogridge. If not for his patience, guidance, and encouragement, the work presented in

this thesis would not be possible. I credit Dr. Mogridge for my growth both as a scientist and as

a person, and I am forever grateful for this enriching experience.

I am also indebted to my colleagues in the Mogridge lab for providing a stimulating work

environment. I am thankful to Altaf, Brad, Kris, Kuo-Chieh, Mandy, Melissa, Mia, Sarah,

Stephanie, and Vineet. I especially want to express my gratitude to Mandy, Kuo-Chieh, and

Sarah for technical help and advice.

My sincere thanks to members of my advisory committee: Drs. John Brumell, Philip

Marsden, and Sandy Der for their time in reviewing my work and providing constructive

criticism. I am appreciative of OSOTF for supporting me through the Norman Bethune Award.

I also wish to thank my friends, my Varsity Blues family, and Dr. Ricky Chan for their care and

support; without them it would have be difficult to stay positive and maintain a balanced lifestyle

during my graduate study. Lastly, I thank my parents who have supported me unequivocally

through all my endeavors.

v

Table of Contents 1.0 Introduction ............................................................................................................................. 1

1.1 Anthrax Toxin ............................................................................................................... 2

1.1.1 Assembly and internalization of anthrax toxins ............................................. 2

1.1.2 Edema toxin ................................................................................................... 4

1.1.3 Lethal toxin .................................................................................................... 5

1.3.1.1 Immune subversion by lethal toxin activity .................................... 6

1.2 Regulation of mRNA stability ...................................................................................... 8

1.2.1 Sequence determinants ................................................................................... 9

1.2.2 Trans-acting regulatory proteins .................................................................. 10

1.2.2.1 HuR ............................................................................................... 11

1.2.2.2 TIAR ............................................................................................. 12

1.2.2.3 KSRP ............................................................................................. 12

1.2.2.4 TTP ............................................................................................... 13

1.2.3 Regulation of IL-8 mRNA stability ............................................................. 16

1.2.4 Mechanisms of mRNA decay ...................................................................... 18

1.2.4.1 Exosome ........................................................................................ 19

1.2.4.2 P-bodies ......................................................................................... 22

1.2.4.3 Stress granules .............................................................................. 25

1.2.4.4 microRNAs ................................................................................... 29

1.3 Thesis summary .......................................................................................................... 31

2.0 Materials and methods ......................................................................................................... 33

2.1 Cell culture .................................................................................................................. 33

2.2 Proteins ....................................................................................................................... 33

2.3 Plasmid constructs ...................................................................................................... 33

2.4 Western blotting .......................................................................................................... 36

2.5 RNA purification and quantification .......................................................................... 37

2.6 siRNA transfection ...................................................................................................... 38

2.7 Fluorescence microscopy ............................................................................................ 38

2.8 Tandem affinity purification ....................................................................................... 39

vi

2.9 Co-immunoprecipitation assay ................................................................................... 39

3.0 Anthrax lethal toxin promotes dephosphorylation of TTP and formation of processing

bodies ............................................................................................................................................ 41

3.1 Summary ..................................................................................................................... 41

3.2 Results ......................................................................................................................... 42

3.2.1 LeTx accelerates IL-8 mRNA decay through the 3’ UTR ........................... 42

3.2.2 IL-8 3’UTR contains AU-rich element that confers mRNA instability ...... 43

3.2.3 Inhibition of ERK1/2, p38, and JNK MAPK pathways are required for IL-8

mRNA destabilization .................................................................................. 46

3.2.4 TTP is required for LeTx-mediated IL-8 destabilization ............................. 47

3.2.5 Treatment of LeTx or MAPK inhibitors leads to dephosphorylation of TTP

............................................................................................................................... 50

3.2.6 Increase of visible P-bodies in cells treated with LeTx ............................... 51

3.2.7 Increased localization of TTP to P-bodies in cells treated with LeTx ......... 54

3.3 Discussion ................................................................................................................... 56

4.0 Identification of TTP associated proteins and their role in IL-8 mRNA destabilization ...

....................................................................................................................................................... 59

4.1 Summary ..................................................................................................................... 59

4.2 Results ......................................................................................................................... 60

4.2.1 Tandem affinity purification of TTP associated proteins ............................. 60

4.2.2 LeTx treatment does not affect myosin-9 and HSC-70 binding to Flag-TTP ..

............................................................................................................................... 61

4.2.3 Binding of myosin-9 and HSC-70 to Flag-TTP is not RNA-dependent ...... 63

4.2.4 Knock-down of myosin-9 or HSC-70 stabilizes IL-8 mRNA ...................... 64

4.2.5 Decreased expression of TTP protein upon myosin-9 knock-down ............ 67

4.2.6 The head domain of myosin-9 is sufficient for TTP binding ....................... 69

4.3 Discussion ................................................................................................................... 69

5.0 Discussion ............................................................................................................................... 73

vii

5.1 Summary of thesis findings ........................................................................................ 73

5.2 Future directions ......................................................................................................... 74

5.2.1 Involvement of P-bodies in LeTx mediated decay of IL-8 mRNA .............. 74

5.2.2 Mapping the interaction between TTP and myosin-9 .................................. 76

5.2.3 Importance of NM IIA motility function in its regulation on TTP function ....

............................................................................................................................... 77

5.2.4 Role of TTP in MYH9 diseases .................................................................... 79

5.3 Conclusions ................................................................................................................. 80

References .................................................................................................................................... 82

viii

List of Abbreviations

ANTXR1 Anthrax toxin receptor 1 ANTXR2 Anthrax toxin receptor 2 ARE AU-rich element AUBP AU-binding protein CMG2 Capillary morphogenesis protein 2 CREB cAMP responsive element binding protein cAMP cyclic AMP EF Edema factor FRAP Fluorescence recovery after photobleaching GM-CSF Granulocyte macrophage – colony stimulating factor HUVECs Human umbilical vein endothelial cells IL Interleukin KO Knockout LeTx Lethal toxin LF Lethal factor MAPKs Mitogen activated protein kinases MAPKKs Mitogen activated protein kinase kinases MAPKKKs Mitogen activated protein kinase kinase kinases miRNA microRNA MK2 Mitogen activated protein kinase-activated protein kinase 2 MS Mass spectrometry Myosin-9 Non-muscle myosin heavy chain 9 NM IIA Non-muscle myosin IIA PA Protective antigen PABP Poly(A)-binding protein PARN Poly(A) ribonuclease PKA Protein kinase A RISC RNA-induced silencing complex RNAi RNA interference siRNA Small interfering RNA SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis TEM8 Tumor endothelial marker protein 8 TIA-1 T-cell internal antigen 1 TIAR T-cell internal antigen 1 related TNFα Tumor necrosis factor alpha UV Ultraviolet wt Wild-type

ix

List of Figures

Figure 1.1: Model of anthrax toxin internalization ........................................................................ 3

Figure 1.2: Degradation of mRNA in eukaryotic cells ................................................................ 19

Figure 1.3: Model of the exosome ............................................................................................... 20

Figure 1.4: Model for cytoplasmic flow of mRNAs to P-bodies and stress granules ................. 28

Figure 3.1: LeTx accelerates IL-8 mRNA decay through the 3’ UTR ........................................ 43

Figure 3.2: Identification of a region within the IL-8 3’UTR that confers mRNA instability .... 45

Figure 3.3: Decay analysis of IL-8 mRNA in response to pharmacological inhibitors ............... 47

Figure 3.4: Involvement of AUBPs in IL-8 mRNA stability ....................................................... 49

Figure 3.5: Effect of LeTx on P-body formation and TTP localization ...................................... 53

Figure 3.6: LeTx increases recruitment of TTP to P-bodies in HeLa cells ................................. 55

Figure 4.1: Isolation of TTP-associated proteins ......................................................................... 61

Figure 4.2: Dependence of LeTx and RNA on TTP binding to myosin-9 and HSC-70 .............. 62

Figure 4.3: Effect of myosin-9 siRNA knock-down on IL-8 mRNA destabilization .................. 65

Figure 4.4: Effect of HSC-70 siRNA knock-down on IL-8 mRNA destabilization .................... 66

Figure 4.5: Effect of myosin-9 siRNA knock-down on TTP mRNA and protein expression ..... 68

Figure 4.6: Myosin-9 head domain is sufficient for interaction with TTP .................................. 69

Figure 5.1: Effect of blebbistatin and latrunculin treatment on IL-8 mRNA destabilization ...... 79

x

List of Tables

Table 1.1: Protein components of cytoplasmic exosome ............................................................21

Table 1.2: Protein components of human P-bodies ....................................................................23

Table 1.3: Protein components of stress granules .......................................................................27

1

Chapter 1

Introduction The negative connotation associated with anthrax was thrust into the spotlight in 2001

when anthrax endospores were dispersed through the postal system in the United States. The

causative agent of anthrax is Bacillus anthracis, a Gram-positive bacterium that belongs to the

Bacillus cereus group species commonly found in the soil (Koehler, 2009). The properties of B.

anthracis that make it a convenient candidate for a biological weapon is its ability to remain as

dormant spores that can withstand and survive the harshest conditions for decades. Apart from

its role in bio-terrorism, anthrax is a zoonotic disease that mainly afflicts herbivores that ingest or

inhale spores from soil while grazing. Humans can be infected by making contact with infected

animals, and is more common in developing countries (Oncu and Sakarya, 2003). Once

internalized into the host, either through cutaneous lesions, inhalation, or ingestion, the spores

are usually phagocytosed by macrophages. In most instances of cutaneous infections, spores

germinate locally and secrete a toxin that causes edema and necrosis, and the disease usually

resolves spontaneously. Gastrointestinal and inhalational anthrax are the more fatal forms of the

disease. In these cases, endospores germinate inside the macrophages en route to regional lymph

nodes and become vegetative bacteria (Guidi-Rontani et al., 1999). The bacteria are then

released from macrophages, multiply quickly and produce exo-toxins. The infected host usually

suffers fatality as a result of massive septicemia and toxemia (Collier and Young, 2003; Mourez

et al., 2002). Many strategies of evasion of the host immune response by this bacterium have

been elucidated, such as the subversion of dendritic cell maturation by the toxin (Agrawal et al.,

2003). Here, I describe another means by which anthrax lethal toxin interferes with the host

immune response by downregulating the expression of an inflammatory cytokine.

2

1.1 Anthrax Toxin

Anthrax toxin belongs to a family of binary toxins, which consists of at least two protein

components that assemble to form toxic complexes but are not toxic on their own. One of the

protein components is the enzymatic element of the toxin, and the other is the receptor binding

and pore forming element. Bacillus anthracis, the causative agent of anthrax, encodes three

toxin polypeptides that comprise anthrax toxin. Protective antigen (PA) is the receptor binding

moiety, which binds to two ubiquitously expressed cellular receptors, thereby facilitating the

delivery of the catalytic moieties of the toxin into the cell (Scobie et al., 2003). Immunization or

administration of antibodies against PA protects hosts from lethality, hence the naming of this

toxin component. Lethal factor (LF) and edema factor (EF) are the enzymatic component of the

toxin, and alter different cellular signaling pathways once translocated into the cytoplasm.

1.1.1 Assembly and internalization of anthrax toxins

During the vegetative growth of Bacillus anthracis, PA, LF, and EF are synthesized and

released into the extracellular milieu independently. The intoxication cycle is initiated when PA

binds to either anthrax toxin receptor 1 (ANTXR1), also known as tumor endothelial marker

protein 8 (TEM8), or anthrax toxin receptor 2 (ANTXR2), also known as capillary

morphogenesis proteins 2 (CMG2) (Scobie et al., 2003; Bradley et al., 2001). PA, an 83 kDa

protein, is then cleaved by a furin-like protease (Gordon et al., 1995) (Figure 1.1). The receptor-

bound C-terminal fragment of PA then self-associates and oligomerizes into a heptamer or

octamer, creating binding sites for a maximum of three or four EF and/or LF molecules

respectively (Kintzer et al., 2009; Cunningham et al., 2002; Mogridge et al., 2002). This

complex is then internalized by clathrin-dependent endocytosis and delivered to endosomes. The

pH drop in early endosomes triggers a conformational change in the PA heptamer, resulting in

3

the formation of a cation-selective pore (Qa'dan et al., 2005). EF and LF are also unfolded in the

acidic environment, which allows the enzymes to be translocated through the PA pore into the

cytosol and exert their toxic effects (Krantz et al., 2004).

Figure 1.1: Model of anthrax toxin internalization. PA binds to mammalian receptors ANTXR1/2 (ATR) and is cleaved by furin-like proteases, releasing a 20 kDa subunit (PA20). The remaining 63 kDa PA (PA63) bound to the receptor oligomerizes into heptamers or octamers which allows binding of EF or LF. The assembled toxin is endocytosed and trafficked to an endosomal compartment. Once the pH decreases in the endosome, PA undergoes a conformational change into a pore, allowing translocation of LF and EF to the cytosol. EF catalyzes the conversion of ATP to cAMP. LF cleaves members of the MAPKK family and other potential targets. (Reprinted, with permission, from Trends in Microbiology, Volume 10 ©2002 by Elsevier Science Ltd.)

4

1.1.2 Edema factor

Edema toxin (EdTx) is the combination of PA and EF. EF is an 89 kDa protein and was

named based on its ability to cause cutaneous edema and death in experimental animals injected

with EdTx (Stanley et al., 1960; Smith and Keppie, 1954). More than two decades later, EF was

characterized as a calcium and calmodulin dependent adenylate cyclase, converting intracellular

ATP to cyclic AMP (cAMP) (Leppla, 1982). The same study revealed that EF has a 1000-fold

higher catalytic rate compared to mammalian calmodulin dependent adenylate cyclases. Since

then, the cloning and recombinant expression of the EF gene has permitted further studies of its

role in anthrax pathogenesis.

cAMP is a secondary messenger involved in a plethora of signaling events. Signalling by

cAMP can occur through the activation of protein kinase A (PKA), which itself can activate

various transcription factors including the cAMP responsive element binding protein (CREB).

Interestingly, both ANTXRs contain CREs, thereby allowing for CREB binding and formation of

the transcription complex (Maldonado-Arocho et al., 2006). This results in increased expression

of ANTXRs in EF-treated monocyte-derived cells, and leads to a subsequent increase of LF

internalization and increased sensitivity to cytolytic effects of LF (Maldonado-Arocho et al.,

2006).

EdTx can also impair the functions of various immune cells. For example, neutrophils,

which are phagocytes that internalize and kill pathogens with reactive oxygen species, are targets

of EdTx. An increased cAMP concentration in neutrophils treated with EdTx was found to be

associated with inhibition of phagocytosis (O'Brien et al., 1985). In addition, in vitro treatment

of T lymphocytes with EdTx interferes with the signaling cascade initiation by the T cell

receptor, thereby suppressing cell activation and proliferation (Paccani et al., 2005). In the

mouse macrophage cell line RAW 264.7, TNFα production was inhibited, along with the

5

phagocytic ability of the macrophages (Comer et al., 2006). TNFα, a pro-inflammatory cytokine

that helps to combat bacterial infections, was also inhibited in EdTx treated human monocytes as

a result of increased levels of cAMP (Hoover et al., 1994). Collectively, these data indicate that

by increasing cellular cAMP levels, EdTx impairs the functions of key white blood cells,

allowing the bacteria to flourish within the host without host inhibitions.

1.1.3 Lethal factor

LF is a 90 kDa protein whose catalytic function was discovered by identification of the

HExxH zinc metalloprotease consensus sequence in the C-terminal domain (Klimpel et al.,

1994). Mutations that prevent zinc binding to LF abolishes LeTx activity in macrophage cell

lines and in rats, indicating the requirement of zinc for LeTx activity (Brossier et al., 1999;

Klimpel et al., 1994). The N-terminal domain of LF has high sequence similarity to that of EF,

and both competitively bind to the identical PA site (Cunningham et al., 2002; Mogridge et al.,

2002). The cellular targets of LF, mitogen activated protein kinase kinase (MAPKK)1 and

MAPKK2, were identified by two independent studies in the same year (Duesbery et al., 1998;

Vitale et al., 1998). Soon after, MAPKK 3, 4, 6, and 7 were identified to be targets of LF (Vitale

et al., 2000; Pellizzari et al., 1999). The MAPKKs are part of a three-component

phosphorylation cascade. This signalling pathway can be activated by various cellular stimuli,

including growth factors, extracellular stress, and inflammatory cytokines (Takekawa et al.,

2005; Chang and Karin, 2001). These signals activate MAPKK kinases (MAPKKK), which

phosphorylate and activate MAPKKs, which in turn phosphorylate and activate downstream

mitogen activated protein kinases (MAPKs). The MAPKs can then phosphorylate cellular

targets to mediate an appropriate response to the stimuli. Three MAPK members are affected by

LF activity: ERK 1/2, which are downstream of MAPKKs 1 and 2; p38 MAPK isoforms, which

6

are downstream of MAPKKs 3 and 6; and JNK 1,2, and 3, which are downstream of MAPKKs 4

and 7. LF cleaves the N-terminal proline-rich region of susceptible MAPKKs, which is crucial

for docking to downstream cognate MAPKs, thereby inhibiting MAPK phosphorylation

(Bardwell et al., 2004).

1.1.3.1 Immune subversion by lethal toxin activity

MAPK pathways play important roles in immune modulation. For example, transcription

factors involved in lymphocyte responses to antigen are activated as a consequence of

phosphorylation by MAPKs (Ashwell, 2006). Therefore, it is expected that LeTx’s inhibition of

MAPKs would interfere with at least certain aspects of the host immune response. Indeed,

studies revealed that LeTx alters the function of many human immune cells. Dendritic cells

detect microbial pathogen-associated molecular patterns, engulf pathogens and display peptide

fragments from the pathogen on the surface of the cell for presentation to T-cells, which are then

activated and initiate the adaptive immune response. However, there is evidence that LeTx

disrupts the antigen presenting function of dendritic cells by inhibiting maturation, thereby

blocking a critical interface between innate and adaptive immunity (Agrawal et al., 2003).

Furthermore, the amount of pro-inflammatory cytokines released is decreased, which can be

mimicked by addition of MAPK inhibitors, suggesting that cleavage of MAPKKs is essential for

this effect. Studies also demonstrated that EdTx targets distinct dendritic cell cytokine secretion

pathways that are critical for innate resistance and adaptive immunity (Tournier et al., 2005).

The concerted effort between LeTx and EdTx in targeting dendritic cells could perhaps be an

indication of the importance of inhibiting the function of these cells to facilitate an anthrax

infection. Macrophages, another arm of innate immunity, are also impacted by LeTx as their

7

production of certain pro-inflammatory cytokines is reduced when exposed to LeTx (Erwin et

al., 2001; Pellizzari et al., 1999).

LeTx was found to significantly retard neutrophil motility and impair chemokinesis

(During et al., 2005). Neutrophils are another type of white blood cell which act as a bridge

between innate and adaptive immunity. IL-8 recruits and activates neutrophils to the site of

infection from the blood, where they phagocytose and kill pathogens through the release of

granule enzymes, superoxide, H2O2, and a variety of bioactive peptides (Rajarathnam et al.,

1994; Baggiolini and Clark-Lewis, 1992). The importance of neutrophils in combating microbial

infections can be illustrated by the hematological disorder known as neutropenia, where patients

have an abnormally low amount of neutrophils and are extremely susceptible to bacterial

infections (Rezaei et al., 2009). Impairment of neutrophil migration to the site of infection may

play a key role in the progression of anthrax infection, as these cells are capable of engulfing and

killing B. anthracis spores through small antimicrobial peptides found in human neutrophil

granules (Mayer-Scholl et al., 2005).

T-cells and B-cells are major components of adaptive immunity, and both are directly

affected by LeTx activity. During normal infection, naïve CD4+ T-cells are activated by antigen-

presenting cells such as dendritic cells, and they can differentiate into antigen-specific helper T-

cells. These helper T-cells initiate the production of antigen specific antibodies by B-cells and

also produce cytokines important in fighting infections. LeTx not only inhibits the proliferation

of CD4+ T-cells, but also production of pro-inflammatory cytokines (Fang et al., 2005; Paccani et

al., 2005). B-cell proliferation and its immunoglobulin production are also suppressed by LeTx

activity (Fang et al., 2006).

Together, LeTx seems to be highly evolved to combat the human immune response, as it

exhibits inhibitory effects on innate immunity, adaptive immunity, and on mediators of the

8

interface between these arms of host immunity. The cumulative effect of these immune

suppressive mechanisms facilitates the proliferation of B. anthracis with little intervention from

the infected host.

1.2 Regulation of mRNA stability

Regulation of mRNA decay rates in eukaryotic cells is a major determinant of the

abundance of mRNA transcripts in the cell. Decay rates of each mRNA species differ and the

half-life, defined as the time it takes to degrade half of the transcripts of that mRNA species, can

range from a few minutes to a few days. The half-life of individual mRNA species can change

in response to various physiological changes in the cell or to extracellular stimuli, but faulty

control of mRNA stability can lead to various diseases, such as cancer, chronic inflammatory

responses, and coronary disease (Al-Souhibani et al., 2010; Liang et al., 2009; Young et al.,

2009; Suswam et al., 2008; Suswam et al., 2005b; Carballo et al., 1998). Regulation of mRNA

stability not only exists to control gene expression, but also functions as a quality control

mechanism in mRNA biogenesis. Transcripts encoded by nonsense containing alleles, which

encode premature stop codons, are targeted for rapid degradation. Known as nonsense-mediated

decay, this mechanism prevents the generation of aberrant mRNAs that can potentially be

detrimental to cell function (Amrani et al., 2006; Maquat and Carmichael, 2001). Other factors

that can influence the stability of an mRNA are cis- and trans-acting elements. Trans-acting

determinants are factors that interact with the mRNA and influence its stability. Cis-acting

elements can be structures that interfere with the actions of trans-factors, or sequence

determinants that are recognition sites for these factors.

9

1.2.1 Sequence and structural determinants

Nearly all eukaryotic mRNAs have an 5’ 7-methylguanosine cap structure incorporated

co-transcriptionally, and a 3’ poly(A) tail added after transcription. These modifications provide

for efficient nuclear export, translation, and are also crucial in maintaining transcript stability

(Cougot et al., 2004b; Kuhn and Wahle, 2004). The 5’ cap structure blocks the enzymatic action

of 5’ to 3’ exoribonucleases. The poly(A) tail binds to poly(A)-binding proteins (PABPs) in the

cytoplasm, which contributes to translation efficiency and mRNA stability (Kuhn and Wahle,

2004). Another example of a structural feature that affects mRNA stability is the iron-responsive

element (IRE), which consists of a stem and loop structure with an affinity for the iron-

regulatory protein. The IRE is in the 3’ UTR of the transferrin receptor mRNA and binding of

the iron-regulatory protein to this structure stabilizes the mRNA (Pantopoulos, 2004).

The best studied and most prevalent sequence determinant of mRNA stability is the

adenosine and uridine-rich element (ARE). Often found in the 3’ UTR of cytokines and proto-

oncogenes, AREs range in size from 50 to 150 nucleotides and usually consist of one or several

AUUUA pentamers within an adenosine and uridine rich region (Barreau et al., 2006; Chen and

Shyu, 1995). AREs were first observed in the 3’ UTR of tumor necrosis factor α (TNFα)

mRNA, granulocyte-macrophage-colony-stimulating factor (GM-CSF), and other cytokine and

oncogenes (Caput et al., 1986; Shaw and Kamen, 1986a). The first evidence that AREs can

function as a potent mRNA destabilizing element was by the insertion of ARE-containing 3’

UTR of GM-CSF into the 3’ UTR of β-globin mRNA, making the otherwise stable β-globin

mRNA unstable (Shaw and Kamen, 1986a). Since then, many other mRNAs bearing such

elements were discovered, and researchers have generated databases that utilize a bioinformatics

approach to predict the presence and functionality of AREs in vertebrate mRNAs (Gruber et al.,

2010; Bakheet et al., 2001). With the sudden onslaught of newly identified AREs, many studies

10

have attempted to classify the discovered AREs based on the number and context of the AUUUA

pentamer (Bakheet et al., 2001; Wilusz et al., 2001; Chen and Shyu, 1995). However, further

studies revealed that there is a higher degree of complexity in ARE-mediated mRNA decay,

indicating that the classifications do not necessarily reflect function of AREs. Although

AUUUA pentamers have been linked to mRNA stability, the presence of the AUUUA motif

does not guarantee a destabilizing function (Chen and Shyu, 1995; Chen and Shyu, 1994; Shaw

and Kamen, 1986b). In addition, sequences flanking AREs can influence the stability of the

mRNA (Stoecklin et al., 2003), and secondary structures have been proposed to promote binding

to trans-acting factors (Gillis and Malter, 1991).

The conservation of AREs between species suggests a functional importance of this

element (Bevilacqua et al., 2003). For example, the sequence similarity between murine and

human IL-3 is 93% in the AREs compared to 45% in the coding region (Dorssers et al., 1987).

The bcl-2 ARE also has conservation between human, mouse, chicken, and even nematode

(Schiavone et al., 2000).

1.2.2 Trans-acting regulatory proteins

AREs promote the rapid deadenylation and subsequent decay of a transcript (Chen and

Shyu, 1995). Some AREs within certain mRNAs have the ability to affect mRNA stability in

response to stimuli, which is mediated through the binding of trans-acting factors to the ARE

which subsequently influences mRNA decay. Such factors that bind to AREs with high

affinities are named AU-binding proteins (AUBPs). Some AUBP members reside only in the

cytoplasm, while others are nuclear and still others shuttle between both compartments. A

plethora of studies was undertaken by various groups to elucidate the functional significance of

AUBPs binding to AREs and how exactly these interactions can alter the rate of mRNA decay.

11

Some may interact directly with the RNA decay machinery, thereby triggering the degradation of

bound mRNA, while others may not be able to interact with the decay machinery and thus

protect the transcript from degradation. In addition, multiple AUBPs can bind to an mRNA, and

competitive binding between AUBPs can occur. The fate of the transcript may rest on the

binding affinities of competitor AUBPs that may be modulated under the influence of different

stimuli (Suswam et al., 2005b). Below, a select few AUBPs are described.

1.2.2.1 HuR

HuR belongs to the ELAV protein family, which are RNA binding proteins that are

essential in Drosophila for neural development (Campos et al., 1985). It is ubiquitously

expressed in all cell types (Good, 1995; King et al., 1994) and is predominantly localized in the

nucleus of unstimulated cells. HuR translocates to the cytoplasm upon stimuli such as serum, T-

cell activation, ultraviolet (UV) light, or lipopolysaccharides (Li et al., 2002; Wang et al., 2000;

Atasoy et al., 1998). HuR may bind to target mRNA in the nucleus and export it to the

cytoplasm, increasing the cytoplasmic concentration of that mRNA species but not affecting its

stability (Prechtel et al., 2006). But HuR is generally implicated in binding to and stabilizing

mRNAs in the cytoplasm (Keene, 1999; Peng et al., 1998). Through analysis of HuR bound

mRNAs, a consensus binding sequence of 17 to 20 bases rich in uracils was identified. Novel

mRNA targets of HuR were identified based on this consensus sequence, but it should be noted

that several mRNAs that bind to HuR do not contain the consensus sequence (Lopez de Silanes

et al., 2004). Over-expression of HuR was found to be able to stabilize GM-CSF, TNF-α, IL-3,

and COX-2 (Wang et al., 2006; Dixon et al., 2001; Fan and Steitz, 1998). The exact mechanism

by which HuR directs stabilization of target transcripts has yet to be clearly defined, but there is

some evidence that HuR blocks the decay of deadenylated mRNA, and hence stabilizes

12

deadenylated intermediates (Peng et al., 1998). In addition, HuR’s inability to recruit the

exosome (see 1.2.3) is consistent with its transcript stabilizing functions (Young et al., 2009;

Dormoy-Raclet et al., 2007; Dixon et al., 2001; Fan and Steitz, 1998).

1.2.2.2 TIAR

T-cell internal antigen related protein (TIAR), similar to HuR, shuttles between the

nucleus and cytoplasm. While it is concentrated in the nucleus at steady state, stimuli such as

heat shock, arsenite treatment, or exogenous triggers of apoptosis cause TIAR to accumulate in

the cytoplasm (Kedersha et al., 1999; Taupin et al., 1995). Furthermore, TIAR acts downstream

of the stress-induced phosphorylation of eIF-2α, leading to the recruitment of untranslated

mRNAs to stress granules, sites that contain translationally stalled mRNAs (see section 1.2.4.3)

(Suswam et al., 2005a). TIAR binds avidly to uridine-rich sequences in mRNAs and was found

to be a component of a translational repressor complex that binds to the ARE of TNFα (Gueydan

et al., 1999) and MYC mRNA (Liao et al., 2007). The function of TIAR is further discussed in

section 1.2.3.3.

1.2.2.3 KSRP

KSRP (K homology-type splicing regulatory protein), contains four copies of the RNA

binding K homology (KH) domain (Siomi et al., 1993). The KH domain interacts with the ARE

of iNOS and directs the destabilization of the transcript (Linker et al., 2005), seemingly by

bridging the bound transcript to polyA ribonuclease (PARN) and the exosome (Chou et al.,

2006; Briata et al., 2005; Gherzi et al., 2004). In addition, depletion of KSRP results in

stabilization of IL-2, c-fos, and TNFα mRNA (Linker et al., 2005; Gherzi et al., 2004). There is

evidence that p38 regulates KSRP by phosphorylation through a KH domain, as the

13

phosphorylated form exhibits reduced binding to ARE-containing mRNA (Briata et al., 2005).

Recently, it was found that phosphorylation of KSRP leads to the unfolding of the same KH

domain, creating a site for 14-3-3ζ (Diaz-Moreno et al., 2009). The 14-3-3 proteins are widely

expressed and highly conserved. They bind to phosphoserine containing motifs, and in doing so,

exert various modes of regulation on the protein, including altering cellular localization (Bridges

and Moorhead, 2005; Muslin and Xing, 2000). The interaction between KSRP and 14-3-

3ζ leads to the nuclear localization of KSRP, sequestering it from its mRNA degradation activity

in the cytoplasm (Diaz-Moreno et al., 2009).

1.2.2.4 TTP

Containing three characteristic PPPPG motifs in the primary sequence, the appropriately

named tristetraprolin (TTP) belongs to a family of CCCH tandem zinc-finger proteins

(Blackshear, 2002). It was first discovered by its rapid increase in transcriptional level in

response to insulin (Lai et al., 1990). This immediate early response behavior from TTP was

also seen in macrophages stimulated with lipopolysaccharide (LPS) or TNFα (Carballo et al.,

1998). The function of TTP was not known until TTP knockout (KO) mice were generated,

which suffered from a complex phenotype including dermatitis, conjunctivitis, destructive

arthritis, and autoimmunity (Taylor et al., 1996). This phenotype was later found to be due to the

excess of circulating TNFα, as repeated injections of antibodies to TNFα prevented the

pathogenesis of this condition (Carballo et al., 1997). The same group demonstrated that TTP

binds to the ARE of TNFα through its tandem zinc finger domain (Carballo et al., 1998).

Furthermore, TNFα and GM-CSF mRNAs are markedly stabilized in macrophages derived from

TTP KO mice (Carballo et al., 2000; Carballo et al., 1998). Given the role of TTP in regulating

two centrally relevant inflammatory molecules, a cataclysm of studies to identify other mRNA

14

targets of TTP, to elucidate the regulation of TTP activity, and to analyze the mechanism in

which TTP promotes decay of bound mRNAs was undertaken.

TNFα and GM-CSF mRNAs were the first two targets found to be enriched in

macrophages derived from TTP KO mice. Subsequently, the ARE containing IL-2 and

interferon-γ mRNA were shown to be stabilized in primary T lymphocytes derived from TTP

KO mice (Ogilvie et al., 2009; Ogilvie et al., 2005). Beyond that, no other physiological TTP

substrate was identified using cells derived from TTP KO mice. However, small interfering

RNA (siRNA) knockdown experiments were used to identify β-1,2-galactosyltransferase 1 as a

TTP target in human umbilical cord cells (Gringhuis et al., 2005). Over-expression of TTP was

shown to stimulate destabilization of target mRNAs, namely c-fos, IL-3, IL-6, COX-2 and TTP

itself (Brooks et al., 2004; Sawaoka et al., 2003; Worthington et al., 2002; Stoecklin et al., 2001;

Lai et al., 2000; Stoecklin et al., 2000). A more unbiased approach to identify TTP targets was

performed using microarrays comparing mRNA turnover between stable fibroblast cell lines

derived from littermate TTP KO and WT mice (Lai et al., 2006). This approach identified 250

mRNAs that are stabilized in the TTP KO cells, but only 7 mRNAs were confirmed to be

significantly destabilized, and they encode for secreted proteins, protein kinases, enzymes, and

proteins of poorly understood function. Finally, a consensus nonamer site, UUAUUUAUU, was

found to permit high-affinity binding to TTP (Brewer et al., 2004). But TTP exhibits some

flexibility in its sequence requirements for binding as variations of the consensus nonamer can

still mediate binding.

TTP is phosphorylated by p42 MAPK, p38 MAPK, and the MAPK downstream protein,

MAPK-activated protein kinase 2 (MK2) (Carballo et al., 2001; Mahtani et al., 2001; Taylor et

al., 1995). Phosphorylation occurs at more than one site as evident by the disappearance of

multiple slower migrating forms when treated with phosphatase and analyzed by SDS-PAGE

15

(Mahtani et al., 2001). A study attempted to identify phosphorylation sites on TTP by MS and

site-directed mutagenesis (Cao et al., 2006). Although more than 30 probable phosphorylation

sites were identified, the functional importance of phosphorylation in most of these sites remains

unclear. A point of contention is whether or not TTP phosphorylation affects the binding affinity

to ARE-containing mRNAs. There is evidence that TTP dephosphorylated by calf intestinal

alkaline phosphatase is able to bind more tightly to an ARE probe than native phosphorylated

TTP (Carballo et al., 2001). However, there was no apparent effect of TTP phosphorylation by

p42/ERK2, p38, or JNK MAPKs on its mRNA-binding activity (Cao et al., 2003). In addition,

phosphorylation of TTP by MK2 was also ineffective in modulating mRNA-binding affinity

(Chrestensen et al., 2004). MK2 does phosphorylate TTP at two serine residues, which allows

binding of 14-3-3 adaptor proteins (Chrestensen et al., 2004; Stoecklin et al., 2004; Johnson et

al., 2002). This interaction protects TTP from dephosphorylation by protein phosphatase 2A, but

there are conflicting data as to whether the interaction could modulate its function or subcellular

localization (Sun et al., 2007; Rigby et al., 2005; Stoecklin et al., 2004). It seems more likely

that binding of 14-3-3 to TTP reduces the destabilizing activity of TTP by preventing it from

localizing with RNA decay machinery in the cytoplasm (Sun et al., 2007; Stoecklin et al., 2004).

There are other properties of TTP that change in response to phosphorylation. MK2

phosphorylation of TTP stabilizes the protein by excluding it from proteasomal degradation

(Deleault et al., 2008; Brook et al., 2006; Hitti et al., 2006). TTP expression is also regulated by

a feedback mechanism. Three AUUUA pentamers are found in the 3’ UTR of TTP, which can

be targeted by the TTP protein, leading to destabilization of its own transcript (Tchen et al.,

2004). Hence, as a result of TTP phosphorylation, TTP mRNA is stabilized and increasingly

translated into protein.

16

TTP promotes the destabilization of target transcripts by recruiting cellular RNA decay

enzymes to the bound transcript. The N-terminus of TTP can interact with the following human

enzymes in an RNA-independent fashion: decapping enzyme hDcp1, 5’-3’ exonuclease hXRN1,

deadenylase hCcr4, and the RNA-binding exosome component PM-Scl75 (Lykke-Andersen and

Wagner, 2005). The C-terminus does not associate with decay enzymes, but it enhances RNA

decay by an unknown mechanism. In an in vitro system, TTP was found to be able to activate

the activity of the poly-A deadenylase, PARN (Lai et al., 2003). A cell-free mRNA decay assay

provided evidence that TTP recruits RNA decay enzymes to ARE-containing mRNA, resulting

in enhanced decay (Hau et al., 2007; Heidi H. Hau, 2007). HeLa S100 extracts from mock or

TTP transfected cells were added to capped, polyadenylated, radiolabelled mRNA transcripts

that contain ARE sequences from select labile transcripts. Decay of radiolabelled transcripts was

analyzed over a 4h time course, and all ARE-containing transcripts exhibited accelerated

deadenylation in extracts prepared from TTP-transfected cells, but not mock transfected cells.

Transcripts that lack TTP binding sequences did not undergo accelerated decay (Hau et al.,

2007).

1.2.3 Regulation of IL-8 mRNA stability

As previously described, IL-8 plays a significant role in recruiting and activating

neutrophils at sites of inflammation. IL-8 expression is rapidly upregulated by phagocytes or

other tissue cells upon exposure to inflammatory stimuli, but it is barely detected from non-

induced cells (Baggiolini et al., 1989). A wide range of stimuli can induce the production of IL-

8, including bacterial or viral products, TNF, and IL-1 (Brasier et al., 1998; Aihara et al., 1997;

Mastronarde et al., 1996; Kasahara et al., 1991). Stimuli such as IL-1 or TNFα can upregulate

IL-8 by more than 100-fold, while certain bacterial factors cause a more moderate 5 to 10-fold

17

induction. However, excessive amounts of local IL-8 can have deleterious effects

(Balakathiresan et al., 2009; Baggiolini, 1998). Therefore, the level of IL-8 expression has to be

fine-tuned in a rapid manner to respond appropriately to the environment, and post-

transcriptional regulation is a mechanism to provide just that.

The 3’UTR contains 9 AUUUA pentamers, some of which have been identified as

important regulators of mRNA stability in IL-8 (Holtmann et al., 1999; Winzen et al., 1999;

Villarete and Remick, 1996; Stoeckle, 1991). A shorter region of the 3’UTR, located between

nucleotides 972 and 1132, was found to be sufficient in mediating destabilization to a reporter

construct (Winzen et al., 1999). Mutation of the 4 AUUUA pentamers within this region

resulted in reduced destabilizing effect (Winzen et al., 2004b; Yu and Chadee, 2001). Not only

do the ARE confer instability to IL-8, but they are also responsive to signalling pathways that

lead to an alteration in transcript stability. Through measuring IL-8 mRNA stability with

tetracycline-regulatable reporter constructs, it was demonstrated that activation of p38 MAPK

pathway stabilizes IL-8 mRNA (Holtmann et al., 2001; Holtmann et al., 1999; Winzen et al.,

1999). Overexpression of the active form of MAPKK6 or MK2 induced marked stabilization of

the IL-8 transcript, whereas a dominant negative mutant of p38 MAPK or of MK2 interfered

with MAPKK6 induced stabilization (Holtmann et al., 1999).

There is evidence that HuR, KSRP, TIAR, and TTP have an affinity for the 3’ UTR of

IL-8 in vitro (Winzen et al., 2007; Suswam et al., 2005b; Winzen et al., 2004b; Nabors et al.,

2001). When HuR was overexpressed in glioma and colon cancer cells, IL-8 mRNA was

stabilized and its expression was upregulated (Nabors et al., 2001). However, overexpressed

HuR in HeLa cells did not affect the stability of reporter mRNA containing nucleotides 1017-

1076 from IL-8 mRNA (Winzen et al., 2004a). In the same cell system, KSRP was found to

mediate destabilization of endogenous IL-8 mRNA. Data indicate that KSRP interacts with IL-8

18

transcripts through nucleotides 972-1310, and can mediate destabilization through this AU-rich

region (Winzen et al., 2007). Furthermore, IL-1α impairs the association of KSRP with IL-8

ARE, but this effect is sensitive to p38 MAPK inhibition. Overexpression of TTP can also

accelerate the degradation of IL-8 ARE containing reporter mRNA, but only under conditions

where basal degradation was slow due to KSRP knockdown. Co-expression of active MK2 can

partly reverse TTP mediated destabilization. However, TTP seems to play a greater role in IL-8

transcript stability in lung epithelial cells. Low levels of TTP in cystic fibrosis epithelial cells

were hypothesized to be responsible for the relative stability of IL-8 mRNA, possibly driving the

pro-inflammatory cellular phenotype in these patients (Balakathiresan et al., 2009).

1.2.4 Mechanisms of mRNA decay

As previously described, the 5’ 7-methylguanosine cap and the 3’ poly(A) tail in

translationally competent eukaryotic mRNAs play an important role in translation efficiency and

in maintaining transcript stability. The poly(A) tail inhibits transcript decay through its

interaction with the poly(A)-binding protein (PABP), which interacts with both the poly(A) tail

and eIF4G, a translation-initiation factor. eIF4G binds to eIF4E, which is a cap binding protein.

The interaction of these three proteins, PABP, eIF4G, and eIF4E, circularizes the mRNA to

promote translation and stabilizes mRNAs by preventing access of exonucleases (Wells et al.,

1998). In eukaryotes, poly(A) tail shortening is a necessary first step for decay of most mRNAs.

The process of deadenylation is carried out by different enzymes in the mammalian system:

PARN, PAN2-PAN3, and CAF1-CCR4-NOT (Muhlemann, 2005; Yamashita et al., 2005; Parker

and Song, 2004). After the shortening of the poly(A) tail, degradation of the mRNA can either

proceed in the 3’ to 5’ direction, occurring in exosomes, or in the 5’to 3’ direction, occurring in

P-bodies (Figure 1.2).

19

Figure 1.2: Degradation of mRNA in eukaryotic cells. mRNA decay is initiated by deadenylation by PARN (not shown) and continued by the CAF1-CCR4-NOT complex. Subsequent of deadenylation, the mRNA can be digested from the 3’ end of the transcript, catalyzed by the exosome, or from the 5’ end, catalyzed by the decapping enzyme DCP2 and the exonuclease XRN1. (Reprinted, with permission, from Nature Reviews Molecular Cell Biology, Volume 8 ©2007 by Nature Publishing Group)

1.2.4.1 Exosome

The exosome is a 10-12 subunit protein complex that contains multiple 3’to 5’

exonucleases and helicases (Butler, 2002; Mitchell and Tollervey, 2000; van Hoof and Parker,

1999). Six subunits share sequence identity with E. coli 3’ to 5’ exoribonucleases. Another

three additional subunits are postulated to bind RNA, and two other subunits share sequence

similarity to E. coli hydrolytic exoribonucleases (Liu et al., 2006). Although the molecular

structure of the exosome has not been solved, based on the interactions between subunits and the

organization of a similar nuclease complex in chloroplasts, the exosome may have two complete

ring structures that form a barrel-like structure (Symmons et al., 2000) (Figure 1.3). It is

20

unknown if individual exosome subunits contribute to RNase activities, or for structural integrity

of the protein complex. However, in certain situations, the exosome can be involved in

recruiting the mRNA targeted for decay. For example, TTP was shown to interact with specific

components of the exosome, thereby recruiting it to bound mRNAs (Chen et al., 2001). An

mRNA degraded by the exosome would be left with the 5’ 7-methylguanosine cap, which is

digested by a scavenger decapping enzyme that associates with the exosome (Wang and

Kiledjian, 2001). Table 1.1 lists some of the known protein components of the exosome.

Figure 1.3: Model of the exosome Surface representation of the human exosome depicting opposing views from the top (left) and bottom (right). The RNase PH-like subunits assemble into a hexameric ring structure. (Reprinted, with permission, from Cell, Volume 127 ©2006 by Elsevier Science Ltd.)

21

Table 1.1: Protein components of cytoplasmic exosome

Protein  Function Rrp41 

Contains Rnase PH domain: has affinity for AU‐rich sequences, and form a six‐membered ring structure 

Rrp42 PM‐Scl75 (Rrp45) Rrp46p Mtr3p OIP2 Rrp6 

3' → 5' exonuclease  Rrp40 Rrp43 Rrp45 Rrp46 Ski7  RNA helicase Ski2p‐Ski3p‐Ski8p  mRNA degradation TTP 

ARE‐mediated mRNA decay KSRP 

Cs14  RNA‐binding motif 

The importance of the exosome in ARE-mediated decay was examined by two groups.

One found that ARE containing mRNAs were stabilized in lysates that have been

immunodepleted with anti-exosome antibodies (Chen et al., 2001). The same study

demonstrated that some AUBPs that destabilize ARE-containing mRNAs in vivo physically

interact with the exosome, and if lysates are depleted of those AUBPs, ARE-containing mRNAs

are no longer degraded. Additionally, purified exosomes along with co-purified AUBPs were

shown to preferentially degrade ARE-containing mRNAs. Another study by the same group

demonstrated the colocalization of reporter mRNA containing the ARE of GM-CSF with

granules enriched with exosome components (Lin et al., 2007). Using live cell imaging, the

movement of mRNA was monitored. Reporter mRNA containg multiple copies of the

bacteriophage MS2 coat protein binding site and the 3’ UTR of GM-CSF was indirectly

visualized by a co-expressed MS2-YFP fusion protein. The mRNA was tracked to exosome

granules where fluorescent signal of the mRNA disappeared rapidly (Lin et al., 2007). This

22

suggests that ARE-containing mRNAs, at least those of GM-CSF, are directed to exosome

granules to be degraded. The second group demonstrated that the exosome component, PM-

Scl75, can specifically interact with the AREs of TNFα or GM-CSF in vitro (Mukherjee et al.,

2002). Therefore, both AUBPs and AREs have been shown by different groups to interact with

exosomal components (Lin et al., 2007; Mukherjee et al., 2002; Chen et al., 2001). It is possible

that ARE-containing mRNAs are first recognized by AUBPs, and then both are transferred to the

exosome.

1.2.4.2 P-bodies

P-bodies were first discovered in 1997 when it was observed that XRN1, the main 5’ to

3’ exoribonuclease in eukaryotic cells, was localized in small granular structures in the

cytoplasm of mammalian cells (Bashkirov et al., 1997). Five years later, the role of these

cytoplasmic XRN1 foci as sites where eukaryotic mRNA degrades emerged from the discovery

that the decapping enzyme, DCP2, and its cofactors colocalize with XRN1 in these foci (Cougot

et al., 2004a; Sheth and Parker, 2003; van Dijk et al., 2002). DCP2 hydrolyses the cap structure

and leaves an mRNA with a 5’ monophosphate, which is the preferred substrate for XRN1.

Other P-body components were identified through patients with various auto-immune diseases.

The auto-immune serum from a patient who suffered from motor and sensory neuropathy

recognizes a novel protein, named GW182 for its molecular weight and presence of glycine and

tryptophan repeats (Eystathioy et al., 2002). GW182 was found to colocalize to cytoplasmic

foci; the same ones that contains XRN1(Eystathioy et al., 2003). Patients with primary biliary

cirrhosis have antibodies against two P-body components: RAP55, an RNA-associated protein,

and Ge-1, a mRNA decapping factor (Fenger-Gron et al., 2005; Yu et al., 2005). In addition to

mRNA decay factors, several proteins involved in repressing translation are also concentrated in

23

P-bodies, such as DDX6 (p54/RCK), a helicase implicated in the process of stress-induced

translational silencing (Coller and Parker, 2005). Also, components of the RNA-induced

silencing complex that mediate microRNA (miRNA)-induced translational silencing, such as

argonaute proteins, are also found in P-bodies (Eulalio et al., 2007; Pillai et al., 2007). P-body

components can be distributed diffusely throughout the cytoplasm as well as being localized in

P-bodies (Kedersha et al., 2005). The dynamic nature of P-bodies allows it to exchange its

components with the cytoplasmic pool. The large P-bodies visible by microscopy may represent

aggregates of non-visible P-bodies with mRNA substrates (Kedersha et al., 2005). Enzymes and

proteins associated with P-bodies are summarized in table 1.2.

Table 1.2: Protein components of human P-bodies

Protein  Function XRN1  5' → 3' exonuclease GW182  In the miRNA pathway DCP2  Decapping enzyme DCP1  Decapping‐enzyme subunit Hedls, Ge‐1  Decapping co‐activator EDC3 (LSm16)  Decapping co‐activator LSm1‐7  Decapping co‐activator complex RAP55 (LSm14)  Predicted decapping co‐activator DDX6 (RCK/p54)  Decapping co‐activator eIF4E  Translation‐initiation factor EIF4E‐T  Translational repression Argonaute proteins  In the siRNA and miRNA pathways CCR4‐CAF1‐NOT complex  Deadenylation CPEB  Translation regulator 

TTP  ARE‐mediated mRNA decay 

All proteins that function in the 5’ to 3’ mRNA-decay pathway have been shown to

localize to P-bodies. In addition to this, several lines of evidence indicate P-bodies are sites of

mRNA degradation. Inhibition of transcription with actinomycin D leads to loss of P-bodies, as

does blocking mRNA decay at an early stage by inhibiting deadenylation (Teixeira et al., 2005;

24

Cougot et al., 2004a; Sheth and Parker, 2003). This suggests that P-body assembly is dependent

on RNA substrates. Indeed, semipurified P-bodies treated with RNase A are disrupted (Teixeira

et al., 2005). In addition, P-bodies increase in size when there is an accumulation of decay

intermediates. This occurs when: decapping is inhibited, or there is blockage of XRN1, or with

treatment of the translation inhibitor puromycin that forces the release of mRNAs from

polysomes (Cougot et al., 2004a; Sheth and Parker, 2003) Conversely, P-bodies decrease in size

with the treatment of cycloheximide, which inhibits polysome disassembly (Brengues et al.,

2005). Collectively, these observations indicate that the size and number of P-bodies depend on

the amount of mRNA that is not engaged in translation, or is committed to degradation.

P-bodies are also sites of storage of translationally repressed transcripts. mRNAs can

leave the P-body structure and re-enter the translational pool. Specific mRNAs accumulated in

P-bodies under a growth or stress condition were observed to exit P-bodies and enter the

polysome pool when a shift in conditions occurs (Brengues et al., 2005). Whether an mRNA in

a P-body is destined to be degraded or be cycled back to polysomes is thought to depend on

whether the irreversible step of decapping takes place. In order for decapping to occur, cap-

binding translation factors, including eIF4E, must be displaced for decapping enzymes to bind

the cap and catalyze decapping (Franks and Lykke-Andersen, 2008). It is predicted that if eIF4E

is complexed with eIF4E-T, it would block translation as well as decapping, therefore mRNAs

with the eIF4E- eIF4E-T complex may be preferentially stored in P-bodies rather than degraded

(Andrei et al., 2005). Destabilization of the mRNA can conceivably be achieved by a pro-

decapping factor that directly interferes with the eIF4E cap complex. Taken together, these data

suggest mRNAs can cycle from polysomes to P-bodies, where they are degraded or returned

back to polysomes.

25

There is evidence that ARE-mediated decay not only involves the exosome, but P-bodies

as well. TTP was shown to localize in P-bodies by co-staining for tagged-TTP and for a

component of the decapping complex, Dcp1a (Kedersha et al., 2005). The presence of an ARE

also seems to stimulate decapping in vitro, through an unknown mechanism (Gao et al., 2001).

Moreover, tethering of TTP to a reporter mRNA lacking an ARE is sufficient to direct the

mRNA toward P-bodies, and also to induce decay of the mRNA (Franks and Lykke-Andersen,

2007; Lykke-Andersen and Wagner, 2005).

The question of whether ARE-mediated decay occurs in the 3’ to 5’ or 5’ to 3’ direction,

that is, in the exosome or P-body respectively, remains a controversial issue. Data that support a

role for the exosome are based on: in vitro decay assays, the interaction of AUBPs with the

exosome, and that the exosome component PM-Scl75 can bind directly to AREs (Lykke-

Andersen and Wagner, 2005; Mukherjee et al., 2002; Chen et al., 2001). Data that support P-

bodies as sites of ARE-mediated decay are: activation of decapping by an ARE in vitro, the

interaction of TTP and related AUBPs with the decapping complex, and localization of TTP and

related AUBPs with P-bodies. Also, a study demonstrated that depletion of P-body components

XRN1 or Lsm1, but not other P-body components, inhibits ARE-mediated decay to a larger

extent than depletion of a number of select exosome components (Stoecklin et al., 2006). The

discrepancy in the data cannot be explained by using different cells, as some studies from both

sides of the argument utilized HeLa cells or HeLa cell lysates. It is more probable that ARE-

mediated decay can in fact occur in both exosomes and P-bodies, and that its localization can be

regulated depending on the activities of distinct AUBPs or the expression levels of decay

enzymes in the cell.

1.2.4.3 Stress granules

26

Mammalian stress granules are dense cytoplasmic structures that appear when cells are

exposed to stresses such as heat, UV irradiation, hypoxia, or oxidative conditions. A family of

serine/threonine kinases senses these stresses and phosphorylates eIF2α, a translation initiation

factor that is part of the eIF2-GTP-tRNAmet ternary complex that loads the initiator tRNA onto

the 40S ribosomal subunit (Kedersha et al., 2002). Phosphorylation of eIF2α reduces the

availability of the eIF2-GTP-tRNAmet ternary complex, thereby inhibiting translational initiation

and promoting polysome disassembly. Downstream of eIF2α is the aggregation of T-cell

internal antigen 1 (TIA-1) and TIAR proteins that lead to the formation of stress granules

(Kedersha et al., 1999). Both proteins continously shuttle between the nucleus and cytoplasm,

but accumulate in the cytoplasm in response to environmental stress, where they aggregate

rapidly to form stress granules (Kedersha et al., 1999). TIA-1 and TIAR have multiple RNA-

binding domains that can bind to mRNA without apparent sequence specificity, or to U-rich

sequences with high affinity and specificity (Dember et al., 1996). During stress, mRNA

metabolism is reprogrammed so that only mRNAs encoding proteins important to repair stress

damage or to adapt to new conditions are translated. Other mRNAs, such as those bearing

housekeeping genes are directed from the polysomes to stress granules, possibly through the

export of TIA-1 or TIAR (Kedersha et al., 2000). Evidence that mRNAs move between

polysomes and stress granules was established by treating cells with drugs that modulate

polysome-mRNA interaction. Emetine, a drug that stabilizes polysomes, causes stress granule

disassembly, whereas puromycin, a drug that dismantles polysomes, causes stress granule

assembly (Kedersha et al., 2000).

While stress granules are composed of many similar proteins as P-bodies, they are

distinct entities and are functionally distinct as well. It is thought that stress granules are sites of

storage, whereas P-bodies are sites of decay. Both granules include similar enzymes or decay

27

factors, such as XRN1, eIF4E, and TTP (Kedersha et al., 2005). However, unlike P-bodies,

stress granules contain translation initiation factors such as eIF3, eIF4G, PABP, and small

ribosomal subunits (Kedersha et al., 2005) (Table 1.3). The large ribosomal subunit is absent

from stress granules, eliminating the possibility that translation can occur in stress granules

(Kedersha et al., 2002). Conversely, decapping enzymes and GW182 are found exclusively in P-

bodies (Anderson and Kedersha, 2006). Stress granules are relatively fixed in the cytoplasm, but

can dock with dynamic P-bodies transiently, and it is thought that this interaction may allow for

transfer of mRNAs (Kedersha et al., 2005).

Table 1.3: Protein components of stress granules

Protein   Function Ago2  RNAi slicer 40S ribosomal subunit 

Translation 

eIF2 eIF3 eIF4E eIF4G FAST HuR  RNA stability PABP‐1  Translation, stability DDX6 (RCK/p54)  Decapping co‐activator TIA‐1 and TIAR  mRNA silencing 

TTP  ARE‐mediated mRNA decay 

It was first thought that stress granule associated mRNAs are not degraded during stress,

but re-enter into the translational pool once cells recover from stress (Nover et al., 1989).

However, it has since been demonstrated that mRNAs targeted to stress granules can not only be

stored, but can be directed to the mRNA degradation machinery, or back to the cytoplasm to

initiate translation. Fluorescence recovery after photobleaching (FRAP), revealed that TIA-1

and PABP are rapidly shuttled out of stress granules (Kedersha et al., 2000). Based on this, the

authors suggest that transcripts are selected for decay, storage, or export rather quickly: within a

28

span of 8 seconds. Both HuR and TTP were shown to accumulate in stress granules in response

to heat shock, and therefore it was postulated these AUBPs may determine whether transcripts

Figure 1.4: Model for cytoplasmic flow of mRNAs to P-body and stress granule. mRNAs can be in a translationally active state that is associated with polysomes or in a translationally inactive state. The latter occurs in response to defects in translation initiation, or through specific recruitment by an AUBP. mRNAs targeted to P-bodies first dissociate from translation factors and bind to translational repressors and then they are either stored, decapped and degraded, or exit the P-body for re-entry into the translational pool. Macroscopic P-bodies are aggregates of smaller functional P-bodies. SGs are another type of RNA granule that forms in response to defects in translation initiation. Aggregation of TIA-1 and TIAR lead to the formation of SGs, which consists of untranslating mRNAs in conjunction with a subset of translation initiation factors and the 40S ribosomal subunit. mRNAs in SGs are translationally stalled, and they have the potential for re-entry into translation, or transferred into P-bodies for degradation. (Reprinted, with permission, from Molecular Cell, Volume 25 ©2007 by Elsevier Science Ltd.)

29

that arrive at the stress granule be translated or degraded (Stoecklin et al., 2004; Gallouzi et al.,

2000) (Figure 1.4). In addition, phosphorylation of mouse TTP at two specific sites mediates its

binding to 14-3-3 (Stoecklin et al., 2004). As a result, TTP is excluded from stress granules, and

the decay of ARE-containing reporter mRNA is prevented. This supports the hypothesis that

stress granules are not only sites of storage, but can direct transcripts to the cellular decay

machinery.

1.2.4.4 microRNAs

microRNAs (miRNAs) are 20-24 nucleotide-long single strand non-coding endogenous

RNAs that act post-transcriptionally to alter gene expression in a process called RNA

interference (RNAi). Although there are still ongoing discoveries, it is estimated that there may

be 1000 or more human miRNAs which may regulate approximately 8000 genes (Asirvatham et

al., 2008). miRNAs can be encoded in introns or exons, or in non-protein coding genes, and can

be transcribed with either RNA polymerase II or III (Lee et al., 2004). The pre-miRNA,

consisting of a hairpin RNA of ~70 nucleotides, is exported to the cytoplasm, where Dicer cuts

the hairpin (Bernstein et al., 2001). The sense strand of the miRNA is then incorporated into the

RNA-induced silencing complex (RISC) (Hutvagner and Zamore, 2002). Central to RISC are

members of the argonaute (Ago) protein family, which have endonuclease activity. Argonautes

also contain two RNA binding motifs that are important in aligning the miRNA for its interaction

with target mRNA. Some argonauts, like Ago2, can cleave target transcripts directly, whereas

other argonauts may recruit other gene silencing proteins to targets (Pratt and MacRae, 2009). It

was discovered that miRNA with perfect or near perfect base pairing with its target mRNA

promotes cleavage of the mRNA (Kawasaki and Taira, 2004). Partially complementary miRNAs

can promote deadenylation by recruiting appropriate cellular enzymes, or inhibit translation of

30

target mRNAs by an unknown mechanism (Eulalio et al., 2009; Williams, 2008). Therefore,

miRNAs regulate gene expression by sequence specific targeting of mRNA for translational

repression and/or transcript degradation.

In cases of animals, most miRNAs are only partially complementary to their targets, and

therefore, miRNA-mediated decay occurs by directing mRNAs to cellular mRNA degradation

machinery. It was found that Argonaute proteins interact with GW182, DCP2, and DDX6

(Behm-Ansmant et al., 2006; Chu and Rana, 2006; Liu et al., 2005). In addition, Argonaute

proteins, miRNAs and miRNA targets are localized in P-bodies, and disruption of P-bodies

decreases the efficiency of RNAi (Jakymiw et al., 2005; Sen and Blau, 2005). These data

strongly suggest that P-bodies play a role in RNAi. An interesting revelation is the role of

miRNAs and Argonaute proteins in ARE-mediated mRNA decay (Jing et al., 2005). The

authors demonstrated that imperfect base pairing between miR-16 and TNFα AREs stabilizes the

binding of TTP, and also recruits the RISC complex to the mRNA. The stability of a reporter

containing the ARE of TNFα corresponded to the level of miR-16: over-expression of miR-16

decreased the RNA reporter, and down-modulation increased the reporter. Furthermore, miR-16

was required for TTP-mediated destabilization of the reporter containing ARE of

TNFα, suggesting that targeting of miR-16 to an ARE is necessary for RNA degradation. The

same study also implicated the involvement if miR-289 in directing stability of mRNAs

containing the AREs of TNFα, IL-6, and IL-8. However, the mechanism of degradation in

RNAs targeted by miRNAs is still unknown. It is conceivable that RISC can recruit enzymes or

P-bodies to degrade targeted RNAs, due to its ability to interact with components of P-bodies.

Recently, over-expression of miR-29a was found to suppress TTP expression (Gebeshuber et al.,

2009). Therefore, miRNAs seem to be involved in ARE-mediated destabilization through its

interactions with both the ARE sequence and with the AUBP.

31

1.3 Thesis summary

The recognition that LeTx activity can cause the accelerated decay of IL-8 transcripts is

intriguing. It is well established that LeTx can dampen the immune response by impairing the

function of various white blood cells. However, other than the work presented in this thesis, no

group has described the ability of LeTx to modulate the stability of an mRNA, one that is

important for initiation of the host innate response. Previous work has demonstrated the

decreased half-life of IL-8 mRNA in human umbilical vein endothelial cells (HUVECs).

Modulation of mRNA decay occurs during normal cellular activities, and is an important

regulatory feature that controls the expression of genes encoding cytokines and chemokines

(Chen et al., 2006; Biswas et al., 2003; Dean et al., 2003; Chen et al., 2000). In chapter 3, a

region of 100 nucleotides in the 3’ UTR was identified to mediate destabilization of the reporter

transcript in response to LeTx or MAPK inhibitors. This region is extremely rich in adenosine

and uracil nucleotides and consists of 4 AUUUA pentamers. These results indicate that LeTx,

through the inactivation of MAPKKs, mediates destabilization of IL-8 mRNA through the 100-

nucleotide AU-rich region. Furthermore, I identify TTP as the AUBP that is required for IL-8

mRNA destabilization. Treatment of LeTx or MAPK inhibitors leads to dephosphorylation of

TTP, and I observed an increase of TTP localization to P-bodies in cells treated with LeTx.

The binding of TTP to various components of the cellular mRNA decay machinery has

been described elsewhere (Franks and Lykke-Andersen, 2007; Hau et al., 2007; Fenger-Gron et

al., 2005; Lykke-Andersen and Wagner, 2005). In chapter 4, I describe two TTP-interacting

proteins that are not decay enzymes or part of the decay machinery. Myosin-9 and HSC-70 were

found to bind to TTP in an RNA-independent manner. Both proteins seem to play a role in IL-8

mRNA destabilization, as the IL-8 mRNA half-life increased in cells transfected with siRNA

directed against either of the protein genes. Treatment of LeTx does not affect the binding of

32

myosin-9 or HSC-70 with TTP, and in accordance with this, knock-down of these proteins does

not affect the ability of LeTx to destabilize IL-8 mRNA. These results suggest that HSC-70 and

myosin-9 are part of a complex regulation of TTP function, and the picture of TTP mechanism is

far from being completely understood.

33

Chapter 2

Materials and methods

2.1 Cell culture

The human cell lines HT1080 and HeLa were maintained under an atmosphere of 5%

CO2 at 37ºC in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum

and 1% penicillin (10000IU) and streptomycin (10,000μg/ml) (Wisent Inc.). Stable cell lines

were generated using the Flp-In System following manufacturer’s protocol (Invitrogen). For

decay assays, cells were seeded at 7.2 × 105 cells per well in a 6-well dish and treated the next

day as indicated. For transfections, cells were seeded at 2.0 × 106 per 10 cm dish and transfected

the next day with SuperFect (Qiagen). RNA extraction was performed 16 h post transfection.

2.2 Proteins

Lethal factor was purified as previously described (Kassam et al., 2005). PA was

purified as previously described (Miller et al., 1999). Endotoxin was removed from purified LF

and PA using Detoxi-Gel AffinityPak columns (Pierce). Endotoxin contamination was assessed

using Limulus Amoebocyte Lysate (Cambrex) with a detection limit of less than 0.03 endotoxin

units ml-1.

2.3 Plasmid constructs

pcDNA3-Flag-TTP and pcDNA3-Flag-HuR were described previously (Lykke-Andersen

and Wagner, 2005). pNTAP-TTP was created by amplification of the coding region of TTP

from the plasmid pcDNA3-Flag-TTP using primers 5’-

GCGGAATTCATGGATCTGACTGCCATCTAC-3’ and 5’-

34

GCGCTCGAGTCACTCAGAAACAGAGATGCG-3’. The amplification products were excised

using EcoRI and XhoI and inserted into pNTAP-B vector (Stratagene). pNTAP-TTP-F126N

was created by mutating phenylalanine in position 126 of the TTP animo acid sequence to

asparagine by utilizing QuikChange Site-Directed Mutagenesis (Strategene) using primers 5’- C

GGG GCCAAGTGCCAGAATGCCCATGGCCTGGGCGAG -3’and 5’-

CTCGCCCAGGCCATGGGCATTCTGGCACTTGGCCCCG-3’.

The coding region of TIAR was amplified from HT1080 cDNA using primers 5’-

GCGGAATTCATGATGGAAGACGACGGG-3’ and 5’-

GCGGCGGCCGCTCACTGTGTTTGGTAACTTG-3’. The coding region of HuR in pcDNA3-

Flag-HuR was excised using EcoRI and NotI and the coding region of TIAR was inserted into

these sites to create pcDNA3-Flag-TIAR.

The coding region of KSRP was excised with EcoRI and XhoI from pOTB7-KSRP

(ATCC) and inserted into pcDNA3.1. Nucleotides between the EcoRI site and the ATG start

codon of KSRP were excised by digestion with EcoRI and SgrAI and replaced with annealed

oligonucleotides 5’-

AATTCATGTCGGACTACAGCACGGGAGGACCCCCGCCCGGGCCGCCGCCGCCCG-3’

and 5’-

CCGGCGGGCGGCGGCGGCCCGGGCGGGGGTCCTCCCGTGCTGTAGTCCGACATG-3’.

Then, EcoRI and XbaI was used to excise the KSRP cDNA and inserted into these sites in

pcDNA3-Flag.

A GFP tag for qPCR detection was cloned between the BamHI and EcoRI restriction sites

of the MCS of pcDNA 3.1 (+) (Invitrogen) by insertion of an oligonucleotide created by

annealing 5’-

GATCCAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTG

35

ACCGCCGCCG-3’ and 5’-

AATTCGGCGGCGGTCACGAACTCCAGCAGGACCATGTGATCGCGCTTCTCGTTGGGG

TCTTTCTG-3’. The genomic sequence and cDNA sequence of IL-8 was then cloned 3’ of the

GFP tag using the NotI and XbaI restriction sites. The IL-8 genomic sequence was amplified

from Human Genomic DNA (Roche) with primers 5’- CGC GCG GCC GCC TCC ATA AGG

CAC AAA CTT TC-3’ and 5’- CGC TCT AGA TTG ACA ACA AAT TAT ATT TTA AAT G-

3’. The IL-8 cDNA sequence was amplified from HUVEC cDNA using the same primers. The

IL-8 3’UTR was cloned into pd2EYFP-N1 (Clontech) as described previously (Batty et al.,

2006) to make EYFP-401-1648. This construct was then used as template to amplify for all

subsequent truncations of IL-8 3’UTR, which were then digested with NotI and XbaI and ligated

into pd2EYFP-N1. Primers 5’- CGCGCGGCCGCTAAAAAAATTCATTCTCTGTGG-3’ and

5’- GCGTCTAGAACAACAGACCCACACAATAC-3’ was used to amplify nucleotides 401-

500. Primers 5’- CGCGCGGCCGCTAAAAAAATTCATTCTCTGTGG-3’ and 5’-

GCGTCTAGATCCCATCATTTTTATGTGATG-3’ was used to amplify nucleotides 401-800.

Primers 5’- GCGGCGGCCGCACA ATAAATTTTGCCATAAAGTCA-3’ and 5’-

GCGTCTAGAAAAGTGCTTCCACATGTC C-3’ was used to amplify nucleotides 800-1000.

Primers 5’-GCGGCGGCCGCTAAGTTTTTTCATCATAACATAAATT-3’ and 5’-

GCGTCTAGAAAATTCTTGCACAAATATTTGATG-3’ was used to amplify nucleotides

1000-1100. Primers 5’-GCGGCGGCCGCCATCAAATATTT GTG CAA GAA TT-3’ and 5’-

CGCTCTAGATTGACAACAAATTATATTTTAAATG-3’ was used to amplify nucleotides

1077-1648.

Cloning into the pcDNA5/FRT expression vector for creation of stable cell lines is as

follows: the pd2EYFP-N1 vectors were used as templates and amplified products were digested

with either NotI and XhoI (EYFP), or XhoI and ApaI (EYFP-401-1648 and EYFP-1000-1100)

36

and ligated into pcDNA5/FRT. Primers 5’- GCGGCGGCCGCGCCACCATGGTGAGCAAG-

3’ and 5’- GCGCTCGAGCTACAC ATTGATCCTAGCAG-3’ were used to amplify the EYFP

gene from the pd2EYFP vector. Primers 5’- GCGCTCGAGCGCCACCATGGTGAGCAAGG-

3’ and 5’- GCGGGGCCCTTGACAACAAATTATATTTTAAATGTTTC-3’ was used to

amplify EYFP-401-1648 from the EYFP-401-1648 vector. Primers 5’-

GCGCTCGAGCGCCACCATGGTGAGCAAGG-3’ and 5’-

GCGGGGCCCAAATTCTTGCACAAATATTTGATG C-3’ was used to amplify EYFP-1000-

1100 from the EYFP-1000-1100 vector.

The pTRE-GFP-NMHC IIA (Addgene) construct, which contains the coding region of

non-muscle myosin heavy chain 9 (myosin-9), was used as a template for amplification of the

head domain, or the heavy meromyosin (HMM)-like fragment of myosin-9, which were

subsequently digested with HindIII and XbaI and then ligated to pcDNA3-HA (Go et al., 2009).

Primers 5’- GCGAAGCTTGCCGCCACCATGGCACAG-3’ and 5’-

GCGTCTAGACGGCTTGACCTTGGTGAAG-3’ were used to amplify the head domain of

myosin-9 (nucleotides 232 to 2739) and was ligated into pcDNA3-HA making pcDNA-HA-

Head. Primers 5’- GCGAAGCTTGCCGCCACCATGGCACAG-3’ and 5’-

GCGTCTAGACTCGTCCTCCACCTGCTTG-3’ were used to amplify the HMM-like fragment

of myosin-9 (nucleotides 232 to 4240) and was ligated into pcDNA3-HA making pcDNA-HA-

HMM.

2.4 Western blotting

Cytoplasmic and nuclear lysates were extracted with the NE-PER Nuclear and

Cytoplasmic Extract Reagents (Pierce) according to manufacturer’s protocol. Otherwise, cell

monolayers were lysed by scraping into EBC buffer followed by sonication. Protein

37

concentration was determined with a protein assay reagent (Bio-Rad). SDS-polyacrylamide gel

electrophoresis was performed with 7.5% or 10% polyacrylamide gel and transferred onto

nitrocellulose blotting membrane (Pall). Membranes were blocked in 0.1% Tween-20 TBS

containing 5% skim milk powder and probed with the primary antibody for 1 h at room

temperature or overnight at 40C. Dilutions of primary antibodies were used as follows: 1:5000

TTP (Abcam), 1:300 TIAR (Santa Cruz), 1:1000 tubulin (Sigma), 1:1000 p53 (Calbiochem),

1:1000 FLAG (Sigma), 1:1000 HA (Sigma), 1:1000 myosin-9 (Sigma), 1:200 HSC-70 (Santa

Cruz), and 1:5000 β-actin (Sigma).

2.4 RNA purification and quantification

Total RNA was isolated and quantified as previously described (Batty et al., 2006).

Briefly, total RNA was isolated using Rneasy Mini kit (Qiagen) and treated with Dnase (RNase-

free DNase kit, Qiagen). RNA was reverse transcribed using SuperScript II Reverse

Transcriptase (Invitrogen) and qPCR was performed using the ABI Prism 7900HT Sequence

Detection System (Applied Biosystems). To detect IL-8, the following primers were used: 5’-

AATCTGGCAACCCTAGTTGCTA-3’ and 5’- AAACCAAGGCACAGTGGAACA-3’.

Primers 5’- AGCAAAGACCCCAACGAGAAG-3’ and 5’-GGCGGCGGTCACGAA-3’ were

used to detect EYFP mRNA levels. Primers 5’- AAAGCCACCCCACTTCTCTCTAA-3’ and

5’- ACCTCCCCTGTGTGGACTTG-3’ were used to detect β-actin mRNA levels. Primers to

detect IRF1 were: 5’-CAGTGACCCCAGAAAAGCATAAC-3’ and 5’-

CATTTAGTGCAATTTTCTCTTAGTG-3’.

Primers to detect TTP were: 5’- GGGCAGGTCCCCAAGTG-3’ and 5’-

CCCCAAGAACCTCGGAAGAC-3’. To determine mRNA fold change in decay assays, a

38

previously described mathematical model was employed (Pfaffl, 2001). Values were normalized

to β-actin levels and expressed relative to untreated samples at 0 min.

2.5 siRNA transfection

siRNA were transfected into HT1080 cells using Lipofectamine RNAiMAX (Invitrogen).

The negative control siRNA was obtained from Ambion and siRNA directed against TTP and

TIAR with dTdT 3’ overhangs were from Dharmacon Research. For TTP knockdown, cells

were transfected with 17 nM of the siRNA duplex with the sense sequence 5’ -

CGCUGCCACUUCAUCCACAAC-3’, which can also target Tis11B and Tis11D. IL-8 decay

was then assayed 24 hours post-transfection. For TIAR knockdown, 167 nM of siRNA with the

sense sequence 5’ –AAGGGCUAUUCAUUUGUCAGA-3’ was used for each transfection.

Cells were re-transfected 2 days after the first transfection, and IL-8 decay assayed 24 hours

after. siRNA directed against non-muscle myosin heavy chain 9 and HSC-70 were obtained

from Applied Biosystems. siRNA duplex with the sense sequence 5’-

GGGUAUCAAUGUGACCGAU-3’ and 5’-GAGUUUAAGCGCAAGCAUA-3’ was used to

target non-muscle myosin heavy chain 9 and HSC-70 respectively. 167 nM of siRNA was used

for each transfection and cells were re-transfected 2 days after the first transfection. mRNA or

protein decay was then measured 24 hours after the second siRNA transfection. The cell density

on the day of every siRNA transfection was ~30% confluence.

2.6 Fluorescence microscopy

Cells were fixed with 4% paraformaldehyde and permeabilized with 0.2% Triton-X.

Blocking was done in 5% BSA for 30 min, and then in Image-iT® FX signal enhancer

(Invitrogen) for 30 min. This treatment was followed by 1 h incubation with primary antibodies

39

which were diluted in the blocking agent as follows: 1:1000 DDX6 (Bethyl) and 1:1000 Flag

(Sigma). Then, cells were incubated for 45 min with 1:800 Alexa Fluor® 488 or Alexa Fluor®

594 (Invitrogen). Cells were then incubated with 1:1000 Hoescht dye if applicable and then

mounted on Mowiol solution. For quantification of P-bodies or colocalization of Flag-TTP with

P-bodies, at least 100 cells were analyzed from three or more independent experiments.

Conventional fluorescence microscopy was performed on Zeiss Axioplan 2 and the images

compiled using AxioVision LE software.

2.7 Tandem affinity purification

The presence of two peptide tags allows for the usage of one or both tags for single or

consecutive purifications with their respective resin. The manufacturer’s protocol was followed

for either single or double consecutive purifications (Stratagene). For Fig. 4.1, 6 μg of pNTAP-

TTP was transfected into HT1080 cells with PEI at a ratio of 5:1 PEI to plasmid DNA. Cells

were lysed as per manufacturer’s protocol and precipitated products from streptavidin resin were

subjected to SDS-PAGE. Bands of interest were visualized by comassie staining (Invitrogen)

and protein identification of select bands was determined by LC MS/MS (ProtTech). For Fig.

4.2A, cells were transfected as in Fig. 4.1 and two consecutive purification steps utilizing both

the streptavidin and calmodulin resin was used to isolate TAP-tagged TTP protein complex,

where eluate from the streptavidin resin undergoes further purification with the calmodulin resin.

1% input and precipitated proteins were probed for myosin-9 and CBP by western blotting. For

Fig. 4.2B and C, a single purification step with streptavidin resin was undertaken to purify the

tagged protein complex and probed for HSC-70 by Western blot.

2.8 Co-immunoprecipitation assay

40

For Fig. 4.2D, 4 μg of pcDNA-HA-HMM was co-transfected with either 4 μg of pcDNA-

FLAG-TTP or pcDNA-FLAG-TTP-F126N. Cells were lysed with TAP lysis buffer according to

manufacturer’s protocol. Where indicated, the cell lysates were treated with 0.1 μg/μl RNase A

(Fischer Scientific) before the addition of 1μg HA antibody (Sigma) overnight at 4ºC. pcDNA-

HA-HMM protein complex were precipitated with 50μl of protein A sepharose slurry (GE

Healthcare) for 2 h at 4ºC. Beads were washed 3 times with TAP lysis buffer and proteins were

eluted with incubating the beads with SDS sample buffer and boiled for 5 min. Eluted proteins

were subjected to SDS-PAGE and transferred to nitrocellulose (Pall) and probed for HA and

FLAG (Sigma). For Fig. 4.6, 4 μg of pcDNA-FLAG-TTP was co-transfected with 4 μg of

pcDNA-HA-HMM or pcDNA-HA-Head. Procedure of IP is as in Fig. 4.2D.

41

Chapter 3

Anthrax lethal toxin promotes dephosphorylation of TTP

and formation of processing bodies

The content of this chapter is reprinted, in part, from Cellular Microbiology, Vol. 12, Issue 4, Edith M.C. Chow, Sarah Batty and Jeremy Mogridge, Anthrax lethal toxin promotes dephosphorylation of TTP and formation of processing bodies, pages 557-568 ©2010, with permission from John Wiley and Sons.

Contributions: I performed all the experiments in this chapter with the exception of Fig. 3.3B, which was performed by Sarah Batty.

3.1 Summary

Anthrax lethal toxin (LeTx) is a bipartite toxin composed of protective antigen (PA) and

lethal factor (LF) – PA is the receptor-binding moiety and LF is the enzymatic moiety that

specifically cleaves and inactivates mitogen-activated protein kinase kinases (MAPKKs). LeTx

subverts the immune response to B. anthracis in a variety of ways, such as downregulating

interleukin-8 (IL-8) by increasing the rate of IL-8 mRNA degradation. Many transcripts are

regulated through cis-acting elements that bind proteins that either impede or promote

degradation. Some of these RNA binding proteins are regulated by MAPKs and previous work

has demonstrated that interfering with MAPK signaling decreases the half-life of IL-8 mRNA.

Here, a segment within the IL-8 3’ untranslated region responsible for LeTx-induced transcript

destabilization is localized and it is shown that this is caused by inhibition of the p38, ERK, and

JNK pathways. TTP, an RNA binding protein involved in IL-8 mRNA decay, became

hypophosphorylated in LeTx-treated cells and exhibited increased localization to Processing-

bodies, which are structures that accumulate transcripts targeted for degradation. Furthermore, it

42

is observed that LeTx promoted the formation of Processing-bodies, revealing a link between the

toxin and a major mRNA decay pathway.

3.2 Results

3.2.1 LeTx accelerates IL-8 mRNA decay through the 3’ UTR

The effect of LeTx on IL-8 mRNA stability in HT1080 fibroblasts was assessed in cells

pretreated with TNF-α to increase the level of endogenous IL-8 mRNA, and then with

actinomycin D, to halt de novo mRNA synthesis. Total RNA was extracted at various times and

IL-8 transcript levels were quantified using quantitative real-time PCR (qPCR) and standardized

to β-actin mRNA levels. The half-life (t1/2) of IL-8 mRNA in LeTx-treated cells was ~52 min

compared to ~140 min in unintoxicated cells (Fig. 3.1A), indicating that LeTx destabilizes IL-8

mRNA in this human fibroblast cell line.

While it was demonstrated previously that the 3’ UTR of the IL-8 transcript confers

LeTx-dependent destabilization to a reporter transcript (Batty et al., 2006), it has been shown

that stability of other transcripts can be influenced by regions in the 5’ UTR and coding region

and by whether or not the transcript has undergone splicing (Zhao and Hamilton, 2007; Chen et

al., 2000). Therefore, to determine if regions outside of the 3’UTR affect LeTx-mediated

transcript destabilization, the IL-8 genomic sequence, the cDNA sequence, and the 3’ UTR was

cloned into reporter constructs containing tags downstream of the transcription start site that

allowed for detection by qPCR. The reporter constructs were transiently transfected into

HT1080 cells for 2 h and the cells were either left untreated or were treated with LeTx for 24 h.

RNA was isolated from untreated and toxin-treated cells and the ratios of the levels of reporter

transcripts were calculated (Fig. 3.1B). The levels of the transcripts containing IL-8 sequences

were reduced by LeTx to similar extents, suggesting that the element(s) responsible for toxin-

43

mediated destabilization are confined to the 3’ UTR and that splicing does not affect the stability

of the transcript.

Figure 3.1: LeTx accelerates IL-8 mRNA decay through the 3’ UTR.

A. Endogenous IL-8 mRNA was induced by incubating HT1080 cells for 2 h with TNF-α (10 ng/ml), followed by treatment with LeTx (10-8 M PA and 10-9 M LF) for 1 h. Transcription was inhibited by addition of actinomycin D (1 μg/ml) and total RNA was isolated at the indicated times and transcript levels was measured using qPCR. Error bars indicate SEM of 3 independent experiments. B. HT1080 cells were transiently transfected with the indicated plasmids containing IL-8 sequences and treated with LeTx (10-8 M PA and 10-9 M LF). Total RNA was isolated from untreated and intoxicated cells and reporter transcript levels were measured using qPCR. Error bars indicate SEM of 3 independent experiments.

3.2.2 IL-8 3’UTR contains AU-rich element that confers mRNA instability

In order to identify cis-acting elements that destabilize IL-8 mRNA, various truncations

of the IL-8 3’ UTR were cloned behind the EYFP coding region (Fig. 3.2A). The constructs

44

were transiently transfected into HT1080 cells and reporter mRNA was quantified using qPCR

and standardized to β-actin mRNA. mRNA containing the entire IL-8 3’ UTR (EYFP-IL-8401-

1648) was detected at an ~10-fold lower level than that of the EYFP control mRNA, confirming

the presence of destabilization elements in the 3’ UTR. A segment comprising nucleotides 1000-

1100 (EYFP-IL-81000-1100), containing 4 clustered AUUUA pentamers, was found to exert

significant destabilization to the reporter transcript, whereas other ARE-containing regions did

not confer significant destabilization to the EYFP coding region.

To test if EYFP-IL-81000-1100 mRNA is responsive to LeTx-mediated destabilization,

stable transfectants were treated with toxin and half-lives were assessed after the addition of

actinomycin D (Fig. 3.2C). EYFP mRNA that lacks IL-8 sequences had a half-life of more than

200 min and LeTx had no effect on the stability of this transcript. Transcripts containing the

EYFP coding region fused to the IL-8 3’ UTR (EYFP-IL-8401-1648) had a half-life of ~130 min in

untreated cells, and ~95 min in LeTx-treated cells. Similarly, transcripts containing the EYFP

coding region fused to nucleotides 1000-1100 of the IL-8 3’ UTR had a half-life of ~74 min in

untreated cells, and ~42 min in LeTx-treated cells. These results indicate that LeTx causes

destabilization of IL-8 mRNA through nucleotides 1000-1100 within the 3’ UTR.

45

Figure 3.2: Identification of a region within the IL-8 3’UTR that confers mRNA instability. A. Scheme depicting the reporter genes containing various truncations of the IL-8 3’UTR. Vertical lines indicate the positions of AUUUA sequences. The thicker vertical lines indicate two adjacent AUUUA sequences. B. IL-8 3’UTR constructs were transiently expressed in HT1080 cells. Total RNA was isolated and reporter mRNA levels were measured using qPCR. Error bars indicate SEM of 3 independent experiments and asterisks indicate significant differences (p < 0.05). C. Cells stably expressing EYFP, EYFP-IL-8401-1648, and EYFP-IL-81000-1100 were treated with LeTx (10-8 M PA and 10-9 M LF) for 1 h followed by addition of actinomycin D (1 μg/ml). RNA was then isolated at the indicated times and measured using qPCR. Error bars indicate SEM of three independent experiments.

46

3.2.3 Inhibition of ERK1/2, p38, and JNK MAPK pathways are required for IL-8 mRNA

destabilization

LeTx downregulates the p38, ERK, and JNK MAPK pathways and it was previously

reported that disruption of each MAPK pathway using pharmacological inhibitors destabilizes

IL-8 mRNA in HUVECs (Batty et al., 2006). Here, the relative importance of the MAPK

pathways on IL-8 mRNA stability in fibroblasts was assessed. HT1080 cells were treated with

actinomycin D and either SB202190 (p38 inhibitor), SP600125 (JNK inhibitor), U0126

(MEK1/2 inhibitor), or a combination of all three inhibitors. There was no appreciable

difference between the decay rates of IL-8 mRNA in cells treated with any one of the inhibitors

individually compared to mock treatment, whereas co-treatment with all three inhibitors

destabilized IL-8 mRNA by more than two-fold (Fig. 3.3A).

Pair-wise combinations of the three inhibitors were tested and it was found that each

combination accelerated IL-8 mRNA decay compared to mock treatment (Fig. 3.3B). Inhibition

of the JNK pathway, in combination with either the ERK or the p38 pathways, was least potent

at destabilizing IL-8 mRNA, accelerating the decay by ~1.6 and ~1.7-fold respectively compared

to mock treatment. The combination of inhibiting the p38 and ERK pathway caused a ~2.3 fold

change, nearly as much as inhibiting all three inhibitors together, which caused a ~2.8-fold

change. These results suggest that LeTx-mediated destabilization of IL-8 mRNA is largely due

to inhibition of the p38 and ERK pathways.

47

Figure 3.3: Decay analysis of IL-8 mRNA in response to pharmacological inhibitors. A. HT1080 cells were treated with 1 μg/ml actinomycin D in combination with either DMSO, 10 μM SB202190, 20 μM SP600125, 10 μM U0126, or all three inhibitors. Total RNA was isolated at the indicated times and IL-8 transcript levels were assessed by qPCR. Error bars indicate SEM of three independent experiments. B. HT1080 cells were treated with 1 μg/ml actinomycin D and either DMSO, pair-wise combinations of inhibitors, or all three inhibitors as indicated. Total RNA was isolated at the indicated times and IL-8 transcript levels assessed by qPCR. Error bars indicate SEM of three independent experiments.

3.2.4 TTP is required for LeTx-mediated IL-8 destabilization

Since TTP, TIAR, and KSRP have been demonstrated previously to bind IL-8 mRNA in

vitro (Winzen et al., 2007; Suswam et al., 2005a; Suswam et al., 2005b), the effect of

48

overexpression of these AUBPs on the level of IL-8 mRNA in HT1080 cells was assessed.

FLAG-tagged forms of these proteins were over-expressed and IL-8 mRNA levels were

quantified by qPCR. IL-8 mRNA expression was lowered in cells over-expressing TTP or

TIAR, but not KSRP (Fig. 3.4A).

To ascertain whether TTP or TIAR is required for LeTx-mediated IL-8 transcript

destabilization, RNA interference was used to downregulate TTP and TIAR levels. The TTP

protein level in cells transfected with TTP siRNA was reduced to ~7% of that detected in cells

transfected with negative control siRNA (Fig. 3.4C). Knock-down of TTP increased the stability

of IL-8 mRNA and this stability was not diminished by LeTx treatment (Fig. 3.4D). In contrast,

knock-down of TIAR to ~10% of the control level increased the half-life of IL-8 mRNA from

~81 min to ~116 min, but did not prevent LeTx treatment from increasing the decay rate by 1.6-

fold (Fig. 3.4E and F). These results indicate that TTP, but not TIAR, mediates LeTx-stimulated

IL-8 mRNA decay.

49

50

Fig. 3.4: Involvement of AUBPs in IL-8 mRNA stability. A. Indicated AUBPs were overexpressed in HT1080 cells and total RNA was isolated. Endogenous IL-8 mRNA was measured and normalized to β-actin mRNA levels. Error bars indicate SEM of three independent experiments and the asterisk indicates significant difference (P < 0.05). B. Cytoplasmic extracts were prepared from cells transfected as in (A) and AUBPs were detected by the FLAG-tag. β-Actin protein levels were measured as a loading control. The blot is representative of three independent experiments. C. Extracts from cells transfected with negative control siRNA or siRNA directed against TTP were prepared and immunoblotted for TTP. β-Actin expression was used as loading control. The blot is representative of three independent experiments. D. HT1080 cells from (C) were treated with 1 mg ml-1 actinomycin D in the absence or presence of LeTx. Total RNA was isolated at the indicated times and IL-8 transcript levels were assessed by qPCR. Error bars indicate SEM of three independent experiments. E. Extracts from cells transfected with negative control siRNA or siRNA directed against TIAR were prepared and immunoblotted for TIAR. β-Actin expression was used as loading control. The blot is representative of three independent experiments. F. HT1080 cells from (E) were treated with 1 mg ml-1 actinomycin D in the absence or presence of LeTx. Total RNA was isolated at the indicated times and IL-8 transcript levels were assessed by qPCR. Error bars indicate SEM of three independent experiments. G. HT1080 cells were left untreated or were treated with LeTx for 2 h. Cytoplasmic and nuclear proteins were isolated and equivalent amounts of extract were subjected to Western blotting using antibodies against TTP, TIAR, tubulin and p53. A sample of untreated cytoplasmic extract was treated with lambda protein phosphatase (ppase). The blot is representative of three independent experiments. H. HT1080 cells were treated with LeTx or with indicated pharmacological inhibitors for 2 h. Cytoplasmic proteins were extracted and probed for TTP and tubulin. The blot is representative of seven independent experiments.

3.2.5 Treatment of LeTx or MAPK inhibitors leads to dephosphorylation of TTP

The possibility that LeTx alters the endogenous expression level or localization of TTP

and TIAR was also addressed. Cytoplasmic and nuclear fractions were prepared and probed for

tubulin (a cytoplasmic marker) and p53 (a nuclear marker) (Fig. 3.4G). Most of the TIAR

protein was found in the nuclear fraction in untreated cells (compare lane 1 and 3); toxin

treatment did not alter its expression level or localization. The doublet observed likely

represents two isoforms that resulted from alternative splicing (Taupin et al., 1995).

51

TTP was found to be localized predominantly to the cytoplasm in both untreated and

intoxicated cells (Fig. 3.4G). Multiple bands corresponding to TTP were observed in both cell

lysates, but the uppermost bands were not apparent in lysates prepared from intoxicated cells and

the lower band was more prominent (Fig. 3.4G, compare lanes 1 and 2). That these bands

represented differentially phosphorylated forms of TTP was shown by incubating untreated cell

lysates with Lambda protein phosphatase (lane 5), which led to the loss of the upper forms and

an increase in the amount of the lower form. Thus, LeTx activity induces the dephosphorylation

of TTP.

Pharmacological inhibitors were used to determine which of the MAPK pathways

contribute to TTP phosphorylation. Cells were treated for 2 h with LeTx or with

pharmacological inhibitors before cytoplasmic proteins were prepared and subjected to Western

blotting (Fig. 3.4H). More of the hypophosphorylated (lower) form of TTP was detected in

lysates from cells treated with either LeTx or the MEK1/2 inhibitor (U0126) alone compared

with lysates from untreated cells (compare lane 1 with lanes 2 and 4). Only a slight, yet

reproducible decrease in the amount of the upper TTP band was observed upon treatment with

the p38 or JNK inhibitors alone (compare lane 1 with lanes 3 and 5). Combinations of the

inhibitors did not substantially increase the levels of hypophosphorylated TTP compared with the

MEK1/2 inhibitor treatment, but the upper bands representing the hyperphosphorylated forms of

TTP were clearly less prominent. Together, these results suggest that each of the three MAPK

pathways contributes to the phosphorylation of TTP.

3.2.6 Increase of visible P-bodies in cells treated with LeTx

Processing bodies are dynamic cytoplasmic loci that are enriched in enzymes involved in

5′ to 3′ mRNA decay. Previous studies have shown that TTP can target ARE containing

52

transcripts to P-bodies (Fenger-Gron et al., 2005; Kedersha et al., 2005). This finding, together

with the data demonstrating that overexpression of TTP lowered IL-8 mRNA levels and that

LeTx activity caused dephosphorylation of TTP, led us to investigate the effects of LeTx on P-

body formation and TTP localization. The effects of LeTx on the assembly of P-bodies were

examined by subjecting untreated or intoxicated HT1080 cells to immunofluorescence analysis.

The helicase DDX6 (p54/RCK) was used as a marker to identify P-bodies (red) and Hoescht dye

was used for nuclear staining. The absence (Fig. 3.5A) or the presence (Fig. 3.5B) of P-bodies

can easily be distinguished using this marker. P-bodies were observed in ~26% of untreated cells

and ~52% of intoxicated cells (Fig. 3.5C). Similarly, cells treated with a combination of

pharmacological inhibitors against p38, MEK1/2 and JNK also exhibited a significant increase in

P-body formation (data not shown). These foci corresponded to P-bodies and not stress granules

as they did not colocalize with the stress granule marker TIA-1 (data not shown).

53

54

Fig. 3.5: Effect of LeTx on P-body formation and TTP localization. A–C. HT1080 cells were left untreated or treated with LeTx for 1 h. DDX6 was used to visualize formation of P-bodies. Representative immunofluorescence micrographs of HT1080 cells exhibiting diffuse (A) or punctate (B) staining of endogenous DDX6 (red). Hoechst dye (blue) was used for nuclear staining. A P-body at higher magnification is shown in the insert. The fraction of cells exhibiting P-bodies from untreated or intoxicated cells was quantified from a minimum of 100 cells per sample (C). Values indicate mean and SEM of three independent experiments. The asterisk indicates significant difference (P < 0.05). D–J. HT1080 cells transiently transfected with FLAG-TTP were left untreated or were treated with LeTx for 1 h. Representative immunofluorescence micrographs show cells exhibiting diffuse (D) or punctate (G) staining of FLAG-TTP. Localization of FLAG-TTP to P-bodies was examined by co-staining with DDX6 (E and H). Merged images are shown (F and I). The fraction of cells exhibiting punctate FLAG-TTP staining was quantified (J). Values indicate mean and SEM of three independent experiments. The asterisk indicates significant difference (P < 0.05).

3.2.7 Increased localization of TTP to P-bodies in cells treated with LeTx

TTP localization was compared between untreated and toxin-treated HT1080 cells. Since

endogenous TTP could not be visualized in these cells by immunohistochemistry, FLAG-tagged

TTP was transiently transfected and cells were stained with anti-FLAG and anti-DDX6

antibodies (Fig. 3.5D–I). In some cells, FLAG-TTP was diffusely distributed in the cytoplasm

(Fig. 5D), whereas in others it concentrated at cytoplasmic foci that always colocalized with the

P-body marker DDX6 (Fig. 5H and I). FLAG-TTP colocalized with P-bodies in ~3% of

untreated cells and in ~15% of LeTx-treated cells (Fig. 3.5J).

Next, the effect of LeTx on TTP localization was examined in HeLa cells, which

constitutively display P-bodies and are used by numerous groups to study mRNA decay (Franks

and Lykke-Andersen, 2007; Fenger-Gron et al., 2005; Stoecklin et al., 2004). HeLa cells

were transfected with FLAG-TTP and stained for FLAG and DDX6. In contrast to HT1080 cells,

P-bodies were visible in almost all of the HeLa cells, and treatment with LeTx did not affect P-

body size or number in these cells. Diffuse staining of FLAG-TTP (Fig. 3.6A) that does not

colocalize with P-bodies (Fig. 3.6B and C) is largely seen in untreated cells. A majority of cells

55

treated with LeTx exhibited punctate staining of FLAG-TTP in the cytoplasm (Fig. 3.6D) that

colocalized to P-bodies (Fig. 3.6E and F). FLAG-TTP accumulated at P-bodies in ~22% of the

untreated cells and in ~54% of the toxin-treated cells (Fig. 3.6G). These data suggest therefore

that LeTx causes TTP to be recruited to P-bodies in both HT1080 and HeLa cells.

Fig. 3.6: LeTx increases recruitment of TTP to P-bodies in HeLa cells. HeLa cells transiently transfected with FLAG-TTP were left untreated or were treated with LeTx for 1 h. Representative immunofluorescence micrographs show cells exhibiting diffuse (A) or punctate (D) staining of FLAG-TTP. Localization of FLAG-TTP to P-bodies was examined by co-staining with DDX6 (B and E). Merged images are shown (C and F). The fraction of cells exhibiting punctate FLAG-TTP staining was quantified (G). Values indicate mean and SEM of three independent experiments. The asterisk indicates significant difference (P < 0.05).

56

3.3 Discussion

Interfering with host gene expression is an effective means for a bacterial pathogen to

evade the immune response. Not surprisingly then, bacteria and their toxins have developed

various ways to downregulate gene expression. Anthrax LeTx downregulates expression of the

neutrophil attractant IL-8 both transcriptionally and post-transcriptionally. A recent study

demonstrated that through the inhibition of histone phosphorylation, LeTx decreased chromatin

accessibility to NF-kB, leading to lowered IL-8 transcription. This group further implicated this

mechanism in reducing neutrophil recruitment during a B. anthracis infection (Raymond et al.,

2009). It was previously demonstrated that LeTx post-transcriptionally regulates IL-8 expression

by increasing the rate of IL-8 transcript decay (Batty et al., 2006). In the current study, the cis-

acting and trans-acting elements involved in this process is characterized.

The element in the IL-8 transcript that confers sensitivity to LeTx is confined to the 3′

UTR. This region, encompassing nucleotides 1000–1100, has an AU content of 82% and

contains four AUUUA motifs; this ARE has been identified previously as a potent

destabilization element (Winzen et al., 2004b). Surprisingly, the EYFP–IL-81000–1100 reporter

transcript had a shorter half-life than that of the EYFP–IL-8401–1648 transcript. Thus, there may

be a stabilizing element in the 3′ UTR located outside of this ARE, or alternatively, the distance

between the stop codon and destabilizing element might affect the efficiency of decay.

Inhibition of the MAPK pathways using pharmacological inhibitors was found to have similar

destabilizing effects as LeTx on EYFP–IL-81000–1100 mRNA (data not shown), suggesting that it

is the inactivation of these pathways by LeTx that causes IL-8 mRNA decay.

Investigation into the possible involvement of the ARE binding proteins TTP, TIAR and

KSRP in LeTx-mediated IL-8 mRNA destabilization was motivated by past studies that

demonstrated their participation in IL-8 mRNA decay (Suswam et al., 2008; Winzen et al., 2007;

57

Suswam et al., 2005b). Overexpression of KSRP did not alter the level of IL-8 mRNA in

HT1080 cells, whereas overexpression of either TTP or TIAR lowered the level of IL-8 mRNA.

When TIAR expression was knocked down, the half-life of IL-8 mRNA increased from ~81 min

in control cells to ~116 min. However, as was observed in control cells, LeTx accelerated IL-8

mRNA decay by 1.6-fold in TIAR knock-down cells. This observation suggests that while TIAR

influences IL-8 transcript stability, its activity is not regulated by LeTx or by the MAPK

pathways. Not surprisingly then, treatment with LeTx did not cause the redistribution of TIAR

from the nucleus to the cytoplasm or affect its expression level.

Treatment of cells with LeTx decreased the level of phosphorylation of TTP. Knocking

down TTP using siRNA caused increased stability of IL-8 mRNA – no appreciable decay was

measured in these cells and importantly, LeTx treatment did not destabilize the transcript (Fig.

4D). These results correlated with the observation that IL-8 mRNA decay increased upon

pharmacological inhibition of p38, ERK and JNK, and that these inhibitors also caused

dephosphorylation of TTP. Past studies identified TTP as a substrate of the p38/MAPKAP K2

pathway (Chrestensen et al., 2004; Stoecklin et al., 2004), although inhibition of MEK1/2 was

found to have minimal effect on TTP phosphorylation (Suswam et al., 2008), suggesting that the

involvement of the ERK pathway may differ between cell types. Phosphorylation of TTP

through the JNK pathway has not been reported previously.

TTP activity is regulated by phosphorylation in several ways. It has been reported that

phosphorylated TTP has a lower affinity for mRNA, which would reduce its ability to mediate

transcript degradation (Carballo et al., 2001). Furthermore, phosphorylated TTP binds 14-3-3, a

ubiquitously expressed phosphoserine- and phosphothreonine-binding protein that exerts a

variety of effects on its binding partners (Bridges and Moorhead, 2005). The binding of 14-3-3

58

to TTP affects its localization and potentially its ability to interact with components of the

mRNA degradation machinery.

It was found that hypophosphorylation of TTP in intoxicated cells was associated with an

increase in the number of cells exhibiting P-bodies and an increase in the localization of TTP to

P-bodies. P-bodies are cytoplasmic granules that contain translationally repressed mRNA. The

protein composition of P-bodies has not been fully defined, but the known components include

decapping enzymes, activators of decapping enzymes and exonucleases (Parker and Sheth, 2007;

Eystathioy et al., 2002). P-bodies are dynamic structures that vary in size and number depending

on the availability of non-translating mRNA pools. TTP can nucleate the formation of P-bodies

or deliver ARE-containing transcripts to pre-existing P-bodies for storage or degradation. This

work suggests that LeTx might affect mRNA turnover by altering the number and mRNA

content of P-bodies.

59

Chapter 4

Identification of TTP associated proteins and their role in

IL-8 mRNA destabilization

Contributions: I performed all experiments presented in this chapter.

4.1 Summary

Through the inactivation of the MAPK pathways, anthrax lethal toxin (LeTx) causes the

accelerated decay of IL-8 mRNA through the AU-rich element (ARE) in its 3’ untranslated

region (UTR). TTP is an AU-binding protein (AUBP) that was found to play a key role in LeTx-

mediated destabilization of IL-8 transcripts. Here, the interactions of select TTP-associated

proteins were characterized and examined for their role in IL-8 transcript decay. Non-muscle

myosin heavy chain 9 (myosin-9) and HSC-70 were shown to interact with TTP. Their binding

to TTP was not affected by LeTx treatment. RNase treatment did not affect HSC-70 binding to

TTP, but increased the binding between myosin-9 and TTP. A mutant TTP defective in RNA

binding interacted with HSC-70 at a slightly higher level compared to wild-type TTP, but its

interaction with myosin-9 was significantly diminished. Both myosin-9 and HSC-70 expression

play a role in IL-8 transcript stability, as knock-down of each protein led to a lower rate of IL-8

mRNA destabilization. However, treatment of LeTx continued to mediate the accelerated decay

of IL-8 mRNA in these siRNA-transfected cells, indicating that LeTx may not be exerting its

destabilization effects through myosin-9 or HSC-70. In addition, knock-down of myosin-9 led to

a decrease in TTP expression, and but this could not be attributed to the rate of transcription, or

to transcript or protein stability.

60

4.2 Results

4.2.1 Tandem affinity purification of TTP associated proteins

In the previous chapter, it was demonstrated that IL-8 transcripts were stabilized in cells

transfected with siRNA directed against TTP. In addition, the accelerated decay of IL-8 mRNA

that occurs with LeTx treatment was abolished when TTP was knocked down. Other studies

have shown that TTP binds to IL-8 mRNA in vitro (Suswam et al., 2005b), and various protein

components of P-bodies, including the decapping enzyme hDcp2 and the 5’-3’ exonuclease

hXrn1 (Lykke-Andersen and Wagner, 2005). Here, the possibility of TTP associating with

different proteins between untreated and LeTx-treated cells was assessed. The coding region of

TTP was cloned into a vector containing two tags with affinities for streptavidin and for

calmodulin (pNTAP-TTP). This vector was developed for tandem affinity purification (TAP,

Stratagene), where two consecutive purification steps using each of the two tags mentioned

above allows for a clean isolation of interacting proteins. pNTAP-TTP was transiently

transfected into HT1080 cells and then treated with LeTx for 1 h. Then, the TAP-tagged TTP

was isolated with streptavidin resin and eluted. Co-precipitated proteins were separated by SDS-

PAGE and visualized by Coomassie staining (Fig. 4.1). Select proteins that were precipitated

from cells transfected with pNTAP-TTP but not from untransfected cells were identified by LC

MS/MS. Two proteins between 25 and 35 kDa were identified to be isoforms of 14-3-3. Heat

shock cognate protein (HSC)-70 and myosin-9 were also identified as proteins that associated

with TAP-tagged TTP.

61

Figure 4.1: Isolation of TTP-associated proteins. Cells were either left untransfected or transfected with pNTAP-TTP. Lysates were precipitated with streptavidin resin, subjected to gel electrophoresis, and visualized by Coomassie staining. Arrows indicate protein bands that were isolated for LC-MS/MS identification. Gel is representative of 3 independent experiments.

4.2.2 LeTx treatment does not affect myosin-9 and HSC-70 binding to Flag-TTP

To assess whether the treatment of LeTx would affect TTP association with myosin-9 or

HSC-70, the pNTAP-TTP vector was transfected and protein complexes were isolated using

tandem affinity purification and levels of binding were visualized by Western blot assays. The

level of myosin-9 binding to TTP was unchanged between untreated cells or cells treated with

LeTx for 2h or 4h (Fig. 4.2A). LeTx treatment also did not affect the association between HSC-

70 and TTP (Fig. 4.2B).

62

Figure 4.2: Dependence of LeTx and RNA on TTP binding to myosin-9 and HSC-70 A. Cells were untransfected or transfected with pNTAP-TTP. Untransfected cells were left untreated and only transfected cells were treated with LeTx for 2 or 4 h. Lysates undergo affinity purification according to the TAP protocol, and then along with 1% input lysates, were probed for endogenous myosin-9 by immunoblotting (IB). Probe for calmodulin binding protein (CBP) was used as IP control. Blots are representative of 3 independent experiments. B. Cells were transfected and lysates were purified as in Fig. 4.2A, and levels of precipitated HSC-70 were probed by IB. Blots are representative of 3 independent experiments.

63

C. Cells were either transfected with pNTAP-TTP or pNTAP-TTP F126N. Where indicated, lysates were treated with 0.1μg/μl of RNaseA (Sigma) for 30 min. followed by precipitation with streptavidin resin. 1% input lysate and precipitated proteins were subjected to western blot and probed for HSC-70 and CBP. Blots are representative of 3 independent experiments. D. pcDNA-HA-myosin-9 was co-transfected with either pcDNA-FLAG-TTP or pcDNA-FLAG-TTP-F126N. Lysates were immunoprecipitated with 1μg of HIS antibody or HA antibody and then was probed for FLAG-TTP or HA-myosin-9 by western blotting. Blots are representative of 3 independent experiments.

4.2.3 Binding of myosin-9 and HSC-70 to Flag-TTP is not RNA-dependent

The possibility that the interaction between myosin-9 or HSC-70 with TTP is not simply

through simultaneous binding to the same transcript was examined. Two methods were used to

test the RNA dependence of the interaction between the proteins. First, lysates were treated with

RNase A prior to isolation of the target protein complex. Second, wild-type TTP was compared

to TTP-F126N, which contains a mutation in the zinc finger domain that renders it deficient in

RNA-binding. Streptavidin resin was used to purify target protein complexes, and the level of

bound HSC-70 was examined by Western blotting. RNase treatment did not affect the binding

between HSC-70 and TTP, but an increase in binding was exhibited between HSC-70 and TTP

F126N (Fig. 4.2B). To test the RNA-dependence of the interaction between TTP and myosin-9,

pcDNA-HA-HMM, which is myosin-9 truncated at the rod domain but retains the regulatory

behavior of the whole heavy chain, was expressed with either pcDNA-FLAG-TTP or pcDNA-

FLAG-TTP-F126N where indicated. Cells were lysed by EBC buffer and lysates were

immunoprecipitated with anti-HA antibody and proteins were detected by Western blotting. The

level of FLAG-TTP precipitated was increased in lysates treated with RNase compared to

untreated lysates (Fig. 4.2C). The RNA-binding deficient form of TTP did not co-

immunoprecipitate with myosin-9.

64

4.2.4 Knock-down of myosin-9 or HSC-70 stabilizes IL-8 mRNA

It was previously demonstrated that knock-down of TTP led to stabilization of IL-8

mRNA (Chow et al., 2010). Here, the role of the TTP-associated proteins, myosin-9 and HSC-

70, on IL-8 mRNA stability was assessed. Myosin-9 was knocked down by siRNA, and the

destabilization of IL-8 transcripts was measured and compared to negative control cells. The

protein level of myosin-9 was reduced to ~25% in cells transfected with myosin-9 siRNA

compared to cells transfected with negative control siRNA (Fig. 4.3A). Knock-down of myosin-

9 increased the stability of IL-8 mRNA by 2.8-fold, increasing the half-life from ~63 min to

~173 min (Fig. 4.3B). LeTx caused a decrease in IL-8 transcript destabilization in myosin-9

knock-down cells, from ~173 min to ~53 min. The levels IRF1 mRNA were also measured as a

control as it contains an ARE in its 3’ UTR and its stability is known not to be altered in cells

treated with LeTx (data not shown). The stability of IRF1 mRNA exhibited no significant

changes between control cells or myosin-9 siRNA-transfected cells (Fig. 4.3C).

siRNA-mediated knock-down of HSC-70 caused an ~90% decrease in HSC-70 protein

levels compared to cells transfected with negative control siRNA (Fig. 4.4A). Knock-down of

HSC-70 increased the half-life of IL-8 mRNA from ~63 min to ~116 min, and treatment with

LeTx decreased the half-life to ~53 min (Fig. 4.4B). Again, levels of IRF1 mRNA were not

significantly altered between control cells or myosin-9 siRNA-transfected cells (Fig. 4.4C).

65

Figure 4.3: Effect of myosin-9 siRNA knock-down on IL-8 mRNA destabilization A. Extracts from cells transfected with negative control siRNA or siRNA directed against myosin-9 were immunoblotted for myosin-9. β-actin expression was used as loading control. Blots are representative of 3 independent experiments. B. Cells from (A) were treated with 1 μg/ml actinomycin D in the absence or prescence of LeTx. Total RNA was isolated at the indicated times and IL-8 transcript levels were assessed by qPCR. Error bars indicate SEM of three independent experiments. C. Identical to (B) but IRF1 transcripts levels were detected by qPCR.

66

Figure 4.4: Effect of HSC-70 siRNA knock-down on IL-8 mRNA destabilization A. Extracts from cells transfected with negative control siRNA or siRNA directed against HSC-70 were immunoblotted for HSC-70. β -actin expression was used as loading control. Blots are representative of 3 independent experiments. B. Cells from (A) were treated with 1 μg/ml actinomycin D in the absence or prescence of LeTx. Total RNA was isolated at the indicated times and IL-8 transcript levels were assessed by qPCR. Error bars indicate SEM of three independent experiments. C. Identical to (B) but IRF1 transcripts levels were detected by qPCR.

67

4.2.5 Decreased expression of TTP protein upon myosin-9 knock-down

TTP expression in myosin-9 knock-down cells was examined by Western blotting.

Expression of TTP was diminished to ~45% of control cells, while expression of another AUBP,

TIAR, was unchanged (Fig. 4.5A). It was first examined whether this decrease in TTP

expression was due to an altered level in TTP transcription or transcript stability. Control and

myosin-9 knock-down cells were left untreated or treated with LeTx, and actinomycin D was

added to halt de novo transcription. TTP mRNA levels at time=0 exhibited no discernable

difference, and decay of TTP mRNA was also similar between samples (Fig. 4.5B). TTP protein

stability was next compared between control and myosin-9 knock-down cells. Cytoplasmic

proteins were extracted at various time points after the addition of cycloheximide, and the level

of TTP expression was detected by Western blotting (Fig. 4.5C and D). The level of TTP

expression at 0 min was set to 100% for each respective sample and expression at subsequent

time points was calculated as a percentage. Both control and myosin-9 knock-down cells had

~47% of TTP remaining after 480 min.

68

Figure 4.5: Effect of myosin-9 siRNA knock-down on TTP mRNA and protein expression A. Endogenous TTP, TIAR, myosin-9, and β-actin were detected by western blotting of lysates from cells transfected with either negative control siRNA or myosin-9 specific siRNA. B. Cells from (A) were treated with 1 μg/ml actinomycin D in the absence or presence of LeTx. Total RNA was isolated at the indicated times and TTP transcript levels were assessed by qPCR. Error bars indicate SEM of three independent experiments. C. 16 h after the 2nd round of siRNA transfection, cells were treated with 50μM cycloheximide. Cytoplasmic lysates were extracted at the indicated times and probed for TTP, myosin-9, and β-actin by IB. Blot is representative of 3 independent experiments. D. The intensity of TTP signals at each time point were quantified by densitometry. Error bars indicate SEM of three independent experiments.

69

4.2.6 The head domain of myosin-9 is sufficient for TTP binding

To localize the binding region of TTP on myosin-9, different regions of myosin-9 were

cloned in an HA-tagged vector. The head domain, along with the HMM-like fragment

containing the head domain and a truncated rod domain that is sufficient for dimerization was

overexpressed with Flag-TTP. Cells were lysed and immunoprecipitated with anti-HA antibody

and then immunoblotted with anti-FLAG antibody. Both the myosin-9 head domain and the

HMM-like fragment were able to immunoprecipitate Flag-TTP (Fig 4.6A).

Figure 4.6: Characterization of the region that mediates myosin-9 binding to TTP FLAG-TTP was co-transfected with either pcDNA-HA-Head or pcDNA-HA-HMM. Cells were lysed and IP with antibody directed to HA. One percent of input lysates and immunoprecipitated proteins were subjected to western blot analysis using anti-FLAG or anti-HA antibody.

4.3 Discussion

TTP is a regulator of transcript stability of many important inflammatory cytokines. The

critical role of TTP in regulating the expression of cytokines, such as TNFα, is reflected by TTP

knock-out mice, which suffer from a complex inflammatory phenotype that can be prevented by

injection of antibodies directed against TNFα (Taylor et al., 1996). The last decade and a half

70

have yielded many important findings on the mechanism of TTP mediated transcript decay.

Many components of the mammalian mRNA degradation machinery can interact with TTP

(Tiedje et al., 2010), which is thought to facilitate the degradation of TTP-associated mRNA. I

previously discovered that TTP is required for LeTx-mediated destabilization of IL-8 mRNA

(Chow et al., 2010). Based on this, I screened for molecular interactions of TTP that may be

modulated with the treatment of LeTx. Here, novel interacting partners for TTP, HSC-70 and

myosin-9, were identified, and their roles in IL-8 transcript stability were examined.

In addition to HSC-70 and myosin-9, 14-3-3 adaptor proteins were precipitated with

TAP-tagged TTP. The interaction between TTP and 14-3-3 proteins is thought to be regulated

by the phosphorylation of specific serines on TTP, and this interaction prevents TTP from

associating with the cellular mRNA decay machinery (Chrestensen et al., 2004; Stoecklin et al.,

2004; Johnson et al., 2002). Since the mechanism and downstream effects of this interaction

have been established by numerous groups elsewhere, this study was directed to two novel

protein interactions of TTP.

The interactions of myosin-9 and HSC-70 with TAP-tagged TTP were not significantly

affected by treatment of LeTx (Fig. 4.2A and B). With respect to LeTx-mediated IL-8 transcript

destabilization, I previously demonstrated that knock-down of TTP abrogates this effect.

However, in this study, knock-down of either myosin-9 or HSC-70 did not interfere with LeTx-

mediated decay of IL-8 mRNA, although it stabilized IL-8 transcripts in untreated cells.

Therefore, it is likely that HSC-70, myosin-9, and LeTx each affect the function of TTP

independently and through different mechanisms.

Previous reports demonstrated the ARE-binding potential of HSC-70 (Matsui et al.,

2007; Zimmer et al., 2001). This protein belongs to the heat shock protein (HSP)-70 family, and

both HSC-70 and HSP-70 have the ability to interact directly to sequence specific RNAs through

71

their ATPase domain and a C-terminal substrate binding domain (Zimmer et al., 2001). Both

proteins have been described to play a role in ARE-directed transcript stability (Knapinska et al.,

2011; Matsui et al., 2007; Laroia et al., 1999). The two studies propose different mechanisms

for regulation of mRNA decay: one demonstrated the direct binding of HSC-70 to the ARE on

the 3’UTR of BIM mRNA, preventing the association of AUBPs, and the other demonstrated the

ubiqitination of AUF1 by the HSP-70-HSC-70 complex, leading to proteasomal degradation of

the AUBP and its associated mRNA. RNase A treatment did not disrupt the interaction between

HSC-70 and TTP, excluding the possibility that this co-precipitation was due to independent

binding of the same transcript (Fig. 4.2C). Therefore, it is possible that TTP expression may be

regulated by HSC-70 through ubiqintination, and this may be an additional decay pathway for

TTP-associated mRNAs. Another possibility is that through the chaperone functions of HSC-70,

it promotes the folding of TTP required for binding of decay enzymes. Compared to wt-TTP, the

RNA-binding deficient form of TTP, TTP-F126N (Lai et al., 2002), exhibits a slight increase in

binding to HSC-70; whereas RNase treatment did not affect the binding between wt-TTP and

HSC-70. This result is somewhat confounding, as both strategies were used to determine the

RNA-dependency of the interaction. It is possible that loss of myosin-9 binding to the mutant

TTP (Fig. 4.2D) allowed the binding site for HSC-70 to be more accessible, but further studies

will be required to test this model.

The actin cytoskeleton has been previously suggested to play a role in lymphokine ARE-

mediated mRNA decay (Henics et al., 1997). The authors demonstrated that disruption of actin

filaments by cytochalasin resulted in stabilization of IL-2 and TNFα mRNAs (Henics, 1999;

Henics et al., 1997) - both transcripts are also TTP substrates (Tiedje et al., 2010; Brooks et al.,

2004). These studies imply that actin filaments play a role in post-transcriptional regulation of

certain ARE-containing mRNAs. In this current study, I demonstrate that the head domain of

72

myosin-9 can interact with TTP (Fig. 4.6). This specific isoform of heavy chain binds to myosin

light chains to form non-muscle myosin IIA (NM IIA) (Vicente-Manzanares et al., 2009). The

globular head domain encoded by the heavy chain binds to actin and propels actin filaments by

movement of the head domain caused by ATP hydrolysis. It is conceivable that TTP is in a

complex that contains both NM IIA and actin filaments, and these interactions enhance the

destabilizing activities of TTP by translocating TTP and its mRNA substrate to areas of the

cytoplasm that is populated with RNA decay enzymes.

In addition, knock-down of the myosin-9 led to a specific and significant reduction of

TTP protein expression (Fig. 4.5A). The observed decrease in TTP expression cannot be

attributed to a diminished rate of transcription or an accelerated decay of TTP transcript (Fig.

4.5B). TTP protein stability was also similar between control and myosin-9 knock-down cells

(Fig. 4.5C), which suggest that myosin-9, through its function as a motor protein or by an

unknown mechanism, can modulate the rate of TTP translation. Efforts were made to measure

the rate of translation through radiolabelling endogenous TTP proteins, but the lack of a good

quality TTP antibody prevented specific precipitation of TTP (results not shown).

The interaction between TTP and various protein components of the exosome and P-body

was thought to be a molecular link between mRNAs targeted for decay and the cellular decay

machinery. Here, the interaction between HSC-70 and TTP was demonstrated, which may

provide a reason to explore the possibility that the proteasome degradation pathway may be in

play for TTP-associated transcripts. The additional regulation of TTP by myosin-9 is also

fascinating, and provides for another avenue of TTP research. The regulation and mechanism of

TTP-mediated mRNA decay is far from conclusive, and the current study opens new directions

for future studies of TTP.

73

Chapter 5

Discussion

5.1 Summary of thesis findings

The ability of LeTx to modulate various aspects of the host immune response is well

documented. Past studies have described the inhibition of dendritic cell maturation (Agrawal et

al., 2003), or suppression of T-cell and B-cell proliferation (Fang et al., 2006; Fang et al., 2005;

Paccani et al., 2005) by LeTx. The work in this thesis describes a novel mechanism in which

LeTx dampens the host immune response, which is by altering the stability of a transcript that

encodes for a gene important for innate immunity. Associated proteins of the trans-element

important for mediating LeTx-induced destabilization were also examined for their role in

activating transcript destabilization.

The cis- and trans-elements important for LeTx mediated destabilization of IL-8

transcripts were elucidated and presented in chapter 3. Using deletion analysis, I localized a

region of 100 nucleotides in the 3’UTR that is responsive to LeTx-mediated destabilization of

IL-8 mRNA. The treatment of cells with pharmacological MAPK inhibitors paralleled the

destabilization effects on IL-8 mRNA by LeTx, suggesting that it is through the inhibitions of

these pathways by LeTx that causes IL-8 mRNA decay. TTP was identified to be the trans-

acting element important for LeTx-mediated IL-8 mRNA destabilization. Knock-down of TTP

expression by siRNA rendered stabilization of IL-8 mRNA, and prevented LeTx from exerting

its destabilization effect on IL-8 transcripts. Knock-down of TTP-associated proteins, myosin-9

and HSC-70, also stabilized IL-8 transcripts, but LeTx treatment was still able to cause an

accelerated decay of IL-8 in both types of siRNA transfected cells. Collectively, these data

suggest LeTx, myosin-9, and HSC-70 regulate the function of TTP independently.

74

Fluorescent microscopy revealed that LeTx induces the formation of visible P-bodies,

and promotes the co-localization of TTP to P-bodies. The latter observation suggests the

involvement of cellular motor proteins in translocation of TTP to cytoplasmic sites of mRNA

decay under LeTx stimuli. Indeed, myosin-9 is the heavy chain component of NM IIA, which

propels actin filaments. Therefore, it is conceivable that TTP utilizes the motor function of

myosin-9 to transport targeted mRNAs to sites of decay. HSC-70 was also identified in the TTP

precipitated complex, which may affect the folding of TTP that promotes the binding of mRNA

decay enzymes.

Binding of myosin-9 and HSC-70 to TTP are both insensitive to LeTx treatment. RNase

treatment did not affect HSC-70 binding to TTP, but was slightly increased between HSC-70 and

TTP F126N. The binding between myosin-9 and TTP was increased in lysates treated with

RNase compared to no treatment, and myosin-9 binding to the mutant TTP was significantly

diminished. This suggests that myosin-9 may be competing with RNA substrates that bind to the

same site on TTP. Conversely, data indicates the head domain of myosin-9 is sufficient to bind

to TTP.

5.2 Future directions

5.2.1 Involvement of P-bodies in LeTx mediated decay of IL-8 mRNA

Data in chapter 3 demonstrated that treatment of LeTx promotes the formation of visible

P-bodies and the localization of TTP to P-bodies, suggesting the involvement of P-bodies in

LeTx mediated IL-8 mRNA decay. In addition, the possibility that IL-8 mRNA decay may

occur in the exosome must be examined, as evidence exists for both P-bodies or exosomes as the

site of ARE-mediated transcript decay (Lin et al., 2007; Stoecklin et al., 2006; Fenger-Gron et

al., 2005; Lykke-Andersen and Wagner, 2005). Co-immunoprecipitation assays indicate that

75

TTP can interact with core components of P-bodies, which include DDX6, hDcp2, hDcp1a,

hEdc3, and Hedls in HeLa cells (Fenger-Gron et al., 2005; Lykke-Andersen and Wagner, 2005).

Decay of reporter mRNA containing the ARE of GM-CSF was slowed when protein members of

the P-body were knocked-down in HT1080 cells (Stoecklin et al., 2006). However, visualization

of reporter mRNA with the same type of ARE by immunofluorescence indicates that they are

localized to exosomes in HeLa cells (Lin et al., 2007). Therefore, it must be empirically

determined the pathway IL-8 mRNA undertakes for decay under the stimulus of LeTx, and

whether the same decay pathway is utilized for decay at steady state.

To localize IL-8 mRNA and monitor its decay in a spatial and temporal manner, multiple

bacteriophage MS2 binding sites that have specific affinity for bacteriophage MS2 coat proteins

(Peabody, 1993) can be inserted into the 3’ UTR of IL-8. Together with the expression of

fusion proteins comprised of GFP and MS2 coat protein, the exogenously expressed transcripts

containing MS2 binding sites can be tracked by immunofluoresence (Lin et al., 2007; Kedersha

et al., 2005; Sheth and Parker, 2003). Investigation of the co-localization of the GFP-labelled

IL-8 mRNA with distinct cellular mRNA decay machinery can be achieved by dual-labelling

with antibodies directed against DDX6 or PM-Scl75, biological markers for P-bodies and

exosomes respectively. Results may show a lack of co-localization between IL- 8 transcripts

with either P-bodies or exosomes. It is possible that IL-8 transcript decay occurs in the diffuse

cytoplasm, as most P-body components are distributed diffusely throughout the cytoplasm as

well as being localized to P-bodies (Yu et al., 2005; Cougot et al., 2004a; Eystathioy et al., 2003;

Eystathioy et al., 2002). To examine this possibility, siRNA-mediated knock-down of P-body

components described below would be expected to decrease the speed of IL-8 mRNA

degradation.

76

A 100-nucleotide long AU-rich region was shown to be sufficient in mediating transcript

decay in chapter 3. By attaching the MS2-binding site 3’ of this 100-nucleotide region on a

reporter construct, the potential of this region in recruiting the mRNA degradation machinery can

be compared to that of the full length IL-8 3’ UTR. The results would indicate whether this

region is promoting transcript destabilization by actively recruiting the cellular decay machinery.

Knock-down of key protein components of the P-body or exosome can be used to verify

their role in IL-8 mRNA decay. The half-life of IL-8 mRNA can be measured in both untreated

and LeTx-treated cells that have been transfected with siRNA directed against various

components of the decay machinery. There are studies that indicate mRNAs can enter and be

released from P-bodies in a reversible manner (Brengues et al., 2005; Kedersha et al., 2005;

Teixeira et al., 2005). Therefore, time-lapse microscopy should be used to test whether IL-8

mRNA targeted for decay by LeTx can be shuttled back into the translational pool by treatment

of LPS. Results can either confirm that the fate of IL-8 transcripts targeted for decay cannot be

reversed, or that extracellular conditions may be able to stimulate IL-8 transcripts to exit P-

bodies and re-enter the translating pool. The latter scenario may provide the cell with a robust

response time to quickly adapt to new environmental conditions.

5.2.2 Mapping the interaction between TTP and myosin-9

The central domain of TTP consists of two zinc finger motifs that are important for RNA

binding (Brewer et al., 2004; Lai and Blackshear, 2001; Lai et al., 2000). Unlike the N-terminal

domain, the C-terminal domain has not been demonstrated to interact with any RNA decay

enzymes (Lykke-Andersen and Wagner, 2005). However, deletion of the N-terminal domain

does not render TTP completely inactive, and over-expression of just the C-terminal domain of

TTP impairs ARE-mediated decay (Lykke-Andersen and Wagner, 2005). Together, these

77

observations suggest that a limiting factor in ARE-mediated decay interacts with the C-terminal

region. Therefore, to map the interface TTP requires for myosin-9 binding will further

contribute to the current understanding of the decay mechanism of TTP.

Purified myosin-9 can be incubated alone, or with GST-purified proteins containing

either the N-terminal, the C-terminal, or the central domain of TTP. By separation with native

PAGE, the mixture that contains an interaction between myosin-9 and GST fused proteins can be

deciphered by its altered mobility when compared to the control that contains purified myosin-9

alone. The results from this experiment can be verified by repeat use of these purified proteins

and utilizing cell lysates to test for myosin-9 binding. The GST-tagged proteins described above

can be used to coat glutathione agarose beads by incubation in EBC buffer. Agarose beads

coated with different domains of TTP can then be incubated with HT1080 cell lysates. After

incubation, the standard pull-down protocol can be followed. The presence or absence of

myosin-9 binding to different domains of TTP can be visualized by western blotting.

5.2.3 Importance of NM IIA motility function in its regulation on TTP function

The cellular function of NM IIA is central to cell adhesion and migration. It binds to

actin and propels the sliding or contracting of actin filaments by utilizing the energy from ATP

hydrolysis (Vicente-Manzanares et al., 2009). Out of the three isoforms of NM II, NM IIA

exhibits the highest rate of ATP hydrolysis, and therefore is most suitable for propelling actin

filaments more readily than the other isoforms. A previous study demonstrated that cytochalasin

B treatment stabilized ARE-containing transcripts, IL-2 and TNFα, and that an unidentified

AUBP can associate strongly with actin (Henics et al., 1997). Cytochalasin inhibits actin

polymerization by binding to the growing end of the actin filament, preventing assembly or

78

disassembly of individual actin monomers at the end of the filament. Therefore, this study

provides a possible link between ARE-mediated decay and the actin cytoskeleton.

The findings in chapter 4 revealed that myosin-9, the heavy chain isoform in NM IIA,

interacts with TTP and plays a role in IL-8 mRNA stability. Due to the established function of

NM IIA in actin binding and motility, and the possible role of actin filaments in ARE-mediated

decay, it would be logical to examine the destabilizing function of TTP under conditions of actin

disruption. Latrunculin A binds to monomeric actin at a 1:1 ratio and prevents assembly of

filamentous actin (Spector et al., 1989). Blebbistatin inhibits myosin by preferentially binding to

the myosin-ADP-Pi, which interferes with phosphate release and leaves myosin in an actin-

detached state (Kovacs et al., 2004). I compared the rate of IL-8 mRNA decay in cells that were

untreated, treated with LeTx, with 10μM blebbistatin, or with 1μM latruculin A. As I previously

saw in chapter 3, LeTx activity led to an accelerated decay of IL-8 mRNA compared to untreated

cells, but treatment of blebbistatin or latruculin A did not affect IL-8 stability (Fig. 5.1). This

suggests that F-actin assembly and the motor function of myosin are not involved in regulation

of IL-8 transcripts. However, it may be worthwhile to test the effect of cytochalasin B on IL-8

transcript stability as it disables assembly of filamentous actin by a different mechanism

compared to latrunculin A, and treatment of this agent led to the stabilization of other transcripts

(Henics et al., 1997).

79

Figure 5.1: Effect of blebbistatin and latrunculin treatment on IL-8 mRNA destabilization HT1080 cells were either treated with LeTx for 1 h followed by addition of actinomycin D, or were treated with DMSO, blebbistatin, or latrunculin together with actinomycin D. Total RNA was isolated at the indicated times and transcript levels were measured using qPCR. Error bars indicate SEM of three independent experiments.

5.2.4 Role of TTP in MYH9 diseases

Various mutations in the MYH9 gene have been identified to be responsible for human

disorders such as May-Hegglin anomaly, Fechtner syndrome, and Sebastian syndrome (Heath et

al., 2001; Seri et al., 2000). These conditions are now collectively called MYH9-related

disorders, and are characterized by large platelets, thrombocytopenia, and other non-

hematological manifestations that include the appearance of inclusion bodies in neutrophils

(Kunishima et al., 2001). The inclusion bodies are composed of aggregates of myosin-9 protein,

and are visible by immunofluorescence (Kunishima et al., 2003). Due to the physical connection

between TTP and myosin-9 established in chapter 4, it would be of great interest to examine the

TTP binding potential of mutant myosin-9, and the downstream affects of TTP function in cells

expressing the mutations seen in MYH9 disorders.

80

There are at least 14 amino acid mutations or deletions that have been identified from

patients suffering from MYH9-related disorders (Kunishima et al., 2001). Select mutations can

be engineered into a HA-tagged plasmid that would otherwise contain the coding region of

myosin-9. The binding potential of these mutants to pcDNA-FLAG-TTP can be determined

using standard IP protocols.

The destabilizing functions of TTP should also be examined in cells that exhibit inclusion

bodies in the cytoplasm. Mutant myosin-9 are aggregated and do not retain their wt functions,

and could well affect TTP activity. Neutrophils and other leukocytes from clinical samples of

patients stricken with MYH9-related disorders can be isolated by percoll and ficoll density

gradients. mRNAs can be isolated from normal cells and MYH9-mutated cells, and the levels of

TTP-regulated mRNAs, such as GM-CSF, TNFα, or IL-8 can be examined by real-time PCR. If

the destabilizing activity of TTP is modulated by defective myosin-9, then the levels of these

transcripts should be stabilized. These results can potentially contribute to the field of MYH9

diseases as the influence of mutant MYH9 on leukocytes is still poorly understood.

5.3 Conclusions

Destabilization of mRNA reduces protein synthesis, and also irreversibly inhibits gene

expression. This highly regulated process is receptive to cell stimuli, and stabilizes or

destabilizes transcripts that are appropriate to respond accordingly to the stimuli. AUBPs act as

a link between extracellular signals and mRNAs to be stabilized or targeted for degradation. The

results demonstrated here provide evidence that under the stimuli of LeTx, TTP is modulated

post-translationally and its cellular localization shifts to P-bodies. TTP was found to be able to

bind to IL-8 transcripts in vitro (Suswam et al., 2005b). Further studies are required to directly

implicate the role of P-bodies in IL-8 mRNA decay in cells treated with LeTx. The complete

81

picture of the mechanism of TTP mediated mRNA decay is far from conclusive and the

observation that TTP binds to two novel interactors in myosin-9 and HSC-70 adds to the enigma.

While it is clear TTP can interact with various components of the mRNA decay machinery, there

may be additional factors that may be necessary for TTP to cause mRNA decay, such as factors

involved in mRNA-protein remodeling or in localization of mRNA to P-bodies. More studies

will be required to examine the possibility of TTP-associated proteins, including myosin-9 and

HSC-70, which act as co-factors to TTP.

82

References

Agrawal, A., Lingappa, J., Leppla, S.H., Agrawal, S., Jabbar, A., Quinn, C. and Pulendran, B.

(2003) Impairment of dendritic cells and adaptive immunity by anthrax lethal toxin.

Nature. 424: 329-334.

Aihara, M., Tsuchimoto, D., Takizawa, H., Azuma, A., Wakebe, H., Ohmoto, Y., et al (1997)

Mechanisms involved in Helicobacter pylori-induced interleukin-8 production by a

gastric cancer cell line, MKN45. Infect Immun. 65: 3218-3224.

Al-Souhibani, N., Al-Ahmadi, W., Hesketh, J.E., Blackshear, P.J. and Khabar, K.S. (2010) The

RNA-binding zinc-finger protein tristetraprolin regulates AU-rich mRNAs involved in

breast cancer-related processes. Oncogene. 29: 4205-4215.

Amrani, N., Sachs, M.S. and Jacobson, A. (2006) Early nonsense: mRNA decay solves a

translational problem. Nat Rev Mol Cell Biol. 7: 415-425.

Anderson, P. and Kedersha, N. (2006) RNA granules. J. Cell Biol. 172: 803-808.

Andrei, M.A., Ingelfinger, D., Heintzmann, R., Achsel, T., Rivera-Pomar, R. and Luhrmann, R.

(2005) A role for eIF4E and eIF4E-transporter in targeting mRNPs to mammalian

processing bodies. Rna. 11: 717-727.

Ashwell, J.D. (2006) The many paths to p38 mitogen-activated protein kinase activation in the

immune system. Nat Rev Immunol. 6: 532-540.

Asirvatham, A.J., Gregorie, C.J., Hu, Z., Magner, W.J. and Tomasi, T.B. (2008) MicroRNA

targets in immune genes and the Dicer/Argonaute and ARE machinery components.

Mol Immunol. 45: 1995-2006.

Atasoy, U., Watson, J., Patel, D. and Keene, J. (1998) ELAV protein HuA (HuR) can redistribute

between nucleus and cytoplasm and is upregulated during serum stimulation and T cell

activation. J Cell Sci. 111: 3145-3156.

83

Baggiolini, M. (1998) Chemokines and leukocyte traffic. Nature. 392: 565-568.

Baggiolini, M. and Clark-Lewis, I. (1992) Interleukin-8, a chemotactic and inflammatory

cytokine. FEBS Lett. 307: 97-101.

Baggiolini, M., Walz, A. and Kunkel, S.L. (1989) Neutrophil-activating peptide-1/interleukin 8,

a novel cytokine that activates neutrophils. J Clin Invest. 84: 1045-1049.

Bakheet, T., Frevel, M., Williams, B.R., Greer, W. and Khabar, K.S. (2001) ARED: human AU-

rich element-containing mRNA database reveals an unexpectedly diverse functional

repertoire of encoded proteins. Nucleic Acids Res. 29: 246-254.

Balakathiresan, N.S., Bhattacharyya, S., Gutti, U., Long, R.P., Jozwik, C., Huang, W., et al

(2009) Tristetraprolin regulates IL-8 mRNA stability in cystic fibrosis lung epithelial

cells. Am J Physiol Lung Cell Mol Physiol. 296: L1012-1018.

Bardwell, A.J., Abdollahi, M. and Bardwell, L. (2004) Anthrax lethal factor-cleavage products of

MAPK (mitogen-activated protein kinase) kinases exhibit reduced binding to their

cognate MAPKs. Biochem J. 378: 569-577.

Barreau, C., Paillard, L. and Osborne, H.B. (2006) AU-rich elements and associated factors: are

there unifying principles? Nucl. Acids Res. 33: 7138-7150.

Bashkirov, V.I., Scherthan, H., Solinger, J.A., Buerstedde, J.M. and Heyer, W.D. (1997) A

mouse cytoplasmic exoribonuclease (mXRN1p) with preference for G4 tetraplex

substrates. J Cell Biol. 136: 761-773.

Batty, S., Chow, E.M.C., Kassam, A., Der, S.D. and Mogridge, J. (2006) Inhibition of mitogen-

activated protein kinase signalling by Bacillus anthracis lethal toxin causes

destabilization of interleukin-8 mRNA. Cellular Microbiology. 8: 130-138.

84

Behm-Ansmant, I., Rehwinkel, J., Doerks, T., Stark, A., Bork, P. and Izaurralde, E. (2006)

mRNA degradation by miRNAs and GW182 requires both CCR4:NOT deadenylase and

DCP1:DCP2 decapping complexes. Genes Dev. 20: 1885-1898.

Bernstein, E., Caudy, A.A., Hammond, S.M. and Hannon, G.J. (2001) Role for a bidentate

ribonuclease in the initiation step of RNA interference. Nature. 409: 363-366.

Bevilacqua, A., Ceriani, M.C., Capaccioli, S. and Nicolin, A. (2003) Post-transcriptional

regulation of gene expression by degradation of messenger RNAs. J Cell Physiol. 195:

356-372.

Biswas, R., Datta, S., Gupta, J.D., Novotny, M., Tebo, J. and Hamilton, T.A. (2003) Regulation

of chemokine mRNA stability by lipopolysaccharide and IL-10. J Immunol. 170: 6202-

6208.

Blackshear, P.J. (2002) Tristetraprolin and other CCCH tandem zinc-finger proteins in the

regulation of mRNA turnover. Biochem. Soc. Trans. 30: 945-952.

Bradley, K.A., Mogridge, J., Mourez, M., Collier, R.J. and Young, J.A. (2001) Identification of

the cellular receptor for anthrax toxin. Nature. 414: 225-229.

Brasier, A.R., Jamaluddin, M., Casola, A., Duan, W., Shen, Q. and Garofalo, R.P. (1998) A

promoter recruitment mechanism for tumor necrosis factor-alpha-induced interleukin-8

transcription in type II pulmonary epithelial cells. Dependence on nuclear abundance of

Rel A, NF-kappaB1, and c-Rel transcription factors. J Biol Chem. 273: 3551-3561.

Brengues, M., Teixeira, D. and Parker, R. (2005) Movement of eukaryotic mRNAs between

polysomes and cytoplasmic processing bodies. Science. 310: 486-489.

Brewer, B.Y., Malicka, J., Blackshear, P.J. and Wilson, G.M. (2004) RNA Sequence Elements

Required for High Affinity Binding by the Zinc Finger Domain of Tristetraprolin:

85

CONFORMATIONAL CHANGES COUPLED TO THE BIPARTITE NATURE OF

AU-RICH mRNA-DESTABILIZING MOTIFS. J. Biol. Chem. 279: 27870-27877.

Briata, P., Forcales, S.V., Ponassi, M., Corte, G., Chen, C.Y., Karin, M., et al (2005) p38-

dependent phosphorylation of the mRNA decay-promoting factor KSRP controls the

stability of select myogenic transcripts. Mol Cell. 20: 891-903.

Bridges, D. and Moorhead, G.B. (2005) 14-3-3 proteins: a number of functions for a numbered

protein. Sci STKE. 2005: re10.

Brook, M., Tchen, C.R., Santalucia, T., McIlrath, J., Arthur, J.S., Saklatvala, J. and Clark, A.R.

(2006) Posttranslational regulation of tristetraprolin subcellular localization and protein

stability by p38 mitogen-activated protein kinase and extracellular signal-regulated

kinase pathways. Mol Cell Biol. 26: 2408-2418.

Brooks, S.A., Connolly, J.E. and Rigby, W.F.C. (2004) The Role of mRNA Turnover in the

Regulation of Tristetraprolin Expression: Evidence for an Extracellular Signal-

Regulated Kinase-Specific, AU-Rich Element-Dependent, Autoregulatory Pathway. J

Immunol. 172: 7263-7271.

Brossier, F., Sirard, J.C., Guidi-Rontani, C., Duflot, E. and Mock, M. (1999) Functional analysis

of the carboxy-terminal domain of Bacillus anthracis protective antigen. Infect Immun.

67: 964-967.

Butler, J.S. (2002) The yin and yang of the exosome. Trends Cell Biol. 12: 90-96.

Campos, A.R., Grossman, D. and White, K. (1985) Mutant alleles at the locus elav in Drosophila

melanogaster lead to nervous system defects. A developmental-genetic analysis. J

Neurogenet. 2: 197-218.

86

Cao, H., Dzineku, F. and Blackshear, P.J. (2003) Expression and purification of recombinant

tristetraprolin that can bind to tumor necrosis factor-alpha mRNA and serve as a

substrate for mitogen-activated protein kinases. Arch Biochem Biophys. 412: 106-120.

Cao, H., Deterding, L.J., Venable, J.D., Kennington, E.A., Yates, J.R., Tomer, K.B. and

Blackshear, P.J. (2006) Identification of the anti-inflammatory protein tristetraprolin as

a hyperphosphorylated protein by mass spectrometry and site-directed mutagenesis.

Biochem J. 394: 285-297.

Caput, D., Beutler, B., Hartog, K., Thayer, R., Brown-Shimer, S. and Cerami, A. (1986)

Identification of a common nucleotide sequence in the 3'-untranslated region of mRNA

molecules specifying inflammatory mediators. Proc Natl Acad Sci U S A. 83: 1670-

1674.

Carballo, E., Gilkeson, G.S. and Blackshear, P.J. (1997) Bone marrow transplantation reproduces

the tristetraprolin-deficiency syndrome in recombination activating gene-2 (-/-) mice.

Evidence that monocyte/macrophage progenitors may be responsible for TNFalpha

overproduction. J Clin Invest. 100: 986-995.

Carballo, E., Lai, W.S. and Blackshear, P.J. (1998) Feedback Inhibition of Macrophage Tumor

Necrosis Factor-{alpha} Production by Tristetraprolin. Science. 281: 1001-1005.

Carballo, E., Lai, W.S. and Blackshear, P.J. (2000) Evidence that tristetraprolin is a

physiological regulator of granulocyte-macrophage colony-stimulating factor messenger

RNA deadenylation and stability. Blood. 95: 1891-1899.

Carballo, E., Cao, H., Lai, W.S., Kennington, E.A., Campbell, D. and Blackshear, P.J. (2001)

Decreased sensitivity of tristetraprolin-deficient cells to p38 inhibitors suggests the

involvement of tristetraprolin in the p38 signaling pathway. J Biol Chem. 276: 42580-

42587.

87

Chang, L. and Karin, M. (2001) Mammalian MAP kinase signalling cascades. Nature. 410: 37-

40.

Chen, C.Y. and Shyu, A.B. (1994) Selective degradation of early-response-gene mRNAs:

functional analyses of sequence features of the AU-rich elements. Mol Cell Biol. 14:

8471-8482.

Chen, C.Y. and Shyu, A.B. (1995) AU-rich elements: characterization and importance in mRNA

degradation. Trends Biochem Sci. 20: 465-470.

Chen, C.Y., Gherzi, R., Andersen, J.S., Gaietta, G., Jurchott, K., Royer, H.D., et al (2000)

Nucleolin and YB-1 are required for JNK-mediated interleukin-2 mRNA stabilization

during T-cell activation. Genes Dev. 14: 1236-1248.

Chen, C.Y., Gherzi, R., Ong, S.E., Chan, E.L., Raijmakers, R., Pruijn, G.J., et al (2001) AU

binding proteins recruit the exosome to degrade ARE-containing mRNAs. Cell. 107:

451-464.

Chen, Y.-L., Huang, Y.-L., Lin, N.-Y., Chen, H.-C., Chiu, W.-C. and Chang, C.-J. (2006)

Differential regulation of ARE-mediated TNF[alpha] and IL-1[beta] mRNA stability by

lipopolysaccharide in RAW264.7 cells. Biochemical and Biophysical Research

Communications. 346: 160-168.

Chou, C.-F., Mulky, A., Maitra, S., Lin, W.-J., Gherzi, R., Kappes, J. and Chen, C.-Y. (2006)

Tethering KSRP, a Decay-Promoting AU-Rich Element-Binding Protein, to mRNAs

Elicits mRNA Decay. Mol. Cell. Biol. 26: 3695-3706.

Chow, E.M.C., Batty, S. and Mogridge, J. (2010) Anthrax lethal toxin promotes

dephosphorylation of TTP and formation of processing bodies. Cellular Microbiology.

12: 557-568.

88

Chrestensen, C.A., Schroeder, M.J., Shabanowitz, J., Hunt, D.F., Pelo, J.W., Worthington, M.T.

and Sturgill, T.W. (2004) MAPKAP Kinase 2 Phosphorylates Tristetraprolin on in Vivo

Sites Including Ser178, a Site Required for 14-3-3 Binding. J. Biol. Chem. 279: 10176-

10184.

Chu, C.Y. and Rana, T.M. (2006) Translation repression in human cells by microRNA-induced

gene silencing requires RCK/p54. PLoS Biol. 4: e210.

Coller, J. and Parker, R. (2005) General translational repression by activators of mRNA

decapping. Cell. 122: 875-886.

Collier, R.J. and Young, J.A. (2003) Anthrax toxin. Annu Rev Cell Dev Biol. 19: 45-70.

Comer, J.E., Galindo, C.L., Zhang, F., Wenglikowski, A.M., Bush, K.L., Garner, H.R., et al

(2006) Murine macrophage transcriptional and functional responses to Bacillus

anthracis edema toxin. Microbial Pathogenesis. 41: 96-110.

Cougot, N., Babajko, S. and Seraphin, B. (2004a) Cytoplasmic foci are sites of mRNA decay in

human cells. J. Cell Biol. 165: 31-40.

Cougot, N., van Dijk, E., Babajko, S. and Seraphin, B. (2004b) 'Cap-tabolism'. Trends Biochem

Sci. 29: 436-444.

Cunningham, K., Lacy, D.B., Mogridge, J. and Collier, R.J. (2002) Mapping the lethal factor and

edema factor binding sites on oligomeric anthrax protective antigen. Proc Natl Acad Sci

U S A. 99: 7049-7053.

Dean, J.L., Sarsfield, S.J., Tsounakou, E. and Saklatvala, J. (2003) p38 Mitogen-activated protein

kinase stabilizes mRNAs that contain cyclooxygenase-2 and tumor necrosis factor AU-

rich elements by inhibiting deadenylation. J Biol Chem. 278: 39470-39476.

89

Deleault, K.M., Skinner, S.J. and Brooks, S.A. (2008) Tristetraprolin regulates TNF TNF-[alpha]

mRNA stability via a proteasome dependent mechanism involving the combined action

of the ERK and p38 pathways. Molecular Immunology. 45: 13-24.

Dember, L.M., Kim, N.D., Liu, K.-Q. and Anderson, P. (1996) Individual RNA Recognition

Motifs of TIA-1 and TIAR Have Different RNA Binding Specificities. J. Biol. Chem.

271: 2783-2788.

Diaz-Moreno, I., Hollingworth, D., Frenkiel, T.A., Kelly, G., Martin, S., Howell, S., et al (2009)

Phosphorylation-mediated unfolding of a KH domain regulates KSRP localization via

14-3-3 binding. Nat Struct Mol Biol. 16: 238-246.

Dixon, D.A., Tolley, N.D., King, P.H., Nabors, L.B., McIntyre, T.M., Zimmerman, G.A. and

Prescott, S.M. (2001) Altered expression of the mRNA stability factor HuR promotes

cyclooxygenase-2 expression in colon cancer cells. J Clin Invest. 108: 1657-1665.

Dormoy-Raclet, V., Menard, I., Clair, E., Kurban, G., Mazroui, R., Di Marco, S., et al (2007)

The RNA-Binding Protein HuR Promotes Cell Migration and Cell Invasion by

Stabilizing the {beta}-actin mRNA in a U-Rich-Element-Dependent Manner. Mol. Cell.

Biol. 27: 5365-5380.

Dorssers, L., Burger, H., Bot, F., Delwel, R., Geurts van Kessel, A.H., Lowenberg, B. and

Wagemaker, G. (1987) Characterization of a human multilineage-colony-stimulating

factor cDNA clone identified by a conserved noncoding sequence in mouse interleukin-

3. Gene. 55: 115-124.

Duesbery, N.S., Webb, C.P., Leppla, S.H., Gordon, V.M., Klimpel, K.R., Copeland, T.D., et al

(1998) Proteolytic inactivation of MAP-kinase-kinase by anthrax lethal factor. Science.

280: 734-737.

90

During, R.L., Li, W., Hao, B., Koenig, J.M., Stephens, D.S., Quinn, C.P. and Southwick, F.S.

(2005) Anthrax lethal toxin paralyzes neutrophil actin-based motility. J Infect Dis. 192:

837-845.

Erwin, J.L., DaSilva, L.M., Bavari, S., Little, S.F., Friedlander, A.M. and Chanh, T.C. (2001)

Macrophage-derived cell lines do not express proinflammatory cytokines after exposure

to Bacillus anthracis lethal toxin. Infect Immun. 69: 1175-1177.

Eulalio, A., Behm-Ansmant, I. and Izaurralde, E. (2007) P bodies: at the crossroads of post-

transcriptional pathways. 8: 9-22.

Eulalio, A., Huntzinger, E., Nishihara, T., Rehwinkel, J., Fauser, M. and Izaurralde, E. (2009)

Deadenylation is a widespread effect of miRNA regulation. Rna. 15: 21-32.

Eystathioy, T., Chan, E.K., Tenenbaum, S.A., Keene, J.D., Griffith, K. and Fritzler, M.J. (2002)

A phosphorylated cytoplasmic autoantigen, GW182, associates with a unique

population of human mRNAs within novel cytoplasmic speckles. Mol Biol Cell. 13:

1338-1351.

Eystathioy, T., Jakymiw, A., Chan, E.K., Seraphin, B., Cougot, N. and Fritzler, M.J. (2003) The

GW182 protein colocalizes with mRNA degradation associated proteins hDcp1 and

hLSm4 in cytoplasmic GW bodies. Rna. 9: 1171-1173.

Fan, X.C. and Steitz, J.A. (1998) Overexpression of HuR, a nuclear-cytoplasmic shuttling

protein, increases the in vivo stability of ARE-containing mRNAs. Embo J. 17: 3448-

3460.

Fang, H., Cordoba-Rodriguez, R., Lankford, C.S.R. and Frucht, D.M. (2005) Anthrax Lethal

Toxin Blocks MAPK Kinase-Dependent IL-2 Production in CD4+ T Cells. J Immunol.

174: 4966-4971.

91

Fang, H., Xu, L., Chen, T.Y., Cyr, J.M. and Frucht, D.M. (2006) Anthrax lethal toxin has direct

and potent inhibitory effects on B cell proliferation and immunoglobulin production. J

Immunol. 176: 6155-6161.

Fenger-Gron, M., Fillman, C., Norrild, B. and Lykke-Andersen, J. (2005) Multiple Processing

Body Factors and the ARE Binding Protein TTP Activate mRNA Decapping. Molecular

Cell. 20: 905-915.

Franks, T.M. and Lykke-Andersen, J. (2007) TTP and BRF proteins nucleate processing body

formation to silence mRNAs with AU-rich elements. Genes Dev. 21: 719-735.

Franks, T.M. and Lykke-Andersen, J. (2008) The Control of mRNA Decapping and P-Body

Formation. 32: 605-615.

Gallouzi, I.E., Brennan, C.M., Stenberg, M.G., Swanson, M.S., Eversole, A., Maizels, N. and

Steitz, J.A. (2000) HuR binding to cytoplasmic mRNA is perturbed by heat shock. Proc

Natl Acad Sci U S A. 97: 3073-3078.

Gao, M., Wilusz, C.J., Peltz, S.W. and Wilusz, J. (2001) A novel mRNA-decapping activity in

HeLa cytoplasmic extracts is regulated by AU-rich elements. Embo J. 20: 1134-1143.

Gebeshuber, C.A., Zatloukal, K. and Martinez, J. (2009) miR-29a suppresses tristetraprolin,

which is a regulator of epithelial polarity and metastasis. EMBO Rep. 10: 400-405.

Gherzi, R., Lee, K.Y., Briata, P., Wegmuller, D., Moroni, C., Karin, M. and Chen, C.Y. (2004) A

KH domain RNA binding protein, KSRP, promotes ARE-directed mRNA turnover by

recruiting the degradation machinery. Mol Cell. 14: 571-583.

Gillis, P. and Malter, J.S. (1991) The adenosine-uridine binding factor recognizes the AU-rich

elements of cytokine, lymphokine, and oncogene mRNAs. J Biol Chem. 266: 3172-

3177.

92

Go, M.Y., Chow, E.M.C. and Mogridge, J. (2009) The Cytoplasmic Domain of Anthrax Toxin

Receptor 1 Affects Binding of the Protective Antigen. Infect. Immun. 77: 52-59.

Good, P.J. (1995) A conserved family of elav-like genes in vertebrates. Proc Natl Acad Sci U S

A. 92: 4557-4561.

Gordon, V.M., Klimpel, K.R., Arora, N., Henderson, M.A. and Leppla, S.H. (1995) Proteolytic

activation of bacterial toxins by eukaryotic cells is performed by furin and by additional

cellular proteases. Infect Immun. 63: 82-87.

Gringhuis, S.I., Garcia-Vallejo, J.J., van Het Hof, B. and van Dijk, W. (2005) Convergent actions

of I kappa B kinase beta and protein kinase C delta modulate mRNA stability through

phosphorylation of 14-3-3 beta complexed with tristetraprolin. Mol Cell Biol. 25: 6454-

6463.

Gruber, A.R., Fallmann, J., Kratochvill, F., Kovarik, P. and Hofacker, I.L. (2010) AREsite: a

database for the comprehensive investigation of AU-rich elements. Nucleic Acids

Research.

Gueydan, C., Droogmans, L., Chalon, P., Huez, G., Caput, D. and Kruys, V. (1999)

Identification of TIAR as a Protein Binding to the Translational Regulatory AU-rich

Element of Tumor Necrosis Factor alpha mRNA. J. Biol. Chem. 274: 2322-2326.

Guidi-Rontani, C., Weber-Levy, M., Labruyere, E. and Mock, M. (1999) Germination of

Bacillus anthracis spores within alveolar macrophages. Molecular Microbiology. 31: 9-

17.

Hau, H.H., Walsh, R.J., Ogilvie, R.L., Williams, D.A., Reilly, C.S. and Bohjanen, P.R. (2007)

Tristetraprolin recruits functional mRNA decay complexes to ARE sequences. J Cell

Biochem. 100: 1477-1492.

93

Heath, K.E., Campos-Barros, A., Toren, A., Rozenfeld-Granot, G., Carlsson, L.E., Savige, J., et

al (2001) Nonmuscle myosin heavy chain IIA mutations define a spectrum of autosomal

dominant macrothrombocytopenias: May-Hegglin anomaly and Fechtner, Sebastian,

Epstein, and Alport-like syndromes. Am J Hum Genet. 69: 1033-1045.

Heidi H. Hau, R.J.W., Rachel L. Ogilvie, Darlisha A. Williams, Cavan S. Reilly, Paul R.

Bohjanen, (2007) Tristetraprolin recruits functional mRNA decay complexes to ARE

sequences. Journal of Cellular Biochemistry. 100: 1477-1492.

Henics, T. (1999) Microfilament-dependent modulation of cytoplasmic protein binding to

TNFalpha mRNA AU-rich instability element in human lymphoid cells. Cell Biol Int.

23: 561-570.

Henics, T., Nagy, E. and Szekeres-Bartho, J. (1997) Interaction of AU-rich sequence binding

proteins with actin: possible involvement of the actin cytoskeleton in lymphokine

mRNA turnover. J Cell Physiol. 173: 19-27.

Hitti, E., Iakovleva, T., Brook, M., Deppenmeier, S., Gruber, A.D., Radzioch, D., et al (2006)

Mitogen-Activated Protein Kinase-Activated Protein Kinase 2 Regulates Tumor

Necrosis Factor mRNA Stability and Translation Mainly by Altering Tristetraprolin

Expression, Stability, and Binding to Adenine/Uridine-Rich Element. Mol. Cell. Biol.

26: 2399-2407.

Holtmann, H., Winzen, R., Holland, P., Eickemeier, S., Hoffmann, E., Wallach, D., et al (1999)

Induction of interleukin-8 synthesis integrates effects on transcription and mRNA

degradation from at least three different cytokine- or stress-activated signal transduction

pathways. Mol Cell Biol. 19: 6742-6753.

Holtmann, H., Enninga, J., Kalble, S., Thiefes, A., Dorrie, A., Broemer, M., et al (2001) The

MAPK kinase kinase TAK1 plays a central role in coupling the interleukin-1 receptor to

94

both transcriptional and RNA-targeted mechanisms of gene regulation. J Biol Chem.

276: 3508-3516.

Hoover, D.L., Friedlander, A.M., Rogers, L.C., Yoon, I.K., Warren, R.L. and Cross, A.S. (1994)

Anthrax edema toxin differentially regulates lipopolysaccharide-induced monocyte

production of tumor necrosis factor alpha and interleukin-6 by increasing intracellular

cyclic AMP. Infect. Immun. 62: 4432-4439.

Hutvagner, G. and Zamore, P.D. (2002) A microRNA in a multiple-turnover RNAi enzyme

complex. Science. 297: 2056-2060.

Jakymiw, A., Lian, S., Eystathioy, T., Li, S., Satoh, M., Hamel, J.C., et al (2005) Disruption of

GW bodies impairs mammalian RNA interference. Nat Cell Biol. 7: 1267-1274.

Jing, Q., Huang, S., Guth, S., Zarubin, T., Motoyama, A., Chen, J., et al (2005) Involvement of

MicroRNA in AU-Rich Element-Mediated mRNA Instability. Cell. 120: 623-634.

Johnson, B.A., Stehn, J.R., Yaffe, M.B. and Blackwell, T.K. (2002) Cytoplasmic Localization of

Tristetraprolin Involves 14-3-3-dependent and -independent Mechanisms. J. Biol.

Chem. 277: 18029-18036.

Kasahara, T., Mukaida, N., Yamashita, K., Yagisawa, H., Akahoshi, T. and Matsushima, K.

(1991) IL-1 and TNF-alpha induction of IL-8 and monocyte chemotactic and activating

factor (MCAF) mRNA expression in a human astrocytoma cell line. Immunology. 74:

60-67.

Kassam, A., Der, S.D. and Mogridge, J. (2005) Differentiation of human monocytic cell lines

confers susceptibility to Bacillus anthracis lethal toxin. Cell Microbiol. 7: 281-292.

Kawasaki, H. and Taira, K. (2004) MicroRNA-196 inhibits HOXB8 expression in myeloid

differentiation of HL60 cells. Nucleic Acids Symp Ser (Oxf): 211-212.

95

Kedersha, N., Chen, S., Gilks, N., Li, W., Miller, I.J., Stahl, J. and Anderson, P. (2002) Evidence

that ternary complex (eIF2-GTP-tRNA(i)(Met))-deficient preinitiation complexes are

core constituents of mammalian stress granules. Mol Biol Cell. 13: 195-210.

Kedersha, N., Cho, M.R., Li, W., Yacono, P.W., Chen, S., Gilks, N., et al (2000) Dynamic

Shuttling of TIA-1 Accompanies the Recruitment of mRNA to Mammalian Stress

Granules. J. Cell Biol. 151: 1257-1268.

Kedersha, N., Stoecklin, G., Ayodele, M., Yacono, P., Lykke-Andersen, J., Fitzler, M.J., et al

(2005) Stress granules and processing bodies are dynamically linked sites of mRNP

remodeling. J. Cell Biol. 169: 871-884.

Kedersha, N.L., Gupta, M., Li, W., Miller, I. and Anderson, P. (1999) RNA-binding Proteins

TIA-1 and TIAR Link the Phosphorylation of eIF-2{alpha} to the Assembly of

Mammalian Stress Granules. J. Cell Biol. 147: 1431-1442.

Keene, J.D. (1999) Why is Hu where? Shuttling of early-response-gene messenger RNA subsets.

Proc Natl Acad Sci U S A. 96: 5-7.

King, P.H., Levine, T.D., Fremeau, R.T., Jr. and Keene, J.D. (1994) Mammalian homologs of

Drosophila ELAV localized to a neuronal subset can bind in vitro to the 3' UTR of

mRNA encoding the Id transcriptional repressor. J Neurosci. 14: 1943-1952.

Kintzer, A.F., Thoren, K.L., Sterling, H.J., Dong, K.C., Feld, G.K., Tang, II, et al (2009) The

protective antigen component of anthrax toxin forms functional octameric complexes. J

Mol Biol. 392: 614-629.

Klimpel, K.R., Arora, N. and Leppla, S.H. (1994) Anthrax toxin lethal factor contains a zinc

metalloprotease consensus sequence which is required for lethal toxin activity. Mol

Microbiol. 13: 1093-1100.

96

Knapinska, A.M., Gratacos, F.M., Krause, C.D., Hernandez, K., Jensen, A.G., Bradley, J.J., et al

(2011) Chaperone Hsp27 modulates AUF1 proteolysis and AU-rich element-mediated

mRNA degradation. Mol Cell Biol.

Koehler, T.M. (2009) Bacillus anthracis physiology and genetics. Mol Aspects Med. 30: 386-396.

Kovacs, M., Toth, J., Hetenyi, C., Malnasi-Csizmadia, A. and Sellers, J.R. (2004) Mechanism of

blebbistatin inhibition of myosin II. J Biol Chem. 279: 35557-35563.

Krantz, B.A., Trivedi, A.D., Cunningham, K., Christensen, K.A. and Collier, R.J. (2004) Acid-

induced unfolding of the amino-terminal domains of the lethal and edema factors of

anthrax toxin. J Mol Biol. 344: 739-756.

Kuhn, U. and Wahle, E. (2004) Structure and function of poly(A) binding proteins. Biochim

Biophys Acta. 1678: 67-84.

Kunishima, S., Matsushita, T., Kojima, T., Sako, M., Kimura, F., Jo, E.K., et al (2003)

Immunofluorescence analysis of neutrophil nonmuscle myosin heavy chain-A in MYH9

disorders: association of subcellular localization with MYH9 mutations. Lab Invest. 83:

115-122.

Kunishima, S., Matsushita, T., Kojima, T., Amemiya, N., Choi, Y.M., Hosaka, N., et al (2001)

Identification of six novel MYH9 mutations and genotype-phenotype relationships in

autosomal dominant macrothrombocytopenia with leukocyte inclusions. J Hum Genet.

46: 722-729.

Lai, W.S. and Blackshear, P.J. (2001) Interactions of CCCH Zinc Finger Proteins with mRNA.

TRISTETRAPROLIN-MEDIATED AU-RICH ELEMENT-DEPENDENT mRNA

DEGRADATION CAN OCCUR IN THE ABSENCE OF A POLY(A) TAIL. J. Biol.

Chem. 276: 23144-23154.

97

Lai, W.S., Stumpo, D.J. and Blackshear, P.J. (1990) Rapid insulin-stimulated accumulation of an

mRNA encoding a proline-rich protein. J Biol Chem. 265: 16556-16563.

Lai, W.S., Kennington, E.A. and Blackshear, P.J. (2002) Interactions of CCCH Zinc Finger

Proteins with mRNA. Journal of Biological Chemistry. 277: 9606-9613.

Lai, W.S., Kennington, E.A. and Blackshear, P.J. (2003) Tristetraprolin and its family members

can promote the cell-free deadenylation of AU-rich element-containing mRNAs by

poly(A) ribonuclease. Mol Cell Biol. 23: 3798-3812.

Lai, W.S., Carballo, E., Thorn, J.M., Kennington, E.A. and Blackshear, P.J. (2000) Interactions

of CCCH Zinc Finger Proteins with mRNA. BINDING OF TRISTETRAPROLIN-

RELATED ZINC FINGER PROTEINS TO AU-RICH ELEMENTS AND

DESTABILIZATION OF mRNA. J. Biol. Chem. 275: 17827-17837.

Lai, W.S., Parker, J.S., Grissom, S.F., Stumpo, D.J. and Blackshear, P.J. (2006) Novel mRNA

targets for tristetraprolin (TTP) identified by global analysis of stabilized transcripts in

TTP-deficient fibroblasts. Mol Cell Biol. 26: 9196-9208.

Laroia, G., Cuesta, R., Brewer, G. and Schneider, R.J. (1999) Control of mRNA Decay by Heat

Shock-Ubiquitin-Proteasome Pathway. Science. 284: 499-502.

Lee, Y., Kim, M., Han, J., Yeom, K.H., Lee, S., Baek, S.H. and Kim, V.N. (2004) MicroRNA

genes are transcribed by RNA polymerase II. Embo J. 23: 4051-4060.

Leppla, S.H. (1982 ) Anthrax toxin edema factor: a bacterial adenylate cyclase that increases

cyclic AMP concentrations of eukaryotic cells Proceedings of the National Academy of

Sciences of the United States of America 79 3162-3166

Li, H., Park, S., Kilburn, B., Jelinek, M.A., Henschen-Edman, A., Aswad, D.W., et al (2002)

Lipopolysaccharide-induced methylation of HuR, an mRNA-stabilizing protein, by

98

CARM1. Coactivator-associated arginine methyltransferase. J Biol Chem. 277: 44623-

44630.

Liang, J., Lei, T., Song, Y., Yanes, N., Qi, Y. and Fu, M. (2009) RNA-destabilizing factor

tristetraprolin negatively regulates NF-kappaB signaling. J Biol Chem. 284: 29383-

29390.

Liao, B., Hu, Y. and Brewer, G. (2007) Competitive binding of AUF1 and TIAR to MYC

mRNA controls its translation. 14: 511-518.

Lin, W.-J., Duffy, A. and Chen, C.-Y. (2007) Localization of AU-rich element-containing

mRNA in cytoplasmic granules containing exosome subunits. J. Biol. Chem.:

M702281200.

Linker, K., Pautz, A., Fechir, M., Hubrich, T., Greeve, J. and Kleinert, H. (2005) Involvement of

KSRP in the post-transcriptional regulation of human iNOS expression-complex

interplay of KSRP with TTP and HuR. Nucl. Acids Res. 33: 4813-4827.

Liu, J., Valencia-Sanchez, M.A., Hannon, G.J. and Parker, R. (2005) MicroRNA-dependent

localization of targeted mRNAs to mammalian P-bodies. Nat Cell Biol. 7: 719-723.

Liu, Q., Greimann, J.C. and Lima, C.D. (2006) Reconstitution, Activities, and Structure of the

Eukaryotic RNA Exosome. Cell. 127: 1223-1237.

Lopez de Silanes, I., Zhan, M., Lal, A., Yang, X. and Gorospe, M. (2004) Identification of a

target RNA motif for RNA-binding protein HuR. Proc Natl Acad Sci U S A. 101: 2987-

2992.

Lykke-Andersen, J. and Wagner, E. (2005) Recruitment and activation of mRNA decay enzymes

by two ARE-mediated decay activation domains in the proteins TTP and BRF-1. Genes

Dev. 19: 351-361.

99

Mahtani, K.R., Brook, M., Dean, J.L.E., Sully, G., Saklatvala, J. and Clark, A.R. (2001)

Mitogen-Activated Protein Kinase p38 Controls the Expression and Posttranslational

Modification of Tristetraprolin, a Regulator of Tumor Necrosis Factor Alpha mRNA

Stability. Mol. Cell. Biol. 21: 6461-6469.

Maldonado-Arocho, F.J., Fulcher, J.A., Lee, B. and Bradley, K.A. (2006) Anthrax oedema toxin

induces anthrax toxin receptor expression in monocyte-derived cells. Molecular

Microbiology. 61: 324-337.

Maquat, L.E. and Carmichael, G.G. (2001) Quality control of mRNA function. Cell. 104: 173-

176.

Mastronarde, J.G., He, B., Monick, M.M., Mukaida, N., Matsushima, K. and Hunninghake,

G.W. (1996) Induction of interleukin (IL)-8 gene expression by respiratory syncytial

virus involves activation of nuclear factor (NF)-kappa B and NF-IL-6. J Infect Dis. 174:

262-267.

Matsui, H., Asou, H. and Inaba, T. (2007) Cytokines Direct the Regulation of Bim mRNA

Stability by Heat-Shock Cognate Protein 70. 25: 99-112.

Mayer-Scholl, A., Hurwitz, R., Brinkmann, V., Schmid, M., Jungblut, P., Weinrauch, Y. and

Zychlinsky, A. (2005) Human Neutrophils Kill Bacillus anthracis. PLoS Pathogens. 1:

e23.

Miller, C.J., Elliott, J.L. and Collier, R.J. (1999) Anthrax protective antigen: prepore-to-pore

conversion. Biochemistry. 38: 10432-10441.

Mitchell, P. and Tollervey, D. (2000) Musing on the structural organization of the exosome

complex. Nat Struct Biol. 7: 843-846.

100

Mogridge, J., Cunningham, K., Lacy, D.B., Mourez, M. and Collier, R.J. (2002) The lethal and

edema factors of anthrax toxin bind only to oligomeric forms of the protective antigen.

Proc Natl Acad Sci U S A. 99: 7045-7048.

Mourez, M., Lacy, D.B., Cunningham, K., Legmann, R., Sellman, B.R., Mogridge, J. and

Collier, R.J. (2002) 2001: a year of major advances in anthrax toxin research. Trends

Microbiol. 10: 287-293.

Muhlemann, O. (2005) Applying the brakes on gene expression. Nat Struct Mol Biol. 12: 1024-

1025.

Mukherjee, D., Gao, M., O'Connor, J.P., Raijmakers, R., Pruijn, G., Lutz, C.S. and Wilusz, J.

(2002) The mammalian exosome mediates the efficient degradation of mRNAs that

contain AU-rich elements. Embo J. 21: 165-174.

Muslin, A.J. and Xing, H. (2000) 14-3-3 proteins: regulation of subcellular localization by

molecular interference. Cellular Signalling. 12: 703-709.

Nabors, L.B., Gillespie, G.Y., Harkins, L. and King, P.H. (2001) HuR, a RNA Stability Factor, Is

Expressed in Malignant Brain Tumors and Binds to Adenine- and Uridine-rich

Elements within the 3' Untranslated Regions of Cytokine and Angiogenic Factor

mRNAs. Cancer Res. 61: 2154-2161.

Nover, L., Scharf, K.D. and Neumann, D. (1989) Cytoplasmic heat shock granules are formed

from precursor particles and are associated with a specific set of mRNAs. Mol Cell Biol.

9: 1298-1308.

O'Brien, J., Friedlander, A., Dreier, T., Ezzell, J. and Leppla, S. (1985) Effects of anthrax toxin

components on human neutrophils. Infect Immun. 47: 306-310.

101

Ogilvie, R.L., Abelson, M., Hau, H.H., Vlasova, I., Blackshear, P.J. and Bohjanen, P.R. (2005)

Tristetraprolin down-regulates IL-2 gene expression through AU-rich element-mediated

mRNA decay. J Immunol. 174: 953-961.

Ogilvie, R.L., SternJohn, J.R., Rattenbacher, B., Vlasova, I.A., Williams, D.A., Hau, H.H., et al

(2009) Tristetraprolin mediates interferon-gamma mRNA decay. J. Biol. Chem.:

M901229200.

Oncu, S. and Sakarya, S. (2003) Anthrax--an overview. Med Sci Monit. 9: RA276-283.

Paccani, S.R., Tonello, F., Ghittoni, R., Natale, M., Muraro, L., D'Elios, M.M., et al (2005)

Anthrax toxins suppress T lymphocyte activation by disrupting antigen receptor

signaling. J. Exp. Med. 201: 325-331.

Pantopoulos, K. (2004) Iron Metabolism and the IRE/IRP Regulatory System: An Update.

Annals of the New York Academy of Sciences. 1012: 1-13.

Parker, R. and Song, H. (2004) The enzymes and control of eukaryotic mRNA turnover. Nat

Struct Mol Biol. 11: 121-127.

Parker, R. and Sheth, U. (2007) P Bodies and the Control of mRNA Translation and

Degradation. Molecular Cell. 25: 635-646.

Peabody, D.S. (1993) The RNA binding site of bacteriophage MS2 coat protein. Embo J. 12:

595-600.

Pellizzari, R., Guidi-Rontani, C., Vitale, G., Mock, M. and Montecucco, C. (1999) Anthrax lethal

factor cleaves MKK3 in macrophages and inhibits the LPS/IFNgamma-induced release

of NO and TNFalpha. FEBS Lett. 462: 199-204.

Peng, S.S., Chen, C.Y., Xu, N. and Shyu, A.B. (1998) RNA stabilization by the AU-rich element

binding protein, HuR, an ELAV protein. Embo J. 17: 3461-3470.

102

Pfaffl, M.W. (2001) A new mathematical model for relative quantification in real-time RT-PCR.

Nucleic Acids Res. 29: e45.

Pillai, R.S., Bhattacharyya, S.N. and Filipowicz, W. (2007) Repression of protein synthesis by

miRNAs: how many mechanisms? Trends Cell Biol. 17: 118-126.

Pratt, A.J. and MacRae, I.J. (2009) The RNA-induced silencing complex: a versatile gene-

silencing machine. J Biol Chem. 284: 17897-17901.

Prechtel, A.T., Chemnitz, J., Schirmer, S., Ehlers, C., Langbein-Detsch, I., Stulke, J., et al (2006)

Expression of CD83 is regulated by HuR via a novel cis-active coding region RNA

element. J Biol Chem. 281: 10912-10925.

Qa'dan, M., Christensen, K.A., Zhang, L., Roberts, T.M. and Collier, R.J. (2005) Membrane

Insertion by Anthrax Protective Antigen in Cultured Cells. Mol. Cell. Biol. 25: 5492-

5498.

Rajarathnam, K., Sykes, B.D., Kay, C.M., Dewald, B., Geiser, T., Baggiolini, M. and Clark-

Lewis, I. (1994) Neutrophil activation by monomeric interleukin-8. Science. 264: 90-92.

Raymond, B., Batsche, E., Boutillon, F., Wu, Y.-Z., Leduc, D., Balloy, V., et al (2009) Anthrax

Lethal Toxin Impairs IL-8 Expression in Epithelial Cells through Inhibition of Histone

H3 Modification. PLoS Pathog. 5: e1000359.

Rezaei, N., Moazzami, K., Aghamohammadi, A. and Klein, C. (2009) Neutropenia and primary

immunodeficiency diseases. Int Rev Immunol. 28: 335-366.

Rigby, W.F.C., Roy, K., Collins, J., Rigby, S., Connolly, J.E., Bloch, D.B. and Brooks, S.A.

(2005) Structure/Function Analysis of Tristetraprolin (TTP): p38 Stress-Activated

Protein Kinase and Lipopolysaccharide Stimulation Do Not Alter TTP Function. J

Immunol. 174: 7883-7893.

103

Sawaoka, H., Dixon, D.A., Oates, J.A. and Boutaud, O. (2003) Tristetraprolin binds to the 3'-

untranslated region of cyclooxygenase-2 mRNA. A polyadenylation variant in a cancer

cell line lacks the binding site. J Biol Chem. 278: 13928-13935.

Schiavone, N., Rosini, P., Quattrone, A., Donnini, M., Lapucci, A., Citti, L., et al (2000) A

conserved AU-rich element in the 3' untranslated region of bcl-2 mRNA is endowed

with a destabilizing function that is involved in bcl-2 down-regulation during apoptosis.

Faseb J. 14: 174-184.

Scobie, H.M., Rainey, G.J.A., Bradley, K.A. and Young, J.A.T. (2003) Human capillary

morphogenesis protein 2 functions as an anthrax toxin receptor. PNAS. 100: 5170-5174.

Sen, G.L. and Blau, H.M. (2005) Argonaute 2/RISC resides in sites of mammalian mRNA decay

known as cytoplasmic bodies. Nat Cell Biol. 7: 633-636.

Seri, M., Cusano, R., Gangarossa, S., Caridi, G., Bordo, D., Lo Nigro, C., et al (2000) Mutations

in MYH9 result in the May-Hegglin anomaly, and Fechtner and Sebastian syndromes.

The May-Heggllin/Fechtner Syndrome Consortium. Nat Genet. 26: 103-105.

Shaw, G. and Kamen, R. (1986a) A conserved AU sequence from the 32 untranslated region of

GM-CSF mRNA mediates selective mRNA degradation. Cell. 46: 659-667.

Shaw, G. and Kamen, R. (1986b) A conserved AU sequence from the 3' untranslated region of

GM-CSF mRNA mediates selective mRNA degradation. Cell. 46: 659-667.

Sheth, U. and Parker, R. (2003) Decapping and Decay of Messenger RNA Occur in Cytoplasmic

Processing Bodies. Science. 300: 805-808.

Siomi, H., Matunis, M.J., Michael, W.M. and Dreyfuss, G. (1993) The pre-mRNA binding K

protein contains a novel evolutionarily conserved motif. Nucleic Acids Res. 21: 1193-

1198.

104

Smith, H. and Keppie, J. (1954) Observations on experimental anthrax; demonstration of a

specific lethal factor produced in vivo by Bacillus anthracis. Nature. 173: 869-870.

Spector, I., Shochet, N.R., Blasberger, D. and Kashman, Y. (1989) Latrunculins--novel marine

macrolides that disrupt microfilament organization and affect cell growth: I.

Comparison with cytochalasin D. Cell Motil Cytoskeleton. 13: 127-144.

Stanley, J.L., Sargeant, K. and Smith, H. (1960) Purification of factors I and II of the anthrax

toxin produced in vivo. J Gen Microbiol. 22: 206-218.

Stoeckle, M.Y. (1991) Post-transcriptional regulation of gro alpha, beta, gamma, and IL-8

mRNAs by IL-1 beta. Nucleic Acids Res. 19: 917-920.

Stoecklin, G., Mayo, T. and Anderson, P. (2006) ARE-mRNA degradation requires the 5'-3'

decay pathway. EMBO Rep. 7: 72-77.

Stoecklin, G., Ming, X.F., Looser, R. and Moroni, C. (2000) Somatic mRNA turnover mutants

implicate tristetraprolin in the interleukin-3 mRNA degradation pathway. Mol Cell Biol.

20: 3753-3763.

Stoecklin, G., Lu, M., Rattenbacher, B. and Moroni, C. (2003) A constitutive decay element

promotes tumor necrosis factor alpha mRNA degradation via an AU-rich element-

independent pathway. Mol Cell Biol. 23: 3506-3515.

Stoecklin, G., Stoeckle, P., Lu, M., Muehlemann, O. and Moroni, C. (2001) Cellular mutants

define a common mRNA degradation pathway targeting cytokine AU-rich elements.

Rna. 7: 1578-1588.

Stoecklin, G., Stubbs, T., Kedersha, N., Wax, S., Rigby, W.F., Blackwell, T.K. and Anderson, P.

(2004) MK2-induced tristetraprolin:14-3-3 complexes prevent stress granule association

and ARE-mRNA decay. Embo J. 23: 1313-1324.

105

Sun, L., Stoecklin, G., Van Way, S., Hinkovska-Galcheva, V., Guo, R.-F., Anderson, P. and

Shanley, T.P. (2007) Tristetraprolin (TTP)-14-3-3 Complex Formation Protects TTP

from Dephosphorylation by Protein Phosphatase 2a and Stabilizes Tumor Necrosis

Factor-{alpha} mRNA. J. Biol. Chem. 282: 3766-3777.

Suswam, E., Li, Y., Zhang, X., Gillespie, G.Y., Li, X., Shacka, J.J., et al (2008) Tristetraprolin

Down-regulates Interleukin-8 and Vascular Endothelial Growth Factor in Malignant

Glioma Cells. Cancer Res. 68: 674-682.

Suswam, E.A., Li, Y.Y., Mahtani, H. and King, P.H. (2005a) Novel DNA-binding properties of

the RNA-binding protein TIAR. Nucl. Acids Res. 33: 4507-4518.

Suswam, E.A., Nabors, L.B., Huang, Y., Yang, X. and King, P.H. (2005b) IL-1beta induces

stabilization of IL-8 mRNA in malignant breast cancer cells via the 3' untranslated

region: Involvement of divergent RNA-binding factors HuR, KSRP and TIAR. Int J

Cancer. 113: 911-919.

Symmons, M.F., Jones, G.H. and Luisi, B.F. (2000) A duplicated fold is the structural basis for

polynucleotide phosphorylase catalytic activity, processivity, and regulation. Structure.

8: 1215-1226.

Takekawa, M., Tatebayashi, K. and Saito, H. (2005) Conserved docking site is essential for

activation of mammalian MAP kinase kinases by specific MAP kinase kinase kinases.

Mol Cell. 18: 295-306.

Taupin, J.L., Tian, Q., Kedersha, N., Robertson, M. and Anderson, P. (1995) The RNA-binding

protein TIAR is translocated from the nucleus to the cytoplasm during Fas-mediated

apoptotic cell death

Proceedings of the National Academy of Sciences of the United States of America. 92: 1629-

1633.

106

Taylor, G.A., Thompson, M.J., Lai, W.S. and Blackshear, P.J. (1995) Phosphorylation of

Tristetraprolin, a Potential Zinc Finger Transcription Factor, by Mitogen Stimulation in

Intact Cells and by Mitogen-activated Protein Kinase in Vitro. J. Biol. Chem. 270:

13341-13347.

Taylor, G.A., Carballo, E., Lee, D.M., Lai, W.S., Thompson, M.J., Patel, D.D., et al (1996) A

pathogenetic role for TNF alpha in the syndrome of cachexia, arthritis, and

autoimmunity resulting from tristetraprolin (TTP) deficiency. Immunity. 4: 445-454.

Tchen, C.R., Brook, M., Saklatvala, J. and Clark, A.R. (2004) The Stability of Tristetraprolin

mRNA Is Regulated by Mitogen-activated Protein Kinase p38 and by Tristetraprolin

Itself. J. Biol. Chem. 279: 32393-32400.

Teixeira, D., Sheth, U., Valencia-Sanchez, M.A., Brengues, M. and Parker, R. (2005) Processing

bodies require RNA for assembly and contain nontranslating mRNAs. Rna. 11: 371-

382.

Tiedje, C., Kotlyarov, A. and Gaestel, M. (2010) Molecular mechanisms of phosphorylation-

regulated TTP (tristetraprolin) action and screening for further TTP-interacting proteins.

Biochem Soc Trans. 38: 1632-1637.

Tournier, J.-N., Quesnel-Hellmann, A., Mathieu, J., Montecucco, C., Tang, W.-J., Mock, M., et

al (2005) Anthrax Edema Toxin Cooperates with Lethal Toxin to Impair Cytokine

Secretion during Infection of Dendritic Cells. J Immunol. 174: 4934-4941.

van Dijk, E., Cougot, N., Meyer, S., Babajko, S., Wahle, E. and Seraphin, B. (2002) Human

Dcp2: a catalytically active mRNA decapping enzyme located in specific cytoplasmic

structures. EMBO J. 21: 6915-6924.

van Hoof, A. and Parker, R. (1999) The exosome: a proteasome for RNA? Cell. 99: 347-350.

107

Vicente-Manzanares, M., Ma, X., Adelstein, R.S. and Horwitz, A.R. (2009) Non-muscle myosin

II takes centre stage in cell adhesion and migration. 10: 778-790.

Villarete, L.H. and Remick, D.G. (1996) Transcriptional and post-transcriptional regulation of

interleukin-8. Am J Pathol. 149: 1685-1693.

Vitale, G., Bernardi, L., Napolitani, G., Mock, M. and Montecucco, C. (2000) Susceptibility of

mitogen-activated protein kinase kinase family members to proteolysis by anthrax lethal

factor. Biochem J. 352 Pt 3: 739-745.

Vitale, G., Pellizzari, R., Recchi, C., Napolitani, G., Mock, M. and Montecucco, C. (1998)

Anthrax Lethal Factor Cleaves the N-Terminus of MAPKKs and Induces

Tyrosine/Threonine Phosphorylation of MAPKs in Cultured Macrophages,.

Biochemical and Biophysical Research Communications. 248: 706-711.

Wang, J.G., Collinge, M., Ramgolam, V., Ayalon, O., Fan, X.C., Pardi, R. and Bender, J.R.

(2006) LFA-1-Dependent HuR Nuclear Export and Cytokine mRNA Stabilization in T

Cell Activation. J Immunol. 176: 2105-2113.

Wang, W., Furneaux, H., Cheng, H., Caldwell, M.C., Hutter, D., Liu, Y., et al (2000) HuR

regulates p21 mRNA stabilization by UV light. Mol Cell Biol. 20: 760-769.

Wang, Z. and Kiledjian, M. (2001) Functional link between the mammalian exosome and mRNA

decapping. Cell. 107: 751-762.

Wells, S.E., Hillner, P.E., Vale, R.D. and Sachs, A.B. (1998) Circularization of mRNA by

eukaryotic translation initiation factors. Mol Cell. 2: 135-140.

Williams, A.E. (2008) Functional aspects of animal microRNAs. Cell Mol Life Sci. 65: 545-562.

Wilusz, C.J., Wormington, M. and Peltz, S.W. (2001) The cap-to-tail guide to mRNA turnover.

Nat Rev Mol Cell Biol. 2: 237-246.

108

Winzen, R., Gowrishankar, G., Bollig, F., Redich, N., Resch, K. and Holtmann, H. (2004a)

Distinct Domains of AU-Rich Elements Exert Different Functions in mRNA

Destabilization and Stabilization by p38 Mitogen-Activated Protein Kinase or HuR.

Mol. Cell. Biol. 24: 4835-4847.

Winzen, R., Gowrishankar, G., Bollig, F., Redich, N., Resch, K. and Holtmann, H. (2004b)

Distinct domains of AU-rich elements exert different functions in mRNA destabilization

and stabilization by p38 mitogen-activated protein kinase or HuR. Mol Cell Biol. 24:

4835-4847.

Winzen, R., Thakur, B.K., Dittrich-Breiholz, O., Shah, M., Redich, N., Dhamija, S., et al (2007)

Functional Analysis of KSRP Interaction with the AU-Rich Element of Interleukin-8

and Identification of Inflammatory mRNA Targets. Mol. Cell. Biol. 27: 8388-8400.

Winzen, R., Kracht, M., Ritter, B., Wilhelm, A., Chen, C.Y., Shyu, A.B., et al (1999) The p38

MAP kinase pathway signals for cytokine-induced mRNA stabilization via MAP

kinase-activated protein kinase 2 and an AU-rich region-targeted mechanism. Embo J.

18: 4969-4980.

Worthington, M.T., Pelo, J.W., Sachedina, M.A., Applegate, J.L., Arseneau, K.O. and Pizarro,

T.T. (2002) RNA Binding Properties of the AU-rich Element-binding Recombinant

Nup475/TIS11/Tristetraprolin Protein. J. Biol. Chem. 277: 48558-48564.

Yamashita, A., Chang, T.C., Yamashita, Y., Zhu, W., Zhong, Z., Chen, C.Y. and Shyu, A.B.

(2005) Concerted action of poly(A) nucleases and decapping enzyme in mammalian

mRNA turnover. Nat Struct Mol Biol. 12: 1054-1063.

Young, L.E., Sanduja, S., Bemis-Standoli, K., Pena, E.A., Price, R.L. and Dixon, D.A. (2009)

The mRNA binding proteins HuR and tristetraprolin regulate cyclooxygenase 2

expression during colon carcinogenesis. Gastroenterology. 136: 1669-1679.

109

Yu, J.H., Yang, W.H., Gulick, T., Bloch, K.D. and Bloch, D.B. (2005) Ge-1 is a central

component of the mammalian cytoplasmic mRNA processing body. Rna. 11: 1795-

1802.

Yu, Y. and Chadee, K. (2001) The 3'-untranslated region of human interleukin-8 mRNA

suppresses IL-8 gene expression. Immunology. 102: 498-505.

Zhao, C. and Hamilton, T. (2007) Introns Regulate the Rate of Unstable mRNA Decay. J. Biol.

Chem. 282: 20230-20237.

Zimmer, C., von Gabain, A. and Henics, T. (2001) Analysis of sequence-specific binding of

RNA to Hsp70 and its various homologs indicates the involvement of N- and C-

terminal interactions. Rna. 7: 1628-1637.