Department of Biochemistry Faculty of Biological Sciences...

Biological Evaluation, Phytoecdysteroids Analyses and their

Enhancement in Ajuga bracteosa Wall. ex Benth.

By

WAQAS KHAN KAYANI

Department of Biochemistry

Faculty of Biological Sciences

Quaid-i-Azam University

Islamabad, Pakistan

2016

i

Biological Evaluation, Phytoecdysteroids Analyses and their

Enhancement in Ajuga bracteosa Wall. ex Benth.

Submitted by

WAQAS KHAN KAYANI

Thesis Submitted to

Department of Biochemistry, Quaid-i-Azam University, Islamabad

In the partial fulfillment of the requirements for the degree of

Doctor of Philosophy

in

Biochemistry / Molecular Biology

Department of Biochemistry

Faculty of Biological Sciences

Quaid-i-Azam University

Islamabad, Pakistan

2016

ii

iii

Declaration

I hereby declare that the work presented in this thesis is my own effort except where

others acknowledged and that the thesis is my own composition. No part of the thesis has

previously been presented for any other degree.

Dated: ___________________

Waqas Khan Kayani

iv

The Prophet Muhammad ملسو هيلع هللا ىلص,

The mentor of all times

Seeking knowledge is obligatory for every man and woman (Prophet Muhammad ملسو هيلع هللا ىلص)

v

TABLE OF CONTENTS

Declaration……...………………………………………………………………………..iii

Dedication………………………………………………………………………… …….iv

Table of contents……………………………………………………...…………………..v

Acknowledgements…………………………………………………………………...xiii

List of abbreviations ……………………………………………..……………………...xv

List of figures ……………………………………………………...…………………... xx

List of tables ……………………………………………………...…………………...xxiv

Abstract ………………………………………………………………..……………...xxvi

1 Introduction ............................................................................................................. 1

1.1 Medicinal plants ................................................................................................ 1

1.2 Ajuga bracteosa ................................................................................................. 1

1.3 Ethnobotany and ethnopharmacology ............................................................... 2

1.4 Biological evaluation of Ajuga bracteosa ......................................................... 3

1.5 Antioxidant activities and polyphenolic compounds ........................................ 4

1.6 Secondary metabolites of A. bracteosa ............................................................. 6

1.7 Phytoecdysteroids .............................................................................................. 8

1.8 Functions of phytoecdysteroids ......................................................................... 8

1.9 Structure of phytoecdysteroids ........................................................................ 10

1.10 Localization of phytoecdysteroids ................................................................... 10

vi

1.11 Phytoecdysteroids biosynthesis ....................................................................... 12

1.12 Agrobacterium tumefaciens mediated transformation ..................................... 14

1.13 Agrobacterium rhizogenes mediated transformation ...................................... 15

1.14 Effect of TR-DNA genes of Agrobacterium rhizogenes ................................. 15

1.15 Effect of TL-DNA genes (rol genes) of Agrobacterium rhizogenes ............... 17

1.16 The secondary metabolism and rol genes ....................................................... 18

1.17 Enhancement of phytoecdysteroids ................................................................. 19

1.18 Aims and objectives ........................................................................................ 21

2 Biological evaluation of Ajuga bracteosa ............................................................. 22

2.1 Materials and Methods .................................................................................... 23

2.1.1 Collection and identification of plant ........................................................... 23

2.1.2 Preparation of extracts .................................................................................. 23

2.1.3 Determination of total flavonoid content ..................................................... 24

2.1.4 Determination of total phenolic content ....................................................... 25

2.1.5 In vitro antioxidant assays ............................................................................ 25

2.1.6 Brine Shrimp Lethality Assay ...................................................................... 27

2.1.7 Potato Disc Antitumor Assay ....................................................................... 27

2.1.8 In vivo assays ................................................................................................ 28

2.1.9 Cancer chemoprevention assays ................................................................... 30

2.1.10 Statistical analysis ........................................................................................ 32

vii

2.2 Results ............................................................................................................. 32

2.2.1 Total flavonoid and phenolic content ........................................................... 32

2.2.2 Antioxidant assays ........................................................................................ 33

2.2.3 Brine shrimps lethality assay ........................................................................ 37

2.2.4 Potato discs antitumor assay ......................................................................... 37

2.2.5 In vivo assays ................................................................................................ 38

2.2.6 Cancer chemopreventive assays ................................................................... 40

2.3 Conclusion ....................................................................................................... 41

3 Seasonal and geographical impact on the morphology, phytoecdysteroid content

and antioxidant activities in different tissue types of wild Ajuga bracteosa ......... 42

3.1 Materials and methods ..................................................................................... 44

3.1.1 Plant material collection ............................................................................... 44

3.1.2 Morphological study ..................................................................................... 45

3.1.3 Plant processing ............................................................................................ 45

3.1.4 Extraction of phytoecdysteroids ................................................................... 46

3.1.5 RP-HPLC analysis ........................................................................................ 46

3.1.6 Antioxidants, total flavonoids and phenolics assays .................................... 47


3.2 Results ............................................................................................................. 49

3.2.1 Effect of different seasons and geographical locations on the morphology . 49

viii

3.2.2 Effect of different seasons and geographical locations on phytoecdysteroids

(PEs) biosynthesis in different tissues .......................................................... 52

3.2.3 Interaction of seasons, geographical locations and tissue types on PEs

biosynthesis .................................................................................................. 55

3.2.4 Effect of different seasons and geographical locations on antioxidant

activities of different tissues ......................................................................... 56

3.2.5 Effect of different seasons and geographical locations on total flavonoid and

phenolic content in different tissues ............................................................. 58

3.3 Conclusion ....................................................................................................... 60

4 Comprehensive screening of influential factors in the Agrobacterium tumefaciens-

mediated transformation of Ajuga bracteosa Wall. ex. Benth. ............................. 61


4.1.1 Plant material and its sterilization ................................................................ 63

4.1.2 Explant preparation for in vitro culturing ..................................................... 63

4.1.3 Kanamycin sensitivity .................................................................................. 63

4.1.4 A. tumefaciens strain and vector used for transformation ............................ 64

4.1.5 Method of transformation ............................................................................. 64

4.1.6 Histochemical GUS assay ............................................................................ 65

4.1.7 Isolation of genomic DNA ........................................................................... 66

4.1.8 PCR analysis ................................................................................................. 66


4.2 Results ............................................................................................................. 67

ix

4.2.1 Optimization of tissue culture conditions ..................................................... 67

4.2.2 Kanamycin sensitivity .................................................................................. 68

4.2.3 Effect of bacterial culture optical density on transformation ....................... 69

4.2.4 Effect of acetosyringone concentration on transformation .......................... 70

4.2.5 Effect of inoculation time on transformation ............................................... 70

4.2.6 Cumulative effect of studied factors and explant types on transformation .. 71

4.2.7 Estimation of regeneration frequency .......................................................... 74

4.2.8 Transgene expression (GUS assay and PCR) ............................................... 75

4.3 Conclusion ....................................................................................................... 77

5 Agrobacterium tumefaciens mediated transformation of A. bracteosa with rol

genes to enhance phytoecdysteroids biosynthesis ................................................. 79


5.1.1 Plant material, growth conditions and pPCV002-ABC transformation ....... 80

5.1.2 Molecular analysis ........................................................................................ 80

5.1.3 Extraction of ecdysteroids and RP-HPLC analysis ...................................... 83


5.2 Results ............................................................................................................. 84

5.2.1 Molecular confirmation of T-DNA integration into plant genome .............. 84

5.2.2 T-DNA of pPCV002-ABC alter plant morphology ..................................... 84

5.2.3 rol genes of pPCV002-ABC are powerful inducer of phytoecdysteroids

biosynthesis .................................................................................................. 85

x

5.2.4 rol genes strongly affected AJL biosynthesis than the rest of

phytoecdysteroids ......................................................................................... 89

5.3 Conclusion ....................................................................................................... 89

6 Agrobacterium rhizogenes mediated transformation of A. bracteosa to enhance

phytoecdysteroids biosynthesis ............................................................................. 90


6.1.1 Plant source and its sterilization for hairy roots induction ........................... 91

6.1.2 Bacterial strains and procedure for A. rhizogenes mediated transformation 91

6.1.3 Media used and shifting of A. rhizogenes infected explants ........................ 92

6.1.4 Growth quotient ............................................................................................ 92

6.1.5 Molecular analysis ........................................................................................ 92

6.1.6 Extraction of ecdysteroids and RP-HPLC analysis ...................................... 93

6.1.7 Treatment with elicitors ................................................................................ 93

6.2 Results ............................................................................................................. 94

6.2.1 Development of hairy roots induced by T-DNA of pRi ............................... 94

6.2.2 Molecular confirmation of T-DNA integration into plant genome .............. 98

6.2.3 rol genes of pRi are powerful inducer of phytoecdysteroids biosynthesis... 98

6.2.4 T-DNA of pRi alter plant morphology ....................................................... 102

6.2.5 Aerial portions of A. bracteosa: a sink of phytoecdysteroids .................... 103

6.2.6 rol genes strongly affected AJL biosynthesis more than the rest of

phytoecdysteroids ....................................................................................... 104

xi

6.2.7 Phenotypic characterization and phytoecdysteroid content in transgenic roots

.................................................................................................................... 105

6.2.8 TR-DNA integration into the genome of transgenic hairy root lines ......... 106

6.2.9 Effect of elicitors on phytoecdysteroids production in hairy root clones ... 107

6.3 Conclusion ..................................................................................................... 110

7 Discussion ............................................................................................................ 111

7.1 Flavonoid and phenolic content ..................................................................... 111

7.2 Antioxidant activity ....................................................................................... 112

7.3 Anticoagulant activity ................................................................................... 113

7.4 Antidepressant, analgesic and anti-inflammatory activity ............................ 113

7.5 Cancer chemoprevention assays .................................................................... 114

7.6 Cytotoxic assay .............................................................................................. 115

7.7 Seasonal and geographical impact on the morphology of Ajuga bracteosa . 116

7.8 Seasonal and geographical impact on phytoecdysteroid content in different

tissue types of Ajuga bracteosa ..................................................................... 117

7.9 Seasonal and geographical impact on antioxidant activities in different tissue

types of Ajuga bracteosa ............................................................................... 119

7.10 Development of an efficient method for Agrobacterium tumefaciens mediated

genetic transformation of A. bracteosa ......................................................... 120

7.11 Agrobacterium tumefaciens mediated transformation of A. bracteosa with rol

genes to enhance phytoecdysteroids biosynthesis ......................................... 122

7.12 Agrobacterium rhizogenes mediated transformation of A. bracteosa to

enhance phytoecdysteroids biosynthesis ....................................................... 123

xii

7.13 Phytoecdysteroids’ biosynthesis is affected by hairy root phenotypes and TR-

DNA genes of pRi ......................................................................................... 125

7.14 Effect of elicitors on phytoecdysteroids production in hairy root clones ...... 126

7.15 Conclusion ..................................................................................................... 128

7.16 Future Work ................................................................................................... 129

8 References ........................................................................................................... 130

xiii

ACKNOWLEDGEMENTS

I am grateful to Almighty Allah, the Omnipotent and the most Merciful, Who bestows

me with strength and courage to achieve my goals and granting me more than I deserve.

My supervisor Prof. Dr. Bushra Mirza, it is a pleasure to express my sincere and deepest

gratitude to you for believing in me and accepting me as a PhD student. You taught me

how to plan a scientific study and how to present it. I thank you for your dynamic

supervision and sincere criticisms throughout the course of my research pursuits.

Prof. Dr. Rosa Cusidò, (Department of plant physiology, University of Barcelona, Spain)

I am extremely grateful to you for extending the facilities and invaluable supervision

during my research. It would not have been be possible to compile this thesis without

your encouragement and guidance in all aspects. Thanks for your motivation and

continuous support to improve my scientific abilities. It has been very inspiring to work

with you and I have learnt a lot from you, which will be a ray of light for me during my

professional life. Prof. Javier Palazòn, thank you very much for your technical support

and guidance during my stay at University of Barcelona. I am also thankful to my lab

colleagues at Barcelona, Prof. Merce Bonfil, Prof. Elisabeth Moyano, Dr. Anna Galigo,

Dr. Karla Ramerez Estrada, Liliana and Diego for their cooperation, support and useful

suggestions.

I wish to express my most sincere thanks to Prof. Dr. Wasim Ahmad (Dean Faculty of

Biological Sciences) for his encouragement, support and help during my research work. I

am thankful to you for your support throughout the time I spent at QAU especially is the

start. I am thankful to my ex-supervisor Prof. Dr. Abdul Waheed, Director, CIIT Sahiwal

who brought me in the world of science.

I would also like to acknowledge Dr. Sarah R. Grant, The University of North Carolina,

Chapel Hill for providing GUS gene construct p35SGUSint. I thank Prof. Shkryl Yurii

Nikolaevich, Institute of Biology and Soil Science, Russian Academy of Sciences,

Vladivostok, Russia for providing me the rol gene constructions. I also thank Prof. Kirsi-

Marja Oksman-Caldentey and Dr. Tuuli Teikari from Plant Biotechnology, Chemical

Science and Technology, VTT Bio- and Chemical Processes, Finland for the provision of

A. rhizogenes strains.

xiv

Acknowledgements are due to Prof. Yoshinori Fujimoto, Department of Chemistry and

Material Sciences, Tokyo Institute of Technology, Meguro, Japan for the provision of

20-hydroxyecdysone. I thank Prof. Josep Coll-Toledano, Department of Biological

Chemistry and Molecular Modeling, SNRC Barcelona, Spain for providing the standard

ecdysteroids, extraction assembly and columns. I am grateful to Mr. Muhammad Fattahi

Urmia University, Orūmīyeh for his assistance in statistical analysis. I am grateful to Dr.

John M. Pezzuto, Professor and Dean College of Pharmacy, University of Hawaii at

Hilo, USA for providing the opportunity of conduction of cell-lines based assays.

I thank Dr. Khawaja Shafique Ahmad for providing local hospitality at Neelum Valley

during plant collection. I also thank Prof. Dr. Rizwana Aleem Qureshi, department of

Plant Sciences, QAU Islamabad for the identification of plant. I am obliged to Dr.

Sarwat Jahan, chairperson department of Animal Sciences at QAU for providing me the

facilities to conduct micrograph of GUS stained tissues. I am obliged to chromatography

team especially Esther at Parc Científic de Barcelona, Spain for RP-HPLC experiments.

I would like to mention some of my friends including Ijaz Aziz, Tariq Aziz, Dr. Mohsin

Rafique, Dr. Majid Mahmood, Sadia Maqbool and Saira Asif who really helped me in

the pursuit of knowledge as well as life. I would like to express my special thanks to my

colleagues at Molecular Biology Laboratory at QAU including Dr. Ihsan-ul-Haq, Dr.

Nazif Ullah, Dr. Samreen, Dr. Bushra Kiani, Dr. Laila Jafri, Rehana, Samiya, Erum,

Tanvir Ahmad, Samina, Irshad Niazi and Amir Bhai for their nice company and

encouragement throughout my research work.

I would like to pay a tribute to my family who helped me to accomplish my goals. I owe

a non-payable debt to my affectionate parents, whose wishes motivated me in striving for

higher education. My special gratitude is due to my brothers, sisters and their families for

their loving support.

I would like to acknowledge Higher Education Commission, Pakistan (HEC) for

providing the Indigenous and IRSIP scholarships and financial support during my

research in Pakistan and Spain.

Waqas Khan Kayani

xv

LIST OF ABBREVIATIONS

AA Ascorbic acid

AAE Ascorbic acid equivalent/g

AbCA Chloroform extract of aerial portion of Ajuga bracteosa

AbCR Chloroform extract of root A. bracteosa

AbMA Methanolic extract of aerial portion A. bracteosa

AbMR Methanolic extract of root A. bracteosa

ABTS 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid

AJK Azad Jammu and Kashmir

AJL Ajugalactone

ANOVA Analysis of variance

AS Acteosyringone

BA (hormone) 6-Benzylaminopurine

BAY-11 (E)-3-(4-Methylphenylsulfonyl)-2-propenenenitrile

BHA Butylated hydroxyanisole

BHT Butylated hydroxytoluene

BY-2 Bright Yellow-2

CCM Co-cultivation medium

CCT Co-cultivation time

CE Mean increase in paw volume of crude extract

CIM Callus induction medium

C-M Callus like morphology

Cor Coronatine

COX-1 Cholinesterase enzymes I

COX-2 Cholinesterase enzymes II

CRD Complete randomized design

CTAB Cetyl trimethyl ammonium bromide

CV Coefficient of variation

CYP Cyasterone

DF Degree of freedom

DMSO Dimethyl sulfoxide

DP Diclofenac Potassium

xvi

DPEC Diethylpyrocarbonate

DPPH 2, 2- Diphenyl-1-picryl-hydrazyl

DW Dry weight

EDTA Ethylenediaminetetraacetic acid

ERα Estrogen receptor

FeCl3 Ferric chloride

F-HCl Fluoxetine HCl.

FV F value

GAE Gallic acid equivalent

GC/MS Gas Chromatography/Mass spectrometery

GUS β-glucuronidase

H2SO4 Sulphuric acid

HgCl2 Mercuric chloride

HPLC High performance liquid chromatography

HR-M Hairy roots morphology

IBA Indole-3-butyric acid

IM inoculation medium

iNOS Nitric oxide synthase

int Intron

IS Islamabad

IT Inoculation time

K3[Fe (CN)6] Potassium ferricyanide

KH Kahuta (Rawalpindi)

KR Karot (Eastern Rawalpindi)

L left border

LB Luria-Bertani medium

L-NMMA Na-L monomethyl arginine

LOX Lipoxygenase

LSD Least significant difference

M Marker

MCF-7 Estrogen receptor positive breast cancer cell line, ATCC

product code HTB-22

MDA-MB-231 Estrogen receptor negative breast cancer cell line

xvii

MeJ methyl jasmonate

MIC Minimum inhibitory concentration

MKA Makisterone A

MKA Makisterone

MS Murashige and Skoog medium

MTT 3-(4,5-dimethylthiazo-2-yl)-2,5-diphenyltetrazolium bromide

Na3PO4 Sodium phosphate

NAA Naphthaleneacetic acid

NaCl Sodium chloride

NC Mean increase in paw volume of negative control

NC Negative control

NFĸB Nuclear factor kappa-B

(NH4)6Mo7O24.4H2O ammonium molybdate

NO Nitric oxide

NOS P Nopaline synthase promoter

NOS T Nopaline synthase terminator

NPT-II Neomycin phosphotransferase gene

NTK Normal hairy root with thick morphology

NTN Normal hairy root with thin morphology

NV Neelum Valley (AJK)

OD Optical density

PBS Phosphate-buffered saline

PC Pre-culture medium

PCR Polymerase chain reaction

PE Phytoecdysteroid content

PoB Polypodine

PVP Polyvinylpyrrolidone

QAU Quaid-i-Azam University

QE Quercetin equivalent

QR1 Quinone reductase 1

RB Right border

rbcS3B Ribulose-1,5-bisphosphate carboxylase small subunit

RIM Root induction medium

https://www.google.com.pk/url?sa=t&rct=j&q=&esrc=s&source=web&cd=1&cad=rja&uact=8&sqi=2&ved=0CBsQFjAAahUKEwih4aWT3d3GAhUKWtsKHTuxAV8&url=https%3A%2F%2Fen.wikipedia.org%2Fwiki%2F1-Naphthaleneacetic_acid&ei=R6GmVeGhD4q07Qa74ob4BQ&usg=AFQjCNH77AcvdAy38_hXnaDwOSI66Hxskw&sig2=RMow3XihFnITYkU_X0FaFg

xviii

rolA, rolB, rolC Root locus genes

ROS Reactive oxygen species

RP Reverse-Phase

RT Reverse Transcriptase

SA Sarsawa (District Kotli, AJK)

SD Standard deviation

SE Sehnsa (District Kotli, AJK)

SG Sengosterone

SGM Stable Growth medium

SH Schenk and Hildebrandt medium

SIM Shoot induction medium

SM1 Selection medium 1




SOV Source of variations

SPSS Statistical Package for the Social Sciences

SQ Semi quantitative

SRB Sulforohodamine B

SS Sum of squares

TCA Total antioxidant capacity

T-DNA Transfer DNA

TE Tris-EDTA

TFC Total flavonoid content

Ti Tumor inducing plasmid

TNF-α Tumor necrosis factor α

TPC Total phenolic content

TPCK N-tosyl-L-phenylalanyl chloromethyl ketone

TRP Total reducing power

v/v Volume/volume

w/v Weight/volume

vir Virulence genes

WT Wild-type untransformed plant

xix

20-HE 20-hydroxyecdysone

35S P CaMV35S promoter

xx

LIST OFFIGURES

Figure 1.1 Ajuga bracteosa ................................................................................................ 2

Figure 1.2 Structure of phytoecdysteroid. (a) General structure of phytoecdysteroids (b)

20-hydroxyecdysone ........................................................................................................ 10

Figure 1.3 Biosynthetic pathway of phytoecdysteroids ................................................... 13

Figure 2.1 Extraction scheme: AbMR: methanolic extract of root, AbMA: methanolic

extract of aerial portion, AbCR: chloroform extract of root, AbCA: chloroform extract of

aerial portion. ................................................................................................................... 24

Figure 2.2 Flavonoids and phenolic contents in different crude extracts of A. bracteosa 33

Figure 2.3 Percentage scavenging of DPPH (A) and H2O2 (B) of crude extracts of A.

bracteosa against ascorbic acid (AA). ............................................................................. 34

Figure 2.4 Reducing power (a) and total antioxidant activity (b) of crude extracts of A.

bracteosa against ascorbic acid. Data is expressed as mean± SD (P < 0.05.................... 36

Figure 2.5 In vivo assays of various crude extracts of A. bracteosa. (A) Anti-

inflammatory assay, (B) Analgesic assay, (C) Anti-depressant assay and (D) Anti-

coagulant assay. NC= negative control; DP= Diclofenac Potassium; F-HCl= Fluoxetine

HCl; NOL= number of lickings. ...................................................................................... 39

Figure 3.1 Map showing the collection sites .................................................................... 45

Figure 3.2 Structural formula of studied phytoecdysteroids (a) 20-hydroxyecdysone (b)

Polypodine B (c) Makisterone A (d) Cyasterone (e) Sengosterone (f) Ajugalactone ...... 47

Figure 3.3 Pictorial presentation of the representative samples for morphological analysis

of A. bracteosa ................................................................................................................. 53

Figure 3.4 Root of (a) SE ecotype, (b) SA ecotype and (c) IS ecotype ........................... 54

Figure 3.5 Effect of (a) habitats, (b) seasons and (c) tissue types on phytoecdysteroid

content (PE µg/g dry weight) in different samples of A. bracteosa. ................................ 54

xxi

Figure 3.6 Effect of (a) habitats versus tissue types (b) seasons versus tissue types and (c)

habitats versus seasons on phytoecdysteroid content (PE µg/g dry weight). ................... 56

Figure 3.7 Effect of (a) habitats, (b) seasons and (c) tissue types on total antioxidant

activity (TCA), reducing power (TRP) and % inhibition of DPPH free radicle of different

samples of A. bracteosa. .................................................................................................. 58

Figure 3.8 Effect of (a) habitats, (b) seasons and (c) tissue types on total phenolic and

flavonoid content in different samples of A. bracteosa. .................................................. 59

Figure 4.1 Schematic representation of T-DNA region of p35SGUSint: LB: left border;

NOS P: nopaline synthase promoter; NOS T: nopaline synthase terminator; NPTII:

neomycin phosphotransferase gene; 35S P: CaMV35S promoter; GUS: β- glucuronidase

gene; int: intron; RB: right border .................................................................................... 64

Figure 4.2 Optimization of tissue culture conditions of Ajuga bracteosa, (A) source wild

plant, (B) multiple shooting, (C) rooting, (D) acclimatization in pots to unsterile

environment ...................................................................................................................... 68

Figure 4.3 Effect of kanamycin on explant survival, (A) 25 mg/L, (B) 50 mg/L, (C) 75

mg/L and (D) 100 mg/L ................................................................................................... 69

Figure 4.4 Effect of (a) OD, (b) AS, (c) IT and (d) CCT on transformation in leaf, nodal

region and petiole explants in transient GUS expression. ................................................ 71

Figure 4.5 Putative transformed explants on selection medium (A-B) nodal region, (C)

petioles, (D) embryogenic callus produced from leaf explants ........................................ 74

Figure 4.6 Regeneration frequency of different explant types ......................................... 75

Figure 4.7 GUS expressions in different explant types. a and b; nodal regions, c-f; leaf

explants (e is control leaf explant), g-h; control nodal regions and petioles, i and j;

Micrographs showing GUS expression in stomata and intercalary zone. ........................ 76

Figure 4.8 PCR products of (a) GUS gene (895 bp) and (b) NPTII gene (780 bp) from

p35SGUSint used as control (c) and transformed plants formed from leaves (L1-L3),

nodal region (N1-N3) and petiole (P1-P3). In the case of leaves, it was callus. .............. 76

xxii

Figure 4.9 Flow chart of the method used in transformation experiment ........................ 77

Figure 5.1 PCR products of pPCV002-ABC transgenic plants. a, rolA gene (308 bp). b,

rolB gene (779 bp). c, rolC gene (541bp). d, npt-II gene (780 bp). M: marker (100 bp+

and 1.0 kb), PC: positive control (colony PCR), NC: negative control (untransformed

plant material), ................................................................................................................. 84

Figure 5.2 Development of intact transgenic plants containing pPCV002-ABC: a, ex

vitro source plant; b, in vitro raised source plant; c-h, independent transgenic lines; i,

dense rooting of the plants. .............................................................................................. 85

Figure 5.3 RP-HPLC Chromatographs representing elution pattern of (a) standard

phytoecdysteroids and (b) phytoecdysteroids profiling in ABC1. ................................... 86

Figure 5.4 Phytoecdysteroid content in intact pPCV002-ABC independent transgenic

lines (1-7) of A. bracteosa samples. a; biosynthesis of phytoecdysteroids, b; increase in

phytoecdysteroid content, c; increase in individual phytoecdysteroids. .......................... 87

Figure 5.5 SQ-RT-PCR of pPCV002-ABC transgenic plants. a, SQ-RT-PCR of rolC

(363 bp); b, SQ-RT-PCR actin (160 bp); c, densitometerical analysis of actin and rolC.

M: marker (100 bp+ and 1.0 kb), PC: positive control (colony PCR), NC: negative

control, WT; wild-type untransformed plant. ................................................................... 88

Figure 6.1 Development of transgenic hairy roots and regenerants. a-b, proximal end of

leaf; c-d, hairy roots on SH medium in ex vivo source of explants; e, regenerants; f,

plageotropism. g, shoots of regenerants; h, leaves of regenerants. i, leaves of pPCV002-

ABC transgenics. .............................................................................................................. 95

Figure 6.2 PCR analysis of (a) rolC and (b) virD1 in the transgenic hairy roots’ genome.

.......................................................................................................................................... 98

Figure 6.3 RP-HPLC Chromatographs representing elution pattern of phytoecdysteroids

in transgenic hairy roots of A. bracteosa. a, Elution of 6 standard phytoecdysteroids; b,

pattern of elution in transgenic hairy root line (A1). ........................................................ 99

xxiii

Figure 6.4 Growth (a) and production (b) of phytoecdysteroids in the transgenic hairy

roots. ............................................................................................................................... 100

Figure 6.5 Phytoecdysteroid content in 11 elite transgenic hairy root lines of A. bracteosa

........................................................................................................................................ 101

Figure 6.6 SQ-RT-PCR of some selected transgenic hairy root lines with (a) rolC (363

bp) and (b) actin (160 bp). M, marker (100 bp+ and 1.0 kb); PC, positive control (colony

PCR); NC, negative control (untransformed roots); WT, wild-type untransformed plant.

........................................................................................................................................ 102

Figure 6.7 Times increase in Phytoecdysteroid content in regenerants obtained from

transgenic hairy roots of A. bracteosa. ........................................................................... 103

Figure 6.8 Sengosterones’ de novo biosynthesis in transgenic hairy roots of A. bracteosa.

a; elution of standards, b; wild type intact plant, c; intact pPCV002-ABC transgenic

plants, d; transgenic hairy roots, e; regenerants obtained from hairy root A1. .............. 104

Figure 6.9 Trend of individual phytoecdysteroid biosynthesis in 59 transgenic hairy root

lines (b) of A. bracteosa ................................................................................................. 105

Figure 6.10 Different hairy roots phenotypes a: control in vitro grown untransformed

roots, b-c: callus like morphology, d: transgenic hairy root with thick morphology, e:

transgenic hairy root with thin morphology, f: typical transgenic hairy root................. 106

Figure 6.11 PCR analysis of the selected genes to confirm their integration into the

transgenic hairy roots’ genome. ..................................................................................... 107

Figure 6.12 Effect of MeJ and Cor on phytoecdysteroids production in selected

transgenic hairy roots lines. MeJ: Methyl jasmonate, Cor: Coronatine ......................... 108

Figure 6.13 Effect of MeJ and Cor on (a) growth rate and (b) production rate of

phytoecdysteroids of elicited transgenic hairy root lines. .............................................. 109

xxiv

LISTOF TABLES

Table 2.1 Comparison of IC50 values ............................................................................... 36

Table 2.2 Mortality of brine shrimps exhibited by various extracts of A. bracteosa in

brine shrimp cytotoxicity assay ........................................................................................ 37

Table 2.3 Effect of A. bracteosa extracts on tumors inhibition in potato disc antitumor

assay ................................................................................................................................. 37

Table 2.4 Cancer chemopreventive and cytotoxic (SRB assay) potential of the crude

extracts of A. bracteosa. ................................................................................................... 41

Table 3.1 Folklore name of A. bracteosa from collected habitats with geographical

parameters ........................................................................................................................ 44

Table 3.2 Study of morphological parameters of the collected samples .......................... 50

Table 3.3 ANOVA table showing effect of seasons, habitats, tissue types and their

interaction on the distribution of phytoecdysteroids ........................................................ 55

Table 3.4 ANOVA table showing effect of seasons, habitats and tissue types on

antioxidant activities and total flavonoid and phenolic content ....................................... 57

Table 4.1 Composition of media used in tissue culture and transformation .................... 64

Table 4.2 Explant sensitivity against selective antibiotic kanamycin .............................. 70

Table 4.3 ANOVA table showing significance of different influential factors affecting

transformation, tissue types and their interactions ........................................................... 72

Table 4.4 Effect of OD, AS, IT and CCT on transformation frequency of petiole explants

in transient GUS expression ............................................................................................. 73

Table 5.1 Attributes of genes screened by PCR and semi-quantitative RT-PCR analysis

in transgenic plants of A. bracteosa ................................................................................. 81

xxv

Table 5.2 Analysis of Variance (ANOVA) of pPCV002-ABC transformed intact plants

using 2-Factor Complete Randomized Design ................................................................. 88


in transgenic hairy roots of A. bracteosa .......................................................................... 93

Table 6.2 Media used for the optimization of hairy root induction, stabilization and

steady growth in A. bracteosa. ......................................................................................... 94

Table 6.3 Effect of medium on induction of hairy roots in A. bracteosa ......................... 95

Table 6.4 Effect of medium on proliferation of hairy roots in A. bracteosa .................... 96

Table 6.5 Effect of medium on stable growth and maintainability of hairy roots ........... 97

Table 6.6 Effect of explants’ origin on hairy root induction and its attributes in A.

bracteosa .......................................................................................................................... 97

Table 6.7 Analysis of Variance (ANOVA) of transgenic hairy root lines using 2-Factor

Complete Randomized Design ....................................................................................... 101

Table 6.8 Hairy root morphology and integration of T-DNA fragments of pRiA4 in hairy

root genome .................................................................................................................... 106

xxvi

ABSTRACT

Ajuga bracteosa has been used traditionally to cure a variety of diseases. In the current

study, crude extracts of A. bracteosa were prepared by using its aerial and root parts

separately first in chloroform (AbCA and AbCR) and subsequently in methanol (AbMA

and AbMR) to test its pharmacological potential. AbMA represented highest values of

flavonoids as quercetin equivalents (QE 1.98% DW) and phenolic contents as Gallic acid

equivalents (GAE 5.94% DW) as well as significantly scavenged DPPH radicles (IC50

36.9) and reduced ferric ions with 718.4 mg ascorbic acid equivalent/g (AAE). In vivo

assays conducted on rats expressed that AbMA significantly reduced edema (up to

74.3%), showed maximum nociceptor suppression and maximum anticoagulation (89.3

sec). All extracts were found strong antidepressants. AbCR displayed a significant NFκB

inhibitory activity (57.5%) and promising cell survival (108 to 125 %). Strong inhibition

of aromatase enzyme (76%) and a promising QR1 induction (3.0) in Hepa 1c1c7 cells

was displayed by AbCA and AbMR respectively.

The impact of phytogeography, season and tissue type on morphology, phytoecdysteroid

content (PEs) and antioxidant activities of A. bracteosa were evaluated. Among the six

studied PEs, four were successfully detected and 20-hydroxyecdysone was found as the

most prominent PE. Plants of Sarsawa (SA) habitat produced highest PE content (1967

µg/g) while flower tissue type represented highest PE content (1868 µg/g) followed by

root part (1221 µg/g). Season versus habitat interaction exposed plants of KR habitat

collected during winter to hold maximum PE content (3620 µg/g). Plants collected in

winter season displayed significantly high antioxidant activities i.e. 82.3 % inhibition of

DPPH radicles and 3.35 % AAE in total reducing power (TRP) assays. This attribute can

be a result of highest phenolic content in the plants collected in winter i.e. 4.74 GAE.

Leaf tissue type displayed a significantly high antioxidant activity (81 % DPPH free

radicles inhibition and 3.49 AAE in TRP), highest total phenolic (4.99 GAE) and total

flavonoid content (2.4 QE). Based on the results, it is hypothesized that chilling cold

hampers vegetative growth and triggers stress induced PEs accumulation, high phenolic

content and antioxidant capacity as a defense response.

Considering the fact that concentration of PEs is very low in wild-type plants and

chemical synthesis is not viable, metabolic engineering strategies offer a promising

solution for the bulk production of these natural products. Therefore, the current study

xxvii

was conducted to optimize transformation conditions for A. bracteosa by employing

Agrobacterium tumefaciens C58C1 harboring the binary plasmid p35SGUSINT with

GUS as the reporter gene and the NTPII gene as the selectable marker. rol genes are well

known inducers/enhancers of plant secondary metabolism. Once the transformation

conditions were optimized, to study the effect of rol genes on the PE biosynthesis in A.

bracteosa, transformation through A. tumefaciens strain GV3101 harboring pPCV002-

ABC was conducted which resulted in the generation of A. bracteosa plants with altered

plant architecture. After the confirmation of T-DNA in seven selected transgenic lines, a

significant increase of PEs in the independent transgenic lines up to 14.5 times higher as

compared to control plants was detected.

Several hairy root lines were obtained from A. rhizogenes strains LBA-9402, A4 and

ARqua1 and the integration of TL-DNA of pRi was confirmed in 59 hairy roots. It is

found that actively growing hairy root lines also showed a high PEs’ profile. Hairy root

lines A4-2 and 9402-01 represented highest PE content i.e. 4449 and 4123µg/g dry

weight respectively. SQ-RT-PCR and densitometeric molecular imaging analysis

revealed a high rolC expression in the root lines from which a high PE content was

harvested. Somatic embryogenesis of hairy root cells generated whole plants

(regenerants) which were substantially different in every morphological aspect to

untransformed and pPCV002-ABC transformed plants. Regenerants expressed more PEs

content than the mother hairy root lines suggesting the presence of a possible sink

(leaves). Considering the PEs’ negative feedback inhibition, we can speculate that due to

unavailability of a suitable sink, further biosynthesis of PEs is hindered in hairy roots.

The clones of these transgenic roots were maintained for successive subcultures on

hormone free medium to attain a stabilized morphology. Hairy roots displayed four

different morphologies: typical hairy root morphology (THR) (59%), callus like

morphology (CM) (17%), normal typical hairy root with thick morphology (NTK) (14%)

and normal typical hairy root with thin morphology (NTN) (10%). Growth rate of the

transgenic hairy root lines varied according to their morphologies and highest growth

rate was found in CM (3.93 times / month). However, THR were found to possess

highest PE content (1538.5 µg/g). Phenotypes of hairy roots were found closely related

to the presence of TR-DNA of pRi. A comparison of hairy root morphology with the

genes of TR-DNA of pRi represented 100% presence of mas1 and ags, and 90% for aux1

xxviii

in CM. The clones with NTK morphology were dramatically all positive for the TL- and

TR-DNA genes. Contrary to it, the NTN clones represented 0% presence of aux1 and

ags genes. Eleven hairy root lines displaying high growth rate and PE content were

elicited with methyl jasmonate (MeJ) and coronatine (Cor). MeJ doubled the PE content

in 14 days elicitation (8356 µg/g in L2) as compared to unelicited control hairy roots and

5.6 times to control in vitro grown untransformed roots. The current study reveals the

best natural source of A. bracteosa for highly valuable secondary metabolites.

Furthermore, the possible mechanism to enhance the amount of these active compounds

through transformation and elicitation has been explored. Further studies will help to

establish the underlying mechanism behind these observations.

1

CHAPTER 1

1 Introduction

1.1 Medicinal plants

The world is blessed with a wealth of medicinally important plants. Human being

inherited the knowledge of medicinal plants for various uses such as treating human and

livestock’s ailments, crop protection, poisons for hunting, water purification. Though,

synthetic drugs have brought about a revolution to control diseases, nevertheless, more

than 80% of the world population especially from the underdeveloped and developing

countries uses folk medicines which are derived from plants (Kamboj, 2000; Vohra and

Kaur, 2011). In the famous traditional medication systems e.g. Ayurveda, Sindha, Greco

Arab etc. plants or plant products have been used for the medicinal purposes (Parjapati et

al., 2003). Low-cost, famousness in society and minimal side effects are the major

reasons for the bulk use of herbal medicines across the globe especially in Asia (Pal and

Shukla, 2003). It is estimated that approximately 70,000 plant species have been used at

one time or the other, for the medical treatments (Kumar et al., 2010). Common forms of

preparation methods for remedies made of medicinal plants include paste, poultice, juice,

powder, chewing fresh plant parts, infusion and decoction (Uprety et al., 2012).

1.2 Ajuga bracteosa

Ajuga is among 266 genera of the family Lamiaceae and consists of at least 301 species

(Israili and Lyoussi, 2009). The genus Ajuga contains more than 40 species and the most

widely used in folk medicine is Ajuga bracteosa Wall. ex. Benth. A. bracteosa is a

perennial herb growing wild from Kashmir to Nepal, Afghanistan, Bhutan, China,

Himalaya and Malaysia and found at an altitude of 1,300 m (Chandel and Bagai, 2011;

Singh et al., 2006). Locally this plant is called “Nilkanthi” (Sanskrit), “Jaan-e-Adam”

(Urdu, Kashmiri) (Hamayun et al., 2006) and “Kori Booti” (Hindko, Punjabi) (Chopra

and Nayar, 1956). In Pakistan, A. bracteosa is found in northern hilly areas in field

margins, along roadsides, open slopes and even on rock cervices (Chopra and Nayar,

1956). A. bracteosa is diffusely branched, compressed to the ground, evergreen, prostrate

and frequently decumbent or stoloniferous. It ranges in height from 10 to 30 cm

(Hamayun et al., 2006). It flowers from March to July and set seeds from September to

2

November. The leaves of A. bracteosa are; either oblanceolate or spathulate; the margins

can be sinulate to toothed; 3.5-10 × 2.5-3 cm size. Lower leaves of A. bracteosa are

petiolate while upper leaves are sessile (Upadhyay et al., 2012). A. bracteosa has

hermaphrodite flowers which range in color from white, pink or purplish-violet (Pal and

Pawar, 2011b). The flowers are found in axillary whorls appearing as spikes and

distinctively tinged at lower epidermis (Hamayun et al., 2006). Calyx is 4 mm long and

villous; teeth half as long as the tube; ovate to lanceolate. Corolla are pale blue or lilac,

pubescent; 8-10 mm long, upper lips are very short and flat; lower lips are spreading and

3-lobed; middle lip is generally dilated and the largest and 2-lobed. Stamens are

didynamous; the lower pair is longer, ascending, exerted or included; anthers 2-celled.

Ovary is short and 4-lobed; style 2-fid, the lobes are nearly equal (Upadhyay et al.,

2012).

Figure 1.1 Ajuga bracteosa

1.3 Ethnobotany and ethnopharmacology

Ajuga is reported with numerous applications. Many species of this genus have been

reported to have antitrypanosomal, antileishmanial, antimicrobial, antitumor, anti-

inflammatory, hepatoprotective, and immunomodulatory properties (Ahmed and

Chaudhary, 2009). Some species of Ajuga have also been found to be active against

3

anopheline and culicine mosquitoes (Pavela, 2008). Pal and Pawar (2011b) found that A.

bracteosa has been used in ethno-medicine to exploit its medicinal properties including

astringent, hypoglycemic, anthelmintic, diuretic, antifungal, anti-inflammatory and

antimycobacterial. The leaves of A. bracteosa are used as stimulant and diuretic. Whole

plant is used for the treatment of rheumatism, gout, palsy and amenorrhea (Kirtikar and

Basu, 1918) which is accordance with the recommendations of Ayurveda (Kaithwas et

al., 2012). Chauhan (1999) mentioned that the juice of the leaves of A. bracteosa is used

as a blood purifier and powder form for boils and burns. A. bracteosa is traditionally

used to treat fever and phlegm (Chauhan, 1999). Pal and Pawar (2011b) mentioned

traditional use of A. bracteosa in the cure of malaria and gout and regarded it as an

alternate of cinchona. The leaves of A. bracteosa are used as a remedy for acne,

constipation, ear infections, headache, hypertension, jaundice, measles, pimples, sore

throats, and stomach hyperacidity, as blood purifier and as cooling agent (Barkatullah et

al., 2009; Ibrar et al., 2007; Qureshi et al., 2009).

1.4 Biological evaluation of Ajuga bracteosa

Ajuga bracteosa has great medicinal significance in ethnobotany. Enormous

ethnopharmacological value of this plant triggered a competition to explore it for the

sake of modern effective drugs. Chandel and Bagai (2011) found that A. bracteosa

possess significant in vitro antiplasmodial efficacy (IC50 10 μg/ml) and exhibited in vivo

significant blood schizontocidal activity (250-750 mg/kg/day). Pal and Pawar (2011b)

investigated aerial parts of A. bracteosa in Swiss albino mice and found significant and

dose-dependent analgesic effects of chloroform and aqueous extracts suggesting its

mediation through opioid receptors.

Gautam et al. (2011) found that the 70% ethanolic extract of A. bracteosa has

considerable anti-inflammatory activity which is mediated through inhibition of COX-1

and COX-2 enzymes. They further isolated five active constituents viz; ajugarin I,

lupulin A, withaferin A, reptoside and 6-deoxyharpagide from this fraction and found 6-

deoxyharpagide significantly inhibiting COX-2 enzyme. Further, Kaithwas et al. (2012)

investigated 70% ethanolic extract of A. bracteosa on chronic immunological arthritis in

albino rats and found significant and dose dependent inhibitory effects even better to

standard drug aspirin. Hsieh et al. (2011) studied the anti-inflammatory activities of A.

4

bracteosa and reported that chloroform extract (ABCE) inhibited the production of NO

and TNF-α, inhibited NFĸB activation and subsequently decrease nuclear p65 and p50

protein levels. The extract also protected the liver from injury by reducing the activity of

plasma aminotransferase in animal mice model and alleviated CCl4-induced liver fibrosis

due to the suppression of macrophage activation. Thus, the above mentioned studies

support its usage both in rheumatism and inflammatory diseases.

Essential oils extracted from A. bracteosa exhibited significant antimicrobial activity

(MIC 0.33-12.2 mg/ml) and DPPH-radical scavenging activity (78%) at 1.0 mg/ml

(Mothana et al., 2012). Methanolic extract of A. bracteosa is reported to be significantly

effective against Staphylococcus aureas and acetone extract active against E. coli (Vohra

and Kaur, 2011). Pal and Pawar (2011b) investigated analgesic activity of aerial parts of

A. bracteosa in mice with acetic acid-induced writhing test and tail immersion test. They

found significant and dose-dependent analgesic effects (200 and 400 mg/kg) in

chloroform and water extracts.

1.5 Antioxidant activities and polyphenolic compounds

Reactive oxygen species (ROS) are chemically active derivatives of oxygen, generated

either in a concentration required for normal cell function, or in excessive quantities-the

state called oxidative stress (Nordberg and Arner, 2001). Reactive oxygen species

including free radicals are the byproducts of metabolism and are detrimental to plant

cells (Hammerschmidt, 2005b). Detrimental effects of ROS especially hydrogen

peroxide, hydroxyl radicals and superoxide radicals include enzymes inactivation and

damage to vital cellular machinery. Moreover, peroxidation of lipids (POL) results in the

formation of highly reactive singlet oxygen which in turn produces lipid hydroperoxides

and lipid peroxy radicals (Steinberg, 1997). Free hydroxyl radicals act as strong

oxidizing agents and can cause damage to important biomolecules such as DNA

(Marnett, 2000) and trigger lipid peroxidation (Steinberg, 1997). Therefore, it is essential

for the plant to alleviate the excessive amount of ROS. The self-defensive mechanism of

plant includes an array of radical scavenging antioxidants. Antioxidant defense system

includes phenolics, flavonoids, alkaloids, carotenoids, α-tocopherols, ascorbate,

glutathione, polyamines etc. (Mullineaux et al., 1997).

5

The defense reactions are held in intracellular compartments and to some extent in the

apoplast. The catalysis of superoxide (•O2-) to molecular oxygen and hydrogen peroxide

(H2O2) is modulated by enzymes like superoxide dimutases (Scandalios, 1993). ROS are

also scavenged by ascorbic acid (Buettner, 1993). The singlet oxygen concentration is

also reduced by carotenoids. Furthermore, glutathiones recycle ascorbic acid, scavenge

hydroxyl radicals and singlet oxygen, and protect thiol(-SH) groups of enzymes (Foyer et

al., 1994). Plants with higher level of antioxidants have increased resistance to the

oxidative damages.

Phenolics either impart flavor, odor and pigment to the plant or toxicity to phytophagous

organisms. These diverse groups of secondary metabolites actively defend plants against

phytopathogens and activate genes meant for plant defense (Hammerschmidt, 2005a).

Infected cells abruptly increase phenolic content to get rid of pathogen (Fry, 1987).

Phenolics like simple phenols, phenolic acid, flavonols and some isoflavones are

produced by healthy (uninfected) plants to inhibit fungal growth (phytoanticipins).

However, phenols like isoflavonoids, flavans, phenanthrenes, stilbenes and

furocoumarins are synthesized in response to infection (phytoalexins) (Lattanzio et al.,

2001). Sometimes plant accumulate stress induced ROS which are toxic to both pathogen

and plant (Baker and Orlandi, 1995). Anthocyanins accumulation at infection site is

thought to scavenge ROS (antioxidants function) and reduce cell damage

(Kangatharalingam et al., 2002). Polyphenols can scavenge more ROS as compared to

ascorbate and tocopherols. Chemical activities of polyphenols such as donation of

hydrogen or electron determines their antioxidant potentials (Rice-Evans et al., 1997).

Plants release phenolic compounds at injured place which are considered responsible for

the defensive mechanism. Recently, a new phenolic compound ‘ajuganane’ has been

isolated from A. bracteosa (Hussain et al., 2012).

Flavonoids are a class of plant secondary metabolites containing 15-carbon skeleton.

They include flavonols, flavanols, flavones, flavanones, dihydroflavonols, chalcones,

dihydrochalcones and anthocyanidins, which are responsible for a broad range of

biological activities (Parr and Bolwell, 2000). Flavonoids are physiologically active

secondary metabolites and possess antimicrobial (Yilmaz and Toledo, 2004), and

antifungal activities (Grager and Harbone, 1994). Flavonoids are attributed to crosslink

microbial enzymes, inhibit microbial enzymes which degrade cell wall and chelate metal

6

ions (Skadhauge et al., 1997). It is found that anthocyanins and flavonoids also possess

antioxidant potential (Kubo et al., 1999).

Many studies report a differential pattern in the presence of polyphenolic compounds in

different parts of plants. The concentration of total flavonoid and phenolic content in

Thymelaea hirsuta was detected highest in flowers and least total flavonoid content was

found in stem tissues. Further, the flower tissue type displayed a significantly high

antioxidant activity measured by ABTS and DPPH assays (24.52±1.08 and 90.83±0.3 %

inhibition at 8mg/ml concentration respectively) compared to other tested tissue types.

Antioxidant activities were found to have significant positive correlation with

polyphenolic content in plants (Amari et al., 2014). High antioxidant activity of both the

leaves and roots has been reported for four Centella asiatica accessions. These parts of

C. asiatica also contained highest amount of α-tocopherol. Moreover, a strong

correlation between antioxidant activities and total phenolic contents was found (Zainol

et al., 2003). Recently, A. bracteosa was tested for its antioxidant activities and highest

was found in reducing power assay with 54.0 vitamin C equivalent mg/g in

methanol/chloroform extract. In the same extract, a higher value of total phenolic content

(34.1 Gallic acid equivalent/g) and total flavonoid content (17.9 mg Quercetin

equivalent/g) was found as compared to aqueous extracts of plant (Akhtar et al., 2015).

1.6 Secondary metabolites of A. bracteosa

A large number of compounds have been isolated from the A. bracteosa, including

phytoecdysteroids, neo-clerodane-diterpenes, di- and triterpenes, anthocyanidin-

glucosides, iridoid glycosides, withanolides, flavonoids and triglycerides. These

compounds possess anabolic, analgesic, antimicrobial, antiestrogenic, anti-inflammatory,

antihypertensive, antileukemic, antimalarial, antimycobacterial, antioxidant, antipyretic,

cardiotonic, cytotoxic, hypoglycemic, and vasorelaxing activity, as well as antifeedant

activities (Israili and Lyoussi, 2009).

Withanolides possess many biological activities including anti-inflammatory, antitumor,

cytotoxic, immunomodulating, cancer chemopreventive, antibacterial antifungal,

insecticidal, feedant deterrents and selective phytotoxicity (Misico et al., 2011). Three

new withanolides, bracteosin A, bracteosin B and bracteosin C have been isolated from

the whole plant of A. bracteosa and they found to possess evident inhibitory potential

7

against cholinesterase enzymes in a concentration-dependent fashion (Riaz et al., 2004).

Riaz et al. (2007) also isolated bractin A and bractin B and bractic acid from A.

bracteosa. These compounds displayed inhibitory potential against enzyme

lipoxygenase.

A wide range of neo-clerodane diterpenoids from Ajuga were documented by Coll and

Tandrón (2008) and it was concluded that antifeedant activity against pests is due to the

presence of neo-clerodane diterpenoids. Different neo-clerodane diterpenoids were

isolated from dichloromethane extract of A. bracteosa including ajubractins A-E,

clerodin, 3-epi-caryoptin, ajugapitin, 14,15-dihydroclerodin, 3-epi- 14,15-

dihydrocaryoptin, ivain II, and 14,15-dihydroajugapitin. Moderately high antifeedant

activity against Spodoptera littoralis larvae was displayed by all the compounds except

the first two on lettuce (Lectuca sativa) (Castro et al., 2011). Verma et al. (2002)

reported a new clerodane diterpene from A. bracteosa (bracteonin-A) and two known

neoclerodane diterpenoids 14,15-dihydroajugapitin and 14-hydro- 15-hydroxyajugapitin

alongwith β-sitosterol and stigmasterol. Singh et al. (2006) isolated a new phthalic acid

ester 1,2-benzenedicarboxylic acid bis(2S-methyl heptyl) ester, a neo-clerodane

diterpene ajugarin-I, and two iridoid glycosides reptoside and 8-O-acetyl harpagide.

Iridoid glycosides are reported as novel cancer chemopreventive agents as 8-O-acetyl

harpagide produced significant inhibitory effect on carcinogenesis test (Konoshima et al.,

2000) and induced the inhibition of pulmonary tumors in mice (Takasaki et al., 1999).

Singh et al. (2006) isolated β-pinene, limonene, β-phellandrene, Z- β-ocimene, γ-

terpinene, linalyl acetate, neryl acetate, geranyl acetate, nopyl acetate, linalool, borneol,

terpinin-4-ol, copaen-4-ol and β-sitosterol from the n-hexane fraction of A. bracteosa.

Vohra and Kaur (2011) extracted essential oils from leaves of A. bracteosa and the

analysis by GC-MS revealed the presence of limonene, α-humulene, β-myrcene, elemol,

camphene, β-caryophellene and α-phellendrene and found these oils active against

Staphylococcus. Mothana et al. (2012) extracted essential oils from the aerial part of A.

bracteosa followed by analysis by GC and GC/MS and identified 47 components

containing oxygenated monoterpenes, high content of aliphatic acids, borneol and

hexadecanoic acid.

8

1.7 Phytoecdysteroids

Ecdysteroids are natural polyhydroxysteroids and steroidal molting hormones of

arthropods. The first ever ecdysteroid (ecdysone) was detected by Butenandt and Karlson

(1954) in silkworm pupae and its structure was deduced in 1965 by X-ray

crystallography. Subsequently, in the search of antitumor agents, Nakanishi et al. (1966)

isolated three polyhydroxylated steroids (ponasterones A, B and C) from the leaves of

Podocarpus nakaii. At the same time, the major biologically active ecdysteroid, 20-

hydroxyecdysone was detected in Podocarpus elatus (Galbraith and Horn, 1966). In the

preceding years, phytoecdysteroids were isolated from several plant species and it soon

became apparent that they are rather widespread in plants (Dinan, 2001; Dinan et al.,

2009; Dinan et al., 2001; Lafont et al., 2010). Plants usually contain small amounts of

ecdysteroids (Saatov et al., 1993), while animals contain even lesser ecdysteroids than

plants (Lafont and Connat, 1989b). Almost 37 ecdysteroids have been reported and

isolated so far, out of which 17 were observed in Ajuga species (Ramazanov, 2005).

1.8 Functions of phytoecdysteroids

As mentioned above, ecdysteroids are steroidal hormones typically responsible for

molting and metamorphosis in insects. Several of their analogues (phytoecdysteroids) are

also reported from plants which are anticipated to function as natural insecticides for

plants. Phytoecdysteroids are structural analogs of the insect molting hormone ecdysone.

It is suggested that phytoecdysteroids are a mean of plant chemical defense against

insects and nematodes, and provides an environmentally safe approach to plant

protection. Most of the plants which do not biosynthesize phytoecdysteroids are still

genetically able to synthesize phytoecdysteroids but they have an inactive

phytoecdysteroid biosynthetic pathway (Bakrim et al., 2008). Phytoecdysteroids

containing plant species mimic the endogenous hormones and induce a precocious

molting leading to the animal’s death. Several plant species have developed defenses

against insects that are based on the ecdysteroid action (Browning et al., 2007). The

steroid hormone 20-hydroxyecdysone (20E) binds to its cognate nuclear receptor and

triggers the main developmental transitions, in particular molting and metamorphosis in

insects (Browning et al., 2007).

9

These are key regulators of metamorphosis, cell differentiation and reproduction

(Browning et al., 2007). Kizelsztein et al. (2009) found a significant decrease of body

weight gain and body fat mass, plasma insulin levels and glucose tolerance by 20-HE

treatment in mice model. 20-HE is independent of testosterone and resulted in a 115%

increase in developing body mass (Slama et al., 1996). They displayed the anti-obesity

and anti-diabetic effects of 20-HE and found that 20-HE begins to elucidate its putative

cellular targets both in vitro and in vivo.

Phytoecdysteroids are active in protein biosynthesis by increasing the activity of

polyribosomes resulting is an increase in body mass (Syrov, 1983). Administration of

phytoecdysteroids increases protein-synthesizing processes in rats (Otaka et al., 1969)

and increased body mass in rats by increasing the mass of internal organs and skeletal

muscle (Syrov et al., 1996). This increase is linked with the increase in total blood

protein content, the number of erythrocytes in peripheral blood and hemoglobin content

(Syrov et al., 1996). In mouse skeletal cell line, hairy root extract of A. turkestanica

containing 20-HE, turkesterone, and cyasterone in 10 or 20 μg/ml concentration

increased protein synthesis by 25.7% or 31.1%, respectively (Cheng et al., 2008).

Ecdysteroids increased the activities of glutamatedecarboxylase (Chaudhary et al., 1969;

Lupien et al., 1969), acetylcholinesterase (Catalán et al., 1984) and alkaline phosphatase

(Kholodova, 1978). Phytoecdysteroids lower the urea and residual nitrogen blood levels

and improve kidney functioning and ecdysten preparation for eye complications in

chronic glomerulonephritis patients is recommended (Saatov et al., 1999). Ecdysteroids

are neuroprotective (Wang et al., 2014b), anti-hyperglycemic (Chen et al., 2006) and are

antifungal and antibacterial (Ahmad et al., 1996). They suppress albuminuria (Syrov and

Khushbaktova, 2000), activate human lymphocytes (Trenin and Volodin, 1999), reduces

lipid peroxidation (Kuzmenko et al., 2001), increase the copulative function and

improved the sperm quality (Mirzaev et al., 1999), prevent myocardial ischaemia and

arrhythmia (Wu, 2000) and exert therapeutic effect after lung contusion (Wu et al.,

1997). They regulate the process of peroxide oxidation of lipids (POL) in complicated

biological systems (Ramazanov, 2005). Ecdysterone is also found to be anti-

inflammatory agent (Kurmukov and Syrov, 1988). Turkesterone produced significant

effect to treat insulin-dependent diabetes (Najmutdinova and Saatov, 1999).

10

1.9 Structure of phytoecdysteroids

Phytoecdysteroids are a family of ~200 plant steroids which are C27, C28 or C29

compounds possessing a 14α -hydroxy-7-en-6-one chromophore and A/B-cis ring fusion

(5β-H) (Dinan, 2001). Majority of phytoecdysteroids possess a cholest-7-en-6-one

carbon skeleton (C27) which is derived in the biosynthetic pathway from cholesterol.

However, a few phytoecdysteroids contain a C28 or C29 skeleton, derived from

phytosterols with an alkyl group at C-24 position. The methyl groups at C-10 and C-13

in phytoecdysteroids have a β-configuration. During the metabolism of ecdysteroids,

modification and dehydroxylation of the β-ring is assumed (Lafont and Dinan, 2003).

Most of the phytoecdysteroids contains a hydroxyl group at 14α-position. The 14α -

hydroxy-7-en-6-one chromophore is considered responsible for characteristic ultra-violet

absorption of phytoecdysteroids at λmax 242 nm in polar solvents. Significant variation

lies in the number, position and orientation of the hydroxyl groups and the conjugating

moieties linked through these. Presence of hydroxyl group on various stoichiometric

carbon positions is the major difference in naturally occurring phytoecdysteroids. The

commonly hydroxylated sites are the 2b-, 3b-, 14α -, 20R- and 22R- positions, which

together give rise to the highly biologically active ponasterone A (25-deoxy-20-

hydroxyecdysone) (Dinan, 2001). Figure (1.1) shows the general structure of

phytoecdysteroids and hydroxylation points in 20-HE.

Figure 1.2 Structure of phytoecdysteroid. (a) General structure of phytoecdysteroids (b)

20-hydroxyecdysone

1.10 Localization of phytoecdysteroids

Phytoecdysteroids have been reported from more than 100 plant families including ferns,

gymnosperms and angiosperms. There are few reports regarding phytoecdysteroids

HO

R2

R3 O

OH

R1

R4

OH

OH

R5

(a)

HO

HO

O

OHH

OH

HOH

OH

(b)

11

distribution in plant families because less than 2% of the world’s flora has been

investigated for their presence (Dinan, 2001). 5-6% of the tested plant species were

positive for ecdysteroids. They are found in both annuals and perennials (Dinan, 1995b).

Major and minor phytoecdysteroids changes during the development of plant (Lafont et

al., 1991). Ecdysteroids accumulate in various aerial plant organs (Ramazanov, 2005).

Phytoecdysteroid content also varies in different parts of the same plant or even between

the plants at the same stage of development (Sarker et al., 1997). There is no general rule

for the localization of phytoecdysteroids in the plants parts and the concentration of

phytoecdysteroids vary in plants parts, during seasons, in different habitats and

developmental stage (Dinan, 1992a; Dinan, 1992b; Grebenok and Adler, 1991).

Evidences are supporting the idea that phytoecdysteroids accumulate in the organs of

plant which are most important for its survival. 20-hydroxyecdysone quantity depends on

climatic conditions (Saatov et al., 1993), plant age (Vereskovskii et al., 1983) and also

varies during plant development (Grebenok and Adler, 1991, 1993).

In spinach (Spinacia oleracea), level of phytoecdysteroid/seed was 17 μg while the seed

coat has only 1 μg. This content remains unchanged for first 20 days of development but

after it, this content increases. Feeding the plant with radiolabeled [2-14

C]MVA

suggested the synthesis of phytoecdysteroids in leaves and its physiological

accumulation in the apical most leaves (Grebenok and Adler, 1991). Bakrim et al. (2008)

reported that older leaves of spinach synthesize phytoecdysteroids (sources) and is

transported and accumulated to the newly developing leaves which act as sink.

Phytoecdysteroids biosynthetic regulatory mechanisms have a direct negative feedback

on their own phytosynthesis. It is assumed that for a sustained production of

phytoecdysteroids, they must be exported (Bakrim et al., 2008).

Ramazanov (2005) reviewed 35 ecdysteroids from Ajuga genus with their specifications

out of which eleven were actively present in A. bracteosa viz; ajugalactone, ajugasterone

A-D, polipodine B, cyasterone, sengosterone and ecdysterone. A comprehensive report

was published in 2007 documenting a wide range of phytoecdysteroids containing

species (Dinan and Lafont, 2007). Their number in A. bracteosa is increasing as many

more phytoecdysteroids are being reported.

Boo et al. (2010) studied 20-HE in individual plant of Achyranthes japonica and found

an increase in first leaf pair stage, followed a decrease with its vegetative growth. In

12

another study, Boo et al. (2013) found higher 20-HE content in root and flower tissues

than stem and leaf, and a decrease in 20E content in stem and leaf with reproductive

growth. 20-HE concentration is highest in the developing seeds of A. japonica and this

concentration decreases with its maturity which suggests a protective and defensive

function in developing organs against phytophagous insects (Boo et al., 2013). Tuleuov

(2009) extracted 20-HE from the aerial portion of several members of Asteraceae and

Caryophyllaceae and reported 20E content in Serratula cardunculus (0.61%) and S.

cretaceae (0.51%). These studies claim the differential accumulation of

phytoecdysteroids in the plant organs.

1.11 Phytoecdysteroids biosynthesis

The data regarding biosynthetic pathway of phytoecdysteroids in plants is scarce. Sterols

are considered to be the precursors of phytoecdysteroids while insects synthesize them

from dietary sterols of plants (Nes and McKean, 1977). Ecdysteroids biosynthesis to

some extent is discussed in many plant species including Spinacia oleracea (Adler and

Grebenok, 1995, 1999; Bakrim et al., 2008; Cheng et al., 2010; Dinan, 1995a; Festucci-

Buselli et al., 2008a; Grebenok and Adler, 1991; Grebenok et al., 1991; Grebenok et al.,

1994; Schmelz et al., 1998, 1999), Achyranthes japonica (Boo et al., 2013),

Chenopodium album (Dinan, 1992a; Dinan, 1992b; Dinan, 1995a), Polypodium vulgare

(Reixach et al., 1999), ferns (Canals et al., 2005; Lafont et al., 2010) and many other

species. In A. bracteosa, biosynthetic study of ecdysteroids remained restricted to the

radiolabeled precursors and many attempts were made to explain it. Phytoecdysteroids

biosynthesis is observed later in the morphogenesis when first and second leaf starts to

develop (cotyledons) while four radiolabeled substrates [2-14

C]mevalonic acid (MVA),

[4-14

C]cholesterol, [2-14

C]acetate and [22,23-3H]α-ecdysone are found incorporated into

the ecdysteroids of spinach (20-hydroxyecdysone and polypodine B) (Grebenok and

Adler, 1993). Proton and carbon (2H and 13C) radiolabeling of sterols substrates was

studied in Ajuga hairy roots clones explained the conversion of cholesterol to 20-

hydroecdysone (Okuzumi et al., 2003) without (Hyodo and Fujimoto, 2000) and with the

involvement of 7-Dehydrocholesterol (Fujimoto et al., 2000). But, the detailed

information and key steps in the biosynthetic pathway are missing. Contrary to it,

ecdysteroids biosynthesis is very well studied and documented in insects (Christiaens et

13

al., 2010; Enya et al., 2014; Iga and Smagghe, 2010; Niwa and Niwa, 2014; Niwa et al.,

2005; Ono et al., 2006; Thummel and Chory, 2002).

Figure 1.3 Biosynthetic pathway of phytoecdysteroids

Acetyl-CoAHO

HO

O

OHMevalonic acid

HO

H

H

H H

H

H

H

H

H

HO

HO

H H

H

Stigmasterol (C29)Brassicasterol (C28)Cholesterol (C27)

CH3

H3C

CH3

CH3

HO

H H

H

H

Lathosterol (C27)

CH3

H3C

CH3

CH3

HO

H H

7-Dehydrocholesterol (C27)

CH3

H3C

H3C

CH3

CH3

HO

OH

Ketodiol (C27)

O

H

H

Lathosteroloxidase

C6-Oxidase,CYP85A1-A3

Black Box

2-deoxyecdysone (C27)

CH3

CH3

OH

O

OH

CH3

CH3

OH

OH

H3C

CH3

CH3

OH

O

CH3

CH3

OH

OH

H3C

HO

HO

Ecdysone (C27) 20-Hydroxyecdysone

CH3

CH3

OH

O

CH3

CH3

OH

OH

H3C

HO

HO

OH

H

2-hydroxylase

CYP315A1,Shadow

20-hydroxylase

CYP314A1,Shade

CH3

CH3

O

OH

O

H

Ketotriol (C27)

H3C CH3

CH3

OHCH3

CH3

OH

O

OH

CH3

CH3

OH

OH

H3C

2-deoxyecdysone (C27)

CH3

H3C

H3C

CH3

CH3

HO

OH

O

H

H25-Hydroxylase,CYP306A1

CYP90,C22-hydroxylase

CYP302A1,disembodied

Ketodiol (C27)

14

Phytoecdysteroids biosynthesis starts with mevalonic acid pathway. Experiments

conducted on spinach revealed an incorporation of radiolabeled 2-14

C mevalonic acid

into reduced side chain C27-sterol (lathosterol) and radiolabeled lathosterol is found to

be the probable precursor for 24-desalkyl ecdysteroids (Grebenok and Adler, 1993) .

Lathosterol undergoes C6-oxidation most probably through CYP85 (Kim et al., 2005b)

and is converted to 20-HE via ketodiol, ketotriol, 2 deoxyecdyson and ecdyson. This step

is considered as “black box”. On the other hand, these reactions are well studied in

insects where these reactions are catalyzed by CYP306A1 (ketodiol to ketotriol) (Niwa

et al., 2004), CYP 90 and CYP 302A1 (ketotriol to 2-deoxyecdyson) (Chávez et al.,

2000; Warren et al., 2002), CYP315A1 (2-deoxyecdyson to ecdyson) (Warren et al.,

2002) and CYP314A1 (ecdyson to 20-HE) (Petryk et al., 2003). Many key steps

including the conversion of lathosterol to ecdyson and ecdyson to 20-HE are assumed

from the previous studies (Adler and Grebenok, 1995; Dinan et al., 2009). Figure 1.2

shows schematic representation of the key steps involved in phytoecdysteroids

biosynthetic pathway of A. bracteosa.

1.12 Agrobacterium tumefaciens mediated transformation

Agrobacterium tumefaciens is a soil born plant pathogen responsible for crown gall

disease. During the process, a specific segment of tumor inducing plasmid (Ti), generally

known as transfer DNA (T-DNA) is transferred from bacterium and stably incorporated

into the plant genome (Hansen and Wright, 1999). T-DNA contains oncogenes and genes

for the synthesis of opines. Expression of these genes disturbs the hormonal balance in

transgenic plant cell and results in the development of crown gall disease (Binns and

Thomashow, 1988). T-DNA has 25 bp direct repeats flanking both of its sides as right

and left border. Outside the T-DNA region, Ti plasmid has genes for opine catabolism,

virulence genes (vir), and an origin of replication (ori). vir region contains more than 10

operons (virA - virJ). T-DNA borders together with VIR proteins are essential for the

processing, transfer and integration of T-DNA into plant cell genome (Zupan and

Zambryski, 1995). The natural ability of A. tumefaciens is exploited in the

Agrobacterium-mediated transformation method where engineered T-DNA (carrying

selectable marker and/or genes of interest) can serve as an excellent vehicle (Klee et al.,

1987; Zambryski et al., 1983). Agrobacterium tumefaciens mediated transformation is

attractive because it is easy and cost effective method. Moreover, by this method, it is

15

possible to transfer large DNA fragments (150 kb) into plant nuclear genomes (Hamilton

et al., 1996) with higher stability of the expression of transgene (Hansen et al., 1997).

The concept that Agrobacterium could transform only dicots species was disproven as

many monocots and even fungi can be transformed by this method (Bundock et al.,

1995; Chan et al., 1993). To date, majority of the transgenic plant production has been

conducted through Agrobacterium-mediated transformation.

1.13 Agrobacterium rhizogenes mediated transformation

Agrobacterium rhizogenes is a soil born bacterium identified to cause hairy-root disease.

It causes hairy root syndrome in majority of dicot and some monocot plants due to its

large root-inducing plasmid (pRi) (White and Nester, 1980). This plasmid contains a

segment of DNA which is transferred from bacterium to plant cell and referred as

transfer DNA (T-DNA). A. tumefaciens T-DNA is integrated into the genome of the

plants as a whole, but A. rhizogenes has two T-DNAs which are transformed and

integrated into the plant genome independently. They are designated as TL-DNA and

TR-DNA. TL-DNA contains root locus genes (rolA, rolB, rolC) while TR-DNA contains

aux, mas and ags genes. The extensively ramified hairy roots normally grow in the

hormone free medium. Hairy roots are a valuable tool to produce secondary metabolites

and for understanding gene function in vitro (Rao and Ravishankar, 2002).

Infection process starts when A. tumefaciens and/or A. rhizogenes cells are

chemotactically attracted to the phenolic compounds released by wounded plant tissue.

Polyphenolic signal transduction activates vir genes in the agrobacteria and eventually

transfer T-DNA to the host cell. The T-DNA of A. rhizogenes when incorporated into

plant genomic DNA induces the hairy root syndrome (Gelvin, 2003; Veena and Taylor,

2007). The “hairy-root phenotype” is characterized by dwarf plants with short

internodes, reduced apical dominance, curled leaves and densely hairy roots and this

phenotype appears after the infection of wild-type A. rhizogenes strain (Tepfer, 1984).

1.14 Effect of TR-DNA genes of Agrobacterium rhizogenes

The rol genes cause the formation of root typically called as transgenic hairy roots which

have more growth rate as compared to the untransformed roots so they are considered as

a valuable tool for studying secondary metabolites (Bhadra et al., 1993). mas1 gene

16

specify a protein involved in manopine biosynthesis (Bouchez and Tourneur, 1991). ags

genes are meant for opine synthesis in transformed plant material (Binns and

Thomashow, 1988) together with aux genes responsible for the synthesis of auxins for

transformed tissue (Chriqui et al., 1996; Morris, 1986). Some scientists considers both

TL- and TR-DNA segments are necessary for hairy root induction (Huffman et al., 1984;

Jouanin, 1984), while other suggest that TL-DNA genes are solely responsible for hairy

root syndrome (Cardarelli et al., 1987; Palazón et al., 1997) while TR-DNA genes

especially aux genes provide additional auxins to transformed cells (Mallol et al., 2001).

Although many researchers studied the effect of TL- and TR-DNA genes on growth and

morphology of hairy roots and plants, but the mechanism of action of rol genes remains

unknown.

Transformed roots of Panax ginseng transformed with pRiA4 displayed three

morphological phenotypes: hairy roots (HR-M), callus-like (C-M) and thin. The aux1

gene was always detected in HR-M and C-M root phenotypes which presented the

highest biomass and ginsenoside productions (Mallol et al., 2001). When effect of

elicitation (chitosan, vanadyl sulfate or methyl jasmonate) was studied on these

mentioned hairy roots, results suggested that these roots grew and produced gensinosides

in a phenotypic-dependent manner. The highest ginsenoside yield was found with methyl

jasmonate at 25 day of culture. Highest ginsenoside content was achieved at the end of

the culture (day 28) by root lines C-M, HR-M and T-M was, respectively, 2, 1.8 and 4

times higher than unelicited corresponding hairy roots (Palazón et al., 2003). Hairy roots

of Withania coagulans obtained from the infection of A. tumefaciens strain C58C1

(pRiA4) represented two morphologies: callus-like and typical hairy roots. The aux1

gene was found in all callus-like roots, however, only 12.5% of the typical hairy roots

contained aux1, suggesting a strong role of aux genes to determine the phenotype of

hairy roots (Mirjalili et al., 2009). Transformed roots of three Solanaceae plants showed

two morphologies: typical hairy roots (high capacity to produce alkaloids) and callus-like

roots (faster growth capacity and lower alkaloid production). The aux1 gene was

detected in all roots showing callus-like morphology, however, it was only detected in

25-60% of typical hairy morphology. Interestingly pRiA4TR- (without aux genes) did

not produce roots with callus-like morphology which suggests a significant role of aux

genes in the morphology of transformed roots (Moyano et al., 1999). Tobacco cell lines

Bright Yellow-2 (BY-2) revealed that the introduction of the aux genes enabled the

17

auxin-autonomous growth of BY-2 cells, but the introduction of the rolABCD genes did

not affect the auxin requirement of the BY-2 cells suggesting that only the aux genes are

necessary for auxin autotrophic cell division (Nemoto et al., 2009). These results suggest

that TR-DNA genes of pRi are strong determinant of phenotype of transgenic hairy root.

1.15 Effect of TL-DNA genes (rol genes) of Agrobacterium rhizogenes

TL-DNA of pRi of A. rhizogenes is considered responsible for the induction of hairy root

syndrome in plants. Both TR- and TL-DNA have their own right and left borders and

range in size from ~15-20 kb each. The delivery of both TR-DNA and TL-DNA to the

host cell and their integration into plant genome occur independent of each other.

Sequencing of the agropine-type TL-DNA of Ri plasmid revealed 18 ORF in which rolA,

rolB, rolC, and rolD corresponds to ORF 10, 11, 12, and 15, respectively (Slightom et

al., 1986). The TL-DNA of agropine-type Ri plasmid carries four rol genes viz. rolA,

rolB, rolC and rolD (Slightom et al., 1986). The mannopine or cucumopine producing

strains of A. rhizogenes do not possess aux genes and carries only one T-DNA having

rolA, rolB and rolC genes. In these strains, this one T-DNA resembles with TL-DNA of

agropine strain but lacking rolD gene, is considered sufficient for the induction of hairy

root phenotype (Christey, 2001). Some scientists consider that function of rol genes is

most likely other than that of producing mere alterations in hormone concentrations

(Nilsson and Olsson, 1997). rol genes are also found repressing polyamine formation and

consequently, change the plant morphology (Martin-Tanguy et al., 1990).

The rolA gene (ORF10) encodes a protein of ~100 amino acids with 11 kDa molecular

mass. The function of this protein is not known but its basic nature suggests that it is a

nucleic acid-binding protein (Levesque et al., 1988). This concept is strengthened by the

similarity of ROLA protein with papillomavirus E2 DNA-binding protein (Rigden and

Carneiro, 1999). Physiological role of ROLA is not known but it is thought to act as a

transcription factor (Meyer et al., 2000). ROLA protein alters the metabolism of

polyamines (Martin-Tanguy et al., 1996; Sun et al., 1991), modifies the hormonal

physiology, reducing/inhibiting the content of gibberellins (Dehio et al., 1993) and

altered the phenotype which can never be induced by the application of exogenous

gibberellins (Dehio et al., 1993; Schmülling et al., 1993).

18

The rolB gene (ORF11), apparently the most powerful inducer of secondary metabolism

encodes a protein of 259 amino acids with 30 kDa molecular mass. This protein is

restricted to the cell membrane and is different from all known proteins except that of

Agrobacterium (Filippini et al., 1996). The rolB gene is considered as a strong growth

suppressor and it is found to disturb the hormonal balance and metabolism. ROLB

protein functions like β-glucosidase and cause the release of glucose-conjugated indole

acetic acid (Estruch et al., 1991). rolB genes alters signal transduction pathway of

hormones and enhances tyrosine phosphatase activity (Filippini et al., 1996) which

increases auxin sensitivity in transgenic cells (Maurel et al., 1991; Maurel et al., 1994).

The rolC gene (ORF12) encodes a protein of 179-181 amino acids with 20.1 kDa

molecular mass (Meyer et al., 2000; Nilsson and Olsson, 1997; Slightom et al., 1986).

ROLC is a β-glucosidase that enhances cytokinins concentration by hydrolyzing the

cytokinin glucosides conjugates. ROLC functions like cytokinins and affects plant

morphology (Estruch et al., 1991).

1.16 The secondary metabolism and rol genes

Oncogenes rolA, rolB, and rolC from A. rhizogenes have been reported as the most

probable activators of secondary metabolism in transformed cells from diverse plant

families. rolA transformed plants are reported to enhance the secondary metabolites like:

nicotine production in tobacco (Palazón et al., 1997) and 2.8 times more anthraquinones

in Rubia cordifolia (Shkryl et al., 2008). rolB gene is found to be the most potent

stimulator of secondary metabolism and suppressor of growth. rolB transgenic plant

material is found to enhance 15 times more anthraquinones in Rubia cordifolia (Shkryl et

al., 2008) and 100 times more resveratrol in Vitis amurensis cells (Kiselev et al., 2007).

An enhanced ROLB expression is thought to be responsible for the increased synthesis of

resveratrol (Dubrovina et al., 2009; Kiselev et al., 2009). rolC transgenics also induced

an enhancement in secondary metabolites production: nicotine in tobacco (Palazón et al.,

1998a), alkaloids in roots of tobacco (Palazón et al., 1997), indole alkaloids in

Catharanthus roseus (Palazón et al., 1998b), 12 times more scopolamine and

hyoscyamine in Atropa belladonna (Bonhomme et al., 2000), 1.8 to 3 times higher

ginsenosides (Bulgakov et al., 1998) and 1.8 times anthraquinone in Rubia cordifolia

(Bulgakov et al., 2002) as compared to their untransformed control plant material.

19

Moreover, this increase of anthraquinones in the ROLC transformed cells remained

stable for over a period of five years (Shkryl et al., 2008).

When plant tissues are transformed with a single insert containing rolA, B and C genes

together, an increased production of secondary metabolites is observed with less

detrimental effects to plant. rolB act as major inducer of secondary metabolism while

rolC finely tunes the activities of rolB (Bulgakov et al., 2009). Many studies revealed

antagonistic effects of different rol genes on each other. The growth of tobacco cells is

retarded due to rolB expression and it is minimized by rolC genes (Schmulling et al.,

1988). Moreover, high sensitivity to phytohormones and severity of transformed

phenotype caused by rolB gene is minimized by rolC (Bulgakov, 2008). In a study, it is

found that the hairy roots obtained from Artemisia dubia transformed with rolABC of A.

tumefaciens produced 36.581 μg/g DW of artemisinin as compared to 0.855 μg/g DW

produced by A. rhizogenes transformed roots (Kiani et al., 2012). Tomato (Solanum

lycopersicum) was transformed with A. tumefaciens harboring rolB gene from A.

rhizogenes resulted in an increased nutritional contents of fruits and also improved foliar

tolerance against fungal pathogens (Arshad et al., 2014).

1.17 Enhancement of phytoecdysteroids

So far, the enhancement of secondary metabolites using biotechnological methods

includes transformation of the genes which trigger secondary metabolism. Hairy roots

are a valuable source for the enhanced biosynthesis of many secondary metabolites and

often it is coupled with elicitors’ supplementation. A. bracteosa though not transformed

before, but three other species of Ajuga are reported for the enhanced production of

phytoecdysteroids. Transgenic hairy roots were generated from Ajuga reptans and A.

multiflora, while untransformed cell suspension culture of A. turkestanica was studied

for phytoecdysteroids’ profiling. Matsumoto and Tanaka (1991) established more than

20 hairy root clones of Ajuga reptans which they obtained from the infection of A.

rhizogenes strain MAFF 03–01724. Production of phytoecdysteroids in these clones was

found closely related to the growth rate of hairy roots as an elite hairy root line (Ar-4)

contained 4 times higher 20-HE content than control root and increased its weight by 230

times when cultured for 45 days.

20

Tanaka and Matsumoto (1993a) while working on regenerants derived from hairy roots

of Ajuga reptans found that they have more number of small sized leaves, high growth

rate and a high phytoecdysteroid content as compared to untransformed plants.

Interestingly, 20-HE content in the roots of regenerants was lower than the mother hairy

root lines, which suggest the possibility of the provision of a sink (leaves) for

phytoecdysteroids accumulation. Further, Tanaka and Matsumoto (1993a) found that pRi

of A. rhizogenes strain MAFF 03–01724 is responsible for dwarfing response in plants

(regenerants) and reported that the high capacity of rooting and 20-HE production of

original hairy root line was stably maintained in clonal regenerants. The same hairy roots

were found growing more when supplemented with exogenous indoleacetic acid (IAA,

0.1 mg/l) and a deficiency of phosphate decreased growth but increased the 20-HE

content (Uozumi et al., 1995). Another batch culture of the same hairy roots depleted

phosphate ions after 16 days and glucose was found the most adequate monosaccharide

for attaining a high cell mass (Uozumi et al., 1993). An enhancement in the cell growth

rate of the same roots was observed when the culture was supplemented with

naphthaleneacetic acid (0.1 mg/l) and smaller hairy root fragments exhibited the highest

plantlet formation frequency in the plantlet formation stage when supplemented with

benzyladenine (10 mg/l). In these hairy roots, β-glucuronidase (GUS) gene was

introduced which showed GUS activity in leaf tissues of the regenerated plants (Uozumi

et al., 1996).

Kim et al. (2005a) established transformation system for Ajuga multiflora by infecting

petiole explant with A. rhizogenes strain A4 and found 10 fold increase in 20-HE content

in hairy roots as compared to the wild type. Cholesterol, mevalonic acid and acetate are

precursors while methyl jasmonate (MeJ) is an elicitor of phytoecdysteroids

biosynthesis. Their addition in cell suspension cultures of A. turkestanica did not affect

phytoecdysteroid content, but an addition of 125 μM MeJ resulted in 3 fold increase in

20-HE content. On the other hand, hairy root cultures responded positively to the

addition of sodium acetate (150 mg/l), mevalonic acid (150 mg/l), and methyl jasmonate

and increased phytoecdysteroid content to two fold (Cheng et al., 2008).

21

1.18 Aims and objectives

i. To scientifically validate wide scale folk use of A. bracteosa by a number of

various in vivo and in vitro assays.

ii. To evaluate the impact of phytogeography, season and tissue types on

morphology, antioxidant potential and phytoecdysteroids’ biosynthesis in A.

bracteosa.

iii. To optimize the conditions for A. tumefaciens and A. rhizogenes mediated genetic

transformation of A. bracteosa.

iv. To describe the role of rol genes on morphology and phytoecdysteroids

biosynthesis in intact plants transformed with A. tumefaciens.

v. To study the effect of pRi TL- and TR-DNA genes of A. rhizogenes, and

elicitation on morphology and phytoecdysteroids biosynthesis in hairy roots of A.

bracteosa.

22

CHAPTER 2

2 Biological evaluation of Ajuga bracteosa

Intrinsic oxygen metabolism generates reactive oxygen species (ROS) as a by-product.

In addition to that, stress stimuli also cause the production of ROS. ROS production

inactivates enzymes and damages vital cellular organelles and membranes, consequently

causing cancers, aging, diabetes, atherosclerosis, chronic inflammation, HIV infection

etc. (Dröge, 2002; Karuppanapandian et al., 2011; Matsue et al., 2003). ROS also

modulate the principal neurotransmitters involved in the neurobiology of depression.

Foremost depression is linked to lower levels of several endogenic antioxidant arrays

(Scapagnini et al., 2012). This indicates that oxidative stress processes might also play a

relevant role in depression. ROS are also known to provoke inflammation and associated

pain caused by tissue injury (Winrow et al., 1993).

Antioxidants protect biological systems from deleterious effects of ROS by free radicals

scavenging mechanism. Antioxidants include carotenoids, anthocyanidins, superoxide

dismutase, catalase, glutathione peroxidase ferritin, ceruloplasmin, catechins, vitamin C,

tocopherols vitamin E, glutathione and flavonoids etc (Benzie, 2003; Chaudière and

Ferrari-Iliou, 1999). Synthetic antioxidants e.g. butylated hydroxyanisole (BHA) and

butylated hydroxytoluene (BHT) possess toxicity to living systems (Sasaki et al., 2002).

Moreover, heart strokes caused by intravascular blood clots are major cause of deaths

worldwide. Although heparin has been used to treat acute thrombotic disorders but it

poses some complications in its clinical usage (Lapikova et al., 2008; Moll and Roberts,

2002). To cope with these problems, there is an increasing demand of alternative

antioxidants and antithrombotic agent (anticoagulants). Medicinal plants have

historically been used as primary source of antioxidants (Ortega‐Ramirez et al., 2014)

and anticoagulants (Chaves et al., 2010).

Ajuga bracteosa Wall. ex. Benth. (Family Lamiaceae) is a perennial plant and is

distributed widely in Kashmir and sub-Himalayan tract. It is recommended in Greco

Arab system of medication for the treatment of several diseases (Gautam et al., 2011;

Kaithwas et al., 2012; Singh et al., 2012). Medicinal properties of A. bracteosa, such as

astringent, anthelmintic, anti-inflammatory and anti-microbial led its use into folk

23

medicine (Kaithwas et al., 2012). In a recently reported quantitative ethnobotanic survey

of KPK province of Pakistan, 92 medicinal plants species were listed. Among them, A.

bracteosa represented highest usage frequency (6) especially as blood purifier,

carminative, anti-cough, anti-asthma, anti-jaundice and as a cooling agent (Barkatullah et

al., 2015). Decoction of its bark is used to cure jaundice and sore throat (Rastogi et al.,

2001). Leaves extract of A. bracteosa is used as a remedy for acne, constipation, ear

infections, headache, jaundice, measles, pimples, sore throats, and hyperacidity, and as a

blood purifier and as cooling agent (Barkatullah et al., 2009). Moreover, it is found to be

pharmacologically active against cancer, hypoglycemia, protozoal diseases, spasmodic

activity and gastric ulcer (Pal and Pawar, 2011b). Extract of this plant lessened CCl4-

induced liver fibrosis (Hsieh et al., 2011).

The aim of the present study was to scientifically validate wide scale folk use of A.

bracteosa. Considering the medicinal potential of A. bracteosa, both the aerial and root

extracts were analyzed for their phenolic and flavonoids content and were further

assayed for in vitro anti-oxidant potential, in vivo anti-inflammatory, analgesic,

antidepressant and anticoagulant activities on Sprague-Dawley rats and in vitro cancer

chemopreventive assays.

2.1 Materials and Methods

2.1.1 Collection and identification of plant

Ajuga bracteosa field grown plants was collected from University Campus, Quaid-i-

Azam University, Islamabad, Pakistan during spring season. The plant was identified by

Prof. Dr. Rizwana Aleem Qureshi (taxonomist) in Plant Sciences department QAU. A

voucher specimen (HMP-460) was deposited in the “Herbarium of medicinal Plants of

Pakistan” in QAU Islamabad, Pakistan.

2.1.2 Preparation of extracts

Fresh plant material was rinsed with distilled water and aerial part was separated from

root. Both parts were air dried under shade. Extract was prepared by soaking ground

plant powder (both parts separately) in chloroform. After 24 hours, chloroform extract

was filtered with white cotton cloth. The residue was extracted two more times in the

same way. Extracts were filtered with Whatman filter paper 1 and was concentrated in

24

BUCHI Rotavapor R-200 rotary evaporator at 40 °C under low rotation and pressure. The

subsequent residue was extracted with methanol in the same way as described before.

The solvents used were of analytical grade and purchased from Sigma Aldrich, GmbH

Buchs Switzerland. Semi-liquid extracts were dried in fume hood and stored at -20 °C for

further usage. The overall scheme of extraction process is shown in Fig. 2.1. Dried crude

extracts were dissolved with the help of Elmasonic Sonicator (E30-H Germany)

accordingly in dimethyl sulfoxide (DMSO) to achieve the concentrations of 1000, 500,

250, 125, 62.5, 31.25, 15.63 and 7.81 ppm (µg/mL). These concentrations were tested in

antioxidant assays, against brine shrimps and potato disc antitumor assay. For the

conduction of assays on rats, crude extracts of 200 mg/Kg body weight of rats were

prepared, while 20 µg/mL concentration was used for anticancer assays.

Figure 2.1 Extraction scheme: AbMR: methanolic extract of root, AbMA: methanolic

extract of aerial portion, AbCR: chloroform extract of root, AbCA:

chloroform extract of aerial portion.

The names of extracts were abbreviated as; the first two italicized letters represent plant

(Ab, Ajuga bracteosa), the third letter represents the solvent (M, Methanol; C,

Chloroform) and the last letter represent the plant part (A, Aerial portion; R, Root). For

example AbMA represents the methanolic extract of aerial parts of A. bracteosa.

2.1.3 Determination of total flavonoid content

The total flavonoid content was determined by aluminum chloride colorimetric method

(Chang et al., 2002) with some modifications. Briefly, an aliquot of 0.5 mL of various

25

extracts (1 mg/mL) were mixed with 1.5mL of methanol, followed by the addition of 0.1

mL of 10% aluminum chloride, 0.1 mL of potassium acetate (1 M) and 2.8 mL of

distilled water. The reaction mixture was kept at room temperature for 30 min. Change in

absorbance was recorded by Spectrophotometer (Agilent technologies UV-VIS

Germany) at 415 nm. The calibration curve (0 µg/mL to 8 µg/mL) was plotted by using

quercetin as a standard. The total flavonoids were expressed as mg quercetin equivalent

(QE/g) dry weight.

2.1.4 Determination of total phenolic content

Total phenolic content was determined by using Folin-Ciocalteu reagent method with

few changes (Chang et al., 2002). Aliquot of 0.1 mL of various extracts (4 mg/mL) was

mixed with 0.75 mL of Folin-Ciocalteu reagent (10-fold diluted with dH2O). The

mixture was kept at room temperature for 5 min and 0.75 mL of 6% sodium carbonate

was added. After 90 min of reaction, its absorbance was recorded at 725 nm. The

standard calibration (0 μg/mL to 25 μg/mL) curve was plotted by using Gallic acid. The

total phenolic content was expressed as mg gallic acid equivalent (GAE/g) dry weight.

2.1.5 In vitro antioxidant assays

Extracts of A. bracteosa were analyzed for their antioxidant potential at 1000, 500, 250,

125, 62.5, 31.25, 15.63 and 7.81 ppm concentrations (prepared in DMSO). In all the

methods, ascorbic acid was used as a positive control. For a more reliable conclusion,

extracts were assayed by four different antioxidant determination methods.

2.1.5.1 2, 2- Diphenyl-1-picryl-hydrazyl radical (DPPH) assay

DPPH assay was conducted as described by Obeid (Obied et al., 2005) with some

modifications. DPPH solution was prepared in methanol (3.2 mg/100mL). In Eppendorf

tubes, 950 μl of DPPH solution and 50 μl of each extract were mixed and kept in dark at

37 °C for 1 hour. Change in absorbance was recorded at 517 nm with spectrophotometer.

Percentage inhibition was measured according to following formula and IC50 value was

calculated by table curve method.

𝑃𝑒𝑟𝑐𝑒𝑛𝑡𝑎𝑔𝑒 𝑖𝑛ℎ𝑖𝑏𝑖𝑡𝑖𝑜𝑛 = 𝐴𝑏𝑠𝑜𝑟𝑝𝑡𝑖𝑜𝑛 𝑜𝑓 𝑐𝑜𝑛𝑡𝑟𝑜𝑙 − 𝑎𝑏𝑠𝑜𝑟𝑝𝑡𝑖𝑜𝑛 𝑜𝑓 𝑠𝑎𝑚𝑝𝑙𝑒𝑠

𝑎𝑏𝑠𝑜𝑟𝑝𝑡𝑖𝑜𝑛 𝑜𝑓 𝑐𝑜𝑛𝑡𝑟𝑜𝑙 × 100

26

2.1.5.2 Hydrogen peroxide (H2O2) scavenging assay

Hydrogen peroxide scavenging activity was determined according to Ruch (Ruch et al.,

1989) with some modifications. A solution of 2 mM H2O2 was prepared in 50 mM

phosphate buffer (pH 7.4). Aliquot of 0.1 mL of various concentration of plant extracts

made in DMSO were transferred into the Eppendorf tubes and their volume was made up

to 0.4 mL with 50 mM phosphate buffer (pH 7.4). After addition of 0.6 mL of H2O2

solution, tubes were vortexed and after 10 min, absorbance at 230 nm was recorded,

against a blank (phosphate buffer). The ability to scavenge the H2O2 was calculated

using the following equation.

𝐻𝑦𝑑𝑟𝑜𝑔𝑒𝑛 𝑝𝑒𝑟𝑜𝑥𝑖𝑑𝑒 𝑠𝑣𝑎𝑣𝑒𝑛𝑔𝑖𝑛𝑔 𝑎𝑐𝑡𝑖𝑣𝑖𝑡𝑦 = (1 − 𝐴𝑏𝑠𝑜𝑟𝑝𝑡𝑖𝑜𝑛 𝑜𝑓 𝑠𝑎𝑚𝑝𝑙𝑒

𝑎𝑏𝑠𝑜𝑟𝑝𝑡𝑖𝑜𝑛 𝑜𝑓 𝑐𝑜𝑛𝑡𝑟𝑜𝑙 ) × 100

2.1.5.3 Reducing power

The reducing power of the extracts was determined as described by Oyaizu (Oyaizu,

1986). The reducing power was determined by using 0.2 mL aliquots of various

concentrations of extracts. 0.5 mL each of phosphate buffer (0.2 M, pH 6.6) and

potassium ferricyanide [K3Fe (CN)6] (1%) were mixed and incubated at 50 °C for 20

min followed by the addition of 0.5 mL trichloroacetic acid (10%) and the mixture was

centrifuged at 3000 rpm for 10 min. The supernatant (0.5 mL) was mixed with 0.5 mL of

distilled water and 0.1 mL of 0.1% (w/v) ferric chloride (FeCl3). After 10 min, change in

absorbance was recorded at 700 nm.

2.1.5.4 Total antioxidant activity

Phosphomolybdenum assay was used to evaluate the total antioxidant activity by already

established protocol (Prieto et al., 1999). An aliquot of 0.1 mL of crude extract was

combined with 1 mL of reagent solution (0.6 M sulphuric acid (H2SO4), 28 mM sodium

phosphate (Na3PO4) and 4 mM ammonium molybdate (NH4)6Mo7O24.4H2O). The

mixture was incubated in water bath at 95 °C for 90 min and cooled to room temperature.

Change in absorbance was measured at 765 nm against a blank (reagent solution). Total

antioxidant capacity was determined by following equation.

𝐴𝑛𝑡𝑖𝑜𝑥𝑖𝑑𝑎𝑛𝑡 𝑒𝑓𝑓𝑒𝑐𝑡 (%) = 𝐴𝑏𝑠𝑜𝑟𝑝𝑡𝑖𝑜𝑛 𝑜𝑓 𝑐𝑜𝑛𝑡𝑟𝑜𝑙 − 𝑎𝑏𝑠𝑜𝑟𝑝𝑡𝑖𝑜𝑛 𝑜𝑓 𝑠𝑎𝑚𝑝𝑙𝑒𝑠

𝑎𝑏𝑠𝑜𝑟𝑝𝑡𝑖𝑜𝑛 𝑜𝑓 𝑐𝑜𝑛𝑡𝑟𝑜𝑙 × 100

27

2.1.6 Brine Shrimp Lethality Assay

This assay was preformed following the procedure (Ul-Haq et al., 2012) with some

modifications. Artificial sea water was prepared (34g of commercial sea salt in 1L of

distilled water with continuous stirring). Brine shrimp (Artemia salina) eggs (Sera,

Heidelberg, Germany) were hatched in shallow rectangular dish (22x32 cm) filled with

prepared seawater. A plastic divider of 2 mm holes was clamped in the dish to make two

unequal compartments. The eggs (~25mg) were sprinkled in the larger compartment

covered with aluminum foil to ensure darkness, while the smaller compartment was

illuminated. After 24 hours of hatching, nauplii (brine shrimp larvae) were collected with

Pasteur pipette from the lightened side. The extracts of A. bracteosa solution were taken

in the vial and 2 ml of sea water was added to each vial. Fifteen shrimps were transferred

to each vial using Pasteur pipette and the volume was raised up to 5ml with sea water

considering the final required concentrations of crude extract in μg/ml. The experiment

was triplicated. The vials were kept under light at room temperature. Survivors were

counted with the help of 3X magnifying glass after 24 hours. Using Abbott’s formula

(Abbot, 1925), percentage death of napulii was calculated. Then LD50 were calculated by

Finney computer program (Finney, 1971).

2.1.7 Potato Disc Antitumor Assay

Antitumor activity of A. bracteosa was assayed according to the standard procedure

(Ahmad et al., 2008). Tumerogenesis was induced by Agrobacterium tumefaciens (strain

At-10) grown in Lauria Broth medium (LB). To evaluate A. bracteosa extracts, different

inoculums of 1 ml volume containing 100μl of plant extracts (different concentrations),

400μl of bacterial cultures and 500μl of distilled water was prepared in autoclaved

Eppendorf tubes. Negative control was prepared by adding 100μl of DMSO rather than

extract. Each petri plate was supplemented with 25ml of media solidified with agar

(1.5%) to support potato discs. Potatoes (Solanum tuberosum) were washed under tap

water and then surface sterilized with 0.1% mercuric chloride (HgCl2) for 5-7 minutes

followed by washing with autoclaved distilled water in laminar flow hood. Potato

cylinders were prepared with the help of a borer of 8mm diameter and were cut into 4-6

mm discs with sterilized surgical blade. Fifteen potato discs were placed on agar surface

in each plate and 50μl of inoculum was placed on the surface of each disc. The plates

were sealed with parafilm and placed in incubator (28°C) in dark. After 21 days, potato

28

discs were stained with Lugol’s solution (10% KI and 5% I2) and numbers of tumors was

counted under dissecting microscope. Tumor inhibition was calculated by using

following formula;

𝑃𝑒𝑟𝑐𝑒𝑛𝑡𝑎𝑔𝑒 𝑖𝑛ℎ𝑖𝑏𝑖𝑡𝑖𝑜𝑛 = (1 − 𝑡𝑢𝑚𝑜𝑟𝑠 𝑖𝑛 𝑠𝑎𝑚𝑝𝑙𝑒

𝑡𝑢𝑚𝑜𝑟𝑠 𝑖𝑛 𝑐𝑜𝑛𝑡𝑟𝑜𝑙 ) × 100

2.1.8 In vivo assays

2.1.8.1 Test animals, their grouping and dosage

For all in vivo assays, Sprague-Dawley rats (age, 6 weeks; 190-200 g) provided by the

National Institute of Health (Islamabad, Pakistan) of either sex were selected. The study

protocol for laboratory animal use and care was approved by an Ethics Committee of

Quaid-i-Azam University. They were locally bred in the Animal House, Faculty of

Biological Sciences, Quaid-i-Azam University, Islamabad at environmental conditions

(12 h light and dark cycles, 25±1 °C temperature and 50% relative humidity). The rats

were kept in stainless steel standard cages under hygienic conditions and fed with an

autoclaved feed and water ad libitum. Rats were acclimatized for 2 weeks in this

environment before the conduction of experiments. Throughout the in vivo studies,

distilled water was used as a vehicle for the administration of test samples and standard

drug. Before the conduction of each assay, rats were divided into six groups, weighed

and marked with numbers and each group received different treatment administered

orally (through feeding tube) 60 min prior to the conduction of assays. First group

received only distilled water (blank or negative control) while second group received

standard drugs (positive control) at 10 mg/10mL/ Kg rat body weight concentration.

Group 3, 4, 5 and 6 received AbMR, AbMA, AbCR and AbCA respectively at 200 mg/Kg

body weight of rats.

2.1.8.2 Anti-inflammatory assay

Anti-inflammatory activity of crude extracts of A. bracteosa was evaluated by

carrageenan induced rat paw edema test (Adeyemi et al., 2002; Winter et al., 1962). For

edema induction, 0.1 mL of freshly prepared 1% (w/v) λ-carrageenan in 0.9% NaCl

solution was injected into the sub plantar tissues of the left hind paw of each rat. The

29

paw volume of the rat was determined instantaneously after injection at 0 hour, and then

at every 1 hour interval for 4 hours by the volume displacement method using digital

Plethysmometer (Ugo Basile 7140) calibrated with electrolyte solution (0.05% NaCl and

0.3% surfactant). At each time interval, three readings were taken. Standard drug,

dichlofenac potassium was used as positive control. The increase in paw volume and %

edema inhibition was calculated by following equations.

𝐼𝑛𝑐𝑟𝑒𝑎𝑠𝑒 𝑖𝑛 𝑝𝑎𝑤 𝑣𝑜𝑙𝑢𝑚𝑒 = 𝑟𝑒𝑠𝑝𝑒𝑐𝑡𝑖𝑣𝑒 ℎ𝑜𝑢𝑟 𝑝𝑎𝑤 𝑣𝑜𝑙𝑢𝑚𝑒 − 0 ℎ𝑟 𝑝𝑎𝑤 𝑣𝑜𝑙𝑢𝑚𝑒

𝑃𝑒𝑟𝑐𝑒𝑛𝑡 𝑒𝑑𝑒𝑚𝑎 𝑖𝑛ℎ𝑖𝑏𝑖𝑡𝑖𝑜𝑛 =𝑁𝐶 − 𝐶𝐸

𝑁𝐶 × 100

Where; NC = Mean increase in paw volume of negative control and, CE = Mean increase

in paw volume of crude extract

2.1.8.3 Analgesic assay (Hot-plate method)

For the conduction of hot plate analgesia, a modified form of already optimized method

(Zulfiker et al., 2010) was followed. Standard drug, dichlofenac potassium was used as

positive control. The animals were placed on Eddy’s hot plate (IKA, Germany) kept at a

temperature of 55 °C. Reaction time was recorded when animals licked their fore or hind

paws or jumped (Toma et al., 2003). Moreover a number of lickings in proceeding 30 sec

after first lick were also recorded.

2.1.8.4 Antidepressant assay

Antidepressant activity of the extracts was tested by forced swim test or Porsolt

swimming test (Porsolt et al., 1977). Fluoxetine HCl was used as positive control. The

rats were acclimatized in a glass water tank (46 cm × 21 cm) filled with water (37 ºC) up

to a depth of 30 cm. The depth of water was sufficient to keep rats supporting themselves

by placing their tails at bottom (Detke and Lucki, 1995). Rats were placed individually in

water tanks for swimming practice for 6 min. Water was changed between each swim

session (Abel and Bilitzke, 1990). During the conduction of assay, after 2 min of

swimming the immobility time of rat was calculated by using stop watch. Immobility

was assigned when the rat showed absence of all movement activity other than that

30

required to balance their body and keep its head above the water (Castagné et al., 2009).

It can be calculated by the following amended formula (Can et al., 2012).

𝐼𝑚𝑚𝑜𝑏𝑖𝑙𝑖𝑡𝑦 𝑡𝑖𝑚𝑒 = 360 − 𝑚𝑜𝑏𝑖𝑙𝑖𝑡𝑦 𝑡𝑖𝑚𝑒

2.1.8.5 Anticoagulant assay

Crude extracts were screened for anticoagulant activity by capillary tube method as

reported by (Pal and Pal, 2005). One hour after the dosage treatment, tail of each rat was

cleaned with spirit and pricked with sterile needle. Stop watch was started, as soon as

first drop of blood appeared. Then capillary tube was placed over the blood drop and

filled with blood. After some time a small piece of capillary was broken and the same

was repeated, till fibrin thread appeared at the broken end of the capillary tube. Time

interval between tail pricking and the first appearance of fibrin thread at the broken ends

of capillary tube was recorded. This time was called the clotting time of blood.

2.1.9 Cancer chemoprevention assays

2.1.9.1 Measurement of the production of nitric oxide (NO) in LPS-stimulated

RAW 264.7 murine macrophage cells (Nitrite assay)

The level of NO in the cultured media was estimated by measuring the level of nitrite

owing to the unstable feature of NO and its subsequent conversion to nitrite. Nitrite assay

was performed as previously described (Hoshino et al., 2010). Briefly, RAW 264.7 cells

were incubated in 96-well culture plates at 37°C, 5% CO2 in a humidified air for 24 h.

Then cells were treated with serially diluted compounds for 15 min, followed by

treatment with or without LPS (1 μg/mL) for an additional 20 h. After the incubation,

nitrite released in the cultured media was measured using Griess reagent [1:1 mixture

(v/v) of 1% sulfanilamide in 5% H3PO4 and 0.1% N-(1-naphthyl) ethylenediamine

dihydrochloride solution], and absorbance was measured at 540 nm. The concentration

of nitrite was calculated using a standard curve was created with the known

concentrations of sodium nitrite. To evaluate the cytotoxic effect of compounds with

RAW 264.7 cells under the same experimental condition, the SRB assay was performed.

Na-L monomethyl arginine (L-NMMA) was used as positive control (IC50 = 19.7µM).

31

2.1.9.2 Nuclear factor kappa-B (NFκB assay)

NFκB inhibition assay was performed by using luciferase reporter gene (Kondratyuk et

al., 2012). Human embryonic kidney 293/NF-κB-Luc cell line, designed for monitoring

the activity of the NFκB, was purchased from Panomics (Freemont, CA, USA). This cell

line contains chromosomal integration of a luciferase reporter construct regulated by the

NFκB response element. Transcription factors can bind to the response element when

stimulated by certain agents, allowing transcription of the luciferase gene. Cells were

seeded into sterile white-walled 96-well plates at 20 × 103 cells per well in Dulbecco’s

modified media with 10% FBS. After growing for 48 hr to 90% confluency, the medium

was replaced with fresh medium containing TNF-α (Human, Recombinant, E. coli,

Calbiochem, Gibbstown, NJ) (final concentration 30 ng/mL) simultaneously with

different test samples at a final concentration of 50 µM in DMSO Sigma (St. Louis, MO,

USA) , followed by 6 hours incubation. Luciferase activity was determined with a

luciferase kit from Promega (Madison, WI, USA) according to the manufacturer’s

instructions. Briefly, after treatment, the cells were washed with phosphate-buffered

saline and 50 μL of 1x Reporter lysis buffer was added before plates were placed in a -

80°C freezer. The following day, the cells were thawed and assayed for luciferase

activity with a LUMIstar Galaxy Luminometer (BMG Lab technologies, Durham, NC,

USA). Results were expressed as a percentage, relative to control (TNFα-treated)

samples, and dose-response curves were constructed for the determination of IC50 values.

As a positive control, three NFκB inhibitors were used: N-tosyl-L-phenylalanyl

chloromethyl ketone (TPCK), IC50 = 3.8±0.6 µM, (E)-3-(4-Methylphenylsulfonyl)-2-

propenenenitrile (BAY-11), IC50 = 2.0±0.33 µM and resveratrol 2.5 ± 0.3 μM.

2.1.9.3 Aromatase assay

Inhibitory capacity of compounds toward aromatase enzymatic activity was examined by

measuring the fluorescent intensity of fluorescein, the hydrolysis product of

dibenzylfluorescein by aromatase as previously described by Lee and coworkers (Lee et

al., 2001). Briefly, 3.5 μL of the test samples were preincubated with 30 μL of NADPH

regenerating system (2.6 mM NADP+, 7.6 mM glucose 6-phosphate, 0.8 U/mL glucose-

6-phosphate dehydrogenase, 13.9 mM MgCl2, and 1 mg/mL albumin in 50 mM

potassium phosphate buffer, pH 7.4) in a 384-well plate for 10 min at 37°C. Then 33 μL

of enzyme and substrate mixture (1 μM CYP19 enzyme, BD Biosciences, 0.4 μM

32

dibenzylfluorescein, 4 mg/mL albumin in 50 mM potassium phosphate, pH 7.4) was

added, and further incubated for 30 min at 37°C. The reaction was terminated by adding

25 μL of 2N NaOH solution, and the plate was further incubated for 24 h at 37°C to

enhance the ratio of signal to background. Fluorescence was measured at 485 nm

(excitation) and 530 nm (emission). Naringenin, a positive control, showed IC50 value of

1.2±0.2 μM.

2.1.9.4 Quinone reductase 1 (QR1) assay

QR1 activity was assayed using Hepa 1c1c7 murine hepatoma cells (Song et al., 1999).

Briefly, cells were incubated in a 96-well plate with test compounds at a maximum

concentration of 50 µM for 48 h prior to permeabilization with digitonin. Enzyme

activity was then determined as a function of the NADPH-dependent menadiol-mediated

reduction of 3-(4,5-dimethylthiazo-2-yl)-2,5-diphenyltetrazolium bromide (MTT) to a

blue formazan. Production was measured by absorption at 595 nm. A total protein assay

using crystal violet staining was run in parallel. Data presented are the result of three

independent experiments run in duplicate. 4’-Bromoflavone (CD = 0.01 µM) was used as

a positive control.

2.1.10 Statistical analysis

Crude extracts were assessed in vitro at eight different concentrations were triplicated.

The same extracts were assessed in vivo at one concentration and triplicated with three

rats in each replicate except analgesic assay which was hexaplicated. Statistical analysis

consisted of descriptive statistics using SPSS Statistical Package (version 16.0) and

represented as means ± standard deviation at P < 0.05.

2.2 Results

2.2.1 Total flavonoid and phenolic content

Considerable differences were observed among the flavonoids and phenolic contents of

various extracts (Fig. 2.2). AbMA represented highest values of flavonoids (QE

1.98±0.06% DW) followed by AbMR (QE 1.51±0.14% DW) with a significant

difference. Results clearly demonstrate that high flavonoid contents are found in

methanolic extracts and aerial portions of A. bracteosa. Like flavonoids, the highest

33

phenolics content was also found in AbMA (GAE 5.94±1.98% DW), followed by AbCR

(GAE 4.76±0.11% DW).

Figure 2.2 Flavonoids and phenolic contents in different crude extracts of A. bracteosa

2.2.2 Antioxidant assays

Antioxidant activity measured by one method cannot show the true antioxidant potential

of any substance, because one method of quantification relay on only one mechanism

(Karadag et al., 2009). Commonly used antioxidant assays are; DPPH assay, H2O2

quenching assay, reducing power, total antioxidant activity etc. (Alam et al., 2013). In

the present study we conducted four antioxidant assays, in order to evaluate a broad

range of antioxidant activity of A. bracteosa extracts.

2.2.2.1 DPPH assay

Extracts which can donate hydrogen atom to DPPH radical are considered good

antioxidants. DPPH free radical scavenging was found highest for AbMA (Fig. 2.3 a).

AbMA, at 31.25 ppm, 62.5 ppm and 125 ppm represented 40.7±3.3, 70.74±3.6% and

75.52±4.8% free radical scavenging activity respectively, which is the highest among all

the tested extracts. AbMA represented promising DPPH free radical scavenging activity

and highest flavonoids and phenolic contents.

34

2.2.2.2 Hydrogen peroxide scavenging (H2O2) activity

There is a decrease in absorbance of H2O2 upon its oxidation. AbCA represented

significantly high H2O2 free radical scavenging activity at all the tested concentrations

(Fig. 2.3 b). It represented 51.29±2.2% and 92.08±4% scavenging of H2O2 radicals at

7.81 and 1000 µg/mL concentration respectively.

Figure 2.3 Percentage scavenging of DPPH (A) and H2O2 (B) of crude extracts of A.

bracteosa against ascorbic acid (AA).

(a)

(b)

35

2.2.2.3 Reducing power assay

Antioxidants alter oxidation state of iron by donating electron and reducing ferric ion to

ferrous ion (Fe+3 to Fe+2) (Moein et al., 2008). Highest reducing power was exhibited

by AbMA with 718.4±36 mg ascorbic acid equivalent/g (AAE) measured at 1000 µg/mL

concentration. It was followed by AbCR 529.1±35.9 mg AAE/g measured at 1000 µg/mL

concentration. AbCA and AbMA represented least reducing powers. This assay revealed

AbMA as having potent reducing power and antioxidant activity at 15.62 to 1000 µg/mL

concentration as compared to the other extracts (Fig. 2.4 a).

2.2.2.4 Phosphomolybdenum method

In phosphomolybdenum assay, Mo (VI) is reduced to Mo (V) by the analyte extracts and

subsequent formation of a green phosphate Mo (V) complex (Alam et al., 2013). Total

antioxidant activity determination gave highest value for AbMR i.e. 506.14±16.68 and

927±50.62 mg AAE/g at 7.81 and 1000 µg/mL concentration. It was followed by AbMA

and AbCR with an AAE of 866±47.94 and 838±46.40 mg/g respectively at 1000 µg/mL

concentration. This method represented AbMR as valuable antioxidant extract (Fig. 2.4

b).

2.2.2.5 Comparison of reducing powers as analyzed through various assays

When IC50 values of the extracts were compared to evaluate antioxidant capabilities, IC50

value of AbMA in DPPH radical scavenging (36.9 µg/mL) and reducing power assay

(1.5 µg/mL) were found promising. AbMR also represented significant IC50 value in

phosphomolybdenium radical reduction (19.1 µg/mL). Chloroform extract of aerial parts

only exhibited significant activity in hydrogen peroxide assay. The results of antioxidant

assays show the scavenging of free radicals or reduction of chemicals in concentration

dependent manner. These results clearly depicted that methanolic extracts of aerial part

of A. bracteosa possess better antioxidant potential than its chloroform extracts and that

of root portion (Table 2.1).

36

Figure 2.4 Reducing power (a) and total antioxidant activity (b) of crude extracts of A.

bracteosa against ascorbic acid. Data is expressed as mean± SD (P < 0.05

Table 2.1 Comparison of IC50 values

Plant extract DPPH H2O2 Phosphomolybdenum Reducing power

AbMR 73.4 44.6 19.1 0.9

AbMA 36.9 96.6 65.3 1.5

AbCR 70.6 434.7 59.9 1.1

AbCA 104.4 8.8 106.5 0.9

AA 0.4 12.7 3.3 2.1

AA= ascorbic acid

(a)

(b)

37

2.2.3 Brine shrimps lethality assay

A. bracteosa was evaluated in the study and its four crude extracts were subjected to

different bioassays in order to check their bioactivity. Brine shrimps lethality assay

revealed AbMR (ED50 76.86 µg/mL) as potently bioactive extract followed by AbMA

(91.91 µg/mL) (Table 2.2). This assay represents that methanolic extracts of A. bracteosa

are valuable bioactive entities.

Table 2.2 Mortality of brine shrimps exhibited by various extracts of A. bracteosa in

brine shrimp cytotoxicity assay

Sample

Mortality at different concentration of samples (µg/mL)

ED50 (µg/mL) 7.81 15.62 31.25 62.5 125 250 500 1000

AbMR 3 7 11 12 16 19 27 30 76.86

AbMA 3 6 9 11 15 18 26 30 91.9

AbCR 2 5 7 11 12 17 24 29 122

AbCA 2 4 6 7 11 15 29 30 118.9

Total number of shrimps in one treatment was 30.

2.2.4 Potato discs antitumor assay

Though all the extracts were found potent in antitumor agents in potato disc antitumor

assay, AbMA was the most valuable extract in tumor inhibition (IC50 3.490) (table 2.3).

It is obvious that methanolic extract of aerial parts is valuable in tumor suppression,

hence is a valuable antitumor extract.

Table 2.3 Effect of A. bracteosa extracts on tumors inhibition in potato disc antitumor

assay

Inhibition (%) at different concentration of samples (µg/mL) IC50 (µg/mL)

Sample 7.81 15.62 31.25 62.5 125 250 500 1000

AbMR 69.54 68.87 66.22 61.59 56.95 62.9 58.9 54 17.96

AbMA 72.85 71.5 68 65.6 62.9 55.6 51.65 47 3.49

AbCR 76 75.5 71.5 67.5 64.9 59.6 54 49.67 11.07

AbCA 80.79 78.8 76. 16 67.55 60.3 56.9 52 48 9.26

38

2.2.5 In vivo assays

2.2.5.1 Anti-inflammatory assay

Paw edema is an inflammation induced by carrageenan and a decrease in rat paw volume

is an indication of anti-inflammatory effects. Test samples represented maximum

carrageenan induced rat paw edema inhibition after 3rd

hour of treatment (Fig. 2.5 a).

Among all the extracts, AbMA performed much better in edema inhibition at all the three

hours after treatment at 200mg/Kg dose (67.9±2.6%, 70.3±0.9% and 74.3±4.3%). Edema

inhibition at 3rd

hour of treatment is comparable to AbCR (74.4±1.8%).

2.2.5.2 Analgesic assay

Paw licking in rats is an indication of pain caused by burning from hotplate. Hot plate

analgesia assay revealed that AbMA represented maximum analgesic value in delaying

the mean time of start of licking (57.7±4.9 sec) by suppressing the nociceptors activity in

paws (Fig. 2.5 b). AbMR also exhibited a delay in start of licking time (53.7±7.2 sec).

Good analgesic agents/extracts cause suppression of nociceptors and represent minimum

number of lickings. AbMR displayed least number of lickings in 30 sec i.e. 12±1.2 sec.

Depending on the results, both AbMA and AbMR thus were found as beneficial analgesic

candidates.

2.2.5.3 Antidepressant assay

Immobility time of a rat in force swim test is an indication of stress and anxiety. AbCR

represented itself as a good antidepressant (2±1 sec) candidate followed by AbMR

(7.3±2.08 sec), AbCA (11.66±2.51) and AbMA (15.66±1.52) (Fig. 2.5 c). The rats were

fairly active after oral dose of the extracts.

2.2.5.4 Anticoagulant assay (Clotting time determination)

AbMR represented significantly better inhibitory effects on coagulation activity (Fig. 2.5

d). It delayed coagulation from 32.66±3.51sec (negative control) to 89.3±4.04 sec

followed by AbMA (68.33±5.03 sec). Chloroform extracts remained least effective in

anticoagulation property.

39

Figure 2.5 In vivo assays of various crude extracts of A. bracteosa. (A) Anti-

inflammatory assay, (B) Analgesic assay, (C) Anti-depressant assay and (D)

Anti-coagulant assay. NC= negative control; DP= Diclofenac Potassium; F-

HCl= Fluoxetine HCl; NOL= number of lickings.

40

2.2.5.5 Comparison of in vivo assays

Anti-inflammatory agents are usually considered to possess analgesic activities too. In

the present study, methanolic extract of aerial portion (AbMA) was found to be a potent

extract possessing anti-inflammatory as well as analgesic activities. Moreover, the same

extract delayed the coagulation time of rat blood. Besides this, all the extracts exhibited

enormous anti-depressant activities. These assays showed the activity of extracts in

concentration dependent manner. Based on in vivo studies mentioned here, methanolic

extract of aerial portion of A. bracteosa hence proved to as an elixir. In this study;

hotplate analgesic assay for A. bracteosa is reported for the first time. It is found all the

tested extracts especially AbMR and AbMA exhibited highly significant analgesic effects

at 200 mg/kg per os concentration. Antidepressants are also known to possess intrinsic

antinociceptive activity.

2.2.6 Cancer chemopreventive assays

2.2.6.1 Nitrite assay

To evaluate the inhibitory activity of the extracts of A. bracteosa towards NO production

by LPS activated macrophage RAW 264.7 cells, nitrite assay was conducted. AbCA

exhibited an inhibitory activity against NO production with 28.1±3.1 at the 20 μg/mL

concentration (Table 4). Cytotoxicity assay was also performed to check the cytotoxic

effect of samples on cells. All the tested extracts showed a high cell survival rate ranging

from 128% to 135% at the tested concentration.

2.2.6.2 NFκB assay

A significant NFκB inhibitory activity was exhibited by AbCR (57.5%) followed with a

significant difference by AbMA (50%). The safety of the usage of A. bracteosa in folk

medicines can also be linked to the percentage of cell survival which ranges from 108%

(AbCA) to 125% (AbMR) at 20 µg/mL concentration (Table 4).

2.2.6.3 Aromatase assay

Aromatase inhibitors have been used to treat breast cancer and they are considered active

chemopreventive agents (Lubet et al., 1994). We found a strong aromatase inhibition

41

(76%) in AbCA while the rest of the extracts were not found potent in inhibiting

aromatase enzyme (Table 4).

2.2.6.4 Quinone reductase 1 (QR1) assay

Crude extracts of A. bracteosa were investigated for their ability to induce QR1 activity

in cultured Hepa 1c1c7 cells. An induction ratio (IR) of 3.0 was displayed by AbMR

while other extracts affected a mild induction of QR1 (1.2 and 1.4) (Table 4).

Table 2.4 Cancer chemopreventive and cytotoxic (SRB assay) potential of the crude

extracts of A. bracteosa.

Sample Aromatase NFkB Nitrite assay QR1

%inhibit % inhibit % survived %inhibit %Survival IR

ABMR 4.2±2.3 45.3±2.4 124.8±0.9 11.4±1.7 132.7±1.6 3.0±1.3

ABMA 22.8±1.9 50.0±2.5 122.5±1.3 7.9±2.1 135.2±2.4 1.2±2.1

ABCA 75.9±2.1 42.4±2.6 108.2±1.2 28.1±3.1 133.2±1.1 1.4±1.5

ABCR 11.2±1.8 57.5±3.5 117.3±1.4 5.8±2.1 127.6±1.2 1.2±1.3

Value represents mean ±S.D; extracts were tested at 20µg/mL

2.3 Conclusion

Extracts of A. bracteosa (especially methanolic extract of aerial parts) represented

promising in vitro and in vivo properties. Moreover, these extracts also presented

valuable cancer chemopreventive properties. This study confirms the traditional use of

aqueous extracts of aerial portion of this plant for a wide array of diseases. A. bracteosa

contains a wide array of chemical compounds which are considered responsible for most

of their activities.

42

CHAPTER 3

3 Seasonal and geographical impact on the morphology,

phytoecdysteroid content and antioxidant activities in different

tissue types of wild Ajuga bracteosa

Ajuga bracteosa Wall. ex Benth. (Lamiaceae) is a valuable aromatic, medicinal, soft,

villous and decumbent herb of 10-30 cm height (Hedge et al., 1990; Kirtikar and Basu,

1935). It is found on exposed slopes, grasslands and open fields in subtropical and

temperate regions of the world (Gupta and Tandon, 2004) at an altitude ranging from

1300 to 2400 m (Chandel and Bagai, 2011). Large morphological variations have been

reported in its ecotypes (Kirtikar and Basu, 1935). It is used as a medicine since ancient

times and has a variety of applications. In ethnomedicine, its use is reported as an

astringent, hypoglycemic, anthelmintic, antifungal, antibacterial, anti-inflammatory and

it also remediates gastrointestinal disorders (Israili and Lyoussi, 2009). A. bracteosa is

traditionally used to treat fever and phlegm in China (Shen et al., 1993). It is

recommended in Ayurveda and Greco Arab medicine to treat gout, palsy, amenorrhea

and rheumatism (Al-Musayeib et al., 2012; Kaithwas et al., 2012). Leaves of A.

bracteosa are stimulant, diuretic and locally used to treat malaria (Al-Musayeib et al.,

2012; Pavela, 2008), hence regarded as an alternate of cinchona (Pal and Pawar, 2011a).

A. bracteosa contains a variety of important categories of compounds including neo-

clerodane diterpenoids, iridoid glycosides, withanolides and phytoecdysteroids (Israili

and Lyoussi, 2009). Phytoecdysteroids are polyhydroxysteroids which are usually

present in plants in small amounts (Saatov et al., 1993), while animals contain even

lesser ecdysteroids than plants (Lafont and Connat, 1989a). In plants, they act as growth

regulators generally (Hendrix and Jones, 1972), and in some species actively defend

them against insect predation (Boo et al., 2010). Phytoecdysteroids are

pharmacologically active triterpenoids which induce an increase in muscle mass and 20-

hydroxyecdysone (20-HE) is one of the naturally occurring and most abundant

phytoecdysteroids (Cheng et al., 2013). PE increases protein synthesis in rats (Otaka et

al., 1969) and increased the mass of internal organs and skeletal muscle (Syrov et al.,

1996). Their ingestion promotes growth in sheep and Japanese quails (Koudela et al.

1995; Slama et al. 1996). They improve kidney functioning (Saatov et al., 1999) and

43

reduces lipid peroxidation (Kuzmenko et al., 2001). They are neuroprotective (Wang et

al., 2014b), antidiabetic (Chen et al., 2006; Najmutdinova and Saatov, 1999), antifungal,

antibacterial (Ahmad et al., 1996), anti-inflammatory (Kurmukov and Syrov, 1988).

Phytoecdysteroids increased the activities of glutamate decarboxylase (Chaudhary et al.,

1969; Lupien et al., 1969), acetylcholinesterase (Catalán et al., 1984) and alkaline

phosphatase (Kholodova, 1978). Precise function of PEs in plants is still unknown

(Sláma and Lafont, 1995) but they are considered to play a protective function against

un-adapted phytophagous insects (Lafont, 1997) and this idea is most accepted (Festucci-

Buselli et al., 2008a). A few reports reveal biosynthesis and accumulation of 20-HE in

plant kingdom. Its content depends on climatic conditions (Saatov et al., 1993) and

varies during plant development (Ramazanov, 2005). Annual plants accumulate

maximum ecdysteroids in their apical regions while perennials recycle them in their

deciduous organs and perennial tissues (Adler and Grebenok, 1995). 20-HE has been

detected in more than 100 plant families (Adler and Grebenok, 1995). Roots of wild

plants of A. reptans contain more PE content than leaves. Leaves of micropropagated A.

reptans had an extremely low PE content in leaves than roots while callus cultures do not

contain any of PEs (Tomás et al., 1993). Ecdysteroids content differs largely among

different organs of the same plant (Dinan, 1995a). However its spatial and temporal

tissue type - based estimation was conducted only in Pfaffia glomerata (Festucci-Buselli

et al., 2008b).

Though various tissue types have been assessed for 20-HE estimation in a few plant

species, yet not a single comprehensive report exists explaining the a broad range of PEs

distribution and/or accumulative effect of key factors i.e. season, habitat and climate. A.

bracteosa can be a potential source of PEs (Israili and Lyoussi, 2009) but it has not been

subjected to any of such estimation yet. In this study, PE content is evaluated in naturally

growing A. bracteosa at various altitudes and in different seasons to identify the right

tissue, geographical location and season for its maximum harvest. Moreover, various

morphological characteristics have been studied in selected chemotypes.

44

3.1 Materials and methods

3.1.1 Plant material collection

Ajuga bracteosa was collected from six different locations of Pakistan, viz. Islamabad

(Quaid-i-Azam University campus; HMP-460), Kahuta (Rawalpindi; HMP-461), Karot

(Eastern Rawalpindi; HMP-462), Sehnsa (District Kotli, AJK; HMP-463), Sarsawa

(District Kotli, AJK; HMP-464) and Neelum Valley (District Neelum, AJK; HMP-465)

and abbreviated as IS, KH, KR, SE, SA and NV respectively (Table 3.1, Fig. 3.1).

Geographical data was recorded by GPS (Giko 301, Garmin). The plants were identified

by Prof. Dr. Rizwana Aleem Qureshi (taxonomist) in Plant Sciences Department Quaid-

i-Azam University (QAU). A voucher specimen of each location (numbering HMP-460

to 465) was deposited in the "Herbarium of medicinal Plants of Pakistan" in QAU

Islamabad, Pakistan. The plant material was collected in three consecutive seasons i.e.

summer and winter of 2011, and spring of 2012.

Table 3.1 Folklore name of A. bracteosa from collected habitats with geographical

parameters

S.No. Habitat Local name Abbrv. Elev. (m) oN

oE

1 Campus, QAU (Islamabad) Booti IS 600 33.74949o 73.14905

o

2 Kahuta (Rawalpindi) Kora KH 723 33.59634o 73.53209

o

3 Karot (Eastern Rawalpindi) Kora KR 462 33.59904o 73.60848

o

4 Sehnsa (District Kotli, AJK) Kori booti SE 644 33.51127o 73.74409

o

5 Sarsawa (District Kotli, AJK) Kora booti SA 966 33.53311o 73.78472

o

6 Neelum Valley (AJK) Jan-e-Adam NV 1817 34.430743o 74.3,5156

o

Abbrv: Abbreviation, Elev: Elevation in meters

45

Figure 3.1 Map showing the collection sites

3.1.2 Morphological study

For morphological analysis, several parameters were studied including plant height, stem

branching, stem color, number of leaves, leaf color, flower color, number of flowers per

plant, flowering time, root branching, presence of hairs and nodules.

3.1.3 Plant processing

After collection (20 adult plants as mentioned in 3.1.1), the plants were rinsed with

distilled water to remove soil/mud from roots and dust from aerial parts. It was followed

by gentle separation of four parts (leaves, flowers, stem and roots) and subsequent air

drying under shade. Fully dried plant material was subjected to vacuum drying in

vacucell (Vacucell 55, MMM, Germany) under 0.1 bar pressure to ensure that it is

completely moisture free. These parts were separately homogenized to fine powder in

lab-scale grinder with short intervals under controlled temperature of milling. The

ground powder was sealed in air tight bags and stored at -20oC till further processing.

46

3.1.4 Extraction of phytoecdysteroids

All the plant material was screened for the presence of six ecdysteroids standards viz: 20-

ydroxyecdysone (20-HE), Ajugalactone (AJL), Sengosterone (SG), Cyasterone (CYP),

Polypodine (PoB) and Makisterone A (MKA) (Fig. 3.2). For the extraction of

phytoecdysteroids, already optimized protocol (Castro et al., 2008) was followed with

some modifications using HPLC grade solvents (Sigma Aldrich, GmbH Buchs

Switzerland). In brief, powdered plant material (~500 mg) was extracted with 10 ml of

methanol for two times (sonication of 20 min at 25oC at 50/60 Hz with occasional

shaking for 5 min, performed in triplicate). The suspension was centrifuged (Eppendorf

5417C, Germany) at 3000 rpm for 15 min and supernatant was recovered. Sonication

was performed in Elmasonic Sonicator (E30-H Germany). The residue was extracted again

with 85% methanol (in the same way). It was centrifuged (3000 rpm, 15 min),

supernatant was recovered and both the fractions (100% methanol and 85% methanol)

were combined and dried in fume hood. Resultant pellet was resuspended in 85%

methanol, sonicated for 20 min and subjected to the partial purification through column

cartridges (RP-C18) with 85% methanol. The column cartridges (Strata C18-E, 55 µm,

70 A, Phenomenex, USA) were previously activated/equilibrated with 20 mL of

methanol followed by 20 mL of 85% methanol. The filtrate obtained was dried, pellet

was resuspended in 5mL of 85% methanol and used HPLC injection.

3.1.5 RP-HPLC analysis

Analytical HPLC was performed with some modifications of already optimized protocol

(Wu et al., 2009) at room temperature and mobile phase was water (A) and acetonitrile

(B). HPLC system used was an integration of; pump Waters 600 controller quaternary,

injector Waters 717 plus autosampler and detector DAD Waters 2996. An AKADY

Chromatographica column C 18 RP with Ultrabase 100 ODS 2, with dimensions 150 ×

4.6 cm X 5 µm was used. Injection volume was maintained at 20 µL with a flow rate of

1mL/min. Gradient program started with 20% B and reaching to 35% in 10 min, 55% in

20 min, 100% at 21 min, maintained at 100% till 26 min and finally 20% from 27 to 37

minutes (column washing). UV spectra were acquired for all the ecdysteroids at 245 nm

except for ajugalactone, which was detected maximum at 237 nm. These specific

conditions resulted ecdysteroids elution between 5.54 to 12.93 min of retention time.

47

Figure 3.2 Structural formula of studied phytoecdysteroids (a) 20-hydroxyecdysone (b)

Polypodine B (c) Makisterone A (d) Cyasterone (e) Sengosterone (f)

Ajugalactone

3.1.6 Antioxidants, total flavonoids and phenolics assays

3.1.6.1 Samples, processing and extraction

For the conduction of antioxidant assays, total flavonoid content assay and total phenolic

content assay, Ajuga bracteosa of each location (voucher specimen number HMP-460 to

465) was collected during spring, summer and winter season and processed as described

in section 3.1.3. Extraction was performed by already optimized method with some

modifications (Ghosh and Laddha, 2006). Briefly, powdered plant material (leaves,

(a) (b)

(d) (c)

(e) (f)

48

roots, flowers and stems of all seasons and locations separately) was extracted with

methanol by a sonication of 5 min at 25 oC under 50/60 Hz. It is followed by occasional

shaking of 20 min. Following sonication, shaking and re-sonication (as described

earlier), the mixture was centrifuged for 5 min at 13000 rpm and supernatant was filtered

with 0.2µm pore size (25mm) filter paper, dried and re-dissolved in DMSO at 1.25mg/ml

concentration.

3.1.6.2 Determination of total flavonoid and phenolic content

The total flavonoid content was determined by aluminum chloride colorimetric method

(Chang et al., 2002) with some modifications as described in section 2.1.3. Absorbance

of reaction mixture was recorded with microplate reader (BioTek, ELx800) at 415 nm.

The calibration curve (0 µg/mL to 8 µg/mL) was plotted by using quercetin as a

standard. The total flavonoids were expressed as mg quercetin equivalent (RE/g) dry

weight. Total phenolic content was determined by using Folin-Ciocalteu reagent method

with few changes (Chang et al., 2002) as described in section 2.1.4. Absorbance of

reaction mixture was recorded with microplate reader at 725 nm. The standard

calibration (0 μg/mL to 25 μg/mL) curve was plotted by using Gallic acid. The total

phenolic content was expressed as mg Gallic acid equivalent (GAE/g) dry weight.

3.1.6.3 Antioxidant assays

Antioxidant assays including 2, 2- Diphenyl-1-picryl-hydrazyl radical (DPPH) assay

(DPPH assay), reducing power assay (TRP) and total antioxidant capacity (TCA) was

conducted as described in section 2.1.5. Antioxidant potential of extracts was determined

as % of scavenged DPPH radicles while TRP and TCA were measured as ascorbic acid

equivalent (AAE). Ascorbic acid was used as positive control.


Statistical analysis including descriptive statistics and ANOVA and LSD was performed

on MSTATC 2.0.

49

3.2 Results

3.2.1 Effect of different seasons and geographical locations on the morphology

The plant samples were collected from quite diverse areas with respect to altitude

(Table1) and climate. The areas of collection ranged from temperate to sub-tropical (Fig.

3.1). Summer is generally hot here and winter very cold. High fluctuation is found in

temperature of the study area. Snowfall occurs only in NV habitat. Multiple parameters

of morphology were studied (Table 3.2). A. bracteosa is short lived, glandular and hairy

with leaves nearly alternate and simple ex-stipulate, and flowers in verticillaster

inflorescence. Results reveal that this endangered herb possesses remarkable diversity as

shown by its different ecotypes. Vegetative growth was found directly proportional to the

plant length. IS ecotype represented maximum height during summer followed by SE.

Minimum plant height was recorded in NV ecotype in all seasons, and in KH during

winter. Maximum number of stem branches was recorded in KH ecotype while in SE, IS

and SA, branching is rather rare. KH ecotype exhibited supreme vegetative growth in

comparison with other ecotypes (Fig. 3.3).

Studied ecotypes also differed considerably in leaf color. Green or light green leaf color

was commonly found in majority of ecotypes. On the contrary, KH ecotype showed

purplish indigo color, especially on lower side of the lamina, whereas NV ecotype had

dark green leaves, specifically during winter. Normally, petals of the plants were found

white or white with blue lines, but NV ecotype has shown seasonal variation in petal

color i.e. blue petals in winter, light blue in spring and blue with white lines during

summer. Regardless of petal color, all the studied ecotypes contained white corolla tube.

Moreover, ecotypes of IS, SE and KH contained maximum number of flowers/plant

(~70). Roots of the studied ecotypes were without nodules except for SE ecotype which

displayed prominent nodules throughout the year (Fig. 3.4). Aerial portions, especially

leaf and stem of KH and KR ecotypes did not contain white hairs while the plant from

the rest of the habitats contained white hair in all seasons. Besides, least root branching

was recorded in KH ecotype. These branches were dense and thin during winter.

50

Table 3.2 Study of morphological parameters of the collected samples

Habitat Morphological

parameters

Seasons (time of collection)

Summer Winter Spring

SA

Plant height (cm) 23-30.5 10-18 13-20.3

Stem branching Seldom, ≤2 Seldom, ≤2 Seldom, ≤1

Stem color Dull green Pink-purple green Pinkish light green

NOL 12-22 8-13 12-20

Leaf color Grayish green Green Light green

Petal color White blue lined White, remnant White bluish

Flowering Bloomed Few new, remnant Few, blooming

NOF 12-30 6-8 2-10

Root branching Tap, small outlets

with hairs

Tap, small, less

branching, hairy

Tap, small hairy

branches

NON Nil Nil Nil

Hairs White, many, larger Grayish white, smaller White smaller

NV

Plant height (cm) 5-20 5-13 5-15

Stem branching Basal, 4-7 Basal, 5-8 Basal, 5-8

Stem color Light reddish,

purplish

Purpled indigo, green

tinged Light purplish green

NOL 13-22 5-8 10-14

Leaf color Dense green Moderately dense green Dense green

Flower color Blue, whitish blue Blue Blue

Flowering Bloomed, Blooming Bloomed and blooming Seldom bloomed,

remnants

NOF 5-15 1-2 but <5 5-10

Root branching Tap, less branched Tap, less branched Tap, less branched

NON Nil Nil Nil

Hairs Dense white hairs Hairy, white Hairy, white

KH

Plant height (cm) 13-23 2.5-8 8-18

Stem branching 8-12, basal Shed, no branches 2-4, mostly basal

Stem color Light indigo bluish Green bluish stained Indigo and blue

staining in green

NOL 22-38 9-15 14-25

Leaf color Green, purplish

veins

Variegated indigo,

pinkish Green Green

Flower color White, light bluish

shade in lines

Grey, survivors of

summer

Bluish white with blue

lines

Flowering Blooming n

bloomed

No flowering, old

surviving Blooming

51

NOF 40-60 1 or <2 <10

Root branching Small root with least

branching Many basal branches

Small outlets of

primary tap root

NON Nil Nil Nil

Hairs Not prominent No hairs Not prominent

KR

Plant height (cm) 13-20 8-13 13-15

Stem branching Basal, 3-5 Basal, 2-3 Basal, 4-5

Stem color Pink, purplish green Green purplish Purplish, indigo green

NOL 18-25 7-11 15-20

Leaf color Light green, green Green Green, bit dark

Flower color White petals with

bluish shade Blue with white shade White with blue shade

Flowering Bloomed Old grey survivors Blooming, embryonic

NOF 12-24 10-16 6-10

Root branching Dense grey, long,

less branches, thin

Yellowish, dense

branching

Pale yellow, small and

thin

NON Nil Nil Nil

Hairs Nil Nil White, small

SE

Plant height (cm) 25-35.5 20-25 5-20

Stem branching Seldom, 1-2 Seldom, 2-3 Seldom, 2

Stem color Purplish pink, little

green shade

Purplish pink, little

green shade

Indigo purplish, little

green shade

NOL 18-29 10-15 16-22

Leaf color Light green Dark green Green

Flower color White blue lined Blue white shaded Bluish white

Flowering Bloomed Few bloomed, mostly

surviving

Blooming, flowering

starts

NOF <70 6-8 14-20

Root branching Dense thin

branching Dense thin branching

Dense thin branching,

smaller root surface

area

NON Yes Yes Yes

Hairs White, small, many White, small, many White, small, many

IS

Plant height (cm) 25-38 15-20 25-35.5

Stem branching Seldom, <2, basal Seldom, <2, basal Seldom, <2, basal

Stem color Green Purplish green Purplish green

NOL 17-30 10-15 18-28

Leaf color Light green Moderately dark green Green

Flower color White, blue lines White bluish shade White blue lined

Flowering Bloomed Bloomed, summer Blooming

52

survivors

NOF 60-75 <30 <16

Root branching Dense thin long

branching

Dense thin hair like

branching

Moderately thin small

branching

NON Nil Nil Nil

Hairs White, dense Smaller, white, covering

full plant Less hairy

NOL: Number of leaves/plant, NOF: Number of flowers/plant, NON: Number of

nodules/ root

3.2.2 Effect of different seasons and geographical locations on phytoecdysteroids

(PEs) biosynthesis in different tissues

Phytoecdysteroid content was estimated keeping in view the effect of season, tissue type

and habitat of collection. All the possible combinations were analyzed to scrutinize the

significant parameters affecting phytoecdysteroid content.

Combined effect of all the studied parameters on phytoecdysteroid content represented

that 20-HE is the major phytoecdysteroid in all the studied habitats and followed the

descending order: 20-HE > CYP > MKA > AJL (Fig. 3.5 a). Individual effect of each

parameter on phytoecdysteroid content represented SA as the best habitat. Habitats

remained significant (table 3.3) (p value < 0.001) with each other in phytoecdysteroid

content and followed the descending order: SA (1967 µg/g) > KH (1457 µg/g) > KR

(1393 µg/g) > SE (1248 µg/g) > IS (1073 µg/g) > NV (500 µg/g). Seasons contributed

significantly (p value < 0.001) (Table 3.3) to the production of phytoecdysteroid content

with the descending order: winter (1795 µg/g) > spring (1386 µg/g) >summer (636 µg/g)

(Fig. 3.5 b). 20-HE content was more than other studied phytoecdysteroids and it was

highest during winter (980 µg/g) followed with a significant difference by spring (755

µg/g) (Fig. 3.5 b). Among the studied phytoecdysteroids, 20-HE was found to be in more

amounts in all the tissue types (Fig. 3.5 c). Tissue types also remained significant (Table

3.3) with reference to each other for phytoecdysteroid content (p value < 0.016) (Fig. 3.5

c) with the descending order: flower (1868 µg/g) > root (1221 µg/g) > stem (1056 µg/g)

> leaf (945 µg/g).

53

Figure 3.3 Pictorial presentation of the representative samples for morphological analysis

of A. bracteosa

54

Figure 3.4 Root of (a) SE ecotype, (b) SA ecotype and (c) IS ecotype

Figure 3.5 Effect of (a) habitats, (b) seasons and (c) tissue types on phytoecdysteroid

content (PE µg/g dry weight) in different samples of A. bracteosa.

(a)

(b)

(c)

55

3.2.3 Interaction of seasons, geographical locations and tissue types on PEs

biosynthesis

Based on the interaction of tissue type to the habitat in PE content, the overall trend

justified that PEs accumulation follows the ascending order; flower > stem > root > leaf.

High PEs yielding ecotypes were KH (3098 µg/g) and SA (2608 µg/g) which was found

in flower tissue type. It was followed by leaf of SA habitat which displayed 2139 µg/g

PE content. In general, maximum content of PE was detected in flower and root part of

the plants of all studied habitats and 20-HE remained highly detected phytoecdysteroid

(Fig. 3.6 a). Tissue type versus season interaction exhibited that PE accumulation

followed the general pattern; flower > root > stem> leaf, but only during spring its

amount is raised in flowers to maximum (2408 µg/g). The amount of PEs was lowest in

summer which gradually increases in spring and reaches to its maximum level in winter

suggesting that low temperature is favorable for its biosynthesis (Fig. 3.6 b). When

seasons were plotted against habitats for PE biosynthesis, same trend was found as

winter being the best season for PE biosynthesis followed by spring and summer.

Highest PE content was found in KR (3620 µg/g) significantly followed by SA (2922

µg/g) (p value < 0.001) habitat during winter season (Fig. 3.6 c, Table 3.3).

Table 3.3 ANOVA table showing effect of seasons, habitats, tissue types and their

interaction on the distribution of phytoecdysteroids

20-HE MKA CYP AJL

SOV DF FV Prob FV Prob FV Prob FV Prob

Seasons (S) 2.0 58925.3 *** 17990.3 *** 35122.5 *** 1698.3 ***

Habitats (H) 5.0 34516.5 *** 891.2 *** 24615.6 *** 177.6 ***

S X H 10.0 33821.2 *** 3538.8 *** 6090.9 *** 187.2 ***

Tissue types (T) 3.0 32813.3 *** 8736.6 *** 5289.1 *** 630.1 ***

S X T types 6.0 7667.1 *** 726.9 *** 832.8 *** 18.2 ***

H X T types 15.0 9294.4 *** 940.7 *** 2015.8 *** 97.2 ***

S X H X T 30.0 6364.2 *** 548.9 *** 770.0 *** 29.0 ***

Error 144.0

Total 215.0

CV

2.03%

3.92%

1.38%

7.96%

SOV: source of variations, DF: degree of freedom, FV: F value, CV: Coefficient of

variation *** means the values are significant at p value < 0.001.

56

Figure 3.6 Effect of (a) habitats versus tissue types (b) seasons versus tissue types and (c)

habitats versus seasons on phytoecdysteroid content (PE µg/g dry weight).

3.2.4 Effect of different seasons and geographical locations on antioxidant

activities of different tissues

When antioxidant activities were plotted to check the effect of the habitat of plant, IS

samples displayed 3.45 ascorbic acid equivalent (AAE) in reducing power assay (TRP),

non-significantly followed by KR plants (3.34 AAE) (Fig. 3.7 a, Table 3.4). Contrary to

(a)

(b)

(c)

57

it, in total antioxidant assy (TCA), plants collected from NV displayed significantly high

AAE value (2.71) followed by KR plants (2.34) at P < 0.001. Scavenging of DPPH free

radicles was found highest in the plants of SA (81.0 %) and IS (80.0 %). Habitat effect

was though significant, but different methods of antioxidant activity determinatin did not

specify the plants of a particular location as best antioxidant candidate. Plants collected

in winter season displayed significantly high DPPH and TRP values i.e. 82.3 %

inhibition of DPPH free radicles and 3.35 AAE respectively. On the other hand, TCA

was found best in the plants of summer (2.6 AAE) (Fig. 3.7 b). Leaf tissue type

displayed a significantly high activity in studied antioxidant assays: 81 % inhibitin of

DPPH free radicles, 3.49 AAE in TRP and 3.1 AAE in TCA (Fig. 3.7 c). It showed this

descending pattern: leaf > flower > stem> root.

Table 3.4 ANOVA table showing effect of seasons, habitats and tissue types on

antioxidant activities and total flavonoid and phenolic content

DPPH TCA TRP TFC TPC

SOV DF FV Prob FV Prob FV Prob FV Prob FV Prob

Replication 2 1.7 ns 1.9 ns 2.3 ns 0.4 ns 5.7 ***

Seasons (S) 2 1008.1 *** 61.8 *** 18.8 *** 46.4 *** 72.3 ***

Habitats (H) 5 161.3 *** 17.4 *** 16.9 *** 13.6 *** 20 ***

S X H 10 130.9 *** 17.3 *** 25.1 *** 11.9 *** 14.7 ***

Tissue types (T) 3 453.9 *** 208.6 *** 41.8 *** 238.9 *** 63.2 ***

S X T 6 69.5 *** 7.7 *** 9.3 *** 41.4 *** 10.1 ***

H X T 15 161 *** 15 *** 15.6 *** 9.9 *** 37.7 ***

S X H X T 30 106.7 *** 8.3 *** 13.8 *** 10.8 *** 14 ***

Error 142

Total 215

CV

0.0096 0.1398 0.0823 0.1382 0.0294

DPPH: Diphenyl-picryl-hydrazyl, TCA: total antioxidant capacity, TRP: reducing power,

TFC: total flavonoid content, TPC: total phenolic content, SOV: source of variations,

DF: degree of freedom, FV: F value, ns: non-significant, CV: Coefficient of variation,

*** means the values are significant at p value < 0.001.

58

Figure 3.7 Effect of (a) habitats, (b) seasons and (c) tissue types on total antioxidant

activity (TCA), reducing power (TRP) and % inhibition of DPPH free radicle

of different samples of A. bracteosa.

3.2.5 Effect of different seasons and geographical locations on total flavonoid and

phenolic content in different tissues

Total phenolic content showed little variation among the plants of studied habitats and

highest total phenolic content was displayed by the plants of NV (4.77 GAE) and SA

(4.72 GAE) habitat (Fig. 3.8 a). Likewise, total flavonoid content determined as

(a)

(b)

(c)

59

quercetin equivalent (QE) also showed small difference in the plants collected from

different habitats, but NV plants were found containing highest value (1.96 QE).

Figure 3.8 Effect of (a) habitats, (b) seasons and (c) tissue types on total phenolic and

flavonoid content in different samples of A. bracteosa.

Presence of total flavonoid and phenolic content was significantly affected by different

seasons (Fig. 3.8 b). Total phenolic content followed this descending order of their

biosynthesis: winter (4.74 GAE) > summer (4.66 GAE) > spring (4.48 GAE).

Interestingly, total flavonoid content displayed a reverse pattern and followed this

descending order of their biosynthesis: summer (1.92 QE) spring > (1.77 QE) winter >

(1.54 QE). Effect of tissue types displayed close values of total phenolic content and leaf

remained dominant tissue type with highest total phenolic contents (4.99 GAE) (Fig. 3.8

(a)

(b)

(c)

60

c). Occurrence of total flavonoid content also displayed a similar fashion and followed

this descending order: leaf (2.4 QE) > flower (1.72 QE) > root (1.42 QE) > stem (1.37

QE). The values in figure 3.8 are presented as mean ± SD of at least three independent

experiments and bars showing different letters are significant at P < 0.01.

3.3 Conclusion

A. bracteosa is a morphologically diverse, endangered and highly medicinal species with

several ecotypes. Large morphological variations were observed in different ecotypes of

A. bracteosa. The habitats with an altitude of nearly 600 m represented almost similar

vegetative growth pattern regardless of their geographical location. The plant offers a

valuable source of phytoecdysteroids especially 20-HE in its aerial portion during winter.

We speculate that biosynthesis of phytoecdysteroids in this plant is not only a direct

consequence of plants phenology, but induced in response to low temperature stress.

61

CHAPTER 4

4 Comprehensive screening of influential factors in the

Agrobacterium tumefaciens-mediated transformation of Ajuga

bracteosa Wall. ex. Benth.

Ajuga bracteosa Wall. ex Benth. (Lamiaceae) is a hairy herb found in temperate regions

at 2000 m of altitude (Kaul et al., 2013). It is widely used in folk medicine to treat a

variety of diseases, such as gout and malaria, and the aqueous extract of its leaves is

diuretic (Pal and Pawar, 2011b). It is well known for having significant anti-arthritic

(Kaithwas et al., 2012), anti-tumor, antioxidant (Mothana et al., 2012), cancer

chemopreventive (Ghufran et al., 2009; Kaithwas et al., 2012) and hepatoprotective

properties (Hsieh et al., 2011). A. bracteosa is a source of a large number of natural

products with potent activities, notably withanoloides, neo-clerodane diterpenoids,

phytoecdysteroids, iridoid glycosides and sterols. Withanolides are present in the

Solanaceae and five other plant families (Misico et al., 2011). Ecdysteroids, mainly

known as insect molting hormones, are present in only 5-6% of the analyzed plant

families, 20-hydroxyecdysone being the most common.

Ecdysteroid activities include antioxidant (Kuz'menko et al., 1998a; Kuz'menko et al.,

1997; Kuz'menko et al., 1998b), hepatoprotective (Syrov and Khushbaktova, 2000;

Syrov et al., 1991a; Tashmukhamedova et al., 1985) and hypoglycemic (Kutepova et al.,

2001; Syrov et al., 1991b). Their accumulation in plants is induced by mechanical

(Schmelz et al., 1998), insect (Schmelz et al., 1999), and low environmental temperature

(Kayani et al., 2014) stresses. Withanolides are reported to inhibit several enzymes, e.g.

lipoxygenase, cholinesterase (Israili and Lyoussi, 2009; Kaithwas et al., 2012; Riaz et al.,

2007), and cyclooxygenase (COX) (Jayaprakasam and Nair, 2003). Cyasterone and 8-

acetylharpagide have shown potent antitumor activity (Takasaki et al., 1999).

Additionally, ajugarin I, lupulin A, withaferin A, and reptoside 6-deoxyharpagide are

potent anti-inflammatory compounds (Gautam et al., 2011).

The production of these therapeutically valuable secondary metabolites is extremely low

in wild A. bracteosa plants and their chemical synthesis is impractical and costly (Yang

and Stöckigt, 2010). Recent advances in metabolic engineering offer a promising

62

approach to improve the biosynthesis of these natural products, which has been enhanced

in several plant species by the overexpression of controlling genes (Arshad et al., 2014;

Bonhomme et al., 2000; Bulgakov et al., 2004; Bulgakov, 2008; Shkryl et al., 2011).

However, transformed Ajuga plants or cell suspension cultures by means of the

Agrobacterium tumefaciens system have not been reported until now. A few groups have

induced the hairy root syndrome in Ajuga species by A. rhizogenes infection to promote

the synthesis of secondary metabolites. Production of 20-HE increased in A. multiflora

transgenic hairy roots obtained by infection with an A. rhizogenes A4 strain (Kim et al.,

2005a). A. reptans var. atropurpurea produced hairy roots when infected with A.

rhizogenes MAFF 03-01724 and showed higher 20-hydroxyecdysone (20-HE) levels

(0.14%) compared to the control roots (0.03%) (Matsumoto and Tanaka, 1991).

Regenerants derived from these hairy roots sustained the enhanced production of 20-HE

in the mother hairy root line, but the clones were dwarf and lacked floral differentiation

(Tanaka and Matsumoto, 1993b). Hairy roots of A. raptans (Uozumi et al., 1993) were

co-transformed with A. rhizogenes plasmid pTR100 containing the GUS gene under the

control of the promoter of a gene encoding the small subunit of ribulose-1,5-

bisphosphate carboxylase (rbcS3B) (Uozumi et al., 1996). Regenerants obtained from

these co-transformed hairy roots retained GUS activity (Uozumi et al., 1996) but they

were abnormal, and possessed shortened internodes, wrinkled leaves and abundant root

mass (Choi et al., 2004). Although ecdysteroids are synthesized in roots, and transgenic

roots are of interest, the metabolites are then transported to the aerial parts (Bakrim et al.,

2008). Leaves in particular can contain significantly higher ecdysteroid levels than roots

or other tissues (Kayani et al., 2014).

According to the published data, A. tumefaciens-mediated transformation of any Ajuga

species has not been previously reported. Consequently, for the biotechnological

production of the aforementioned valuable natural products, the establishment of an

effective and stable transformation system for A. bracteosa is a crucial prerequisite. To

address these issues, an extensive series of experiments were conducted to optimize all

the influential factors affecting A. tumefaciens-mediated genetic transformation of A.

bracteosa.

63


4.1.1 Plant material and its sterilization

A. bracteosa plants (~45 days old) were collected from Quad-i-Azam University campus

in Islamabad, Pakistan. Surface sterilization of its aerial parts was done by immersion in

sodium hypochlorite (30% v/v) for 20 minutes with continuous sonication. The aerial

parts were then immersed in ethanol (70% v/v) for 1 minute, followed by treatment with

0.1% (w/v) mercuric chloride (HgCl2) solution for 30 seconds, and rinsed several times

in sterilized distilled water.

4.1.2 Explant preparation for in vitro culturing

Reported tissue culture conditions were followed (Kaul et al., 2013) with some

modifications. Leaf discs, nodal regions and petiole segments were dissected after

sterilization and cultured on shoot induction medium (SIM) (Table 4.1). Resultant

multiple shoots were excised and maintained in stable growth medium (SGM). When the

explants attained a length of 7-8 cm, they were shifted to a root induction medium (RIM)

followed by acclimatization to ex vitro conditions. Healthy in vitro grown plants were

selected for explant preparation for bacterial infection. The conditions of the growth

room were: temperature 25±1 °C, 16 hours of light intensity at 110 µmol m2/s and an 8-

hour dark period. The media pH was maintained at 5.8 throughout the study.

4.1.3 Kanamycin sensitivity

The NPTII gene, which confers resistance to kanamycin, was cloned in the vector

p35SGUSint and used as the selection marker. To find the effective dose to eliminate the

untransformed explants, the SIM was supplemented with kanamycin (25, 50, 75 and 100

mg/L), maintaining the explants in a growth room for four weeks. The medium was

refreshed once during the experiment and the number of surviving explants recorded

after four weeks (Table 4.2). The experiment was conducted in three replicates with 30

explants in each replicate.

64

Table 4.1 Composition of media used in tissue culture and transformation

Tissu

e cu

lture

med

ia

Medium Abbr. Composition

Shoot induction medium SIM MS+ 0.8% agar +0.45-3.6 mg/L BA

Root induction medium RIM Half strength MS +0.8% agar

Stable growth medium SGM MS +0.8% agar

Callus induction medium

CIM

MS+ 0.8% agar + BA 0.225 mg/L and 1.48 mg/L

NAA

Tra

nsfo

rmatio

n rela

ted m

edia

Pre-culture medium PC MS + 0.8% agar

inoculation medium IM MS liquid + agrobacteria + acetosyringone

Co-cultivation CCM MS+ 0.8% agar + acetosyringone

Selection medium

SM1

MS+ 0.8% agar + kanamycin 100 mg/L+

Cefotaxime 500 mg/L

Selection medium

SM2


Cefotaxime 300 mg/L

Selection medium

SM3


Cefotaxime 150 mg/L

Selection medium SM4 MS+ 0.8% agar + kanamycin 25 mg/L

4.1.4 A. tumefaciens strain and vector used for transformation

Transformation was performed with the disarmed A. tumefaciens strain C58C1 carrying

the plasmid p35SGUSINT. The T-DNA of this plasmid harbored the GUS reporter gene

under the control of the CaMV35S promoter and a kanamycin resistance gene (NPTII)

(Fig. 4.1).

Figure 4.1 Schematic representation of T-DNA region of p35SGUSint: LB: left border;

NOS P: nopaline synthase promoter; NOS T: nopaline synthase terminator;

NPTII: neomycin phosphotransferase gene; 35S P: CaMV35S promoter;

GUS: β- glucuronidase gene; int: intron; RB: right border

4.1.5 Method of transformation

Nodal regions (5-10 mm), petioles (7-10 mm) and leaf discs (1-1.5 cm) were taken from

30-day in vitro grown healthy plants and used as explants. They were shifted to a pre-

65

culture medium (PC) and placed in the growth room in the same conditions as described

before. Meanwhile, A. tumefaciens strain C58C1 was maintained on LB (Sigma) agar

medium. For co-cultivation, a single cell colony of this bacterium was grown overnight

(120 rpm, 27±1 °C) in 50 mL LB broth supplemented with 50 mg/L kanamycin. In order

to establish the effect of Agrobacterium cell density, a 16-hour-old culture was pelleted

down at 5000 rpm and resuspended to an OD600 of 0.25, 0.5, 0.75, and 1.0. Each type of

pre-cultured explant was separately immersed in each of the bacterial suspensions

prepared in the inoculation medium (IM) for three different inoculation times (IT) of 10,

20 and 30 minutes. Explants on IM with a specific OD of bacteria received three

different levels of acetosyringone concentration (100 µM, 200 µM, and 400 µM) for

three different IT periods. These explants were then blotted on sterile filter papers to

remove excessive bacteria and finally co-cultivated for 24, 48 and 72 hours in darkness

at 25±1 °C. Following co-cultivation, explants were washed with half-strength MS liquid

supplemented with 250 mg/L cefotaxime and 100 mg/L kanamycin, blotted on sterile

blotting paper, and two thirds of them were transferred to the same medium (solidified)

in an illuminated growth room until the agrobacteria were eliminated. The remaining

third of explants were assayed for GUS expression. Nodal and petiole explants that

survived selection developed shoot primordia, while leaf disc explants produced calli.

They were passed to the selection medium SM2 (Table 4.1) after two weeks. Kanamycin

selection was gradually withdrawn by shifting explants to SM3 and SM4 after 28 and 42

days of infection, respectively. When shoots attained a length of 6-8 cm, they were again

assayed for GUS expression. PCR analysis confirmed that transgenic shoots were

cultured on RIM, until plants with a well-developed root system were established. The

plants with established roots were transferred to a greenhouse after acclimatization.

Optimized parameters were: AS = acetosyringone concentration (AS1=100µM,

AS2=200µM, AS3=400µM), IT = inoculation time (IT1= 10 min, IT2= 20 min, IT3=

30min), OD = optical density of bacteria (OD1=0.25, OD2=0.50, OD3=0.75, OD4=1.0)

and CCT = co-cultivation time (CCT1= 1 day, CCT2= 2 days, CCT3= 3 days).

4.1.6 Histochemical GUS assay

The tested explants were incubated in an X-Gluc solution consisting of 1 mg L-1

X-Gluc,

0.5% triton X-100, 20% methanol and 50 mM NaH2PO4 at a pH of 7. The tissues were

incubated in darkness at 37 °C overnight in this solution and 200 mbar vacuum was

66

applied for 10 minutes to facilitate infiltration. After 12-16 hours, the GUS solution was

replaced with 70% ethanol followed by 96% ethanol to completely remove the

chlorophyll for an improved visualization of the blue GUS expression.

4.1.7 Isolation of genomic DNA

Genomic DNA (gDNA) was isolated from the leaves of transformed plants and

untransformed plant (control). Cetyl trimethyl ammonium bromide (CTAB) method

(Doyle and Doyle, 1990) was employed for the extraction of gDNA. Fresh leaf samples

were ground individually with sterilized pestle and mortar in 600 µl of pre-warmed (65

°C) CTAB buffer {100 mM Tris-HCl (pH 8.0) containing 2% CTAB, 20 mM

Ethylenediaminetetraacetate (EDTA), 1.4 M Sodium chloride (NaCl) and 1%

Polyvinylpyrrolidone (PVP)}. The solution without any visible suspension was

transferred to autoclaved Eppendorf tubes. Then it was incubated at 65 °C for 40 minutes

and centrifuged for 10 minutes at 13000 rpm. Then the clear top solution (supernatant)

was pipetted off into clean, autoclaved and labeled Eppendorf tube. An equal volume of

chloroform was added and mixed by vortexing, followed by centrifugation for 10

minutes at 13000 rpm. Then again the supernatant was pipetted off into clean, autoclaved

and labeled Eppendorf tube. By adding two volumes of absolute ethanol and 0.1 volumes

of 4 M Ammonium acetate, the nucleic acid was precipitated by incubating at -20 °C

overnight. Precipitates were collected by centrifugation at 13000 rpm for 20 minutes,

washed by adding 500 μl of 70% ethanol, vortexed briefly and re-centrifuged at 13000

rpm for 10 minutes. The pellet was partially dried under vacuum and resuspended in 50

μl of TE buffer containing RNAs (10 mM Tris-HCl, 1 mM EDTA, pH. 8.0). Purified

DNA samples were stored at -20°C for further use. DNA quantity and quality was tested

through NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies Wilmington,

DE, USA).

4.1.8 PCR analysis

Kanamycin-resistant putative transformants were subjected to molecular analysis by

PCR. For positive control, colony PCR of C58C1 was performed. PCR was performed

using a thermocycler (T1 96, Biometra GmbH) according to the established standard

protocol (Taylor, 1991). For NPTII, the forward primer was

5´AAGATGGATTGCACGCAGGTC3´ and the reverse primer was

67

5´GAAGAACTCGTCAAGAAGGCG3´. For GUS, the forward primer was

5´AACGGCAAGAAAAAGCAGTC3´ and the reverse primer was

5´GAGCGTCGCAGAACATTACA3´. The reaction conditions were: 5 min of 94 °C,

followed by 35 cycles of 35 sec at 94 °C; 35 sec at 56 °C for GUS, with 54 °C for NPT-II

and 45 sec at 72 °C and a final extension of 10 min at 72 °C. The amplified products

were resolved on 1.5 % agarose gel.


Regeneration of transgenic explants was performed in triplicate with twenty explants per

replicate. Treatments for the induction of transformation were triplicated and there were

ten explants in each replicate. Data was analyzed statistically by analysis of variance

(ANOVA) and least significant difference (LSD) tests using MSTATC version 2.0.

4.2 Results

Genetic transformation conditions for A. bracteosa were standardized by using A.

tumefaciens strain C58C1 harboring p35SGUSINT with the GUS reporter gene. Various

factors, including kanamycin sensitivity of explants, explant type, bacterial cell density,

inoculation time, concentration of virulence-inducer acetosyringone, co-cultivation

period and regeneration frequency of transformants were evaluated and optimized.

4.2.1 Optimization of tissue culture conditions

A quick and reproducible method for A. bracteosa tissue culture was established.

Multiple shooting and rooting was achieved on shoot and root induction media,

respectively (Table1). Explants especially nodal regions induced multiple shoots on SIM

(Fig. 4.2 B). These shoots were maintained in hormone free stable growth medium

(SGM) (Table 4.1) with a delayed growth rate. Supplementation of cytokinin induces

vigorous shoots and multiple shoots were obtained at 0.45 mg/L BA, reaching a

maximum at 3.6 mg/L BA. On the procurement of handsome amount of multiple shoots,

successful rooting was achieved on RIM medium (Fig. 4.2 C). Newly cut juvenile leaf

discs and stem sections produced embryogenic calli on callus induction media. Plants

with well-developed root system were acclimatized to ex vitro conditions (Fig. 4.2 D).

68

Figure 4.2 Optimization of tissue culture conditions of Ajuga bracteosa, (A) source wild

plant, (B) multiple shooting, (C) rooting, (D) acclimatization in pots to

unsterile environment

4.2.2 Kanamycin sensitivity

The selection of the transformed cells was based on the sensitivity of explants to

kanamycin. The used bacterial strain harbored the NPTII gene, which confers resistance

to kanamycin, as a selection marker. To establish the most suitable kanamycin

concentration for the selection of the inoculated plant material, different concentrations

were assayed in non-transformed cultures. Explant survival was significantly reduced by

the addition of kanamycin in the SGM (P < 0.05), being inversely proportional to the

kanamycin concentration (Fig. 4.3). The maximum endurance of the explants was found

at 75 mg/L, the leaf explants being more resistant to the detrimental effects of the

antibiotic than petioles and nodal regions. However, at 100 mg/L kanamycin, explant

69

survival rate was zero (Table 4.2). On the basis of these results, 100 mg/L kanamycin

was the concentration used for subsequent transformation experiments.

Figure 4.3 Effect of kanamycin on explant survival, (A) 25 mg/L, (B) 50 mg/L, (C) 75

mg/L and (D) 100 mg/L

4.2.3 Effect of bacterial culture optical density on transformation

Transformation induction was significantly affected by different levels of agrobacterial

OD (P < 0.001) (Table 4.3) (Fig. 4.4 a). All three explant types presented significant

transformation induction at the four levels tested, although it was highest at OD4 (OD

1.0). Almost all leaf disc explants presented cell transformation at OD4, regardless of the

other studied parameters. Similar results were found in the petiole explants when OD4

was coupled with 20 minutes of inoculation time (IT2) (Table 4.4).

70

Table 4.2 Explant sensitivity against selective antibiotic kanamycin

Each treatment was replicated three times, and each replicate consisted of 20 explants.

4.2.4 Effect of acetosyringone concentration on transformation

Acetosyringone concentrations of 100 µM (AS1), 200 µM (AS2) and 400 µM (AS3)

enhanced transformation induction (P < 0.001) (Table 4.3). The most effective treatment

was AS3 in leaf disc explants, 7.5±1.42 of which were transformed (Fig. 4.4 b). In nodal

regions and leaf discs, the effects of AS1 and AS2 differed significantly (Table 4.4). Leaf

discs responded better to AS3 than other explant types. These results show that

acetosyringone addition enhanced transformation induction by increasing the recognition

and infection process.

4.2.5 Effect of inoculation time on transformation

Inoculation time significantly affected transformation induction (Table 4.3). Longer

times resulted in higher transformation levels in all explant types except the petiole, in

which the effect of IT2 and IT3 was practically the same (Fig. 4.4 c) (Table 4.4).

Maximum induction of transformation was found in leaf discs at IT3, i.e. 7.49±1.11

explants. IT2, when coupled with an OD of 1.0, resulted in the maximum percentage of

transformation. All the explants subjected to IT3 (30 minutes) presented high

Agrobacterium contamination and few of them showed any cell transformation (Table

4.3). Almost all the explants presented transgenic cells and areas when co-cultivation

Kanamycin. (mg/L) Explants’ type % Survival

25

Leaf discs 80.0

Nodal region 76.66

Petiole 73.33

50

Leaf discs 56.66

Nodal region 53.33

Petiole 53.33

75

Leaf discs 13.33

Nodal region 6.66

Petiole 3.33

100

Leaf discs 0

Nodal region 0

Petiole 0

71

time CCT2 was coupled with an OD of 1.0. The transformation effects of CCT2 and

CCT3 differed significantly among the different explant types, but within each type, the

results was similar (Fig. 4.4 d).

Figure 4.4 Effect of (a) OD, (b) AS, (c) IT and (d) CCT on transformation in leaf, nodal

region and petiole explants in transient GUS expression.

4.2.6 Cumulative effect of studied factors and explant types on transformation

Transgenic plantlets generated from nodal regions produced multiple shoots/explant on

SIM (Fig. 5 a-b), while on the same medium plantlets generated from petiole explants

produced 1-2 shoots/explant (Fig. 4.5 c). In contrast, leaf explants produced calli (Fig. 5

d). The overall effect of all the studied factors (OD, IT, CCT and AS) on transformation

was found to be significant (P < 0.001) in all three explant types. It is worth noting that

although there were statistical differences between second and third levels of AS, IT and

CCT in their effects on transformation, the values were very close. The most important

individual determinant of transformation induction was the OD of 1.0, which had a

maximum effect when coupled with the second level of the other parameters (AS2, IT2

and CCT2) (Table 4.4).

72

Table 4.3 ANOVA table showing significance of different influential factors affecting transformation, tissue types and their interactions

Leaf Nodal Region Petiole

Source of variations DF MS F Value Prob MS F Value Prob MS F Value Prob

Optical Density (OD) 3 759.6 771.5 *** 739.8 533.8 *** 569.8 379.9 ***

AS-Acetosyringone (AS) 2 48.7 49.5 *** 97.9 70.6 *** 73.7 49.1 ***

(OD)*(AS) 6 12.8 13.0 *** 6.1 4.4 *** 15.4 10.3 ***

Inoculation time (IT) 2 67.3 68.3 *** 79 57 *** 111.2 74.2 ***

(OD)*(IT) 6 19.6 19.9 *** 3.8 2.8 * 3.7 2.5 *

(AS)*(IT) 4 4.3 4.4 ** 0.9 0.7 ns 5.1 3.4 **

(OD)*(AS)*(IT) 12 3.7 3.7 *** 2.4 1.8 ns 2.6 1.7 ns

Co-cultivation time (CCT) 2 30.3 30.7 *** 72.1 52.0 *** 93.7 62.5 ***

(OD)*(CCT) 6 3.7 3.8 ** 2.2 1.6 ns 5.7 3.8 **

(AS)*(CCT) 4 0.6 0.7 ns 1.9 1.4 ns 0.3 0.2 ns

(OD)*(AS)*(CCT) 12 1.2 1.3 ns 1.3 0.9 ns 3.4 2.3 **

(IT)*(CCT) 4 3.1 3.2 * 1.2 0.9 ns 2 1.3 ns

(OD)*(IT)*(CCT) 12 1.8 1.8 ns 0.6 0.4 ns 1.3 0.9 ns

(AS)*(IT)*(CCT) 8 0.5 0.5 ns 0.4 0.3 ns 1.8 1.2 ns

(AS)*(OD)*(IT)*(CCT) 24 2.4 2.5 *** 0.4 0.3 ns 1.9 1.3 ns

Error 216 1.0 1.4 1.5

Total 323 3175 3171 2917

Coefficient of Variation 14.37% 19.90 20.062

MS = Mean Square;*** Significant at (P < 0.001); ** Significant at (P < 0.01); * Significant at (P < 0.05); ns non-Significant at (P < 0.05).

73

Table 4.4 Effect of OD, AS, IT and CCT on transformation frequency of petiole explants in transient GUS expression

OD↓ AS↓ IT→ 10 20 30

CCT→ 1 2 3 1 2 3 1 2 3

0.25 100 0.0 x 0.3 wx 1.0 u-x 0.7 v-x 1.3 t-x 2.0 r-x 2.3 q-x 2.3 q-x 2.3 q-x

200 1.3 t-x 1.7 s-x 2.7 p-w 3.3 n-u 5.7 g-n 6.7 d-k 2.7 p-w 5.0 i-p 4.3 k-r

400 1.7 s-x 2.3 q-x 4.3 k-r 6.0 f-m 7.0 c-j 7.7 a-h 3.3 n-u 5.0 i-p 6.0 f-m

0.5 100 1.3 t-x 2.3 q-x 4.0 l-s 4.3 k-r 6.0 f-m 4.0 l-s 3.0 o-v 6.0 f-m 6.0 f-m

200 2.0 r-x 3.7 m-t 6.0 f-m 3.0 o-v 7.0 c-j 7.33 b-i 2.3 q-x 6.0 f-m 8.0 a-g

400 3.0 o-v 4.7 j-q 5.0 i-p 3.3 n-u 6.3 e-l 7.0 c-j 3.7 m-t 5.7 g-n 5.3 h-o

0.75 100 4.0 l-s 4.7 j-q 5.7 g-n 4.7 j-q 6.3 e-l 7.3 b-i 6.0 f-m 8.0 a-g 8.7 a-e

200 7.0 c-j 8.0 a-g 6.0 f-m 7.3 b-i 8.0 a-g 8.3 a-f 7.0 c-j 7.7 a-h 8.7 a-e

400 6.0 f-m 6.3 e-l 9.0 a-d 7.0 c-j 9.3 a-c 9.3 a-c 9.3 a-c 9.3 a-c 7.7 a-h

1.0 100 6.0 f-m 9.0 a-d 9.0 a-d 8.7 a-e 10.0 a 10.0 a 9.7 ab 10.0 a 9.7 ab

200 8.7 a-e 8.7 a-e 9.0 a-d 9.7 ab 10.0 a 10.0 a 9.7 ab 10.0 a 9.7 ab

400 6.7 d-k 8.3 a-f 9.0 a-d 9.0 a-d 10.0 a 10.0 a 9.0 a-d 10.0 a 10.0 a

Transformation frequency 1.0 = 10.0 %, LSD= 1.597, Standard error = 0.57, Values which do not share the same letter are significantly different

(P <0.05).

74

Figure 4.5 Putative transformed explants on selection medium (A-B) nodal region, (C)

petioles, (D) embryogenic callus produced from leaf explants

4.2.7 Estimation of regeneration frequency

The regeneration capacity of a plant/plantlet is an important criterion that determines

productivity and yield. Both transformed and untransformed leaf discs do not normally

regenerate shoots but produce embryogenic calli. In contrast, nodal regions easily

generate shoots as they bear meristematic region(s). The regeneration potential of

putatively transformed nodal regions into multiple shoots was found to be significantly

higher compared to other explants (Fig. 4.6).

75

Figure 4.6 Regeneration frequency of different explant types

4.2.8 Transgene expression (GUS assay and PCR)

Transgene expression was confirmed by a histochemical GUS assay. Lower levels of the

studied factors induced partial GUS expression while their higher levels produced strong

GUS expression. Figure 4.7 (a-f) shows different explants with variation in GUS

expression, which can also be seen at a cellular level (Fig. 4.7 i-j), where guard cells,

even inner cortical cells and the intercalary region, present successful transformation.

The expression of the GUS gene in the tested independent transgenic lines was

confirmed by PCR with precisely designed GUS and npt-II primers. Transgenic lines

revealed the successful amplification of transgenes and expressed the expected bands of

895 bp for GUS (Fig. 4.8 a) and 780 bp for the npt-II gene (Fig. 4.8 b). The optimized

protocol is summarized in Fig. 4.9.

76

Figure 4.7 GUS expressions in different explant types. a and b; nodal regions, c-f; leaf

explants (e is control leaf explant), g-h; control nodal regions and petioles, i

and j; Micrographs showing GUS expression in stomata and intercalary zone.

Figure 4.8 PCR products of (a) GUS gene (895 bp) and (b) NPTII gene (780 bp) from

p35SGUSint used as control (c) and transformed plants formed from leaves

(L1-L3), nodal region (N1-N3) and petiole (P1-P3). In the case of leaves, it

was callus.

77

Figure 4.9 Flow chart of the method used in transformation experiment

4.3 Conclusion

Based on the present study, for a simple and efficient A. tumefaciens-mediated genetic

transformation, 3-day pre-cultured nodal regions of 60-day-old in vitro grown A.

bracteosa are recommended for use as explants for infection with 1.0 OD600. The

procedure should also involve 20 min of inoculation (in MS liquid) and 2 days of co-

cultivation (on MS solid medium), adding 200 µM acetosyringone at a media pH of 5.8.

Moreover, to enable a quick screening, the explants should be selected on a medium

containing 100 mg/L kanamycin.

The biotechnological production of secondary compounds with therapeutic properties is

currently one of the main goals of plant metabolic engineering. It has been shown in

multiple systems that the overexpression of one or more genes involved in the

78

biosynthesis of the target compounds or the overexpression of a master regulator may

dramatically improve production. In each case, an effective transformation protocol is

required. The results obtained in this work pave the way for a future metabolic

engineering of A. bracteosa, which would allow us to establish highly productive

transformed plants overexpressing key genes that control the biosynthesis of the

therapeutic secondary metabolites.

79

CHAPTER 5

5 Agrobacterium tumefaciens mediated transformation of A.

bracteosa with rol genes to enhance phytoecdysteroids

biosynthesis

Phytoecdysteroids are triterpenoids and more than 250 of their analogs have been

identified so far from over 100 terrestrial plant families. They were first recognized

steroidal hormones (Dinan, 2001). Although less than 2% of the world flora has been

investigated, among them ~ 6% produce phytoecdysteroids (Dinan, 2001). The most

common and biologically active phytoecdysteroid found in plants is 20-hydroxyecdysone

(20-HE) (Dinan et al., 2002).

Phytoecdysteroids, though are the insect molting hormones, their biosynthesis in plants is

attributed to their role to confer defense against phytophagous insects. When plant-

parasitic nematodes were treated with 20-HE, they undergo abnormal molting,

immobility, reduced invasion, impaired development, and/or ultimate death (Soriano et

al., 2004). Phytoecdysteroids of Ajuga iva reduced fecundity, fertility and survival of two

insect species whitefly Bemisia tabaci and the mite Oligonychus perseae (Aly et al.,

2011). Four Ajuga species were tested against two sucking insect species and resulted in

a considerable per os efficacy against their larvae. 20-HE, cyasterone and ajugalactone

were found responsible agents for this activity (Fekete et al., 2004).

Ecdysteroid levels in plants are usually ≥0.1% of their dry weight and are distributed in

all parts of plants in much higher amounts than in arthropods (Dinan, 2001).

Ecdysteroids are considered to be present in more amounts in tissues which are most

important for plant survival and their level changes during plant development. A.

bracteosa is a medicinal plant known worldwide for its traditional use in folk medicine

and it is also recommended plant for the treatment of many diseases in Greco Arab

medicine. Different extracts of the tested species of Ajuga revealed total

phytoecdysteroid content of 2053, 1892 and 95 mg kg-1

for A bracteosa, A reptans and A

chamaepitys respectively (Fekete et al., 2004).

80

rol genes, the plant oncogenes are powerful activators/inducer of plant secondary

metabolism mediated by uncommon signal transduction pathways (Bulgakov, 2008). The

rol genes are carried on plasmids of the A. rhizogenes. After infection, they are

transferred and integrated to plant genome to produce tumor and hairy root disease

(Spena et al., 1987). None of the species of Ajuga has been transformed with A.

tumefaciens. Moreover, only two species of this genus were transformed with A.

rhizogenes (A. reptans and A. multiflora). As rol genes are well-known inducers of plant

secondary metabolism, this chapter covers Agrobacterium tumefaciens mediated

transformation of A. bracteosa with rol genes to enhance phytoecdysteroids biosynthesis.


5.1.1 Plant material, growth conditions and pPCV002-ABC transformation

Ex vitro grown field plants were taken and after surface sterilization, they were cultured

as mentioned in chapter 4. In vitro grown plants of A. bracteosa were used for

transformation. A. tumefacienes strain GV3101 harboring rol A, B and C genes in the T-

DNA region of pPCV002-ABC was a clone of Ri plasmid of A. rhizogenes strain A4

(Spena et al., 1987). Transformation procedure from in vitro grown source plant to

selection, regeneration and acclimatization was optimized before in chapter 4 and used in

the same way. Conditions of growth room were: 25 2 ºC 16 h of photoperiod,

illumination of 45 µE m-2

s-1

or 1000 lux and 60 % relative humidity.

5.1.2 Molecular analysis

For the confirmation of integration of desired genes, molecular analysis was carried out

through PCR and semi-quantitative reverse transcriptase PCR. Transformed and

untransformed control plants were used for PCR for rol A, B, C and npt-II genes. rolC

gene and actin (housekeeping gene) was used to analyze the expression studies through

semi-quantitative RT-PCR in A. tumefaciens mediated transformation.

5.1.2.1 Isolation of genomic DNA

Genomic DNA from transformed plants and control untransformed plants was isolated

by CTAB (Cetyl trimethyl ammonium bromide) method (Doyle and Doyle, 1990) as

81

described in detail in 4.1.7. A colony PCR of GV3101 cells containing pPCV002-ABC

was performed for the positive control.

5.1.2.2 PCR analysis

The genes, primers, sequences of primer and PCR conditions are described in Table 5.1.

PCR Master Mix (Life Technologies, Spain) was used for the conduction of PCR

reactions and it was carried out in thermocycler (Perkin-Elmer Gene Amp PCR System

9600, USA). PCR was performed according to standard method (Taylor, 1991). PCR

conditions were fixed except for annealing temperature. They were; 5 minutes 95°C,

followed by 35 cycles of 35 seconds at 95°C, 35 sec for primers annealing (temperature

given in table), and finally an extension of 10 min at 70°C. Amplified PCR products

were resolved at 1.5 percent (w/v) agarose gel electrophoresis and visualized with UV-

Trans illuminator (Life Technology, USA).


in transgenic plants of A. bracteosa

Gene Sequence Size (bp) Tm (°C)

PCR

rolA F:5ʹ-AGAATGGAATTAGCCGGACTA-3ʹ

308 53°C R:5ʹ-GTATTAATCCCGTAGGTTTGTT-3ʹ

rolB F:5ʹ-GCTCTTGCAGTGCTAGATTT-3ʹ

779 55°C R:5ʹ-GAAGGTGCAAGCTACCTCTC-3ʹ

rolC F:5ʹ-GAAGACGACCTGTGTTCTC-3ʹ

540 54°C R:5ʹ-CGTTCAAACGTTAGCCGA TT-3ʹ

npt-II F:5ʹAAGATGGATTGCACGCAGGTC3ʹ

780 54°C R:5ʹGAAGAACTCGTCAAGAAGGCG3ʹ

SQ-RT-PCR

rolC F:5ʹ-CTGTACCTCTACGTCGACT-3ʹ

363 62°C R:5ʹ-AAACTTGCACTCGCCATGCC-3ʹ

actin F:5ʹ-ATCAGCAATACCAGGGAACATAGT-3ʹ

160 60°C R:5ʹ-AGGTGCCCTGAGGTCTTGTTCC-3ʹ

5.1.2.3 Extraction of RNA

Total RNA from transgenic A. bracteosa plants was isolated with the TRIzol® Plus RNA

Purification Kit (Life Technologies, Germany.) according to manufacturer’s instructions.

82

Briefly, the plant sample (leaves of transgenic intact plants and transgenic hairy roots)

frozen in liquid nitrogen was ground in autoclaved and sterilized pestle and mortar. A

100 mg of ground tissue was transferred to the Eppendorf tubes and further homogenized

in TRIzol® Reagent (1 ml) with sterile metallic balls in tissue lyser (Qiagen, Hilden,

Germany). After complete homogenization, it was left at room temperature for 5 min. It

was followed by an addition of chloroform (200 µl/1 ml of TRIzol® Reagent) and then

the homogenate was centrifuged at 13000 rpm at 4 °C for 15 min to separate aqueous

and organic phases. The upper, aqueous phase was collected in separate Eppendorf tubes.

It was followed by an addition of isopropanol (500 µl/1 ml of TRIzol® Reagent).

Following a mixing by inverting and incubation at room temperature for 10 min, its

homogenate was centrifuged at 13000 rpm at 4 °C for 10 min to pellet down RNA. The

pellet was dissolved in 1 ml of ethanol. The sample was then transferred to the

PureLink™ RNA mini kit spin cartridge containing a silica-based membrane to which

the RNA binds. The RNA was washed to remove contaminants and the purified total

RNA was then eluted in 50 µl RNAse-free Tris Buffer (TE) at pH 7.5. Further, it was

supplemented with 1 µl of RNase inhibitor and ultimately RNA quantity and quality was

tested through NanoDrop apparatus. Only the samples with a 260:280 ratio between 1.9

and 2.0 were used for the analysis.

5.1.2.4 DNase treatment

To 50 µl of RNA, 5 µl of DNase buffer (0.1 % volume of TE containing RNA) and 1 µl

of DNase were added. It was placed in thermoblock (Eppendorf, Sigma Aldrich) at 37 °C

for 30 min and 5 µl of DNase inhibitor (pre-vortexed) was added. The mixture was

incubated at room temperature for 5 min with gentle mixing after each 30 seconds.

Subsequently, it was centrifuged for 10 min at 13000 rpm and supernatant was taken out

carefully. The purified RNA was electrophoresed over TBE solidified with 1.5 %

agarose. It was again checked for quantity and quality with NanoDrop machine and

stored in autoclaved Eppendorf tubes at -20 °C till further use.

5.1.2.5 First-strand cDNA Synthesis

For sqRT-PCR, cDNA was prepared from total RNA with SuperScript II reverse

transcriptase (Invitrogen, Carlsbad CA). Synthesis of cDNA was carried out according to

manufacturer’s instructions. Briefly, 1 µl of Oligo(dT) or dT15 (50 µM) and1 µl of dNTP

83

mixture (10mM each) was added to 1 µg of RNA in a nuclease-free microcentrifuge

tube. The volume of the reaction mixture was raised to 12 µl by the addition of

autoclaved and DPEC treated water. It was gently mixed, briefly centrifuged and

incubated in thermocycler at 65 °C for 5 min and immediately chilled on ice. To this 12

µl, 4 µl of 5× buffer (first-strand buffer), 2 µl of 0.1 M DTT and 1 µl of RNaseOUT™

was added. It was followed by brief mixing and an incubation of 2 min at 37 °C. Finally,

1 µl of (200 units) SuperScript™ II RT (reverse transcriptase enzyme) was added to this

reaction and volume was raised to 20 μl by the addition of autoclaved and DPEC treated

water. It was mixed gently by pipetting the mixture, incubated first at 37 °C for 50 min

and then deactivated the reaction by heating it at 70 °C for 15 min. cDNA quantity and

quality was tested through NanoDrop apparatus and stored at -20 °C till further use.

5.1.2.6 Expression analysis

Expression analysis was performed through semi-quantitative RT-PCR. In A.

tumefaciens mediated transformation rolC and actin (housekeeping gene) genes were

amplified in the selected transgenic lines using 1-2 µl of cDNA (~200 ng) as template.

PCR conditions, primers sequences and amplicons’ size is described in Table 5.1. The

expression of genes was further analyzed by densitometry of the amplicons using Kodak

molecular imaging v4.0 software.

5.1.3 Extraction of ecdysteroids and RP-HPLC analysis

All the plant material was screened for the presence of six ecdysteroids standards viz: 20-

hydroxyecdysone (20-HE), Ajugalactone (AJL), Sengosterone (SG), Cyasterone (CYP),

Polypodine (PoB) and Makisterone A (MKA) (Fig. 3.2). For the extraction of

ecdysteroids, already optimized protocol (Castro et al., 2008) was followed with some

modifications as mentioned in 3.1.4. While, analytical HPLC was performed with some

modifications of already optimized protocol (Wu et al., 2009) as described in 3.1.5.


RP-HPLC was conducted in triplicate for each sample. Two factor Complete

Randomized Design (CRD) was applied on the data to retrieve Analysis of Variance

84

(ANOVA). Data analyzed with MSTATC 2.0 version. Different letter over the bars (a-c)

are statistically significant to each other at p < 0.001 and provided with ± SD.

5.2 Results

5.2.1 Molecular confirmation of T-DNA integration into plant genome

PCR analysis of rolA, rolB, rolC, and nptII genes in plants transformed with pPCV002-

ABC revealed a successful integration of T-DNA into plant genome (Fig. 5.1 a-d) in 1 to

7 independent transgenic lines of intact plants.

Figure 5.1 PCR products of pPCV002-ABC transgenic plants. a, rolA gene (308 bp). b,

rolB gene (779 bp). c, rolC gene (541bp). d, npt-II gene (780 bp). M: marker

(100 bp+ and 1.0 kb), PC: positive control (colony PCR), NC: negative

control (untransformed plant material),

5.2.2 T-DNA of pPCV002-ABC alter plant morphology

Untransformed plants of A. bracteosa have straight unbranched stems which are soft in

texture (Fig. 5.2 a-b). The intact transgenic plants generated through pPCV002-ABC

transformation were branched and abnormally dwarf as their internodes were short and

hard in texture (Fig. 5.2 c-h). They had more lateral branches and assumed a bushy

appearance. The leaves were twisting to its margins and formed ridges and furrows. The

furrows were found at the branch of veins. The leaves were curled and wrinkled, and the

roots were long and highly branched (Fig. 2i).

85

Figure 5.2 Development of intact transgenic plants containing pPCV002-ABC: a, ex

vitro source plant; b, in vitro raised source plant; c-h, independent transgenic

lines; i, dense rooting of the plants.

5.2.3 rol genes of pPCV002-ABC are powerful inducer of phytoecdysteroids

biosynthesis

Studied phytoecdysteroids were found in a scarce amount in wild-type plants of A.

bracteosa. Among the 6 tested phytoecdysteroids, only 4 were successfully detected in 7

pPCV002-ABC transgenic lines (ABC1 to ABC7) (Fig. 5.3 a-b). They showed a clear

increase in total phytoecdysteroid content e.g. transgenic line 3 and 4 produced 6728 and

6759 µg/g dry weight of total phytoecdysteroid content respectively, which is 14.5 times

higher, compared to control untransformed in vitro grown plants (Fig. 5.4 a-c, Table 2).

86

Figure 5.3 RP-HPLC Chromatographs representing elution pattern of (a) standard

phytoecdysteroids and (b) phytoecdysteroids profiling in ABC1.

(a)

(b)

87

Figure 5.4 Phytoecdysteroid content in intact pPCV002-ABC independent transgenic

lines (1-7) of A. bracteosa samples. a; biosynthesis of phytoecdysteroids, b;

increase in phytoecdysteroid content, c; increase in individual

phytoecdysteroids.

To further confirm the increase of phytoecdysteroid content and the effect of rol genes,

expression analysis of rolC gene through semi-quantitative RT-PCR was performed in

the transgenic lines. Analysis of rolC gene revealed a relative high expression in both the

transgenic lines while almost similar amplicons’ band intensity was found for actin

housekeeping gene (Fig. 5.5 a-b). The densitometry analysis of molecular imaging of

corresponding amplicon bands revealed a high expression of rolC in the two transgenic

lines as compared to the other associated lines (Fig. 5.5 c).

(c)

(b)

(a)

88

Table 5.2 Analysis of Variance (ANOVA) of pPCV002-ABC transformed intact plants

using 2-Factor Complete Randomized Design

SOURCE DF SS MS F-value P value

Transgenic plants 7 28379204 4054171.9 2794.538 ***

Phytoecdysteroids 3 2628070 876023.3 603.8423 ***

Transgenic plants ×

phytoecdysteroids 21 7420919 353377.0 243.5826 ***

Error 64 92847.91 1450.7

TOTAL 95 38521041

Coefficient of Variation: 4.68%; DF, degree of freedom; SS, sum of squares; MS, means

square.

Figure 5.5 SQ-RT-PCR of pPCV002-ABC transgenic plants. a, SQ-RT-PCR of rolC

(363 bp); b, SQ-RT-PCR actin (160 bp); c, densitometerical analysis of actin

and rolC. M: marker (100 bp+ and 1.0 kb), PC: positive control (colony

PCR), NC: negative control, WT; wild-type untransformed plant.

(b)

(a)

(c)

0

30000

60000

90000

120000

150000

180000

1 2 3 4 5 6 7

Am

plic

on

s' in

ten

sity rol C actin

89

5.2.4 rol genes strongly affected AJL biosynthesis than the rest of

phytoecdysteroids

Among the studied phytoecdysteroids, 20-HE, MKA, CYP and AJL were successfully

detected in the transgenic plants. These phytoecdysteroids were enhanced at varying

level in transgenic plant material (Fig. 5.4 c). 20-HE content of intact transgenic plants

containing T-DNA of pPCV002-ABC represented on an average 5.6 times more

phytoecdysteroid content as compared to untransformed plants. Highest effect of

transformation was found on AJL content. Intact pPCV002-ABC transgenic plants

revealed 11.0 times increase in AJL contents when compared to control untransformed

plants.

5.3 Conclusion

Transformation through A. tumefaciens harboring rol genes generated transgenic A.

bracteosa plants with altered plant architecture. the rol genes induced a significant

increase of phytoecdysteroids which is ~14.5 times higher as compared to control

untransformed in vitro grown plants. It can be concluded that expression of rolC and

densitometeric analysis revealed a relatively high expression as compared to control

plants. The rol genes can be a valuable tool for enhanced biotechnological production of

phytoecdysteroids.

90

CHAPTER 6

6 Agrobacterium rhizogenes mediated transformation of A.

bracteosa to enhance phytoecdysteroids biosynthesis

Hairy roots are a valuable biotechnological tool for the production of plant secondary

metabolites due to high productivity and stability of growth (Pistelli et al., 2010).

Agrobacterium rhizogenes infect plants and generate hairy roots in response to the

transfer and integration of DNA (T-DNA) from agrobacterial large root inducing plasmid

(pRi) into plant genome (Chilton et al., 1977; Chilton et al., 1982). Agropine type strains

contain two T-DNA regions on Ri plasmid called as TL-DNA and TR-DNA which are

independently incorporated into the plant genome (Chilton et al., 1982; Vilaine and

Casse-Delbart, 1987). The Ri TL-DNA carrying rolA, B, C and D genes are responsible

for hairy root induction (Cardarelli et al., 1987; Vilaine and Casse-Delbart, 1987) while

Ri TR-DNA possess the genes responsible for opine biosynthesis (Paolis et al., 1985).

TR-region was further found important in the determination of the hairy root

morphology (Mallol et al., 2001; Moyano et al., 1999). Elicitation of hairy roots can

further enhance the biosynthesis of valuable secondary metabolites (Pistelli et al., 2010).

Phytoecdysteroids biosynthesis was found to be closely related to the growth of hairy

roots (Matsumoto and Tanaka, 1991). Among several hairy roots of A. reptans, Ar-4 was

found to increase the weight by 230 times and the content of 20-hydroxyecdysone (20-

HE) by 4 times when cultured for 45 days (Matsumoto and Tanaka, 1991). The

regenerants of these hairy roots showed altered plant morphology but the same

production of 20-HE as in original hairy root line (Tanaka and Matsumoto, 1993a). Hairy

roots obtained from A. multiflora produced 10 times more 20-HE as compared to wild

type (Kim et al., 2005a). Moreover, elicitors are found to induce higher

phytoecdysteroids biosynthesis (Soriano et al., 2004).

In the present study, the potential of transformed roots of A. bracteosa and effect of

elicitation to produce phytoecdysteroids is evaluated for the first time. Moreover, the

phenotypic effects of the integration of TR-DNA genes from A. rhizogenes into the hairy

roots’ genome were also investigated.

91


6.1.1 Plant source and its sterilization for hairy roots induction

Both in vitro and ex vitro grown explants were used for hairy roots induction. For

infecting ex vitro (field grown plants), surface sterilization of whole plant was done by

immersion in sodium hypochlorite (30% v/v) for 20 minutes with continuous sonication,

immersion in ethanol (70% v/v) for 1 minute, 5 times washing with sterilized distilled

water and drying by blotting them on sterile filter paper. Both in vitro and ex vitro grown

young and fresh stem sections, root sections, and leaves with petioles are prepared (1-3

cm).

6.1.2 Bacterial strains and procedure for A. rhizogenes mediated transformation

A. rhizogenes strain LBA-9402, A4 and ARqua1 were streaked down separately in YEB

medium solidified with agar. The petri plates were kept inverted in dark at 27 ºC and

individual bacterial colonies were used for infection. Following transformation methods

were used;

6.1.2.1 Injury to vascular system zone

Agrobacterial colonies were picked up with surgical blades and syringe needles

separately. Bacterial colonies adhered to surgical blade were gently moved over the fresh

cut sections of stem and 2-3 slight cuts were also made in stem and placed over medium

in upright direction. Sterile surgical blade and needle harboring agrobacteria adhered to

their pointed end were used to prick abaxial side of leaves and root sections at several

sites.

6.1.2.2 Sonication assisted transformation

Explants were prepared as described above and infected with LB grown agrobacteria

which were harvested and resuspended in liquid MS medium. The explants were

sonicated with this bacterial suspension for 20 min according to already optimized

protocol (Georgiev et al., 2011). Thereafter, they were blotted on sterile filter paper,

cocultivated on 0.5MS for two days and then shifted to the medium containing Claforan

500 mg/L.

92

6.1.3 Media used and shifting of A. rhizogenes infected explants

A wide range of media were screened to optimize hairy roots induction, proliferation and

optimally stabilized growth (Table 6.2). Hairy roots along with the mother explant was

routinely shifted to new medium after every 5 days, while after 3 weeks, they were

shifted every week. In the third phase (stable growth stage), hairy roots were excised

from mother explant (2-3 cm long) and shifted to the medium after every two weeks in

such a way that one root line was transferred in one petri plate. From the start to date,

hairy roots are maintained in the growth room (conditions described) in dark.

6.1.4 Growth quotient

To screen actively growing hairy roots, 200 mg of fresh weight of root inoculum was

cultured on half strength media for one month. After the incubation period, fresh weight

of each root line was harvested. Growth quotient was measured by dividing the fresh

weight harvested by the fresh weight of inoculum.

6.1.5 Molecular analysis

For the PCR analysis, genomic DNA was isolated from hairy roots and control roots

(untransformed) by the optimized method (Doyle and Doyle, 1990) and its quantitative

and qualitative parameters were checked by NanoDrop apparatus as described in chapter

4. Integration of TL-DNA into the genome of hairy roots was confirmed by the PCR of

rolC gene. To ensure the hairy root clones free from agrobacterial contamination, PCR

was carried out for the absence of virD1 gene. TR-DNA integration into the hairy roots’

genome was confirmed by the PCR analysis of aux1, mas1, and ags genes. PCR

conditions were fixed except for annealing temperature. They were: 5 minutes at 95 °C;

35 cycles of 35 sec at 95 °C, 35 sec (primers annealing temperature given in Table 2), 1

min at 70°C; and 10 min at 70°C. rolC gene and actin (housekeeping gene) was used to

analyze the expression studies through semi-quantitative RT-PCR. RNA isolation,

DNase treatment and synthesis of cDNA were performed as described in chapter 5.

Amplified PCR products were resolved at 1.5 percent (w/v) agarose gel electrophoresis

in TBE running buffer and visualized with UV-Trans illuminator. The expression of

genes was further analyzed by densitometry of the amplicons using Kodak molecular

imaging v4.0 software.

93


in transgenic hairy roots of A. bracteosa

Gene Sequence Size (bp) Tm (°C)

rolC F:5ʹ-TAACATGGCTGAAGACGACC-3ʹ 534 60

R:5ʹ-AAACTTGCACTCGCCATGCC-3ʹ

virD1

F:5ʹ-ATGTCGCAAGGCAGTAAGCCC-3ʹ 438 56

R:5ʹ-GAAGTCTTTCAGCATGGAGCA-3ʹ

rolC F:5ʹ-CTGTACCTCTACGTCGACT-3ʹ 363 62

(SQ-RT-PCR) R:5ʹ-AAACTTGCACTCGCCATGCC-3ʹ

actin F:5ʹ-ATCAGCAATACCAGGGAACATAGT-3ʹ 160 60

(SQ-RT-PCR) R:5ʹ-AGGTGCCCTGAGGTCTTGTTCC-3ʹ

ags

F:5ʹ-GGCGTGAGCACCTCATATCCG-3ʹ 347 62

R:5ʹ-TTCGAAGCCTTTGCCTGCAAA-3ʹ

mas1

F:5ʹ-ACCTTGGTACTGCCCAGCCAC-3ʹ 343 62

R:5ʹ-CTTCAGTGGTCCATACCCACC-3ʹ

aux1

F:5ʹ-ATGTCGCAAGGCAGTAAGCCC-3ʹ 438 56

R:5ʹ-GAAGTCTTTCAGCATGGAGCA-3ʹ

6.1.6 Extraction of ecdysteroids and RP-HPLC analysis

Six ecdysteroids screened in the study were; 20-ydroxyecdysone (20-HE), Ajugalactone

(AJL), Sengosterone (SG), Cyasterone (CYP), Polypodine (PoB) and Makisterone A

(MKA) (Fig. 3.2). For the extraction of ecdysteroids, the harvested hairy roots were

freeze dried (lypholizer) and ground to fine powder. Extraction was performed according

to already optimized protocol (Castro et al., 2008) with some modifications as described

in 3.1.4. Analytical HPLC was performed with some modifications of already optimized

protocol (Wu et al., 2009) as described in 3.1.5.

6.1.7 Treatment with elicitors

Methyl Jasmonate (MeJ) and Coronatine (Cor) (Sigma-Aldrich, St. Louis, MO, USA)

were added to the already optimized medium for stable growth and production (half

94

strength MS) prior to inoculation. Both the elicitors were filter-sterilized (0.22 µm sterile

PES filters, Millipore, Billerica, MA, USA) and added to the media just before pouring

to make a final concentration of 100 µM MeJ and 1 µM Cor. 200 mg of fresh inoculum

of each hairy root line was cultured for 14 and 21 days. Each treatment was conducted in

triplicate and to compare the effect of elicitors, control (un-elicited) hairy roots were

provided with 2.5 ml ethanol (MeJ control). For analysis, three independently treated

hairy root line (3 petri-plates) were harvested after 14 and 21 days of elicitation.

6.2 Results

6.2.1 Development of hairy roots induced by T-DNA of pRi

Among the tested explant types for hairy roots procurement, only leaf discs with midrib,

veins and its proximal end containing petiole were found valuable (Fig. 1 a-b). Stem and

root sections did not produce any hairy root.

For hairy root induction, MS, B5 and SH media were screened (Table 6.2, Table 6.3). A

few of the explants produced small number of hairy roots on MS and B5 media. But

when SH (Schenk and Hildebrandt, 1972) medium (pH 7.0) was supplemented to the

infected explants, vigorously growing enormous number of hairy roots were obtained

(Fig. 6.1 c, Table 6.3).

Table 6.2 Media used for the optimization of hairy root induction, stabilization and

steady growth in A. bracteosa.

Medium Composition

First phase media (hairy root induction ≥ 10

days)

MS/B5+ Claforan 500 mg/L

SH+ Claforan 500 mg/L

Second phase media (hairy root proliferation ≥

30-35 days)

0.5 MS+ Claforan 500 mg/L

0.5 MS+IBA+ Claforan 500 mg/L

0.5 B5+ Claforan 500 mg/L

0.5 B5+IBA+ Claforan 500 mg/L

SH+ Claforan 500 mg/L

Third phase medium (stable growth and

maintainability)

MS+ Claforan 250 mg/L

0.5 MS+ Claforan 250 mg/L

B5+ Claforan 250 mg/L

0.5 B5 + Claforan 250 mg/L

SH + Claforan 250 mg/L

95

After one month of hairy roots culture in third phase medium, claforan was removed.

Figure 6.1 Development of transgenic hairy roots and regenerants. a-b, proximal end of

leaf; c-d, hairy roots on SH medium in ex vivo source of explants; e,

regenerants; f, plageotropism. g, shoots of regenerants; h, leaves of

regenerants. i, leaves of pPCV002-ABC transgenics.

Table 6.3 Effect of medium on induction of hairy roots in A. bracteosa

Media Strain Explants Roots EPR RI (days) Branching (%)

MS/B5

LBA-9402 839 49 34 13 40

A4 415 33 23 12 55

Arqua1 262 12 8 9 60

SH LBA-9402 60 289 31 7 90

A4 20 78 5 8 100

EPR: explants producing roots, RI: root induction

96

However, this medium (SH) seemed to help only in the increase in hairy root induction.

After ≥ 10 days, the hairy roots on this medium started getting pale yellow followed by

browning and death. Further a number of media were screened for their survival (second

phase media, Table 6.2). MS (half strength) supplemented with 2 mg/L IBA was found

better to reinitiate and proliferate the hairy root growth, colour and ramification (Table

6.4).

Table 6.4 Effect of medium on proliferation of hairy roots in A. bracteosa

Strain Media Growth status of roots

LBA-

9402

0.5B5+IBA Secondary branches, increase in length, few produce callus

0.5B5 Single root, no ramification, very slow growth

0.5MS Single root, no ramification, very slow growth

0.5MS+IBA

More increase in length than width, ramification, some

produce callus

SH No ramification, callus induction

A4

0.5B5+IBA

Ramification, length increase, some generate callus by

increasing width

0.5B5 No growth, no ramification

0.5MS No growth, no ramification

0.5MS+IBA

Ramification, increased in width and swollen, length also

increased

SH Pale yellow, dying

ARqua1

0.5B5+IBA Swollen callus, spiny

0.5B5 No growth, no ramification, greyish

0.5MS Dead

0.5MS+IBA Dying, no growth

SH Surviving

After 10-15 days (two times refreshing this medium), supplementation of IBA was

stopped and good quality and quantity of the roots were procured (third phase media,

Table 6.2). After one month of emergence of hairy roots, the survived roots were found

stable on half strength MS medium (Table 6.5).

97

Table 6.5 Effect of medium on stable growth and maintainability of hairy roots

Media Growth status of roots

B5 Bit swollen, broader, thick, ramification but less increase in length

MS Callus like, beaded appearance, no increase in length but increase in width

0.5B5 Normal hairy roots, ramification, increase in length found, few are thick

0.5MS Multiple ramification, densely hairy, increase in length, few are thick

SH No increase, pale yellow roots, dying

Surface sterilized field grown plants and four-week old in vitro grown plants were

infected with A. rhizogenes strains to induce hairy roots. When compared the effect of in

vitro and ex vitro grown source of explants, ex vitro explant source was found more

prone for hairy root syndrome (Table 6.6). Ex vivo source of explants induced hairy roots

quickly and in a higher number (Fig. 1 c-d).

Table 6.6 Effect of explants’ origin on hairy root induction and its attributes in A.

bracteosa

Strain Explants Roots EPR RI (days) Branching

In vitro

LBA-9402 634 22 15 14 No

A4 245 12 15 13 No

Arqua1 204 9 5 8 No

Ex vitro

LBA-9402 265 301 41 11 Yes

A4 190 99 16 12 Yes

Arqua1 58 3 3 11 Yes

EPR: explants producing roots, RI: root induction

Among the tested A. rhizogenes strains, LBA-9402 and A4 were found to induce hairy

roots on large scale (table 6). Among the three methods of infection, needle prick

method, sonication assisted method and pointed cut with surgical blade, latter was found

the best method to induce hairy roots (Fig. 1b).

98

6.2.2 Molecular confirmation of T-DNA integration into plant genome

Successful amplification of rolC gene in hairy roots confirmed the TL-DNA of pRi

integration in hairy roots’ genome (Fig. 6.2 a). To ensure that the hairy root cultures are

devoid of agrobacteria, they were screened for the presence of virD1, which was found

negative (Fig. 6.2 b).

Figure 6.2 PCR analysis of (a) rolC and (b) virD1 in the transgenic hairy roots’ genome.

First lane, ladder (100 bp+); second lane, positive control (colony PCR); third lane,

negative control (untransformed roots).The other 59 samples from 4th

well are as follows:

A1, A2, L1, L2, L3, L4, L5, L6, L7, L8, L9, L10, L11, L12, L13, L14, L15, L16, L17,

L18, L19, L20, L21, L22, L23, L24, L25, L26, L27, L28, L29, L30, L31, L32, L33, L34,

L35, L36, L37, L38, L39, L40, L41, L42, L43, L44, L45, L46, L47, L48, L49, L50, L51,

L52, L53, L55, L56 and Ar1. First two transgenic root lines were obtained from A4 and

the last one was obtained after the infection of ARqua1 strains of A. rhizogenes. All the

rest of hairy root clones were generated after the infection of A. rhizogenes strain LBA-

9402.

6.2.3 rol genes of pRi are powerful inducer of phytoecdysteroids biosynthesis

From the three strains, 59 stable transgenic hairy root lines were confirmed for the

presence of TL-DNA of pRi. RP-HPLC analysis revealed a successful detection of four

phytoecdysteroids (Fig. 6.3 a-b) in all transgenic hairy root lines. Among 59, eleven root

lines were found to exhibit higher growth rate (Fig. 6.4 a) and also a higher

phytoecdysteroids’ profile (Fig. 6.4 b) than the rest. A1 and A2 are hairy root lines

obtained from infection of A. rhizogenes A4 strain while L1 to L42 are selected

transgenic hairy root lines obtained from the infection of A. rhizogenes strain LBA-9402.

99

Figure 6.3 RP-HPLC Chromatographs representing elution pattern of phytoecdysteroids

in transgenic hairy roots of A. bracteosa. a, Elution of 6 standard

phytoecdysteroids; b, pattern of elution in transgenic hairy root line (A1).

(a)

(b)

100

Figure 6.4 Growth (a) and production (b) of phytoecdysteroids in the transgenic hairy roots.

(a)

(b)

101

Phytoecdysteroids’ profiling of these hairy roots revealed considerably high amount of

phytoecdysteroids as compared to control roots. Among the obtained roots, A2

represented significantly highest (P < 0.001) phytoecdysteroid content i.e. 4449 µg/g

(Fig. 6.4 b and Table 6.7). It was followed by L1 which represented 4123 µg/g of

phytoecdysteroid content. The hairy root lines A2 and L1 produced 3.64 and 3.37 times

more phytoecdysteroid content as compared to control roots (Fig. 6.5). Among the 11

elite transgenic hairy root lines, the other eight hairy root lines obtained from LBA-9402

strain represented between 2001 to 2561 µg/g dry weight of phytoecdysteroid content.

Figure 6.5 Phytoecdysteroid content in 11 elite transgenic hairy root lines of A. bracteosa

Table 6.7 Analysis of Variance (ANOVA) of transgenic hairy root lines using 2-Factor

Complete Randomized Design

Source DF SS MS F-value P value

Transgenic hairy roots (T) 58 22012543.87 379526.618 590.6268 ***

Ecdysteroids (PE) 3 39953845.3 13317948.43 20725.6527 ***

T × PE 174 18722812.99 107602.373 167.4529 ***

Error 472 303299.093 642.583

TOTAL 707 80992501.25

Coefficient of Variation: 6.71%. ANOVA of transgenic hairy root lines was done against

59 established root clones. DF, degree of freedom; SS, sum of squares; MS, means

square;*** means that the transgenic lines, phytoecdysteroids and their interaction is

significant at P < 0.001.

102

The 9 elite transgenic hairy root lines (both in terms of growth and phytoecdysteroids’

production) obtained from A. rhizogenes strain LBA-9402 were selected and subjected to

semi-quantitative RT-PCR analysis. They were obtained after the infection of A.

rhizogenes strain LBA-9402 and named as: L1, L2, L6, L8, L11, L12, L13, L32 and L42.

The analysis revealed a dramatically high rolC expression in the root lines from which

high phytoecdysteroid content was harvested (Fig. 6.4 b, 6.5 and 6.6 a-b). The

densitometeric analysis of molecular imaging of corresponding gene bands further

confirmed a high expression of rolC gene in L1 and L13 hairy root lines as compared the

other associated lines (Fig. 6.6 c).

Figure 6.6 SQ-RT-PCR of some selected transgenic hairy root lines with (a) rolC (363

bp) and (b) actin (160 bp). M, marker (100 bp+ and 1.0 kb); PC, positive

control (colony PCR); NC, negative control (untransformed roots); WT, wild-

type untransformed plant.

6.2.4 T-DNA of pRi alter plant morphology

Wild A. bracteosa have straight unbranched stems which are soft in texture (chapter 5,

Fig. 5.1 a-b). The plants raised through somatic embryogenesis of callus cells from pRi

of A4 and LBA9402 infection were highly different in every morphological aspect to

untransformed and pPCV002-ABC transformed plants (Fig. 5.2 c-h). These regenerants

lack the central main stem instead they form a bunch of 20-30 shoots generating from the

same position (Fig. 6.1 e-f). These plants were thin and possessing enormous number of

leaves and roots. Their leaves were very thin, narrow and long without the central midrib

(b)

(a)

(c)

0

30000

60000

90000

120000

150000

180000

1 2 3 4 5 6 7

Am

plic

on

s' in

ten

sity rol C actin

103

and a definite petiole as compared to the leaves of wild type or pPCV002-ABC raised

transgenic plants (Fig. 6.1 g-i). The roots drastically grow in medium and most often are

plageotropic (Fig. 6.1 f).

6.2.5 Aerial portions of A. bracteosa: a sink of phytoecdysteroids

As supported by the previous reports, it is assumed that phytoecdysteroids are

synthesized in hairy roots of A. bracteosa and they are transported to the aerial portions.

For the sake of a logical answer, the regenerants (intact plants) from somatic

embryogenesis of hairy root cells were raised and analyzed for their phytoecdysteroid

content (Fig. 1 e,f). It was found that the regenerants contain more phytoecdysteroid

content (up to 5.3 times) than corresponding mother hairy root lines (up to 1.64 times)

and untransformed roots (Fig. 6.5 and 6.7). This differential biosynthetic pattern of

phytoecdysteroids suggests the provision of a possible sink (aerial portion especially

leaves) in regenerants.

Figure 6.7 Times increase in Phytoecdysteroid content in regenerants obtained from

transgenic hairy roots of A. bracteosa.

SG was not detected in any of the transgenic or untransgenic plant material but

interestingly it is detected in some transgenic hairy root lines which contain high

phytoecdysteroid profile. The regenerants derived from these hairy showed the presence

of SG. It is inferred from the results that SG might be de novo biosynthesized only in

roots (Fig. 6.8) and then transported in aerial portions of the regenerants. Already

published literature supports this hypothesis.

104

Figure 6.8 Sengosterones’ de novo biosynthesis in transgenic hairy roots of A. bracteosa.

a; elution of standards, b; wild type intact plant, c; intact pPCV002-ABC transgenic

plants, d; transgenic hairy roots, e; regenerants obtained from hairy root A1.

6.2.6 rol genes strongly affected AJL biosynthesis more than the rest of

phytoecdysteroids

Among the studied phytoecdysteroids, 20-HE, MKA, CYP and AJL were successfully

detected in the transgenic hairy roots. 20-HE content of hairy roots increased up to 1.142

times as compared to control untransformed roots. Highest effect of transformation was

found on AJL content. Hairy roots represented 7.1 times increase in AJL contents when

compared to control roots (Fig. 6.9).

a b c d e

SG -

10

.16

7

SG -

10

.16

8

105

Figure 6.9 Trend of individual phytoecdysteroid biosynthesis in 59 transgenic hairy root

lines (b) of A. bracteosa

6.2.7 Phenotypic characterization and phytoecdysteroid content in transgenic

roots

Transgenic roots were observed in proximal end of leaves of A. bracteosa infected with

A. rhizogenes strains A4, LBA-9402 and ARqua1 carrying pRi within 9-12 days. The

hairy root clones were maintained for successive subcultures and they maintained the

morphology. The established hairy root cultures grew actively on hormone free half

strength medium, and showed four different morphologies (Fig. 6.10). Most of the hairy

roots (59%) exhibited typical hairy root morphology (THR) as described previously

(David et al., 1984). Among the rest, callus like morphology (CM), typical hairy root

with thick morphology (NTK) and typical hairy root with thin morphology (NTN)

accounted for 17%, 14% and 10% respectively (Table 6.8). All transgenic hairy roots

were fast growing, ramified and plageotropic except CM which was less ramified. CM

exhibited the capacity to dedifferentiate and produce callus tissue in hormone free culture

medium.

106

Figure 6.10 Different hairy roots phenotypes a: control in vitro grown untransformed

roots, b-c: callus like morphology, d: transgenic hairy root with thick

morphology, e: transgenic hairy root with thin morphology, f: typical

transgenic hairy root.

Table 6.8 Hairy root morphology and integration of T-DNA fragments of pRiA4 in hairy

root genome

Morphology Incidence Growth rate PE (µg/g) rolC aux1 mas1 ags

THR 58.62 % 3.277±0.32 1538±48.2 100% 70.60% 100% 73.50%

CM 17.24 % 3.93±0.3 1509±37.3 100% 90% 100% 100%

NTK 13.79 % 2.675±0.23 1217±17.9 100% 100% 100% 100%

NTN 10.34 % 2.35±0.52 1202.3±63 100% 0.00% 16.70% 0.00%

THR: Typical hairy root, CM: Callus like morphology, NTK: Normal hairy root with

thick morphology, NTN: Normal hairy root with thin morphology, PE: Phytoecdysteroid

content

6.2.8 TR-DNA integration into the genome of transgenic hairy root lines

Presence of T-DNA genes was compared with the morphology, growth rate and

phytoecdysteroid content of transgenic hairy roots. Three TR-DNA genes of A.

rhizogenes i.e. aux1, ags and mas1 were screened in selected 59 hairy root lines. When

107

morphologies of the hairy roots were tested with the genes of T-DNA of pRi, the CM

represented 100% integration of mas1 and ags, and 90% of the hairy root lines were

positive in aux1 (Fig. 6.11). At the same time, aux1 gene was not found in any of the

clone of NTN (Table 8). The clones with NTK morphology were dramatically all

positive for the TR-DNA genes. Contrary to it, the NTN clones represented 0% presence

of aux1 and ags genes, and only 16.7% of them were positive in mas1 integration into

their genome. ags gene was present in all CM and NTK hairy roots, while mas1 was

present in all hairy roots types except NTN.

Figure 6.11 PCR analysis of the selected genes to confirm their integration into the

transgenic hairy roots’ genome.

First lane is the ladder (100 bp+), second lane is positive control (colony PCR for A4

agrobacteria) and third lane is for negative control (untransformed roots). The other 59

samples from 4th

well are mentioned in section 6.2.2.

6.2.9 Effect of elicitors on phytoecdysteroids production in hairy root clones

Hairy roots lines (Fig. 6.5), which exhibited highest growth rate and production of

phytoecdysteroids were selected to study the effect of elicitation i.e. MeJ (100 µM) and

Cor (1 µM). Elicitation of MeJ was found inducing a maximum phytoecdysteroid content

of 8356 µg/g DW after 14 days of elicitation in L2 hairy root clone and it was followed

by L32 which produced 8066 µg/g DW of phytoecdysteroid content (Fig. 6.12). MeJ

elicitation remained dominant over Cor elicitation and 14 days of elicitation was found

inducing higher phytoecdysteroid content as compared to 21 days of elicitation.

108

Figure 6.12 Effect of MeJ and Cor on phytoecdysteroids production in selected transgenic hairy roots lines. MeJ: Methyl jasmonate, Cor:

Coronatine

109

Hairy root lines elicited for 21 days has more growth rate/biomass than 14 days elicited

roots as compared to their respective controls. Despite of producing more mass, 21 days

elicited roots produced less phytoecdysteroid content. Growth rate was determined after

culturing the hairy root clones for one month on hormone free medium. But elicitation of

21 days induced detrimental effects on hairy roots and they started getting yellow to

brown and then dark brown and ultimately died (Fig. 6.13 a). On the average, MeJ

treated hairy roots produced more phytoecdysteroid content in 14 day elicitation (up to

6789 µg/g DW) with 1.24 times more biomass production (Fig. 6.13 b) than 21 days of

elicitation. On the contrary, elicitation of 21 days with MeJ and Cor resulted in the

production of 4577 and 4498 µg/g DW phytoecdysteroid content respectively although

their production rate was 1.58 and 1.55 as compared to control.

Figure 6.13 Effect of MeJ and Cor on (a) growth rate and (b) production rate of

phytoecdysteroids of elicited transgenic hairy root lines.

110

6.3 Conclusion

Ajuga bracteosa is a novel and rich source of phytoecdysteroids and here it is reported

for the first time for the biotechnologically enhanced production of phytoecdysteroids

both via the transformation as well as the elicitation. Regenerants obtained after the

somatic embryogenesis of transgenic hairy root cells revealed a higher phytoecdysteroid

content as compared to mother hairy root clone. It is obvious from the results that TR-

DNA genes of pRi play a significant role in the determination of the morphology of hairy

roots. Moreover, 14 days of MeJ elicitation is a significant tool to produce higher

amounts of phytoecdysteroids.

111

CHAPTER 7

7 Discussion

Though synthetic drugs have brought about a revolution in controlling diseases, almost

85-90% of the population of globe utilizes traditional herbal medicines. Plants are natural

source of medicines and hold a promise to overcome this problem. Ajuga bracteosa is

one of such medicinally significant plant species. It is a perennial herb which has been

used in ethno-medicine as astringent, anthelmintic, diuretic, antifungal, anti-

inflammatory, antibacterial and also valuable in gastrointestinal disorders. The leaves of

A. bracteosa are used as stimulant and diuretic. Whole plant is used for the treatment of

rheumatism, gout, palsy, and amenorrhea. A. bracteosa is traditionally used to treat fever

and phlegm and it is recommended in Ayurveda to treat palsy and amenorrhea. A.

bracteosa is also traditionally used in the cure of malaria and regarded as an alternate of

cinchona. A. bracteosa has also been proven to be pharmacologically active against

cancer, hypoglycemia, protozoal and microbial diseases and gastric ulcer. It also

possesses significant antiplasmodial efficacy, blood schizontocidal activity and

antiproliferative activity. This plant is effective against chronic immunological arthritis

and is a good source of phenolics, flavonoids and tannins. The mentioned properties of

this plant in ethnomedicine demand a comprehensive screening of biological activities

that are carried out with a variety of bioassays.

7.1 Flavonoid and phenolic content

Majority of the biological activities of plants are attributed to the flavonoid and phenolic

contents of that plant species. In the present study, the levels of flavonoids and phenolic

compounds were found to be higher in methanolic extract of aerial portion of plant than

in roots as reported earlier in ginger (Ghasemzadeh et al., 2010). Moreover, the solvents

of different polarity affect polyphenol content and antioxidant activity (Turkmen et al.,

2006). In folk medicines, aqueous extract of aerial parts of A. bracteosa is used generally

for the treatment of a variety of ailments. It is inferred that polar solvents (methanol) are

rich in polyphenols, which might be a reason for the potency of folk use of aqueous

extracts.

112

7.2 Antioxidant activity

Antioxidant behavior of plant extracts can be attributed to their ability to prevent chain

initiation, block nonstop hydrogen abstraction, bind to transition metal ion catalysts,

peroxides decomposition, reductive competency and radical scavenging (Diplock, 1997;

Oktay et al., 2003). Moreover, antioxidant activity measured by one method cannot show

the true antioxidant potential of any substance, because one method of quantification rely

on only one mechanism (Karadag et al., 2009). Commonly used antioxidant assays are;

DPPH assay, H2O2 quenching assay, reducing power, total antioxidant activity etc.

(Alam et al., 2013).

In the present study, the mentioned four antioxidant assays were conducted in order to

evaluate a broad range of antioxidant activity of A. bracteosa extracts. Aerial portions of

this plant extracted in methanol and chloroform was active in DPPH and H2O2 assays. As

flavonoids and phenols are cogent free radical scavengers (Ahmed et al., 2014), there

seems a strong positive correlation between DPPH free radical scavenging activity and

flavonoids and phenolic compounds of methanolic extracts of aerial parts. On the other

hand, H2O2 is a free radical that rapidly decomposes into oxygen and water. It can also

produce hydroxyl radicals that can initiate lipid peroxidation and cause DNA damage in

the body. To neutralize it, phenolic compounds donate electron to H2O2 to generate water

(Gülçin et al., 2004). It can be suggested that phenolic content found in the extract

offered electron to H2O2. The literature also suggests the polarity of the solvent as an

important parameter to extract the antioxidant compounds from a plant (Settharaksa et

al., 2012). Although the principal compounds of A. bracteosa harboring antioxidant

activity are not known, polyphenols got attention due to their antioxidant potential

especially free radical scavenging (Jan et al., 2013). Phenolic compounds are competent

source for free radical scavenging (Qian et al., 2008). Polyphenolic compounds are

extensively present in plant derived food products, and they confer additional antioxidant

attributes. Higher phenolic contents of the medicinal plants take priority over other

attributes to treat different diseases (Petti and Scully, 2009). It is considered that a

positive correlation exists between phenolic contents and free radical scavenging

(Turkmen et al., 2006). The plants containing abundant flavonoids are considered to be a

probable source of natural antioxidants (Jan et al., 2013).

113

Sometimes plants with high phenolic and flavonoid content exhibit low antioxidant

activity and vice versa. We find AbMA in DPPH and reducing power assay while AbMR

in phosphomolybdenum assay as potent extracts to scavenge free radicals. These extracts

also possess highest amounts of flavonoids and phenolic contents. But when we compare

these extracts to AbCA in H2O2 assay, it represented a drastically low IC50 value (1.5

µg/mL) and low flavonoids and phenolic contents. This indicates that the antioxidant

potential of pant extract analyte does not always dependent on total amount of

polyphenolic compounds only (Javanmardi et al., 2003).

7.3 Anticoagulant activity

Extracts of medicinal plants play their haemostatic role being anti-infective, wound

healer, and antineoplastic. Fibrin sealants start coagulation cascade when delivered to the

bleeding sites and thrombin converts fibrinogen into fibrin to solidify the whole mixture

(Scarano et al., 2013). Herbal resources offer a safe anticoagulant treatment. In this

study, methanolic extracts of A. bracteosa delayed the coagulation time up to 57

seconds. In Cameroon, 95.3% interviewed patients are reported to use Dichrocephala

intergrifolia as an effective and safe anticoagulant agent. A Turkish herbal extract

(Ankaferd Blood Stopper) is recently approved for the management of external

hemorrhage and dental surgery bleeding to reduce coagulation time effectively (Agbor et

al., 2011).

7.4 Antidepressant, analgesic and anti-inflammatory activity

Antidepressants are being used as analgesics for various pain related disorders and their

analgesic activity is well recognized (Chugh et al., 2013). Antidepressants may also

benefit the patients having depression and inflammatory pains. Fluoxetine, a standard

antidepressant drug is found to significantly decrease inflammation in carrageenan

induced rat paw oedema (Chugh et al., 2013). The anti-inflammatory activity of A.

bracteosa can be attributed to the presence of withanolides. Evaluation of ethanolic

extract (70%) of A. bracteosa is reported expressing a promising anti-inflammatory

activity probably mediated through inhibition of cholinesterase enzymes I and II (COX-1

and COX-2). Further 6-deoxyharpagide (isolate of the same extract) exhibited significant

COX-2 inhibition (Gautam et al., 2011). Moreover, withanolides isolated from A.

bracteosa bractin A, B and bractic acid displayed inhibitory potential against enzyme

114

lipoxygenase (LOX), while four of diterpenoids were found to inhibit COX enzymes in a

concentration-dependent manner (Riaz et al., 2007). Based on in vivo studies presented

in chapter 1, methanolic extract of aerial portion of A. bracteosa hence proved as an

elixir. Methanolic extracts of A. bracteosa produced significant analgesic effects which

is comparable to a previous study where acetic acid-induced writhing test and tail

immersion test of chloroform and water extracts (200 and 400 mg/kg, i.p.) showed

significant and dose-dependent analgesic effects probably mediated through opioid

receptors (Pal and Pawar, 2011b). It is suggested that the mechanism of this extract may

be linked partly to inhibition of LOX and/or COX in peripheral tissues decreasing

prostaglandin E2 synthesis and interfering with the mechanism of transduction in

primary afferent nociceptor (Pal and Pawar, 2011b). Antidepressants are also known to

possess intrinsic antinociceptive activity. Antidepressants by inhibiting the uptake of

monoamines lead to increased amount of noradrenaline and serotonin in the synaptic

cleft causing reinforcement of descending pain inhibitory pathways (Maizels and

McCarberg, 2005).

7.5 Cancer chemoprevention assays

Nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) is a protein

complex that has impact in transcription of DNA, cell differentiation, cell migration etc.

Upon activation, it may contribute to inflammation, cell proliferation, apoptosis etc.

Inhibition of NFκB signalling has potential application for the cure or prevention of

cancer. In this study, tested extracts of A. bracteosa inhibited NFκB activity up to 57.5%

with up to 125 % cell survival rate at 20 µg/mL concentration. In a previous study, NFκB

subunits p50 and p65 proteins were found in traces in RAW264.7 cells but when they

were treated with LPS (1 µg/mL) caused nuclear translocation. A pretreatment of

chloroform extract of A. bracteosa decreased p65 expression up to 50-56% (at 50 and

100 µg/mL respectively) and 42% (100 µg/mL) p50 expression (Hsieh et al., 2011). A

high NFκB inhibitory activity in AbCR extract might be the result of a decreased

expression of p50 and p65 proteins. Lipopolysaccharide stimulation induces the nitric

oxide synthase (iNOS) transcription, NO production and stimulates the proteolysis of

IκB and NFκB nuclear translocation (Xie et al., 1994). In the nitrite assay, AbCA

significantly inhibited NO production. Scientific literature regarding the inhibition of NO

production in LPS-activated RAW 264.7 cells in vitro is scarce. In a previous study,

115

pretreatment of RAW 264.7 cells with the extracts of A. bracteosa for 1 hour were

treated with LPS for one day inhibited NO production in concentration dependent

manner and found an IC50 47.2 µg/mL (Hsieh et al., 2011). AbCA displayed better results

to this report and the possible reason for this can be the difference in tissue of extraction

i.e. aerial parts rather than the whole plant.

The estrogen receptor (ERα) is implicated in the stimulation of breast cancer cell

proliferation. Estrogen induces aromatase expression without direct binding of ERα to

the aromatase promoter. Aromatase converts androgen to estrogen and provokes breast

cancer development (Cortez et al., 2010). Aromatase inhibitors have been used to treat

breast cancer and they are considered active chemopreventive agents (Lubet et al., 1994).

Among the tested extracts, AbCA represented itself as a strong aromatase inhibitor

(76%). Moreover, AbMR induced QR1 activity in cultured Hepa 1c1c7 cells with an

induction ratio of 3.0. Quinone reductase 1 (QR1) is a phase II enzyme and its induction

is thought as a biomarker for chemoprevention (Dinkova-Kostova and Talalay, 2000).

Accordingly, the plant products capable to induce QR1 can be used to slow the process

of carcinogenesis. Literature regarding QR1 activity of A. bracteosa is not available.

7.6 Cytotoxic assay

In the present study, in-vitro cytotoxic potential of A. bracteosa was assessed in brine

shrimps lethality assay. Methanolic extracts of A. bracteosa represented promising

results in cytotoxic (ED50 76.86 µg/mL) and potato disc antitumor (IC50 3.490) assays. It

is considered that crude extract having LD50 of 1000 µg/mL or less than this are

significant for cytotoxity (Meyer et al., 1982). In a previous study, methanolic extract of

A. parviflora gave 80% mortality in 1000 µg/mL dose and the LD50 value is 321.42

μg/ml (Rahman et al., 2013). Two important and main constituents (cyasterone and 8-

acetylharpagide) of another species of Ajuga, A. decumbens showed potent antitumor-

promoting activities on a mouse-skin in vivo two-stage carcinogenesis procedure

(Takasaki et al., 1999). Both of the mentioned compounds are phytoecdysteroids and are

extracted in polar solvents. In a previous study, a neoclerodane diterpenoid (ajugalide-B)

was isolated from Ajuga taiwanensis which exhibited high anti-proliferative activity

against various human cancer cell lines in SRB assay with GI50 values ranging from 3.18

to 5.94 µM (Chiou et al., 2012). A. bracteosa contain many important natural products

116

which can be responsible for these activities. Inhibition of MCF-7 and Hep-2 tumor cell

lines (IC50 value 65 and 30 μg/ml) by methanolic fraction of crude extract of A.

bracteosa is reported (Pal et al., 2014).

Methanolic extract of aerial parts of plant represented promising in vitro antioxidant and

in vivo anti-inflammatory, analgesic, antidepressant and anticoagulant properties and can

be suggested as a potent elixir. Moreover, these extracts also presented valuable cancer

chemopreventive properties and promising cytotoxicity potential. This study confirms

the traditional use of aqueous extracts of aerial portion of this plant for a wide array of

diseases. Methanolic fractions are rich source of biologically and metabolically active

compounds called phytoecdysteroids. Phytoecdysteroids also play important role in the

plant defensive mechanisms especially towards insects. Enhanced phytoecdysteroids

production can be a potential source for enhanced biological activities as well as for

better defense against insects.

7.7 Seasonal and geographical impact on the morphology of Ajuga

bracteosa

Steroids are widely used in medicines due to their pivotal disease curing role. Steroids

such as phytoecdysteroids are natural polyhydroxysteroids. They play an anabolic role in

animals, act as plant growth regulators and are toxic to insects. In insects, 20-

hydroxyecdysone (20-HE) an insect molting hormone gradually reduces feeding and

induces starvation, resulting in fat body lipolysis. Concentration of phytoecdysteroids

depends on climatic conditions, plant age and also varies during plant development.

Ajuga bracteosa is a widely distributed medicinal plant with several chemotypes. In this

study, these chemotypes were assessed on morphological basis and screened for

phytoecdysteroids distribution in different tissue types collected during different seasons

from various geographical locations of Pakistan. Large morphological variations were

observed in different chemotypes of A. bracteosa. Plants from KH habitat possessed

maximum vegetative growth which is probably due to environmental feasibility i.e.

temperature and rainfall. However, plants collected from the same altitude regardless of

their geographical location, represented similar vegetative growth pattern.

117

A. bracteosa is a non-leguminous plant, but interestingly SE ecotype possesses enormous

number of root nodules throughout the year. This suggests that it can be an actinorhizal

host, being capable of nodules formation when infected with a nitrogen-fixing

actinomycete Frankia (Obertello et al., 2004). An enormous color shift was found in

different tissue types. Stem and leaf color was green with purple or indigo tinge during

spring, light green in summer and dark green with purple to pink or indigo shade in

winter. In mature leaves, rise in carbohydrate concentration triggers plants to use surplus

amounts to produce anthocyanin. The flowers of A. bracteosa are white or white with

blue lines but NV ecotype contains blue flowers during winter. Ontogenetic color

changes in flowers are widespread throughout the angiosperms (Weiss, 1995).

Anthocyanin pigments are considered to be responsible for blue colors of various tissue

types in majority of plants (Grotewold, 2006). Anthocyanin undergoes acylation to

enhance and stabilize color intensity and can induce blue color (Yonekura-Sakakibara et

al., 2009).

7.8 Seasonal and geographical impact on phytoecdysteroid content in

different tissue types of Ajuga bracteosa

It has been suggested that developmental stage, habitat and season of the plant collection

affect the concentration of the phytoecdysteroids (Dinan, 1992a; Dinan, 1992b;

Grebenok and Adler, 1991; Israili and Lyoussi, 2009; Ramazanov, 2005). Distribution of

phytoecdysteroids has been reported and their fluctuation at different growth stages has

been scrutinized in some plant species (Boo et al., 2010; Grebenok and Adler, 1991). In

the present study, maximum amount of phytoecdysteroids was found in flowers i.e. 1868

µg/g (0.18%) followed by roots (1221 µg/g) and stem (1056 µg/g) while leaves

contained the least amount of all. Compared to the results of this study, exploration of

Pfaffia glomerata for 20-HE revealed its maximum amount in flowers (0.82%) followed

by roots (0.66%), leaves (0.60%), and stems (0.24%) (Festucci-Buselli et al., 2008b).

Flowers of A. bracteosa from KH and SA habitats displayed the highest contents of

phytoecdysteroids (3098 µg/g and 2608 µg/g respectively). Both KR and SE habitats are

located in North West of Pakistan. These locations have minimum altitude and a hilly

terrain. Although IS location is also at the same altitude, its geographical location is

different as it is situated near the hot plains of Punjab. Moreover, the ecotype of SE

contains the second highest plant height and maximum number of flowers (~70)

118

followed by that of KR which contains maximum branches. Based upon these facts, it

seems that the aerial portion of the said plants from hilly zones can be ideal for

phytoecdysteroids harvest.

Seasons contributed significantly to the phytoecdysteroid content of the plant

representing maximum amount during winter (1795 µg/g), followed with a significantly

low value in spring (1386 µg/g) and the least in summer (636 µg/g). Although the

summer season presents maximum vegetative growth of plants, probably due to

enormous rainfall at all the studied habitats, it exhibits the least amount of

phytoecdysteroids. Phytoecdysteroid content is reported to decrease during maximum

vegetative growth (Lafont et al., 2010). Highest phytoecdysteroid content was displayed

by KR habitat during winter (3620 µg/g).Varying amount of phytoecdysteroids over

seasons can be related to defense response of A. bracteosa towards low temperatures.

During spring, when average temperature is below the optimum temperature for plant

growth, phytoecdysteroids was found in moderate amount and its quantity gradually fell

during summer. However, when the low temperature stress hampered the growth of this

plant during winter, maximum quantity of phytoecdysteroids was observed which

indicates its accumulation and defense function in response to cold stress. Earlier it has

been observed that phytoecdysteroids increase in amount on mechanical damage

(Schmelz et al., 1998), which indicates their involvement in defense mechanism (Hunter,

2001). 20-HE has tissue specific functions in plants and may have ecological

significance too (Festucci-Buselli et al., 2008b). When phytophagous insects feed on the

plants with higher phytoecdysteroid content, they undergo lethal effects e.g. premature

molting, weight loss and metabolic defects (Blackford and Dinan, 1997; Soriano et al.,

2004).

Aerial portion of A. bracteosa (flower) contain maximum phytoecdysteroid content as

previously found in spinach (Grebenok and Adler, 1991). 20-HE was found distributed

in apical leaves and stems of spinach, suggesting its biosynthesis in older leaves (source)

and translocation to younger leaves (sink) (Grebenok and Adler, 1991) where it may be

accumulated (Bakrim et al., 2008). 20-HE content increases on tissue injury (Schmelz et

al., 1998), methyl jasmonate application and insect predations (Schmelz et al., 1999)

which supports 20-HE involvement in plant protection and defense (Schmelz et al.,

2002). It is a well-known fact that in defense, plants produce jasmonic acid, which

119

triggers defense responses (Howe and Jander, 2008). Jasmonic acid (JA) also induces

rise in 20-HE content, which suggests that JA pathway is involved in signaling the

damage-induced accumulation of 20-HE (Schmelz et al., 1998, 1999).

Based on the results of the experiments conducted on wild type plants, it was

hypothesized that low temperatures during winters would act as an elicitor in situ and

would be crucial in profound production of phytoecdysteroids in A. bracteosa. This

suggests that ontogeny or developmental stages could not be the only cause for increased

production of phytoecdysteroids in A. bracteosa. Concentrations of plant’s defensive

compounds could be influenced by environmental conditions (Gambarana et al., 1999).

It is widely known that plants induce the production of secondary metabolites during low

temperature as part of their defense (Janská et al., 2010). Enhancement of secondary

metabolites during low temperature season is of great physiological significance, as it

provides a tool to ascertain harvesting times based on secondary metabolite yield. The

absolute values of withanolides were higher in the stress experiment than in situ

Withania somnifera plants (Kumar et al., 2012). In an ex situ experiment, a plant is

subjected to low temperature and therefore metabolic energy is reconfigured in a

different way. Plants always tend to follow the less energy consuming path even when

encountering stress. This may or may not involve increased production of secondary

metabolites as seen during salt stress in Swertia chirata (Abrol et al., 2012). Temperature

stress is known to cause many physiological, biochemical and molecular changes in plant

metabolism and possibly alter the secondary metabolite production in plants (Levitt,

1980). In a previous report relatively high or low temperatures reduced the

photosynthetic efficiency of the leaves of St. John’s wort plants and resulted in low CO2

assimilation. Indeed, biotic and abiotic stresses exert a considerable influence on the

levels of secondary metabolites in plants (Dixon and Paiva, 1995). Temperature stress is

suggested as another factor for induction of phytoecdysteroids accumulation.

7.9 Seasonal and geographical impact on antioxidant activities in different

tissue types of Ajuga bracteosa

Highest antioxidant activities of A. bracteosa were found in the plants which were

collected during winter and highest flavonoid and phenolic contents were found in the

plants of NV. Season of collection influence the activities of plants. Antioxidant activity

120

of Propolis revealed that the quantity required to scavenge 50% of free radicals depends

on the month of collection of its samples, and samples of November collection had the

highest antioxidant capacity (Isla et al., 2009). It was found that the plants which were

collected during summer did not show good antioxidant activities except TCA assay.

These results are in accordance with another study where Citrus sinensis varieties

resulted in higher values of antioxidant activity in the samples collected in winter and

lowest in summer (Cardeñosa et al., 2015). Likewise almond varieties tested for total

phenolic compounds represented highest value in the samples collected during winter

and least in summer (Sivaci and Duman, 2014).

7.10 Development of an efficient method for Agrobacterium tumefaciens

mediated genetic transformation of A. bracteosa

Phytoecdysteroids are intrinsically present in A. bracteosa but their yield is very low in

wild-type plants and its chemical synthesis not viable. Metabolic engineering strategies

offer a promising solution for the bulk production of these natural products. However,

these strategies usually require establishment of an efficient genetic transformation

method which is not reported for A. bracteosa. Until now, no Ajuga species has been

subjected to A. tumefaciens-mediated transformation. By this study, a simple,

reproducible, cost-effective and efficient A. tumefaciens-mediated transformation of A.

bracteosa is reported for the first time. Establishing optimal tissue culture conditions was

a prerequisite for this study, achieved by investigating different media for root, shoot and

callus induction. Successful shoot induction was achieved at lower concentrations of

hormones (0.45-3.6 mg/L BA only) compared to a previous study (BA 5mg/L and IAA

2mg/L) (Kaul et al., 2013). Moreover, for root induction, half-strength MS was optimal.

Friable and embryogenic calli were achieved when MS was supplemented with BA

(0.225 mg/L) and NAA (1.48 mg/L), in contrast with the hard and non-friable calli

obtained by other authors (Jan et al., 2014) using more expensive procedures.

Transformation efficiency was found to be highly dependent on the concentration of

bacteria (OD600). Maximum induction of transformation was at 1.0 (OD4) in the three

tested explant types. It seems that at this OD, bacteria in liquid inoculation medium are

likely to be in the hypervirulent active log phase, thereby inducing maximum

transformation frequency (Yadav et al., 2012).

121

The virulence inducer acetosyringone (AS) notably increased transformation efficiency

in the three studied explant types. Above the optimum AS2 value (200µM), a slightly

higher increase in transformation was observed, but it was difficult to remove the

Agrobacterium from the explants and they eventually died. In contrast, in transformation

experiments with pea plants using the moderately virulent C58C1 strain, AS added to the

co-cultivation medium at above the optimum concentration acts as a negative control and

does not increase transformation induction (Švábová and Griga, 2008). That is why less

virulent strains are recommended for plant transformation, being easily removed with

low doses of antibiotics after co-cultivation, which avoids further stress for the plants

(Maheswaran et al., 1992). AS used in inoculation media is considered safe at

concentrations up to 200 μM (Stachel et al., 1985). In another Lamiaceae species

(Pogostemon cablin), the most efficient transformation was obtained at 150 μM AS (Paul

et al., 2012). The similar results were obtained with AS2 and AS3 are probably due to

the detrimental effects of AS at the third level.

Detrimental effects were observed when explants were submitted to an inoculation of 30

minutes and a co-cultivation of two days or more. In these conditions, explants were

difficult to rescue from the overgrowth of agrobacteria. More than 4 days of co-

cultivation is usually not recommended because of overgrowth of A. tumefaciens from

leaf tissues (De Bondt et al., 1994). Although the highest transformation rate was found

at 3 days of cocultivation (CCT), the difference was nominal, while at less than 2 days

few transformants were generated. A brief CCT can be a reason for low transformation

induction due to the scarcity of agrobacteria (Montoro et al., 2003), but, although

increasing the co-cultivation period can promote transfection, bacterial overgrowth

covering the explants may lead to tissue necrosis (Folta and Dhingra, 2006).

Nodal regions and petioles bearing meristematic regions were readily transformed, easy

to multiply and free from agrobacterial overgrowth. Meristems have been used in an A.

tumefaciens-mediated genetic transformation method for Vitis vinifera to obtain non-

chimeric transgenic plants (Dutt et al., 2007). Irrespective of this, leaf discs generally

produced calli, which usually died when cultured on selection medium. The few

surviving cells were generally considered transgenic and cultured on SIM for transgenic

plant retrieval. Based on the regeneration and viability assay, putative transgenic nodal

regions were regarded as the optimal explants for regeneration. The transformed plantlets

122

rooted successfully on half-strength MS medium, as in Vigna radiate (Yadav et al.,

2012). At moderate levels of all the tested variables, GUS expression in stomata and

intercalary regions was usually high. These results are in accordance with the only

available study on Ajuga (Uozumi et al., 1996) dealing with regenerants from A.

rhizogenes-mediated co-transformation of A. raptans hairy roots with the GUS gene. In

that study, the regenerants showed a stable GUS expression in green parts, indicating its

differential expression under a light-inducible promoter. Moreover, GUS co-transformed

hairy roots showed a higher regeneration frequency than the control untransformed roots

(Uozumi et al., 1996). This suggests a positive effect of transgene incorporation in Ajuga

species.

An efficient method for A. tumefaciens mediated genetic transformation of A. bracteosa

was developed by investigating all the persuasive factors systematically and optimal

transformation conditions were established. Based on the present study, for a simple and

efficient A. tumefaciens-mediated genetic transformation, 3-day pre-cultured nodal

regions of 60-day-old in vitro grown A. bracteosa are recommended for use as explants

for infection with 1.0 OD600. The procedure should also involve 20 min of inoculation (in

MS liquid) and 2 days of co-cultivation (on MS solid medium), adding 200 µM

acetosyringone at a media pH of 5.8. Moreover, to enable a quick screening, the explants

should be selected on a medium containing 100 mg/L kanamycin.

7.11 Agrobacterium tumefaciens mediated transformation of A. bracteosa

with rol genes to enhance phytoecdysteroids biosynthesis

The biotechnological production of secondary compounds with therapeutic properties is

currently one of the main goals of plant metabolic engineering. It has been shown in

multiple systems that the overexpression of one or more genes involved in the

biosynthesis of the target compounds or the overexpression of a master regulator may

dramatically improve production. Expression of rol genes in plants alters several

developmental processes and affects their architecture by altering principally the plant

hormone metabolism (Casanova et al., 2005). To study the effect of rol genes on the

phytoecdysteroids biosynthesis in A. bracteosa, the optimized conditions of A.

tumefaciens mediated transformation were followed to generate intact transgenic plants

through A. tumefaciens strain GV3101 harboring pPCV002-ABC. The rol genes resulted

123

in the production of transgenic A. bracteosa plants with altered plant architecture.

Resultant transgenic lines were abnormally dwarfed with a bushy appearance and their

leaves were curled and wrinkled. The rol genes alters several developmental processes

and affects plant architecture by altering principally the plant hormone metabolism

(Casanova et al., 2005). Transgenic plants were screened for the presence of

phytoecdysteroids and 20-HE, MKA, CYP and AJL were successfully detected in the

transgenic plants. Transgenic line ABC-3 and ABC-4 produced 6728 µg/g and 6759 µg/g

dry weight of total phytoecdysteroid content respectively which are 14.5 times higher as

compared to control untransformed in vitro grown plants.

7.12 Agrobacterium rhizogenes mediated transformation of A. bracteosa to

enhance phytoecdysteroids biosynthesis

Hairy roots are a valuable biotechnological tool for the production of plant secondary

metabolites due to high productivity and stability of growth (Pistelli et al., 2010).

Transgenic hairy roots from A. bracteosa were obtained by the infection of

Agrobacterium rhizogenes strains A4, LBA-9402 and ARqua1. The selectively

established 59 hairy root lines increased growth up to 6.6 times (L42) in one month of in

vitro culturing and produced phytoecdysteroid content from 69.3 to 4449 µg/g (L3 and

A2 respectively) as compared to control in vitro grown untransformed roots. In a

previous study, A. reptans was infected by MAFF 03-01724 strain of A. rhizogenes and

among many hairy root lines, Ar-4 (the elite hairy root clone) represented 4 times higher

phytoecdysteroid content compared to control roots (Matsumoto and Tanaka, 1991).

Another species of Ajuga, A. multiflora, when infected with A. rhizogenes strain A4,

resulted in a number of hairy root line. An efficient hairy root clone produced 10 times

more 20-HE as compared to wild type (Kim et al., 2005a).

20-HE content of hairy roots increased up to 1.142 times as compared to control roots

but intact transgenic plants containing T-DNA of pPCV002-ABC represented 5.6 times

more phytoecdysteroid content as compared to untransformed plants. When biosynthetic

rate of phytoecdysteroids in intact transgenic plants and hairy roots was compared, it was

found that intact plants represent a clearly high production of said compounds. Highest

effect of transformation was found on AJL content. Hairy roots represented 7.1 while

124

intact pPCV002-ABC transgenic plants revealed 11. 0 times increase in AJL contents

when compared to control roots and control plants, respectively.

Hairy roots hold the ability to regenerate whole plants (Tepfer, 1984). Regenerants were

obtained from the somatic embryogenesis of the transgenic cells of hairy roots. These

regenerants (intact transgenic plant) were drastically different in phenotype from the wild

type plants, untransformed in vitro grown plants and pPCV002-ABC transformed plants.

They were characterized by a huge number of smaller and thin leaves and extensive

plageotropic roots. Regenerants obtained from A. reptans had different morphology than

control plants (Tanaka and Matsumoto, 1993a). In a previous study, regenerants obtained

from the hairy roots of A. reptans represented dwarf phenotype with an increase in leaf

size, leaf number and root mass (Tanaka and Matsumoto, 1993b). The rolC transformed

carnation plants induced ≤48% more stem cuttings per mother plant and improved dense

rooting as compared to untransformed plants (Zuker et al., 2001).

It is evident from the results that intact transgenic plants harbor more phytoecdysteroid

content than transgenic hairy roots. So based on these result, it can be speculated that T-

DNA of pPCV002-ABC is a stronger inducer of phytoecdysteroids than that of pRi.

However, it is reported that during spinach ontogeny 20-HE was transported to the apical

regions, annuals concentrate ecdysteroids in apical regions of the plant and perennials

recycle phytoecdysteroids between their deciduous (leaves) and perennial organs (roots)

(Adler and Grebenok, 1995). Another study confirms that phytoecdysteroids are

biosynthesized in roots of herbaceous perennials (Zibareva, 1997). Moreover,

phytoecdysteroids are found to accumulate in aerial organs of plants e.g., flowers, leaves,

stems, and fruit (Ramazanov, 2005). Based on these evidences, it is assumed that

phytoecdysteroids are synthesized in hairy roots of A. bracteosa and they are transported

to the aerial portions. This idea was supported by the regenerants (intact plants obtained

from somatic embryogenesis of hairy root cells) which represented more

phytoecdysteroid content (up to 5.3 times) than corresponding mother hairy root lines

(up to 1.64 times) and untransformed roots. Based on the study, it can be concluded that

aerial portion of A. bracteosa especially leaves are a possible sink of phytoecdysteroids.

Experiment conducted by Adler and Grebenok (1995) on spinach revealed that during its

development, 20-HE was transported to the apical parts of plant. It is an established fact

that phytoecdysteroids are synthesized in roots and accumulated in the aerial parts of A.

125

bracteosa. However, higher content of phytoecdysteroids was observed in regenerants

than corresponding mother hairy root clones: the reason for this remained unanswered.

This can be explained on the basis of previous reports where ecdysteroids were found to

suppresses their own biosynthesis through negative feedback inhibition in insects

(Beydon and Lafont, 1983; Bodnaryk, 1986). The same is assumed for plants, and it is

speculated that the phytoecdysteroids are synthesized in roots (up to a certain amount)

and due to unavailability of a suitable sink (leaves), their biosynthesis stops. It is inferred

from the previous studies that in hydroponically grown plants, wound induced

accumulation of 20-HE in roots may confer enhanced resistance against subterranean

herbivorous insects (Schmelz et al., 1998) and this can be the result of its de novo

biosynthesis in roots (Schmelz et al., 1999). Aerial portions of perennial plants are more

prone to insect attack. So, to confer resistance, phytoecdysteroids are required in higher

amount in the aerial portions.

This idea was further supported by the fact that sengosterone (SG) was neither detected

in untransformed plants nor in untransformed roots or even not in transgenic intact plants

of pPCV002-ABC (especially transgenic line 3 and 4). But in some transgenic hairy root

lines (with high phytoecdysteroid profile) SG was detected. This does not mean that all

the phytoecdysteroids are synthesized in roots, as clarified already by radiolabeled

carbon feed experiments (Grebenok and Adler, 1991). It is assumed that SG content was

below the detection limit in untransformed material. At the same time, its absence in

pPCV002-ABC transgenic line 3 and 4, and its presence in only some of transgenic hairy

roots and regenerants showed that it might be de novo biosynthesized only in roots. This

hypothesis is further supported by a previous study where tissue cultured roots of A.

reptans produced phytoecdysteroids independent of shoots. However, phytoecdysteroids

were not detected in the shoots cultured in the absence of roots (Tomás et al., 1993).

7.13 Phytoecdysteroids’ biosynthesis is affected by hairy root phenotypes

and TR-DNA genes of pRi

We found hairy roots with four different morphologies: typical hairy root morphology

(THR) (59%), callus like morphology (CM) (17%), normal typical hairy root with thick

morphology (NTK) (14%) and normal typical hairy root with thin morphology (NTN)

(10%). Growth rate of the transgenic hairy root lines varied according to their

126

morphologies and highest growth rate was found in CM (3.93 times -month

). However,

THR were found to possess highest phytoecdysteroid content (1538.5 µg/g).The possible

reason for this decrease in phytoecdysteroids in CM roots can be the loss of organized

tissue. In the same way, Mallol and coworkers found that CM and THR morphology of

the transgenic hairy roots of Panax ginseng produced ginsenosides (almost same)

significantly higher to roots with thin morphology (Mallol et al., 2001).

A comparison of hairy root morphology with the genes of TR-DNA of pRi represented

100% presence of rolC, mas1 and ags, and 90% for aux1 in CM. The clones with NTK

morphology were dramatically all positive for the TL- and TR-DNA genes. Contrary to

it, the NTN clones represented 0% presence of aux1 and ags genes, and only 16.7% for

mas1 gene. ags gene was present in all CM and NTK hairy roots, while mas1 was

present in all hairy roots types except NTN. The ags gene is involved in agropine

biosynthesis while in aux1 is considered playing an additional role for indole acetic acid

in transgenic material (Nilsson and Olsson, 1997). mas1 gene specify a protein involved

in manopine biosynthesis (Bouchez and Tourneur, 1991). Role of aux1 gene (to provide

the transgenic cells with additional source of auxins) is also reflected in previous studies

(Morris, 1986). These findings are in accordance with the previous reports (Palazón et

al., 1995) in which the provision of synthetic auxins (2,4-D) enhance callus biomass and

reduce alkaloids production. It is argued that the overproduction of auxins can drive the

disorganization in the transgenic hairy root lines (Jung et al., 1995). Robins (1998)

reported a complete loss of nicotine in the root clones of Nicotiana rustica treated with

synthetic auxins. In another study, CM from three different plant species represented

100% insertion of aux1 gene (Moyano et al., 1999). Less incorporation of TR-DNA into

transgenic hairy roots genome can be due to its incomplete integration events (Gaudin et

al., 1994). In a previous study, a constitutive A. tumefaciens strain carrying pRiA4TR-

(aux genes deleted) produced transgenic hairy roots exactly same in the morphology (no

callogenesis) and production of alkaloids to the transgenic roots obtained with A4

(Moyano et al., 1999).

7.14 Effect of elicitors on phytoecdysteroids production in hairy root clones

Eleven hairy root lines displaying high growth rate and phytoecdysteroid content were

elicited with methyl jasmonate (MeJ) and coronatine (Cor). MeJ doubled the

127

phytoecdysteroid content in 14 days elicitation (8356 µg/g in L2) as compared to

unelicited control hairy roots and 5.6 times to control in vitro grown untransformed

roots. Phytoecdysteroid are biosynthesized through mevalonate pathway. In a previous

study, it was found that radiolabeled mevalonate (14C-MVA) was incorporated 2-3.5%

into 20-HE in 24 hours of spinach cultures (Bakrim et al., 2008). The key enzyme, 3-

hydroxy-3-methylglutaryl coenzyme A reductase (HMGR-CoA reductase) irreversibly

convert HMG-CoA to MVA and is considered to be the rate limiting factor in this

pathway (Chappell, 1995). Higher phytoecdysteroid content found in the elicited hairy

root clones can be a result of high expression of HMGR. Recently, an elicitor-responsive

gene involved in 20-hydroxyecdysone production, 3-hydroxy-3-methylglutaryl

coenzyme A reductase (HMGR) was cloned in Cyanotis arachnoidea. Consequently

more biosynthesis of 20-HE in MeJ treated cells and a corresponding high expression of

HMGR appeared suggesting that 20-HE biosynthesis may be the result of the expression

up-regulation of CaHMGR (Wang et al., 2014a). HMGR provides mevalonate for the

biosynthesis of 20-HE and other secondary metabolites. In another study, an elicitation

of 0.6 mM MeJ for 6 days to Achyranthes bidentata cells was found to produced 2.6

times more 20-HE (Wang et al., 2013). Plasticity or tolerance of plants to different

chemicals varies in different species. Treatment of spinach with methyl jasmonate (MJ)

induced 78% and 61% more 20-hydroxyecdysone concentration in roots and shoots

respectively and it did not affect plant growth (Soriano et al., 2004).

The behavior of the transgenic hairy root clones to produce more phytoecdysteroids in 14

days and a reduction in this content in 21 days is in accordance with the experiments

performed by Mangas and coworkers. They studied MeJ treatment for two weeks and

found an increased production of sterols and which gradually reduced during third and

fourth week in Centella asiatica, and Galphimia glauca (Mangas et al., 2006). Longer

period of elicitation and/or higher concentration of elicitors can be a reason for this

decrease in phytoecdysteroids production. In another species of Ajuga, it is reported that

20-HE content increased 3 fold when cell suspension culture of A. turkestanica was

treated with 125 µM MeJ and it dramatically decreased when supplemented with 250

µM MeJ as compared to control/untreated cultures (Cheng et al., 2008).

128

7.15 Conclusion

Ajuga bracteosa is an endangered medicinal herb, which contains several natural

products of therapeutic importance. Methanolic extract of aerial parts of plant

represented promising in vitro antioxidant and in vivo anti-inflammatory, analgesic,

antidepressant and anticoagulant properties and can be suggested as a potent elixir.

Moreover, these extracts also presented valuable cancer chemopreventive properties and

high cell survival rate in cytotoxicity assays.

Geography and habitat play a crucial role in the metabolism and morphology of a plant.

Large morphological variations in various ecotypes of A. bracteosa were found, however

plants from the same altitude, represented similar morphology. SA ecotype, flower tissue

type and winter season produced highest phytoecdysteroid content i.e. 1967 µg/g, 1868

µg/g and 1795 µg/g. Plants collected in winter season displayed significantly high

antioxidant activities and phenolic content in leaf tissue type On the basis of these

results, it is hypothesized that chilling cold hampers vegetative growth and triggers stress

induced PEs accumulation, high phenolic content and more antioxidant capacity as a

defense response.

Yield of phytoecdysteroids is very low in wild A. bracteosa plants, and their chemical

synthesis is not viable. Metabolic engineering strategies offers a solution in the form of

bulk production of secondary metabolites but require the establishment of an efficient

genetic transformation method, Therefore Agrobacterium tumefaciens strain C58C1

harboring the binary plasmid p35SGUSINT with GUS as the reporter gene and the NTPII

gene as the selectable marker was employed for optimal transformation conditions. We

established that nodal explants of A. bracteosa precultured for 3 days, inoculated with a

culture of A. tumefaciens with an OD of 1.0 for 20 minutes and co-cultivated for 2 days

in MS medium with 200 µM acetosyringone at media pH 5.8 showed 100%

transformation induction. Already optimized protocol was employed to raise transformed

A. bracteosa plants through A. tumefaciens strain GV3101 harboring pPCV002-ABC.

Resultant transformed intact plants presented altered plant architecture and a significant

increase of phytoecdysteroids i.e. line 3 and 4 produced 6728 and 6759 µg/g of total

phytoecdysteroids respectively, which is 14.5 times higher as compared to control plants.

129

Further transformation experiments with A. rhizogenes strains LBA-9402, A4 and

ARqua1 produced 59 hairy root lines and it was found that actively growing hairy root

lines also exhibit a high ecdysteroids’ profile. Hairy root lines A4-2 and 9402-01

represented highest phytoecdysteroid content i.e. 4449 and 4123µg/g dry weight

respectively. Somatic embryogenesis of transgenic hairy root cells generated whole

plants (regenerants) which were substantially different in every morphological aspect to

untransformed and pPCV002-ABC transformed plants. Regenerants expressed more

phytoecdysteroid content than the mother hairy root lines suggesting the presence of a

possible sink (leaves). Majority of hairy roots displayed THR morphology while CM,

NTK and NTN phenotypes were also seen. Growth rate of the transgenic hairy root lines

varied according to their morphologies and highest growth rate was found in CM (3.93

times / month). However, THR were found to possess highest phytoecdysteroid content

(1538.5 µg/g dry weight). A comparison of hairy root morphology with the genes of TR-

DNA of pRi showed that the phenotype of hairy roots are determined by TR-DNA genes

i.e. mas1, ags, and aux1. Eleven hairy root lines displaying high growth rate and

phytoecdysteroid content were elicited with methyl jasmonate (MeJ) and coronatine

(Cor). MeJ doubled the phytoecdysteroid content in 14 days elicitation (8356 µg/g in L2)

as compared to unelicited control hairy roots and 5.6 times to control in vitro grown

untransformed roots.

7.16 Future Work

Ecdysteroids biosynthesis is poorly discussed in many plant species and the discussion

remained restricted to the radiolabeled precursors and substrates. On the other hand, all

the key steps in their pathway are precisely discussed in insects. The detailed information

regarding biosynthesis of phytoecdysteroids and key steps in the biosynthetic pathway is

missing. Many key steps including the conversion of lathosterol to 20-HE are assumed

from the previous studies and summarized in Figure 1.2. There is a strong need to dig in

biosynthetic pathway of phytoecdysteroids for the targeted metabolic engineering to

harvest maximum of their contents.

130

8 References

Abel, E. L., Bilitzke, P., 1990. A possible alarm substance in the forced swimming test.

Physiol. Behav. 48, 233-239.

Abrol, E., Vyas, D., Koul, S., 2012. Metabolic shift from secondary metabolite

production to induction of anti-oxidative enzymes during NaCl stress in Swertia chirata

Buch.-Ham. Acta Physiol. Plant. 34, 541-546.

Adeyemi, O., Okpo, S., Ogunti, O., 2002. Analgesic and anti-inflammatory effects of the

aqueous extract of leaves of Persea americana Mill (Lauraceae). Fitoterapia 73, 375-

380.

Adler, J. H., Grebenok, R. J., 1995. Biosynthesis and distribution of insect-molting

hormones in plants-a review. Lipids 30, 257-262.

Adler, J. H., Grebenok, R. J., 1999. Occurrence, biosynthesis, and putative role of

ecdysteroids in plants. Crit. Rev. Biochem. Mol. Biol. 34, 253-264.

Agbor, A. M., Naidoo, S., Mbia, A. M., 2011. The role of traditional healers in tooth

extractions in Lekie Division, Cameroon. J. Ethnobiol. Ethnomed. 7, 1-8.

Ahmad, M. S., Hussain, M., Hanif, M., Ali, S., Qayyum, M., Mirza, B., 2008. Di- and

triorganotin(IV) esters of 3,4-methylenedioxyphenylpropenoic acid: synthesis,

spectroscopic characterization and biological screening for antimicrobial, cytotoxic and

antitumor activities. Chem. Biol. Drug Des. 71, 568-576.

Ahmad, V., Khaliq-Uz-Zaman, S., Ali, M., Perveen, S., Ahmed, W., 1996. An

antimicrobial ecdysone from Asparagus dumosus. Fitoterapia 67, 88-91.

Ahmed, D., Chaudhary, M. A., 2009. Medicinal and nutritional aspects of various trace

metals determined in Ajuga bracteosa. J. Appl. Sci. Res. 5, 864-869.

Ahmed, D., Fatima, K., Saeed, R., 2014. Analysis of phenolic and flavonoid contents,

and the anti-oxidative potential and lipid peroxidation inhibitory activity of methanolic

extract of Carissa opaca roots and its fractions in different solvents. Antioxidants 3, 671-

683.

Akhtar, N., Ihsan ul, H., Mirza, B., 2015. Phytochemical analysis and comprehensive

evaluation of antimicrobial and antioxidant properties of 61 medicinal plant species.

Arabian J. Chem.

Al-Musayeib, N. M., Mothana, R. A., Matheeussen, A., Cos, P., Maes, L., 2012. In vitro

antiplasmodial, antileishmanial and antitrypanosomal activities of selected medicinal

plants used in the traditional Arabian Peninsular region. BMC Complement. Altern.

Med. 12, 49.

Alam, M. N., Bristi, N. J., Rafiquzzaman, M., 2013. Review on in vivo and in vitro

methods evaluation of antioxidant activity. Saudi Pharm. J. 21, 143-152.

131

Aly, R., Ravid, U., Abu‐Nassar, J., Botnick, I., Lebedev, G., Gal, S., Ziadna, H.,

Achdari, G., Smirov, E., Meir, A., 2011. Biological activity of natural phytoecdysteroids

from Ajuga iva against the sweetpotato whitefly Bemisia tabaci and the persea mite

Oligonychus perseae. Pest Manage. Sci. 67, 1493-1498.

Amari, N. O., Bouzouina, M., Berkani, A., Lotmani, B., 2014. Phytochemical screening

and antioxidant capacity of the aerial parts of Thymelaea hirsuta L. Asian Pac. J. Trop.

Dis. 4, 104-109.

Arshad, W., Ihsan-ul-Haq, Waheed, M. T., Mysore, K. S., Mirza, B., 2014.

Agrobacterium-mediated transformation of tomato with rolB gene results in

enhancement of fruit quality and foliar resistance against fungal pathogens. PLoS ONE

9, e96979.

Baker, C. J., Orlandi, E. W., 1995. Active oxygen in plant pathogenesis. Annu. Rev.

Phytopathol. 33, 299-321.

Bakrim, A., Maria, A., Sayah, F., Lafont, R., Takvorian, N., 2008. Ecdysteroids in

spinach (Spinacia oleracea L.): Biosynthesis, transport and regulation of levels. Plant

Physiol. Biochem. 46, 844-854.

Barkatullah, Ibrar, M., Hussain, F., 2009. Ethnobotanical studies of plants of Charkotli

hills, Batkhela district, Malakand, Pakistan. Front. Biol. Chin. 4, 539-548.

Barkatullah, Ibrar, M., Rauf, A., Hadda, T. B., Mubarak, M. S., Patel, S., 2015.

Quantitative ethnobotanical survey of medicinal flora thriving in Malkand Pass Hills,

Khyber PakhtunKhwa, Pakistan. J. Ethnopharmacol. 169, 335-346.

Benzie, I. F., 2003. Evolution of dietary antioxidants. Comp. Biochem. Physiol. A: Mol.

Integr. Physiol. 136, 113-126.

Beydon, P., Lafont, R., 1983. Feedback inhibition of ecdysone production by 20-

hydroxyecdysone in Pieris brassicae pupae. J. Insect Physiol. 29, 529-533.

Bhadra, R., Vani, S., Shanks, J. V., 1993. Production of indole alkaloids by selected

hairy root lines of Catharanthus roseus. Biotechnol. Bioeng. 41, 581-592.

Binns, A. N., Thomashow, M. F., 1988. Cell Biology of Agrobacterium Infection and

Transformation of Plants. Annu. Rev. Microbiol. 42, 575-606.

Blackford, M. J., Dinan, L., 1997. The effects of ingested 20-hydroxyecdysone on the

larvae of Aglais urticae, Inachis io, Cynthia cardui (Lepidoptera: Nymphalidae) and

Tyria jacobaeae (Lepidoptera: Arctiidae). J. Insect Physiol. 43, 315-327.

Bodnaryk, R. P., 1986. Feedback inhibition of ecdysone production by 20‐hydroxyecdysone during pupal—adult metamorphosis of Mamestra configurata Wlk.

Arch. Insect Biochem. Physiol. 3, 53-60.

132

Bonhomme, V., Laurain-Mattar, D., Fliniaux, M., 2000. Effects of the rolC gene on

hairy root: Induction development and tropane alkaloid production by Atropa

belladonna. J. Nat. Prod. 63, 1249-1252.

Boo, K. H., Lee, D., Jeon, G. L., Ko, S. H., Cho, S. K., Kim, J. H., Park, S. P., Hong, Q.,

Lee, S.-H., Lee, D.-S., Riu, K. Z., 2010. Distribution and Biosynthesis of 20-

Hydroxyecdysone in Plants of Achyranthes japonica Nakai. Biosci., Biotechnol.,

Biochem. 74, 2226-2231.

Boo, K. H., Lee, D., Van Nguyen, Q., Jin, S. B., Kang, S., Viet, C. D., Park, S. P., Lee,

D.-S., Riu, K. Z., 2013. Fluctuation of 20-hydroxyecdysone in individual organs of

Achyranthes japonica during reproductive growth stage and its accumulation into seed. J.

Korean Soc. Appl. Biol. Chem. 56, 335-338.

Bouchez, D., Tourneur, J., 1991. Organization of the agropine synthesis region of the T-

DNA of the Ri plasmid from Agrobacterium rhizogenes. Plasmid 25, 27-39.

Browning, C., Martin, E., Loch, C., Wurtz, J.-M., Moras, D., Stote, R. H., Dejaegere, A.

P., Billas, I. M., 2007. Critical role of desolvation in the binding of 20-hydroxyecdysone

to the ecdysone receptor. J. Biol. Chem. 282, 32924-32934.

Buettner, G. R., 1993. The pecking order of free radicals and antioxidants: lipid

peroxidation, α-tocopherol, and ascorbate. Arch. Biochem. Biophys. 300, 535-543.

Bulgakov, V., Tchernoded, G., Mischenko, N., Khodakovskaya, M., Glazunov, V.,

Radchenko, S., Zvereva, E., Fedoreyev, S., Zhuravlev, Y. N., 2002. Effect of salicylic

acid, methyl jasmonate, ethephon and cantharidin on anthraquinone production by Rubia

cordifolia callus cultures transformed with the rolB and rolC genes. J. Biotechnol. 97,

213-221.

Bulgakov, V., Tchernoded, G., Mischenko, N., Shkryl, Y. N., Fedoreyev, S., Zhuravlev,

Y. N., 2004. The rolB and rolC genes activate synthesis of anthraquinones in Rubia

cordifolia cells by mechanism independent of octadecanoid signaling pathway. Plant Sci.

166, 1069-1075.

Bulgakov, V. P., 2008. Functions of rol genes in plant secondary metabolism.

Biotechnol. Adv. 26, 318-324.

Bulgakov, V. P., Inyushkina, Y. V., Gorpenchenko, T. Y., Koren, O. G., Shkryl, Y. N.,

Zhuravlev, Y. N., 2009. Emerging Roles of Agrobacterial Plant-Transforming

Oncogenes in Plant Defense Reactions. IAENG Transactions on Engineering

Technologies Volume I: Special Edition of the International MultiConference of

Engineers and Computer Scientists 2008, vol. 1089. AIP Publishing, pp. 94-103.

Bulgakov, V. P., Khodakovskaya, M. V., Labetskaya, N. V., Chernoded, G. K.,

Zhuravlev, Y. N., 1998. The impact of plant rolC oncogene on ginsenoside production

by ginseng hairy root cultures. Phytochemistry 49, 1929-1934.

133

Bundock, P., den Dulk-Ras, A., Beijersbergen, A., Hooykaas, P. J., 1995. Trans-kingdom

T-DNA transfer from Agrobacterium tumefaciens to Saccharomyces cerevisiae. EMBO

J. 14, 3206-3214.

Butenandt, A., Karlson, P., 1954. Über die isolierung eines metamorphose-hormons der

insekten in kristallisierter form. Zeitschrift für Naturforschung B 9, 389-391.

Can, A., Dao, D. T., Arad, M., Terrillion, C. E., Piantadosi, S. C., Gould, T. D., 2012.

The mouse forced swim test. J. Vis. Exp., 1-5.

Canals, D., Irurre-Santilari, J., Casas, J., 2005. The first cytochrome P450 in ferns.

Evidence for its involvement in phytoecdysteroid biosynthesis in Polypodium vulgare.

FEBS J. 272, 4817-4825.

Cardarelli, M., Mariotti, D., Pomponi, M., Spano, L., Capone, I., Costantino, P., 1987.

Agrobacterium rhizogenes T-DNA genes capable of inducing hairy root phenotype. Mol.

Gen. Genet. 209, 475-480.

Cardeñosa, V., Barreira, J., Barros, L., Arenas-Arenas, F. J., Moreno-Rojas, J. M.,

Ferreira, I. C., 2015. Variety and harvesting season effects on antioxidant activity and

vitamins content of Citrus sinensis Macfad. Molecules 20, 8287-8302.

Casanova, E., Trillas, M. I., Moysset, L., Vainstein, A., 2005. Influence of rol genes in

floriculture. Biotechnol. Adv. 23, 3-39.

Castagné, V., Porsolt, R. D., Moser, P., 2009. Use of latency to immobility improves

detection of antidepressant-like activity in the behavioral despair test in the mouse. Eur.

J. Pharmacol. 616, 128-133.

Castro, A., Coll, J., Arfan, M., 2011. neo-Clerodane diterpenoids from Ajuga bracteosa.

J. Nat. Prod. 74, 1036-1041.

Castro, A., Coll, J., Tandrón, Y. A., Pant, A. K., Mathela, C. S., 2008. Phytoecdysteroids

from Ajuga macrosperma var. breviflora roots. J. Nat. Prod. 71, 1294-1296.

Catalán, R., Aragones, M., Godoy, J., Martinez, A., 1984. Ecdysterone induces

acetylcholinesterase in mammalian brain. Comp. Biochem. Physiol. C. 78, 193-195.

Chan, M.-T., Chang, H.-H., Ho, S.-L., Tong, W.-F., Yu, S.-M., 1993. Agrobacterium-

mediated production of transgenic rice plants expressing a chimeric α-amylase

promoter/β-glucuronidase gene. Plant Mol. Biol. 22, 491-506.

Chandel, S., Bagai, U., 2011. Screening of antiplasmodial efficacy of Ajuga bracteosa

Wall ex. Benth. Parasitol. Res. 108, 801-805.

Chang, C. C., Yang, M. H., Wen, H. M., Chern, J. C., 2002. Estimation of total flavonoid

content in Propolis by two complementary colorimetric methods. J. Food Drug Anal. 10,

178-182.

134

Chappell, J., 1995. The biochemistry and molecular biology of isoprenoid metabolism.

Plant Physiol. 107, 1-6.

Chaudhary, K., Lupien, P., Hinse, C., 1969. Effect of ecdysone on glutamic

decarboxylase in rat brain. Experientia 25, 250-251.

Chaudière, J., Ferrari-Iliou, R., 1999. Intracellular antioxidants: from chemical to

biochemical mechanisms. Food Chem. Toxicol. 37, 949-962.

Chauhan, N. S., 1999. Medicinal and aromatic plants of Himachal Pradesh. Indus

Publishing.

Chaves, D. S. A., Costa, S. S., Almeida, A. P., Frattani, F., Assafim, M., Zingali, R. B.,

2010. Secondary metabolites from vegetal origin: a potential source of antithrombotic

drugs. Quim. Nova 33, 172-180.

Chávez, V. M., Marqués, G., Delbecque, J. P., Kobayashi, K., Hollingsworth, M., Burr,

J., Natzle, J. E., O'Connor, M. B., 2000. The Drosophila disembodied gene controls late

embryonic morphogenesis and codes for a cytochrome P450 enzyme that regulates

embryonic ecdysone levels. Development 127, 4115-4126.

Chen, Q., Xia, Y., Qiu, Z., 2006. Effect of ecdysterone on glucose metabolism in vitro.

Life Sci. 78, 1108-1113.

Cheng, D. M., Kutzler, L. W., Boler, D. D., Drnevich, J., Killefer, J., Lila, M. A., 2013.

Continuous infusion of 20-hydroxyecdysone increased mass of Triceps Brachii in

C57BL/6 mice. Phytother. Res. 27, 107-111.

Cheng, D. M., Yousef, G. G., Grace, M. H., Rogers, R. B., Gorelick-Feldman, J., Raskin,

I., Lila, M. A., 2008. In vitro production of metabolism-enhancing phytoecdysteroids

from Ajuga turkestanica. Plant Cell Tiss. Org. Cult. 93, 73-83.

Cheng, D. M., Yousef, G. G., Lila, M. A., 2010. Variation in phytoecdysteroid

accumulation in seeds and shoots of Spinacia oleracea L. accessions. HortScience 45,

1634-1638.

Chilton, M.-D., Drummond, M. H., Merlo, D. J., Sciaky, D., Montoya, A. L., Gordon, M.

P., Nester, E. W., 1977. Stable incorporation of plasmid DNA into higher plant cells: the

molecular basis of crown gall tumorigenesis. Cell 11, 263-271.

Chilton, M. D., Tepfer, D. A., Petit, A., David, C., Cassedelbart, F., Tempe, J., 1982.

Agrobacterium rhizogenes inserts T-DNA into the genomes of the host plant root cells.

Nature 295, 432-434.

Chiou, C.-T., Kuo, Y.-H., Chan, Y.-Y., Juang, S.-H., Chan, H.-H., Wu, T.-S., 2012.

Ajugalide-B (ATMA) is an anoikis-inducing agent from Ajuga taiwanensis with

antiproliferative activity against tumor cells in vitro. Phytochemistry 80, 64-69.

135

Choi, P., Kim, Y., Choi, K., Chung, H., Choi, D., Liu, J., 2004. Plant regeneration from

hairy-root cultures transformed by infection with Agrobacterium rhizogenes in

Catharanthus roseus. Plant Cell Rep. 22, 828-831.

Chopra, R. N., Nayar, S., 1956. Glossary of Indian Medicinal Plants. Council of

scientific and Industrial research, New Delhi.

Chriqui, D., Guivarc'h, A., Dewitte, W., Prinsen, E., van Onkelen, H., 1996. Rol genes

and root initiation and development. Plant Soil 187, 47-55.

Christey, M. C., 2001. Invited review: Use of Ri-mediated transformation for production

of transgenic plants. In Vitro Cell. Dev. Biol. Plant 37, 687-700.

Christiaens, O., Iga, M., Velarde, R., Rougé, P., Smagghe, G., 2010. Halloween genes

and nuclear receptors in ecdysteroid biosynthesis and signalling in the pea aphid. Insect

Mol. Biol. 19, 187-200.

Chugh, P. K., Kalra, B. S., Kaushik, N., Tekur, U., 2013. Evaluation of anti-

inflammatory activity, effect on blood pressure and gastric tolerability of antidepressants.

Indian J. Med. Res. 138, 99-103.

Coll, J., Tandrón, Y. A., 2008. neo-Clerodane diterpenoids from Ajuga: structural

elucidation and biological activity. Phytochem. Rev. 7, 25-49.

Cortez, V., Mann, M., Brann, D. W., Vadlamudi, R. K., 2010. Extranuclear signaling by

estrogen: role in breast cancer progression and metastasis. Minerva Ginecol. 62, 573-

583.

David, C., Chilton, M.-D., Tempé, J., 1984. Conservation of T-DNA in plants

regenerated from hairy root cultures. Nat. Biotechnol. 2, 73-76.

De Bondt, A., Eggermont, K., Druart, P., De Vil, M., Goderis, I., Vanderleyden, J.,

Broekaert, W. F., 1994. Agrobacterium-mediated transformation of apple (Malus x

domestica Borkh.): an assessment of factors affecting gene transfer efficiency during

early transformation steps. Plant Cell Rep. 13, 587-593.

Dehio, C., Grossmann, K., Schell, J., Schmülling, T., 1993. Phenotype and hormonal

status of transgenic tobacco plants overexpressing the rolA gene of Agrobacterium

rhizogenes T-DNA. Plant Mol. Biol. 23, 1199-1210.

Detke, M. J., Lucki, I., 1995. Detection of serotonergic and noradrenergic

antidepressants in the rat forced swimming test: the effects of water depth. Behav. Brain

Res. 73, 43-46.

Dinan, L., 1992a. The analysis of phytoecdysteroids in single (preflowering stage)

specimens of fat hen, Chenopodium album. Phytochem. Anal. 3, 132-138.

Dinan, L., 1992b. The association of phytoecdysteroids with flowering in fat hen,

Chenopodium album, and other members of the Chenopodiaceae. Experientia 48, 305-

308.

136

Dinan, L., 1995a. Distribution and levels of phytoecdysteroids within individual plants of

species of the Chenopodiaceae. Eur. J. Entomol. 92, 295-295.

Dinan, L., 1995b. A strategy for the identification of ecdysteroid receptor agonists and

antagonists from plants. Eur. J. Entomol. 92, 271-283.

Dinan, L., 2001. Phytoecdysteroids: biological aspects. Phytochemistry 57, 325-339.

Dinan, L., Harmatha, J., Volodin, V., Lafont, R., 2009. Phytoecdysteroids: diversity,

biosynthesis and distribution. Ecdysone: Structures and Functions. Springer, pp. 3-45.

Dinan, L., Lafont, R., 2007. Compilation of the literature reports for the screening of

vascular plants, algae, fungi and non-arthropod invertebrates for the presence of

ecdysteroids. Ecdybase, Cybersales, Prague, online http://ecdybase.org.

Dinan, L., Savchenko, T., Whiting, P., 2001. On the distribution of phytoecdysteroids in

plants. CMLS Cell Mol. Life Sci. 58, 1121-1132.

Dinan, L., Savchenko, T., Whiting, P., 2002. Chemotaxonomic significance of

ecdysteroid agonists and antagonists in the Ranunculaceae: phytoecdysteroids in the

genera Helleborus and Hepatica. Biochem. Syst. Ecol. 30, 171-182.

Dinkova-Kostova, A. T., Talalay, P., 2000. Persuasive evidence that quinone reductase

type 1 (DT diaphorase) protects cells against the toxicity of electrophiles and reactive

forms of oxygen. Free Radical Biol. Med. 29, 231-240.

Diplock, A. T., 1997. Will the'good fairies' please prove to us that vitamin E lessens

human degenerative disease? Free Radic. Res. 27, 511-532.

Dixon, R. A., Paiva, N. L., 1995. Stress-induced phenylpropanoid metabolism. The Plant

Cell 7, 1085.

Doyle, J. J., Doyle, J. L., 1990. Isolation of plant DNA from fresh tissue. Focus 12, 13-

15.

Dröge, W., 2002. Free radicals in the physiological control of cell function. Physiol. Rev.

82, 47-95.

Dubrovina, A. S., Kiselev, K. V., Veselova, M. V., Isaeva, G. A., Fedoreyev, S. A.,

Zhuravlev, Y. N., 2009. Enhanced resveratrol accumulation in rolB transgenic cultures

of Vitis amurensis correlates with unusual changes in CDPK gene expression. J. Plant

Physiol. 166, 1194-1206.

Dutt, M., Li, Z., Dhekney, S., Gray, D., 2007. Transgenic plants from shoot apical

meristems of Vitis vinifera L.“Thompson Seedless” via Agrobacterium-mediated

transformation. Plant Cell Rep. 26, 2101-2110.

Enya, S., Ameku, T., Igarashi, F., Iga, M., Kataoka, H., Shinoda, T., Niwa, R., 2014. A

Halloween gene noppera-bo encodes a glutathione S-transferase essential for ecdysteroid

biosynthesis via regulating the behaviour of cholesterol in Drosophila. Sci. Rep. 4, 6586.

http://ecdybase.org/

137

Estruch, J. J., Schell, J., Spena, A., 1991. The protein encoded by the rolB plant

oncogene hydrolyses indole glucosides. EMBO J. 10, 3125-3128.

Fekete, G., Polgár, L. A., Báthori, M., Coll, J., Darvas, B., 2004. Per os efficacy of Ajuga

extracts against sucking insects. Pest Manage. Sci. 60, 1099-1104.

Festucci-Buselli, R. A., Contim, L. A., Barbosa, L. C. A., Stuart, J., Otoni, W. C., 2008a.

Biosynthesis and potential functions of the ecdysteroid 20-hydroxyecdysone-a review.

Botany 86, 978-987.

Festucci-Buselli, R. A., Contim, L. A., Barbosa, L. C. A., Stuart, J. J., Vieira, R. F.,

Otoni, W. C., 2008b. Level and distribution of 20-hydroxyecdysone during Pfaffia

glomerata development. Braz. J. Plant Physiol. 20, 305-311.

Filippini, F., Rossi, V., Marin, O., Trovato, M., Costantino, P., Downey, P. M., Lo, S. F.,

Terzi, M., 1996. A plant oncogene as a phosphatase. Nature 379, 499-500.

Finney, D. J., 1971. Probit Analysis: 3d Ed. Cambridge University Press.

Folta, K. M., Dhingra, A., 2006. Transformation of strawberry: The basis for

translational genomics in Rosaceae. In Vitro Cell. Dev. Biol. Plant 42, 482-490.

Foyer, C., Descourvieres, P., Kunert, K., 1994. Protection against oxygen radicals: an

important defence mechanism studied in transgenic plants. Plant, Cell Environ. 17, 507-

523.

Fry, S. C., 1987. Intracellular feruloylation of pectic polysaccharides. Planta 171, 205-

211.

Fujimoto, Y., Ohyama, K., Nomura, K., Hyodo, R., Takahashi, K., Yamada, J., Morisaki,

M., 2000. Biosynthesis of sterols and ecdysteroids in Ajuga hairy roots. Lipids 35, 279-

288.

Galbraith, M., Horn, D., 1966. An insect-moulting hormone from a plant. Chem.

Commun. (London), 905-906.

Gambarana, C., Ghiglieri, O., Tolu, P., De Montis, M. G., Giachetti, D., Bombardelli, E.,

Tagliamonte, A., 1999. Efficacy of an Hypericum perforatum (St. John's wort) extract in

preventing and reverting a condition of escape deficit in rats. Neuropsychopharmacology

21, 247-257.

Gaudin, V., Vrain, T., Jouanin, L., 1994. Bacterial genes modifying hormonal balances

in plants. Plant Physiol. Biochem. 32, 11-29.

Gautam, R., Jachak, S. M., Saklani, A., 2011. Anti-inflammatory effect of Ajuga

bracteosa Wall Ex Benth. mediated through cyclooxygenase (COX) inhibition. J.

Ethnopharmacol. 133, 928-930.

Gelvin, S. B., 2003. Agrobacterium-mediated plant transformation: the biology behind

the “gene-jockeying” tool. Microbiol. Mol. Biol. Rev. 67, 16-37.

138

Georgiev, M. I., Ludwig-Müller, J., Alipieva, K., Lippert, A., 2011. Sonication-assisted

Agrobacterium rhizogenes-mediated transformation of Verbascum xanthophoeniceum

Griseb. for bioactive metabolite accumulation. Plant Cell Rep. 30, 859-866.

Ghasemzadeh, A., Jaafar, H. Z., Rahmat, A., 2010. Antioxidant activities, total phenolics

and flavonoids content in two varieties of Malaysia young ginger (Zingiber officinale

Roscoe). Molecules 15, 4324-4333.

Ghosh, D., Laddha, K., 2006. Extraction and monitoring of phytoecdysteroids through

HPLC. J. Chromatogr. Sci. 44, 22-26.

Ghufran, M. A., Qureshi, R. A., Batool, A., Kondratyuk, T. P., Guilford, J. M., Marler,

L. E., Chang, L. C., Pezzuto, J. M., 2009. Evaluation of selected indigenous medicinal

plants from the western Himalayas for cytotoxicity and as potential cancer

chemopreventive agents. Pharm. Biol. 47, 533-538.

Grager, R., Harbone, J., 1994. A survey of antifungal compounds from higher plants.

Phytochemistry 37, 19-42.

Grebenok, R. J., Adler, J. H., 1991. Ecdysteroid distribution during development of

spinach. Phytochemistry 30, 2905-2910.

Grebenok, R. J., Adler, J. H., 1993. Ecdysteroid biosynthesis during the ontogeny of

spinach leaves. Phytochemistry 33, 341-347.

Grebenok, R. J., Ripa, P. V., Adler, J. H., 1991. Occurrence and levels of ecdysteroids in

spinach. Lipids 26, 666-668.

Grebenok, R. J., Venkatachari, S., Adler, J. H., 1994. Biosynthesis of ecdysone and

ecdysone phosphates in spinach. Phytochemistry 36, 1399-1408.

Grotewold, E., 2006. The genetics and biochemistry of floral pigments. Annu. Rev. Plant

Biol. 57, 761-780.

Gülçin, I., Küfrevioǧlu, Ö. İ., Oktay, M., Büyükokuroǧlu, M. E., 2004. Antioxidant,

antimicrobial, antiulcer and analgesic activities of nettle (Urtica dioica L.). J.


Gupta, A. K., Tandon, N., 2004. Reviews on Indian medicinal plants. Indian Council of

Medical Research, New Delhi.

Hamayun, M., Afzal, S., Khan, M. A., 2006. Ethnopharmacology, indigenous collection

and preservation techniques of some frequently used medicinal plants of Utror and

Gabral, district Swat, Pakistan. Afr. J. Tradit. Complement. Altern. Med. 3, 57-73.

Hamilton, C. M., Frary, A., Lewis, C., Tanksley, S. D., 1996. Stable transfer of intact

high molecular weight DNA into plant chromosomes. Proc. Natl. Acad. Sci. USA. 93,

9975-9979.

139

Hammerschmidt, R., 2005a. Antioxidants and the regulation of defense. Physiol. Mol.

Plant Pathol. 66, 211-212.

Hammerschmidt, R., 2005b. Phenols and plant–pathogen interactions: the saga

continues. Physiol. Mol. Plant Pathol. 66, 77-78.

Hansen, G., Shillito, R. D., Chilton, M. D., 1997. T-strand integration in maize

protoplasts after codelivery of a T-DNA substrate and virulence genes. Proc. Natl. Acad.

Sci. USA. 94, 11726-11730.

Hansen, G., Wright, M. S., 1999. Recent advances in the transformation of plants.

Trends Plant Sci. 4, 226-231.

Hedge, I., Nasir, Y., Ali, S., 1990. Flora of Pakistan. University of Karachi, Department

of Botany, Karachi 192.

Hendrix, S. D., Jones, R. L., 1972. The activity of β-ecdysone in four gibberellin

bioassays. Plant Physiol. 50, 199-200.

Hoshino, J., Park, E.-J., Kondratyuk, T. P., Marler, L., Pezzuto, J. M., van Breemen, R.

B., Mo, S., Li, Y., Cushman, M., 2010. Selective synthesis and biological evaluation of

sulfate-conjugated resveratrol metabolites. J. Med. Chem. 53, 5033-5043.

Howe, G. A., Jander, G., 2008. Plant immunity to insect herbivores. Annu. Rev. Plant

Biol. 59, 41-66.

Hsieh, W. T., Liu, Y. T., Lin, W. C., 2011. Anti-inflammatory properties of Ajuga

bracteosa in vivo and in vitro study and their effects on mouse model of liver fibrosis. J.


Huffman, G., White, F., Gordon, M., Nester, E., 1984. Hairy-root-inducing plasmid:

physical map and homology to tumor-inducing plasmids. J. Bacteriol. 157, 269-276.

Hunter, M. D., 2001. Out of sight, out of mind: the impacts of root‐feeding insects in

natural and managed systems. Agric. For. Entomol. 3, 3-9.

Hussain, J., Begum, N., Hussain, H., Khan, F. U., Rehman, N. U., Al-Harrasi, A., Ali, L.,

2012. Ajuganane: a new phenolic compound from Ajuga bracteosa. Nat. Prod. Commun.

7, 615-616.

Hyodo, R., Fujimoto, Y., 2000. Biosynthesis of 20-hydroxyecdysone in Ajuga hairy

roots: the possibility of 7-ene introduction at a late stage. Phytochemistry 53, 733-737.

Ibrar, M., Hussain, F., Sultan, A., 2007. Ethnobotanical studies on plant resources of

Ranyal Hills, District Shangla, Pakistan. Pak. J. Bot. 39, 329-337.

Iga, M., Smagghe, G., 2010. Identification and expression profile of Halloween genes

involved in ecdysteroid biosynthesis in Spodoptera littoralis. Peptides 31, 456-467.

140

Isla, M. I., Zampini, I. C., Ordóñez, R. M., Cuello, S., Juárez, B. C., Sayago, J. E.,

Moreno, M. I. N., Alberto, M. R., Vera, N. R., Bedascarrasbure, E., 2009. Effect of

seasonal variations and collection form on antioxidant activity of propolis from San Juan,

Argentina. J. Med. Food 12, 1334-1342.

Israili, Z. H., Lyoussi, B., 2009. Ethnopharmacology of the plants of genus Ajuga. Pak. J.

Pharm. Sci. 22, 425-462.

Jan, M., Singh, S., Kaloo, Z. A., Maqbool, F., 2014. Callus induction and multiple shoot

regeneration in Ajuga bracteosa Wall ex. Benth.-An important medicinal plant growing

in Kashmir Himalaya. J. Sci. Innov. Res. 3, 319-324.

Jan, S., Khan, M. R., Rashid, U., Bokhari, J., 2013. Assessment of antioxidant potential,

total phenolics and flavonoids of different solvent fractions of Monotheca buxifolia fruit.

Osong Public health Res. Perspect. 4, 246-254.

Janská, A., Maršík, P., Zelenková, S., Ovesná, J., 2010. Cold stress and acclimation–

what is important for metabolic adjustment? Plant Biol. 12, 395-405.

Javanmardi, J., Stushnoff, C., Locke, E., Vivanco, J., 2003. Antioxidant activity and total

phenolic content of Iranian Ocimum accessions. Food Chem. 83, 547-550.

Jayaprakasam, B., Nair, M. G., 2003. Cyclooxygenase-2 enzyme inhibitory withanolides

from Withania somnifera leaves. Tetrahedron 59, 841-849.

Jouanin, L., 1984. Restriction map of an agropine-type Ri plasmid and its homologies

with Ti plasmids. Plasmid 12, 91-102.

Jung, K. H., Kwak, S. S., Choi, C. Y., Liu, J. R., 1995. An interchangeable system of

hairy root and cell suspension cultures of Catharanthus roseus for indole alkaloid

production. Plant Cell Rep. 15, 51-54.

Kaithwas, G., Gautam, R., Jachak, S. M., Saklani, A., 2012. Antiarthritic effects of Ajuga

bracteosa Wall ex Benth. in acute and chronic models of arthritis in albino rats. Asian

Pac. J. Trop. Biomed. 2, 185-188.

Kamboj, V. P., 2000. Herbal medicine. Curr. Sci. 78, 35-39.

Kangatharalingam, N., Pierce, M. L., Bayles, M. B., Essenberg, M., 2002. Epidermal

anthocyanin production as an indicator of bacterial blight resistance in cotton. Physiol.

Mol. Plant Pathol. 61, 189-195.

Karadag, A., Ozcelik, B., Saner, S., 2009. Review of methods to determine antioxidant

capacities. Food Anal. Methods 2, 41-60.

Karuppanapandian, T., Moon, J. C., Kim, C., Manoharan, K., Kim, W., 2011. Reactive

oxygen species in plants: their generation, signal transduction, and scavenging

mechanisms. Aust. J. Crop. Sci. 5, 709-725.

141

Kaul, S., Das, S., Srivastava, P., 2013. Micropropagation of Ajuga bracteosa, a

medicinal herb. Physiol. Mol. Biol. Plants 19, 289-296.

Kayani, W. K., Rani, R., Ihsan-ul-Haq, Mirza, B., 2014. Seasonal and geographical

impact on the morphology and 20-hydroxyecdysone content in different tissue types of

wild Ajuga bracteosa Wall. ex Benth. Steroids 87, 2–20.

Kholodova, I., 1978. Phytoecdysones-biologically active polyhydroxylated sterols. Ukr.

Biokhim. Zh. 51, 560-575.

Kiani, B. H., Safdar, N., Mannan, A., Mirza, B., 2012. Comparative Artemisinin analysis

in Artemisia dubia transformed with two different Agrobacteria harbouring rol ABC

genes. Plant Omics 5, 386-391.

Kim, O. T., Manickavasagm, M., Kim, Y. J., Jin, M. R., Kim, K. S., Seong, N. S.,

Hwang, B., 2005a. Genetic transformation of Ajuga multiflora Bunge with

Agrobacterium rhizogenes and 20-hydroxyecdysone production in hairy roots. J. Plant

Biol. 48, 258-262.

Kim, T. W., Hwang, J. Y., Kim, Y. S., Joo, S. H., Chang, S. C., Lee, J. S., Takatsuto, S.,

Kim, S. K., 2005b. Arabidopsis CYP85A2, a cytochrome P450, mediates the Baeyer-

Villiger oxidation of castasterone to brassinolide in brassinosteroid biosynthesis. Plant

Cell 17, 2397-2412.

Kirtikar, K., Basu, B., 1935. Indian Medicinal Plants, second ed. International book

distributors, Dehradhun.

Kirtikar, K. R., Basu, B. D., 1918. Indian medicinal plants. Bahadurganj, India.

Kiselev, K., Dubrovina, A., Veselova, M., Bulgakov, V., Fedoreyev, S., Zhuravlev, Y.

N., 2007. The rolB gene-induced overproduction of resveratrol in Vitis amurensis

transformed cells. J. Biotechnol. 128, 681-692.

Kiselev, K. V., Turlenko, A. V., Zhuravlev, Y. N., 2009. CDPK gene expression in

somatic embryos of Panax ginseng expressing rolC. Plant Cell Tiss. Org. Cult. 99, 141-

149.

Kizelsztein, P., Govorko, D., Komarnytsky, S., Evans, A., Wang, Z., Cefalu, W. T.,

Raskin, I., 2009. 20-Hydroxyecdysone decreases weight and hyperglycemia in a diet-

induced obesity mice model. Am. J. Physiol. Endocrinol. Metabol. 296, E433-E439.

Klee, H., Horsch, R., Rogers, S., 1987. Agrobacterium-mediated plant transformation

and its further applications to plant biology. Annu. Rev. Plant Physiol. 38, 467-486.

Kondratyuk, T. P., Park, E.-J., Yu, R., Van Breemen, R. B., Asolkar, R. N., Murphy, B.

T., Fenical, W., Pezzuto, J. M., 2012. Novel marine phenazines as potential cancer

chemopreventive and anti-inflammatory agents. Mar. Drugs 10, 451-464.

142

Konoshima, T., Takasaki, M., Tokuda, H., Nishino, H., 2000. Cancer chemopreventive

activity of an iridoid glycoside, 8-acetylharpagide, from Ajuga decumbens. Cancer Lett.

157, 87-92.

Kubo, J., Lee, J. R., Kubo, I., 1999. Anti-Helicobacter pylori agents from the cashew

apple. J. Agric. Food Chem. 47, 533-537.

Kumar, A., Abrol, E., Koul, S., Vyas, D., 2012. Seasonal low temperature plays an

important role in increasing metabolic content of secondary metabolites in Withania

somnifera (L.) Dunal and affects the time of harvesting. Acta Physiol. Plant. 34, 2027-

2031.

Kumar, S., Malhotra, R., Kumar, D., 2010. Euphorbia hirta: Its chemistry, traditional

and medicinal uses, and pharmacological activities. Pharmacogn. Rev. 4, 58.

Kurmukov, A., Syrov, V., 1988. Anti-inflammatory properties of ecdysterone. Med. Zh.

Uzb. 10, 68-70.

Kutepova, T., Syrov, V., Khushbaktova, Z., Saatov, Z., 2001. Hypoglycemic activity of

the total ecdysteroid extract from Ajuga turkestanica. Pharm. Chem. J. 35, 608-609.

Kuz'menko, A., Morozova, R., Nikolenko, I., Donchenko, G., 1998a. Antioxidant effect

of 20-hydroxyecdysone in a model system. Ukr. Biokhim. Zh. 71, 35-38.

Kuz'menko, A., Morozova, R., Nikolenko, I., Korniets, G., Kholodova, Y., 1997. Effects

of vitamin D3 and ecdysterone on free-radical lipid peroxidation. Biochemistry (Mosc).

62, 609-612.

Kuz'menko, A., Morozova, R., Nykolenko, Y., Kornyets, H., Donchenko, H., 1998b.

Effect of vitamin D3, arginine, and a biologically active complex from Serratula

coronata on free radical oxidation of lipids in vitamin D deficiency. Ukr. Biokhim. Zh.

71, 69-74.

Kuzmenko, A. I., Niki, E., Noguchi, N., 2001. New Functions of 20-Hydroxyecdysone in

Lipid Peroxidation. J. Oleo Sci. 50, 497-506.

Lafont, R., 1997. Ecdysteroids and related molecules in animals and plants. Arch. Insect

Biochem. Physiol. 35, 3-20.

Lafont, R., Bouthier, A., Wilson, I., 1991. Phytoecdysteroids: structures, occurrence,

biosynthesis and possible ecological significance. In: Hrdy, I. (Ed.), Insect Chemical

Ecology. Academia Prague, Prague, pp. 197-214.

Lafont, R., Connat, J., 1989a. Pathways of ecdysone metabolism. Ecdysone. Georg

Thieme-Verlag, Stuttgart, 167-173.

Lafont, R., Connat, J., 1989b. Pathways of ecdysone metabolism. Ecdysone: From

chemistry to mode of action. Georg Thieme Verlag Stuttgart, pp. 167-173.

143

Lafont, R., Dinan, L., 2003. Practical uses for ecdysteroids in mammals including

humans: and update. J. Insect Sci. 3, 7.

Lafont, R., Ho, R., Raharivelomanana, P., Dinan, L., 2010. Ecdysteroids in ferns:

distribution, diversity, biosynthesis, and functions. Working with Ferns. Springer, pp.

305-319.

Lapikova, E., Drozd, N., Tolstenkov, A., Makarov, V., Zvyagintseva, T., Shevchenko,

N., Bakunina, I., Besednova, N., Kuznetsova, T., 2008. Inhibition of thrombin and factor

Xa by Fucus evanescens fucoidan and its modified analogs. Bull. Exp. Biol. Med. 146,

328-333.

Lattanzio, V., Di Venere, D., Linsalata, V., Bertolini, P., Ippolito, A., Salerno, M., 2001.

Low temperature metabolism of apple phenolics and quiescence of Phlyctaena

vagabunda. J. Agric. Food Chem. 49, 5817-5821.

Lee, D., Bhat, K. P., Fong, H. H., Farnsworth, N. R., Pezzuto, J. M., Kinghorn, A. D.,

2001. Aromatase inhibitors from Broussonetia papyrifera. J. Nat. Prod. 64, 1286-1293.

Levesque, H., Delepelaire, P., Rouzé, P., Slightom, J., Tepfer, D., 1988. Common

evolutionary origin of the central portions of the Ri TL-DNA of Agrobacterium

rhizogenes and the Ti T-DNAs of Agrobacterium tumefaciens. Plant Mol. Biol. 11, 731-

744.

Levitt, J., 1980. Responses of plants to environmental stresses. Volume II. Water,

radiation, salt, and other stresses. Academic Press.

Lubet, R., Steele, V., Casebolt, T., Eto, I., Kelloff, G., Grubbs, C., 1994.

Chemopreventive effects of the aromatase inhibitors vorozole (R-83842) and 4-

hydroxyandrostenedione in the methylnitrosourea (MNU)-induced mammary tumor

model in Sprague–Dawley rats. Carcinogenesis 15, 2775-2780.

Lupien, P., Hinse, C., Chaudhary, K., 1969. Ecdysone as a hypocholesterolemic agent.

Arch. Physiol. Biochem. 77, 206-212.

Maheswaran, G., Welander, M., Hutchinson, J. F., Graham, M. W., Richards, D., 1992.

Transformation of Apple Rootstock M26 with Agrobacterium tumefaciens. J. Plant

Physiol. 139, 560-568.

Maizels, M., McCarberg, B., 2005. Antidepressants and antiepileptic drugs for chronic

non-cancer pain. Am. Fam. Physician 71, 483-490.

Mallol, A., Cusido, R. M., Palazon, J., Bonfill, M., Morales, C., Piñol, M. T., 2001.

Ginsenoside production in different phenotypes of Panax ginseng transformed roots.

Phytochemistry 57, 365-371.

Mangas, S., Bonfill, M., Osuna, L., Moyano, E., Tortoriello, J., Cusido, R. M., Piñol, M.

T., Palazón, J., 2006. The effect of methyl jasmonate on triterpene and sterol

metabolisms of Centella asiatica, Ruscus aculeatus and Galphimia glauca cultured

plants. Phytochemistry 67, 2041-2049.

144

Marnett, L. J., 2000. Oxyradicals and DNA damage. Carcinogenesis 21, 361-370.

Martin-Tanguy, J., Sun, L.-Y., Burtin, D., Vernoy, R., Rossin, N., Tepfer, D., 1996.

Attenuation of the phenotype caused by the root-inducing, left-hand, transferred DNA

and its rolA gene (correlations with changes in polyamine metabolism and DNA

methylation). Plant Physiol. 111, 259-267.

Martin-Tanguy, J., Tepfer, D., Paynot, M., Burtin, D., Heisler, L., Martin, C., 1990.

Inverse relationship between polyamine levels and the degree of phenotypic alteration

induced by the root-inducing, left-hand transferred DNA from Agrobacterium

rhizogenes. Plant Physiol. 92, 912-918.

Matsue, H., Edelbaum, D., Shalhevet, D., Mizumoto, N., Yang, C., Mummert, M. E.,

Oeda, J., Masayasu, H., Takashima, A., 2003. Generation and function of reactive

oxygen species in dendritic cells during antigen presentation. J. Immunol. 171, 3010-

3018.

Matsumoto, T., Tanaka, N., 1991. Production of phytoecdysteroids by hairy root cultures

of Ajuga reptans var. atropurpurea. Agric. Biol. Chem. 55, 1019-1025.

Maurel, C., Barbier-Brygoo, H., Spena, A., Tempé, J., Guern, J., 1991. Single rol genes

from the Agrobacterium rhizogenes TL-DNA alter some of the cellular responses to

auxin in Nicotiana tabacum. Plant Physiol. 97, 212-216.

Maurel, C., Leblanc, N., Barbier-Brygoo, H., Perrot-Rechenmann, C., Bouvier-Durand,

M., Guern, J., 1994. Alterations of auxin perception in rolB-transformed tobacco

protoplasts (Time course of rolB mRNA expression and increase in auxin sensitivity

reveal multiple control by auxin). Plant Physiol. 105, 1209-1215.

Meyer, A., Tempe, J., Costantino, P., 2000. Hairy root: a molecular overview. Functional

analysis of Agrobacterium rhizogenes T-DNA genes. In: G, S., N, K. (Eds.), Plant-

microbe interactions, vol. 5. APS Press, Minnesota, pp. 93-139.

Meyer, B., Ferrigni, N., Putnam, J., Jacobsen, L., Nichols, D. j., McLaughlin, J., 1982.

Brine shrimp: a convenient general bioassay for active plant constituents. Planta Med.,

31-34.

Mirjalili, H. M., Fakhr‐Tabatabaei, S. M., Bonfill, M., Alizadeh, H., Cusido, R. M.,

Ghassempour, A., Palazon, J., 2009. Morphology and withanolide production of

Withania coagulans hairy root cultures. Eng. Life Sci. 9, 197-204.

Mirzaev, I., Syrov, V., Khrushev, S., Iskanderova, S., 1999. Effect of ecdystene on

parameters of the sexual function under experimental and clinical conditions. Eksp. Klin.

Farmakol. 63, 35-37.

Misico, R. I., Nicotra, V. E., Oberti, J. C., Barboza, G., Gil, R. R., Burton, G., 2011.

Withanolides and related steroids. Prog. Chem. Org. Nat. Prod. 94, 127-229.

Moein, M. R., Moein, S., Ahmadizadeh, S., 2008. Radical scavenging and reducing

power of Salvia mirzayanii subfractions. Molecules 13, 2804-2813.

145

Moll, S., Roberts, H. R., 2002. Overview of anticoagulant drugs for the future. Semin.

Hematol., vol. 39. Elsevier, pp. 145-157.

Montoro, P., Rattana, W., Pujade-Renaud, V., Michaux-Ferriere, N., Monkolsook, Y.,

Kanthapura, R., Adunsadthapong, S., 2003. Production of Hevea brasiliensis transgenic

embryogenic callus lines by Agrobacterium tumefaciens: roles of calcium. Plant Cell

Rep. 21, 1095-1102.

Morris, R. O., 1986. Genes specifying auxin and cytokinin biosynthesis in

phytopathogens. Annu. Rev. Plant Physiol. 37, 509-538.

Mothana, R. A., Alsaid, M. S., Hasoon, S. S., Al-Mosaiyb, N. M., Al-Rehaily, A. J., Al-

Yahya, M. A., 2012. Antimicrobial and antioxidant activities and gas chromatography

mass spectrometry (GC/MS) analysis of the essential oils of Ajuga bracteosa Wall. ex

Benth. and Lavandula dentata L. growing wild in Yemen. J. Med. Plant Res. 6, 3066-

3071.

Moyano, E., Fornalé, S., Palazón, J., Cusidó, R., Bonfill, M., Morales, C., Piñol, M.,

1999. Effect of Agrobacterium rhizogenes T-DNA on alkaloid production in Solanaceae

plants. Phytochemistry 52, 1287-1292.

Mullineaux, C. W., Tobin, M. J., Jones, G. R., 1997. Mobility of photosynthetic

complexes in thylakoid membranes. Nature 390, 421-424.

Najmutdinova, D. K., Saatov, Z., 1999. Lung local defense in experimental diabetes

mellitus and the effect of 11, 20‐dihydroxyecdysone in combination with maninil. Arch.

Insect Biochem. Physiol. 41, 144-147.

Nakanishi, K., Koreeda, M., Sasaki, S., Chang, M., Hsu, H., 1966. Insect hormones. The

structure of ponasterone A, insect-moulting hormone from the leaves of Podocarpus

nakaii Hay. Chem. Commun. (London), 915-917.

Nemoto, K., Hara, M., Suzuki, M., Seki, H., Oka, A., Muranaka, T., Mano, Y., 2009.

Function of the aux and rol genes of the Ri plasmid in plant cell division in vitro. Plant

Signal. Behav. 4, 1145-1147.

Nes, W. R., McKean, M. L., 1977. Biochemistry of steroids and other isopentenoids.

University Park Press.

Nilsson, O., Olsson, O., 1997. Getting to the root: the role of the Agrobacterium

rhizogenes rol genes in the formation of hairy roots. Physiol. Plant. 100, 463-473.

Niwa, R., Matsuda, T., Yoshiyama, T., Namiki, T., Mita, K., Fujimoto, Y., Kataoka, H.,

2004. CYP306A1, a cytochrome P450 enzyme, is essential for ecdysteroid biosynthesis

in the prothoracic glands of Bombyx and Drosophila. J. Biol. Chem. 279, 35942-35949.

Niwa, R., Niwa, Y. S., 2014. Enzymes for ecdysteroid biosynthesis: their biological

functions in insects and beyond. Biosci., Biotechnol., Biochem. 78, 1283-1292.

146

Niwa, R., Sakudoh, T., Namiki, T., Saida, K., Fujimoto, Y., Kataoka, H., 2005. The

ecdysteroidogenic P450 Cyp302a1/disembodied from the silkworm, Bombyx mori, is

transcriptionally regulated by prothoracicotropic hormone. Insect Mol. Biol. 14, 563-

571.

Nordberg, J., Arner, E. S., 2001. Reactive oxygen species, antioxidants, and the

mammalian thioredoxin system. Free Radical Biol. Med. 31, 1287-1312.

Obertello, M., SY, M. O., Laplaze, L., Santi, C., Svistoonoff, S., Auguy, F., Bogusz, D.,

Franche, C., 2004. Actinorhizal nitrogen fixing nodules: infection process, molecular

biology and genomics. Afr. J. Biotechnol. 2, 528-538.

Obied, H. K., Allen, M. S., Bedgood, D. R., Prenzler, P. D., Robards, K., Stockmann, R.,

2005. Bioactivity and analysis of biophenols recovered from olive mill waste. J. Agric.

Food Chem. 53, 823-837.

Oktay, M., Gülçin, İ., Küfrevioğlu, Ö. İ., 2003. Determination of in vitro antioxidant

activity of fennel (Foeniculum vulgare) seed extracts. LWT-Food Sci. Technol. 36, 263-

271.

Okuzumi, K., Hara, N., Fujimoto, Y., Yamada, J., Nakamura, A., Takahashi, K.,

Morisaki, M., 2003. Biosynthesis of phytoecdysteroids in Ajuga hairy roots: clerosterol

as a precursor of cyasterone, isocyasterone and 29-norcyasterone. Tetrahedron Lett. 44,

323-326.

Ono, H., Rewitz, K. F., Shinoda, T., Itoyama, K., Petryk, A., Rybczynski, R., Jarcho, M.,

Warren, J. T., Marqués, G., Shimell, M. J., 2006. Spook and Spookier code for stage-

specific components of the ecdysone biosynthetic pathway in Diptera. Dev. Biol. 298,

555-570.

Ortega‐Ramirez, L. A., Rodriguez‐Garcia, I., Leyva, J. M., Cruz‐Valenzuela, M. R.,

Silva‐Espinoza, B. A., Gonzalez‐Aguilar, G. A., Siddiqui, M. W., Ayala‐Zavala, J. F.,

2014. Potential of medicinal plants as antimicrobial and antioxidant agents in food

industry: a hypothesis. J. Food Sci. 79, R129-R137.

Otaka, T., Uchiyama, M., Takemoto, T., Hikino, H., 1969. Stimulatory effect of insect-

metamorphosing steroids from ferns on protein synthesis in mouse liver. Chem. Pharm.

Bull. (Tokyo) 17, 1352-1355.

Oyaizu, M., 1986. Studies on products of browning reaction: antioxidative activities of

products of browning reaction prepared from glucosamine. Jpn. J. Nutr. 44, 307-315.

Pal, A., Pawar, R., 2011a. A Study on Ajuga bracteosa Wall ex. Benth for analgesic

activity. Int. J. Cur. Bio. Med. Sci. 1, 12-14.

Pal, A., Pawar, R., 2011b. A Study on Ajuga bracteosa Wall ex. Benth for analgesic

activity. Int. J. Cur. Bio. Med. Sci. 1, 12-14.

Pal, A., Toppo, F. A., Chaurasiya, P. K., Singour, P. K., Pawar, R. S., 2014. In vitro

cytotoxicity study of methanolic fraction from Ajuga bracteosa Wall ex. Benth on MCF-

147

7 breast adenocarcinoma and hep-2 larynx carcinoma cell lines. Pharmacogn. Res. 6, 87-

91.

Pal, G., Pal, P., 2005. Textbook of practical physiology 2nd Ed. Orient longman private

limited.

Pal, S. K., Shukla, Y., 2003. Herbal medicine: current status and the future. Asian Pac. J.

Cancer Prev. 4, 281-288.

Palazón, J., Altabella, T., Cusidó, R., Ribó, M., Piñol, M., 1995. Growth and tropane

alkaloid production in Agrobacterium transformed roots and derived callus of Datura.

Biol. Plant. 37, 161-168.

Palazón, J., Cusidó, R., Roig, C., Pinol, M., 1997. Effect of rol genes from

Agrobacterium rhizogenes TL-DNA on nicotine production in tobacco root cultures.

Plant Physiol. Biochem. 35, 155-162.

Palazón, J., Cusidó, R., Roig, C., Pinol, M., 1998a. Expression of the rolC gene and

nicotine production in transgenic roots and their regenerated plants. Plant Cell Rep. 17,

384-390.

Palazón, J., Cusidó, R. M., Bonfill, M., Mallol, A., Moyano, E., Morales, C., Piñol, M.

T., 2003. Elicitation of different Panax ginseng transformed root phenotypes for an

improved ginsenoside production. Plant Physiol. Biochem. 41, 1019-1025.

Palazón, J., Cusidó, R. M., Gonzalo, J., Bonfill, M., Morales, C., Piñol, M. T., 1998b.

Relation between the amount of rolC gene product and indole alkaloid accumulation in

Catharanthus roseus transformed root cultures. J. Plant Physiol. 153, 712-718.

Paolis, A. D., Mauro, M. L., Pompom, M., Cardarelli, M., Spano, L., Costantino, P.,

1985. Localization of agropine-synthesizing functions in the TR region of the root-

inducing plasmid of Agrobacterium rhizogenes 1855. Plasmid 13, 1-7.

Parjapati, N., Purohit, S., Sharma, A., Kumar, T., 2003. A handbook of medicinal plants:

A complete source book. Agrobios (India), Jodhpur, 506.

Parr, A. J., Bolwell, G. P., 2000. Phenols in the plant and in man. The potential for

possible nutritional enhancement of the diet by modifying the phenols content or profile.

J. Sci. Food Agric. 80, 985-1012.

Paul, A., Bakshi, S., Sahoo, D. P., Kalita, M. C., Sahoo, L., 2012. Agrobacterium-

mediated genetic transformation of Pogostemon cablin (Blanco) Benth. Using leaf

explants: bactericidal effect of leaf extracts and counteracting strategies. Appl. Biochem.

Biotechnol. 166, 1871-1895.

Pavela, R., 2008. Larvicidal effects of various Euro-Asiatic plants against Culex

quinquefasciatus Say larvae (Diptera: Culicidae). Parasitol. Res. 102, 555-559.

Petryk, A., Warren, J. T., Marques, G., Jarcho, M. P., Gilbert, L. I., Kahler, J., Parvy, J.

P., Li, Y. T., Dauphin-Villemant, C., O'Connor, M. B., 2003. Shade is the Drosophila

148

P450 enzyme that mediates the hydroxylation of ecdysone to the steroid insect molting

hormone 20-hydroxyecdysone. Proc. Natl. Acad. Sci. USA. 100, 13773-13778.

Petti, S., Scully, C., 2009. Polyphenols, oral health and disease: A review. J. Dent. 37,

413-423.

Pistelli, L., Giovannini, A., Ruffoni, B., Bertoli, A., Pistelli, L., 2010. Hairy root cultures

for secondary metabolites production. Bio-Farms for Nutraceuticals. Springer, pp. 167-

184.

Porsolt, R. D., Le Pichon, M., Jalfre, M., 1977. Depression: a new animal model

sensitive to antidepressant treatments. Nature 266, 730-732.

Prieto, P., Pineda, M., Aguilar, M., 1999. Spectrophotometric quantitation of antioxidant

capacity through the formation of a phosphomolybdenum complex: specific application

to the determination of vitamin E. Anal. Biochem. 269, 337-341.

Qian, Z. J., Jung, W. K., Byun, H. G., Kim, S. K., 2008. Protective effect of an

antioxidative peptide purified from gastrointestinal digests of oyster, Crassostrea gigas

against free radical induced DNA damage. Bioresour. Technol. 99, 3365-3371.

Qureshi, R., Waheed, A., Arshad, M., Umbreen, T., 2009. Medico-ethnobotanical

inventory of tehsil Chakwal, Pakistan. Pak. J. Bot. 41, 529-538.

Rahman, N., Ahmad, M., Riaz, M., Mehjabeen, Jahan, N., Ahmad, R., 2013.

Phytochemical, antimicrobial, insecticidal and brine shrimp lethality bioassay of the

crude methanolic extract of Ajuga parviflora Benth. Pak. J. Pharm. Sci. 26, 751-756.

Ramazanov, N. S., 2005. Phytoecdysteroids and other biologically active compounds

from plants of the genus Ajuga. Chem. Nat. Compd. 41, 361-369.

Rao, S. R., Ravishankar, G., 2002. Plant cell cultures: chemical factories of secondary

metabolites. Biotechnol. Adv. 20, 101-153.

Rastogi, R. P., Mehrotra, B., Sinha, S., Seth, R., 2001. Compendium of Indian medicinal

plants. Central Drug Research Institute and Publications & Information Directorate, New

Delhi.

Reixach, N., Lafont, R., Camps, F., Casas, J., 1999. Biotransformations of putative

phytoecdysteroid biosynthetic precursors in tissue cultures of Polypodium vulgare. Eur.

J. Biochem. 266, 608-615.

Riaz, N., Malik, A., Nawaz, S. A., Muhammad, P., Choudhary, M. I., 2004.

Cholinesterase-Inhibiting Withanolides from Ajuga bracteosa. Chem. Biodivers. 1,

1289-1295.

Riaz, N., Nawaz, S. A., Mukhtar, N., Malik, A., Afza, N., Ali, S., Ullah, S., Muhammad,

P., Choudhary, M. I., 2007. Isolation and enzyme inhibition studies of the chemical

constituents from Ajuga bracteosa. Chem. Biodivers. 4, 72-83.

149

Rice-Evans, C., Miller, N., Paganga, G., 1997. Antioxidant properties of phenolic

compounds. Trends Plant Sci. 2, 152-159.

Rigden, D. J., Carneiro, M., 1999. A structural model for the rolA protein and its

interaction with DNA. Proteins 37, 697-708.

Robins, R. J., 1998. The application of root cultures to problems of biological chemistry.

Nat. Prod. Rep. 15, 549-570.

Ruch, R. J., Cheng, S. J., Klaunig, J. E., 1989. Prevention of cytotoxicity and inhibition

of intercellular communication by antioxidant catechins isolated from Chinese green tea.

Carcinogenesis 10, 1003-1008.

Saatov, Z., Agzamkhodzhaeva, D., Syrov, V., 1999. Distribution of phytoecdysteroids in

plants of Uzbekistan and the possibility of using drugs based on them in neurological

practice. Chem. Nat. Compd. 35, 186-191.

Saatov, Z., Gorovits, M., Abubakirov, N., 1993. Phytoecdysteroids of plants of the genus

Silene. Chem. Nat. Compd. 29, 551-557.

Sarker, S. D., Girault, J.-P., Lafont, R., Dinan, L. N., 1997. Ecdysteroid xylosides from

Limnanthes douglasii. Phytochemistry 44, 513-521.

Sasaki, Y. F., Kawaguchi, S., Kamaya, A., Ohshita, M., Kabasawa, K., Iwama, K.,

Taniguchi, K., Tsuda, S., 2002. The comet assay with 8 mouse organs: results with 39

currently used food additives. Mutat. Res. 519, 103-119.

Scandalios, J. G., 1993. Oxygen stress and superoxide dismutases. Plant Physiol. 101, 7.

Scapagnini, G., Davinelli, S., Drago, F., De Lorenzo, A., Oriani, G., 2012. Antioxidants

as antidepressants: fact or fiction? CNS Drugs 26, 477-490.

Scarano, A., Murmura, G., Di Cerbo, A., Palmieri, B., Pinchi, V., Mavriqi, L., Varvara,

G., 2013. Anti-hemorrhagic agents in oral and dental practice: an update. Int. J.

Immunopathol. Pharmacol., 847-854.

Schenk, R. U., Hildebrandt, A., 1972. Medium and techniques for induction and growth

of monocotyledonous and dicotyledonous plant cell cultures. Can. J. Bot. 50, 199-204.

Schmelz, E. A., Grebenok, R. J., Galbraith, D. W., Bowers, W. S., 1998. Damage-

induced accumulation of phytoecdysteroids in spinach: a rapid root response involving

the octadecanoic acid pathway. J. Chem. Ecol. 24, 339-360.

Schmelz, E. A., Grebenok, R. J., Galbraith, D. W., Bowers, W. S., 1999. Insect-induced

synthesis of phytoecdysteroids in spinach, Spinacia oleracea. J. Chem. Ecol. 25, 1739-

1757.

Schmelz, E. A., Grebenok, R. J., Ohnmeiss, T. E., Bowers, W. S., 2002. Interactions

between Spinacia oleracea and Bradysia impatiens: a role for phytoecdysteroids. Arch.

Insect Biochem. Physiol. 51, 204-221.

150

Schmülling, T., Fladung, M., Grossmann, K., Schell, J., 1993. Hormonal content and

sensitivity of transgenic tobacco and potato plants expressing single rol genes of

Agrobacterium rhizogenes T-DNA. Plant J. 3, 371-382.

Schmulling, T., Schell, J., Spena, A., 1988. Single genes from Agrobacterium rhizogenes

influence plant development. EMBO J. 7, 2621-2629.

Settharaksa, S., Jongjareonrak, A., Hmadhlu, P., Chansuwan, W., Siripongvutikorn, S.,

2012. Flavonoid, phenolic contents and antioxidant properties of Thai hot curry paste

extract and its ingredients as affected of pH, solvent types and high temperature. Int.

Food Res. J. 19, 1581–1587.

Shen, X., Isogai, A., Furihata, K., Sun, H., Suzuki, A., 1993. Two neo-clerodane

diterpenoids from Ajuga macrosperma. Phytochemistry 33, 887-889.

Shkryl, Y., Veremeichik, G., Bulgakov, V., Zhuravlev, Y., 2011. Induction of

anthraquinone biosynthesis in Rubia cordifolia cells by heterologous expression of a

calcium dependent protein kinase gene. Biotechnol. Bioeng. 108, 1734-1738.

Shkryl, Y. N., Veremeichik, G. N., Bulgakov, V. P., Tchernoded, G. K., Mischenko, N.

P., Fedoreyev, S. A., Zhuravlev, Y. N., 2008. Individual and combined effects of the

rolA, B, and C genes on anthraquinone production in Rubia cordifolia transformed calli.

Biotechnol. Bioeng. 100, 118-125.

Singh, N., Mahmood, U., Kaul, V., Jirovetz, L., 2006. A new phthalic acid ester from

Ajuga bracteosa. Nat. Prod. Res. 20, 593-597.

Singh, R., Patil, S., Pal, G., Ahmad, M., 2012. Evaluation of in vivo and in vitro anti-

inflammatory activity of Ajuga bracteosa Wall ex Benth. Asian Pac. J. Trop. Dis. 2, 404-

407.

Sivaci, A., Duman, S., 2014. Evaluation of seasonal antioxidant activity and total

phenolic compounds in stems and leaves of some almond (Prunus amygdalus L.)

varieties. Biol. Res. 47, 1-5.

Skadhauge, B., Thomsen, K. K., Wettstein, D., 1997. The role of the barley testa layer

and its flavonoid content in resistance to Fusarium infections. Hereditas 126, 147-160.

Slama, K., Koudela, K., Tenora, J., Maťhová, A., 1996. Insect hormones in vertebrates:

anabolic effects of 20-hydroxyecdysone in Japanese quail. Experientia 52, 702-706.

Sláma, K., Lafont, R., 1995. Insect hormones-ecdysteroids: their presence and actions in

vertebrates. Eur. J. Entomol. 92, 355-355.

Slightom, J. L., Durand-Tardif, M., Jouanin, L., Tepfer, D., 1986. Nucleotide sequence

analysis of TL-DNA of Agrobacterium rhizogenes agropine type plasmid. Identification

of open reading frames. J. Biol. Chem. 261, 108-121.

Song, L. L., Kosmeder, J. W., Lee, S. K., Gerhäuser, C., Lantvit, D., Moon, R. C.,

Moriarty, R. M., Pezzuto, J. M., 1999. Cancer chemopreventive activity mediated by 4′-

151

bromoflavone, a potent inducer of phase II detoxification enzymes. Cancer Res. 59, 578-

585.

Soriano, I. R., Riley, I. T., Potter, M. J., Bowers, W. S., 2004. Phytoecdysteroids: a novel

defense against plant-parasitic nematodes. J. Chem. Ecol. 30, 1885-1899.

Spena, A., Schmülling, T., Koncz, C., Schell, J., 1987. Independent and synergistic

activity of rol A, B and C loci in stimulating abnormal growth in plants. EMBO J. 6,

3891.

Stachel, S. E., Messens, E., Van Montagu, M., Zambryski, P., 1985. Identification of the

signal molecules produced by wounded plant cells that activate T-DNA transfer in

Agrobacterium tumefaciens. Nature 318, 624-629.

Steinberg, D., 1997. Low density lipoprotein oxidation and its pathobiological

significance. J. Biol. Chem. 272, 20963-20966.

Sun, L.-Y., Monneuse, M.-O., Martin-Tanguy, J., Tepfer, D., 1991. Changes in

flowering and the accumulation of polyamines and hydroxycinnamic acid-polyamine

conjugates in tobacco plants transformed by the rolA locus from the Ri TL-DNA of

Agrobacterium rhizogenes. Plant Sci. 80, 145-156.

Švábová, L., Griga, M., 2008. The effect of cocultivation treatments on transformation

efficiency in pea (Pisum sativum L.). Plant Cell Tiss. Org. Cult. 95, 293-304.

Syrov, V., 1983. Mechanism of the anabolic action of phytoecdisteroids in mammals.

Nauchnye Doki. Vyss. Shkoly Biol. Nauki., pp. 16-20.

Syrov, V., Khushbaktova, Z., 2000. Experimental study of pharmacotherapeutic effect of

phytoecdisteroids and nerobol in toxic liver damage. Eksp. Klin. Farmakol. 64, 56-58.

Syrov, V., Khushbaktova, Z., Nabiev, A., 1991a. An experimental study of the

hepatoprotective properties of phytoecdysteroids and nerobol in carbon tetrachloride-

induced liver lesion. Eksp. Klin. Farmakol. 55, 61-65.

Syrov, V., Tashmukhamedova, M., Khushbaktova, Z., Mirtalipov, D., Mamatkhanov, A.,

1991b. Effect of phytoecdysteroids and nerobol on parameters of carbohydrate and lipid

metabolism and phospholipid spectrum of liver mitochondrial membrane in experimental

diabetes mellitus of rats. Ukr. Biokhim. Zh. 64, 61-67.

Syrov, V. N., Nasyrova, S. S., Khushbaktova, Z. A., 1996. The results of experimental

study of phytoecdysteroids as erythropoiesis stimulators in laboratory animals. Eksp.

Klin. Farmakol. 60, 41-44.

Takasaki, M., Tokuda, H., Nishino, H., Konoshima, T., 1999. Cancer chemopreventive

agents (Antitumor-promoters) from Ajuga decumbens. J. Nat. Prod. 62, 972-975.

Tanaka, N., Matsumoto, T., 1993a. Characterization of Ajuga plants regenerated from

hairy roots. Plant Tiss. Cult. Lett. 10, 78-83.

152

Tanaka, N., Matsumoto, T., 1993b. Regenerants from Ajuga hairy roots with high

productivity of 20-hydroxyecdysone. Plant Cell Rep. 13, 87-90.

Tashmukhamedova, M., Almatov, K., Syrov, V., Sultanov, M., Abidov, A., 1985.

Comparative study of the effect of ecdysterone, turkesterone and nerobol on the function

of rat liver mitochondria in experimental diabetes. Vopr. Med. Khim. 32, 24-28.

Taylor, G. R., 1991. Polymerase chain reaction: basic principles and automation. In:

McPherson MJ, Quirka P, Taylor GR (Eds), PCR. A practical approach. IRL Press,

Oxford, UK. pp., 1-14.

Tepfer, D., 1984. Transformation of several species of higher plants by Agrobacterium

rhizogenes: sexual transmission of the transformed genotype and phenotype. Cell 37,

959-967.

Thummel, C. S., Chory, J., 2002. Steroid signaling in plants and insects-common themes,

different pathways. Genes Dev. 16, 3113-3129.

Toma, W., Gracioso, J. d. S., Hiruma-Lima, C., Andrade, F. d., Vilegas, W., Brito, A. S.,

2003. Evaluation of the analgesic and antiedematogenic activities of Quassia amara bark

extract. J. Ethnopharmacol. 85, 19-23.

Tomás, J., Camps, F., Coll, J., Melé, E., Messeguer, J., 1993. Phytoecdysteroid

production by Ajuga reptans tissue cultures. Phytochemistry 32, 317-324.

Trenin, D. S., Volodin, V. V., 1999. 20‐hydroxyecdysone as a human lymphocyte and

neutrophil modulator: In vitro evaluation. Arch. Insect Biochem. Physiol. 41, 156-161.

Tuleuov, B., 2009. 20-Hydroxyecdysone content of several representatives of the

families Asteraceae and Caryophyllaceae. Chem. Nat. Compd. 45, 762-763.

Turkmen, N., Sari, F., Velioglu, Y. S., 2006. Effects of extraction solvents on

concentration and antioxidant activity of black and black mate tea polyphenols

determined by ferrous tartrate and Folin–Ciocalteu methods. Food Chem. 99, 835-841.

Ul-Haq, I., Ullah, N., Bibi, G., Kanwal, S., Ahmad, M. S., Mirza, B., 2012. Antioxidant

and cytotoxic activities and phytochemical analysis of Euphorbia wallichii root extract

and its fractions. Iran. J. Pharm. Res. 11, 241.

Uozumi, N., Kohketsu, K., Kobayashi, T., 1993. Growth and kinetic parameters of Ajuga

hairy root in fed batch culture on monosaccharide medium. J. Chem. Technol.

Biotechnol. 57, 155-161.

Uozumi, N., Makino, S., Kobayashi, T., 1995. 20-Hydroxyecdysone production in Ajuga

hairy root controlling intracellular phosphate content based on kinetic model. J. Ferment.

Bioeng. 80, 362-368.

Uozumi, N., Ohtake, Y., Nakashimada, Y., Morikawa, Y., Tanaka, N., Kobayashi, T.,

1996. Efficient regeneration from GUS- transformed Ajuga hairy root. J. Ferment.

Bioeng. 81, 374-378.

153

Upadhyay, S., Patel, V., Patel, A., Upadhyay, U., Patel, N., 2012. Ajuga bracteosa: A

promising herb. Pharma Sci. Monitor 3, 2085-2104.

Uprety, Y., Asselin, H., Dhakal, A., Julien, N., 2012. Traditional use of medicinal plants

in the boreal forest of Canada: review and perspectives. J. Ethnobiol. Ethnomed. 8, 1-14.

Veena, V., Taylor, C. G., 2007. Agrobacterium rhizogenes: recent developments and

promising applications. In Vitro Cell. Dev. Biol. Plant 43, 383-403.

Vereskovskii, V., Chekalinskaya, I., Pashina, G., 1983. Dynamics of contents of

ecdisterone in species of the genus Rhaponticum. Rastit. Resur. 19, 60-65.

Verma, V. H., Mahmood, U., Singh, B., 2002. Clerodane diterpenoids from Ajuga

bracteosa Wall. Nat. Prod. Lett. 16, 255-259.

Vilaine, F., Casse-Delbart, F., 1987. Independent induction of transformed roots by the

TL and TR regions of the Ri plasmid of agropine type Agrobacterium rhizogenes. Mol.

Gen. Genet. 206, 17-23.

Vohra, A., Kaur, H., 2011. Chemical investigation of medicinal plant Ajuga bracteosa. J.

Nat. Prod. Plant Resour. 1, 37-45.

Wang, Q. J., Zheng, L. P., Sima, Y. H., Yuan, H. Y., Wang, J. W., 2013. Methyl

jasmonate stimulates 20-hydroxyecdysone production in cell suspension cultures of

Achyranthes bidentata. Plant Omics 6, 116-120.

Wang, Q. J., Zheng, L. P., Zhao, P. F., Zhao, Y. L., Wang, J. W., 2014a. Cloning and

characterization of an elicitor-responsive gene encoding 3-hydroxy-3-methylglutaryl

coenzyme A reductase involved in 20-hydroxyecdysone production in cell cultures of

Cyanotis arachnoidea. Plant Physiol. Biochem. 84, 1-9.

Wang, W., Wang, T., Feng, W.-Y., Wang, Z.-Y., Cheng, M.-S., Wang, Y.-J., 2014b.

Ecdysterone protects gerbil brain from temporal global cerebral ischemia/reperfusion

injury via preventing neuron apoptosis and deactivating astrocytes and microglia cells.

Neurosci. Res. 81, 21-29.

Warren, J. T., Petryk, A., Marques, G., Jarcho, M., Parvy, J. P., Dauphin-Villemant, C.,

O'Connor, M. B., Gilbert, L. I., 2002. Molecular and biochemical characterization of two

P450 enzymes in the ecdysteroidogenic pathway of Drosophila melanogaster. Proc.

Natl. Acad. Sci. USA. 99, 11043-11048.

Weiss, M. R., 1995. Floral color change: a widespread functional convergence. Am. J.

Bot., 167-185.

White, F. F., Nester, E. W., 1980. Hairy root: plasmid encodes virulence traits in

Agrobacterium rhizogenes. J. Bacteriol. 141, 1134-1141.

Winrow, V., Winyard, P., Morris, C., Blake, D., 1993. Free radicals in inflammation:

second messengers and mediators of tissue destruction. Br. Med. Bull. 49, 506-522.

154

Winter, C. A., Risley, E. A., Nuss, G. W., 1962. Carrageenin-induced edema in hind paw

of the rat as an assay for antiinflammatory drugs. Exp. Biol. Med. 111, 544-547.

Wu, J. J., Cheng, K. W., Wang, H., Ye, W. C., Li, E. T., Wang, M., 2009. Simultaneous

determination of three phytoecdysteroids in the roots of four medicinal plants from the

genus Asparagus by HPLC. Phytochem. Anal. 20, 58-63.

Wu, X., 2000. Use of ecdysteroids in preparing medicine for angiocardiopathy.

Application CN 12119, 200000731.

Wu, X., Jiang, Y., Fan, S., 1997. Effect of ecdysterone on lung contusion from impact.

Chin. J. Traumatol. 13, 295-296.

Xie, Q., Kashiwabara, Y., Nathan, C., 1994. Role of transcription factor NF-KB/Rel in

induction of nitric oxide synthase. J. Biol. Chem. 269, 4705-4708.

Yadav, S. K., Katikala, S., Yellisetty, V., Kannepalle, A., Narayana, J. L., Maddi, V.,

Mandapaka, M., Shanker, A. K., Bandi, V., Bharadwaja, K. P., 2012. Optimization of

Agrobacterium mediated genetic transformation of cotyledonary node explants of Vigna

radiata. SpringerPlus 1, 1-8.

Yang, L., Stöckigt, J., 2010. Trends for diverse production strategies of plant medicinal

alkaloids. Nat. Prod. Rep. 27, 1469-1479.

Yilmaz, Y., Toledo, R. T., 2004. Health aspects of functional grape seed constituents.

Trends Food Sci. Technol. 15, 422-433.

Yonekura-Sakakibara, K., Nakayama, T., Yamazaki, M., Saito, K., 2009. Modification

and stabilization of anthocyanins. Anthocyanins. Springer, pp. 169-190.

Zainol, M., Abd-Hamid, A., Yusof, S., Muse, R., 2003. Antioxidative activity and total

phenolic compounds of leaf, root and petiole of four accessions of Centella asiatica (L.)

Urban. Food Chem. 81, 575-581.

Zambryski, P., Joos, H., Genetello, C., Leemans, J., Vanmontagu, M., Schell, J., 1983.

Ti-plasmid vector for the introduction of DNA into plant cells without alteration of their

normal regeneration capacity. EMBO J. 2, 2143-2150.

Zibareva, L., 1997. The prognosis of the presence of ecdysteroids among the species

Silene L. and Chenopodium L. to their contents in the seeds. Rastit. Resur. 33, 89-92.

Zuker, A., Tzfira, T., Scovel, G., Ovadis, M., Shklarman, E., Itzhaki, H., Vainstein, A.,

2001. RolC-transgenic carnation with improved horticultural traits: quantitative and

qualitative analyses of greenhouse-grown plants. J. Am. Soc. Hort. Sci. 126, 13-18.

Zulfiker, A., Rahman, M. M., Hossain, M. K., Hamid, K., Mazumder, M., Rana, M. S.,

2010. In vivo analgesic activity of ethanolic extracts of two medicinal plants-Scoparia

dulcis L. and Ficus racemosa Linn. Biol. Med. 2, 42-48.

155

Zupan, J. R., Zambryski, P., 1995. Transfer of T-DNA from Agrobacterium to the plant

cell. Plant Physiol. 107, 1041.

156

Publications

Kayani, W. K., Rani, R., Ihsan-ul-Haq, Mirza, B., 2014. Seasonal and geographical

impact on the morphology and 20-hydroxyecdysone content in different tissue types of

wild Ajuga bracteosa Wall. ex Benth. Steroids 87, 2-20.

Kayani, W. K., Palazòn, J., Rosa M. Cusidò, R. M., Mirza, B. 2016. The effect of rol

genes on phytoecdysteroid biosynthesis in Ajuga bracteosa differs between transgenic

plants and hairy roots. RSC Advances. DOI: 10.1039/C6RA00250A.

Kayani, W. K., Fattahi, M., Palazòn, J., Cusidò R. M., Mirza, B., 2016. Comprehensive

screening of influential factors in the Agrobacterium tumefaciens-mediated

transformation of the Himalayan elixir: Ajuga bracteosa Wall. ex. Benth. Journal of

Applied Research on Medicinal and Aromatic Plants. (Accepted).

Kayani, W. K., Ahmed, T., Ismail, H., Dilshad, E., Mirza, B. 2016. Evaluation of Ajuga

bracteosa for antioxidant, anti-inflammatory, analgesic, antidepressant and anticoagulant

activities. J. Ethnopharmacol. (Under review in Journal of Ethnopharmacol.).

Gallego, A., Karla, R. E., Heriberto, R. V.-L., Diego, H., Liliana, L., Kayani, W. K.,

Cusido, R. M., Palazon, J., 2014. Biotechnological production of centellosides in cell

cultures of Centella asiatica (L) Urban. Eng. Life Sci. 14(6): 633-642.

Kayani, W. K., Palazòn, J., Cusidò R. M., Moyano, E., Mirza, B., 2016. Effect of pRi T-

DNA genes and elicitation on morphology and phytoecdysteroids biosynthesis in hairy

roots of Ajuga bracteosa. (Submitted).

Kayani, W. K., Rubnawaz, S., Ihsan-ul-Haq, Kondrytuk, T. P., Pezzuto, J. M., Mirza,

B., 2016. Cancer inhibitory potential of Ajuga bracteosa Wallich ex Bentham.

(Manuscript).

Kayani, W. K., Ihsan-ul-Haq, Palazòn, J., Cusidò R. M., Bonfill, M., Mirza, B., 2016.

Seasonal and geographical impact on the morphology, phytoecdysteroid content and

antioxidant activities in different tissue types of wild Ajuga bracteosa Wall. ex Benth.

(Manuscript).

15%SIMILARITY INDEX

8%INTERNET SOURCES

14%PUBLICATIONS

3%STUDENT PAPERS

1 1%

2 1%

3 <1%

4 <1%

5 <1%

PhD ThesisORIGINALITY REPORT

PRIMARY SOURCES

www.ncbi.nlm.nih.govInternet Source

Dinan, L.. "Phytoecdysteroids: biologicalaspects", Phytochemistry, 200106Publicat ion

www.biomedcentral.comInternet Source

Arun Kumar. "Seasonal low temperatureplays an important role in increasingmetabolic content of secondary metabolitesin Withania somnifera (L.) Dunal and affectsthe time of harvesting", Acta PhysiologiaePlantarum, 03/02/2012Publicat ion

Archer, Crystal R., Michael Groll, Martin L.Stein, Barbara Schellenberg, Jérôme Clerc,Markus Kaiser, Tamara P. Kondratyuk, JohnM. Pezzuto, Robert Dudler, and André S.Bachmann. "Activity Enhancement of theSynthetic Syrbactin Proteasome InhibitorHybrid and Biological Evaluation in TumorCells", Biochemistry, 2012.

Waqas Khan Kayani

Typewriter

Waqas Khan Kayani

Waqas Khan Kayani

Typewriter

Department of Biochemistry Faculty of Biological Sciences...

Documents

Transcript of Department of Biochemistry Faculty of Biological Sciences...

waqas mtrl kitkat

Strategies Employed Article by Khurram Kayani

Waqas Report

Bonds by Waqas Maqsod

Waqas Khaliq

Lean-Manufacturing-Fizza & Waqas (Final)

Professional English Presentation Waqas 15129145

Tv camera....by sajjad kayani

MATTIAS PERSSON WAQAS BAIG

Object oriented programming by Waqas

Waqas analysis

Thesis Report Waqas

Types of lenses by Sajjad Kayani

Muhammad Waqas Hussain's CV

Final Project Haier Waqas Post Mid

Videography by sajjad kayani .

Muhammad Waqas Advertising and Public Relations Muhammad Waqas.

Kayani Legal Litigation Department

WAQAS KHAN - prr.hec.gov.pk

Hazrat usman (R.A) by waqas malik