Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) "...
Transcript of Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) "...
![Page 1: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/1.jpg)
Dal proge*o genoma umano ad oggi: evoluzione delle tecniche di
sequenziamento, analisi genomica e proteomica e prospe9ve future!
David Horner Dipar.mento di Bioscienze Università degli Studi di Milano
![Page 2: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/2.jpg)
Come va sequenziato il DNA?
• Sequenziamento Sanger (1978 – oggi): – Cos. rela.vamente al. – Richiede molto tempo per preparazione di campioni – Produce poche leLuri LUNGHI (1000 nt) – Pochi errori di sequenziamento
![Page 3: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/3.jpg)
Sequenziamento Sanger (1978)
![Page 4: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/4.jpg)
Sequenziamento Sanger (1978)
![Page 5: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/5.jpg)
Genome
1) Frammentare in modo “casuale”, clonare fammen. in plasmidi
2) Sequenziare un fragmento (a caso)
3) Individuare un clone sovraposto …. Sequenziarlo e costruire un frammento piu lungo
4) Andare al passaggio 2 (fino alla fine!)
![Page 6: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/6.jpg)
viruses plasmids
bacteria fungi
plants algae
insects
mollusks
rep.les
birds
mammals
Genomi, quanto sono grandi ?
104 108 105 106 107 1011 1010 109
bony fish
amphibians
![Page 7: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/7.jpg)
![Page 8: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/8.jpg)
Sequenziamento Sanger (anni 1990)
96 reazioni in parallelo 1000 nt x reazione
![Page 9: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/9.jpg)
Robot!
![Page 10: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/10.jpg)
1981 • Sinclair ZX-‐81
![Page 11: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/11.jpg)
Computer
![Page 12: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/12.jpg)
Whole Genome Shotgun Approach
![Page 13: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/13.jpg)
Assembly by overlap
![Page 14: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/14.jpg)
Sequenze Ripetute
Sequenze uniche
Sequenze ripetute
Se le sequenze ripetute sono meno lunghe del “leLure” di sequenziamento, non c’è problema
A B C
![Page 15: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/15.jpg)
A B C
Sequenze Ripetute
Se sono piu lunghi, NON POSSIAMO ASSEMBLARE!
A B c ?
A C B ?
![Page 16: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/16.jpg)
Steps to Assemble a Genome
1. Find overlapping reads
4. Derive consensus sequence ..ACGATTACAATAGGTT..
2. Merge some “good” pairs of reads into longer contigs
3. Link contigs to form supercontigs
Some Terminology read a 500-‐900 long word that comes
out of sequencer mate pair a pair of reads from two ends
of the same insert fragment con-g a con.guous sequence formed
by several overlapping reads with no gaps
supercon-g an ordered and oriented set (scaffold) of con.gs, usually by mate
pairs consensus sequence derived from the sequene mul.ple alignment of reads
in a con.g
![Page 17: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/17.jpg)
Con.gs and scaffolds
![Page 18: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/18.jpg)
1. Genome fragmentation
2. Library
3. Sequences 4. Genome assembly by overlap
Shot Gun Sequencing
![Page 19: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/19.jpg)
Timeline
![Page 20: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/20.jpg)
Meet Your Genome
(The Wheat genome (16.9 Gbp) is more than 5 .mes bigger than the human genome and 80% of its genome consists of repe..ve sequences)
The Human Genome
![Page 21: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/21.jpg)
Quanto è COMPLESSO il genoma?
(Il Genoma di FRUMENTO (16.9 Gbp) è piu di 5 VOLTE piu grande di quello umano. 80% consiste di elemen. ripetu.)
Il genoma Umano c. 3Gb
![Page 22: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/22.jpg)
Physical Mapping
![Page 23: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/23.jpg)
Top down sequencing
1. 2.
3. 4.
Genome fragmentation
Physical map
Subclone library
Sequence clones by walking or by SHOTGUN strategy
![Page 24: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/24.jpg)
Human Genome Project 16/02/2001
![Page 25: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/25.jpg)
OK, abbiamo sequenziato il genoma …. Ora che cosa fare?
Dove sono I geni? Sequenziare ed allineare cDNA (mRNA) al genoma
![Page 26: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/26.jpg)
Ma quali gene/allele sono responsabile per feno.pi di interesse?
Dobbiamo paragonare genomi di tan. individui diversi e fare sta.s.ca per capire feno.pi complessi …. Cioè, dobbiamo sequenziare TANTI individui della stessa specie ed associare feno.pi con geno.pi. Genome Wide Associa.on Studies (GWAS)
![Page 27: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/27.jpg)
“GWAS” + “Human” nella leLeratura Prima di 2004 (60 ar.coli) Da 2004 in poi (>14000 ar.coli) Sono sta. sequenzia. > 10000 genomi umani da 2004 in poi,
Come è stato faLo?
![Page 28: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/28.jpg)
Revolu.onary techniques in molecular gene.cs
Molecular cloning Sanger sequencing PCR
Gel Electrophoresis Bloung (Southern/Northern/Western etc) Expression cloning (microarrays)
Next Genera.on Sequencing
![Page 29: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/29.jpg)
Next Genera.on Sequencing
• (Massively Parallel /Second Genera.on) • HIGH throughput (lots of data) • Rela.vely low cost • Transversal in terms of applica.on
![Page 30: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/30.jpg)
Read Length is Not As Important For Resequencing
0%
10%20%
30%40%
50%
60%70%
80%90%
100%
8 10 12 14 16 18 20
Length of K-mer Reads (bp)
% o
f P
aire
d K
-mer
s w
ith U
niqu
ely
Ass
igna
ble
Loca
tion
E.COLIHUMAN
![Page 31: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/31.jpg)
Cost per megabase of DNA sequence
![Page 32: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/32.jpg)
Next-Generation Sequencing
Illumina / Solexa Gene.c Analyzer HiSeq 2000 (150x2 bp, 600 Gb / run)
Applied Biosystems SOLiD 4 SystemTM
(100x2 bp, 400 Gb / run)
Roche / 454 Genome Sequencer FLX .tanium (800 bp, 800 Mb / run)
Ion Proton PacBio
A number of platforms using different strategies and chemistries, and with different throughput are entering the market.
![Page 33: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/33.jpg)
Fold coverage % sequenced 0.25 22 0.5 39 0.75 53 1 63 2 87.5 3 95 4 98.2 5 99.4 6 99.75 7 99.91 8 99.97 9 99.99 10 99.995
When has a genome been fully sequenced?
![Page 34: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/34.jpg)
Illumina
• Bridge PCR
• Sequencing by synthesis using fluorescent reversible terminators
![Page 35: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/35.jpg)
Technology Overview: Solexa/Illumina Sequencing
http://www.illumina.com/
![Page 36: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/36.jpg)
Immobilize DNA to Surface
Source: www.illumina.com
![Page 37: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/37.jpg)
Technology Overview: Solexa Sequencing
![Page 38: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/38.jpg)
Bridge PCR
• DNA fragments are flanked with adaptors. • A flat surface coated with two types of primers, corresponding to the
adaptors. • Amplifica.on proceeds in cycles, with one end of each bridge
tethered to the surface. • Used by Solexa.
![Page 39: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/39.jpg)
Sequence Colonies
The bases are “reversible terminators”, only one base can be added. Then they are modified so that the next round of extension can occur.
![Page 40: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/40.jpg)
![Page 41: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/41.jpg)
Sequence Colonies
Each base has a different Fluor (color). Excited by laser, and color is read.
![Page 42: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/42.jpg)
Illumina sequencers sequencing-by-synthesis coupled with bridge amplification
Available versions: § HiSeq 2000 (up to 600 Gb, 250x2 bp reads)
§ HiSeq 1000 (up to 300 Gb, 250x2 bp reads)
§ Genome Analyzer (up to 95 Gb, 150x2 bp reads) § MiSeq pla=orm (up to 6 Gb, 250x2 bp reads)
![Page 43: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/43.jpg)
Da 2008
![Page 44: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/44.jpg)
![Page 45: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/45.jpg)
SNP calling • The basic principle is simple!
• This looks like a homozygous SNP
ACTTTTGCCCTGTGTCTAAAATGCGTCGTAGCATGT - reference!ACTTTTGCCCTGTGACTAAAATG ! ! !read1! TTGCCCTGTGACTAAAATGCGT! ! !read2! TGCCCTGTGACTAAAATGCGTA ! !read3! GCCCTGTGACTAAAATGCGTAG ! !read4! GCCCTGTGACTAAAATGCGTAG ! !read5! CCTGTGACTAAAATGCGTAGTAG ! !read6!
![Page 46: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/46.jpg)
SNP calling • And this one looks heterozygous
ACTTTTGCCCTGTGTCTAAAATGCGTCGTAGCATGT - reference!ACTTTTGCCCTGTGACTAAAATG ! ! !read1! TTGCCCTGTGTCTAAAATGCGT! ! !read2! TGCCCTGTGACTAAAATGCGTA ! !read3! GCCCTGTGTCTAAAATGCGTAG ! !read4! GCCCTGTGACTAAAATGCGTAG ! !read5! CCTGTGTCTAAAATGCGTAGTAG ! !read6!
![Page 47: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/47.jpg)
On average, we think that we will find a SNP (Single Nucleo.de
Polymorphism) between 2 Human individuals about every 2000 bases.
99.5% iden.ty
maybe 1,500,000 differences!
![Page 48: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/48.jpg)
Structural Variation (SV) l Any DNA sequence altera.on other than a single nucleo.de
subs.tu.on l copy number variations (CNV), l transposon movement l Expansion of trinucleotide and other simple repeats l insertions-deletions (indels) l translocations l inversions l the vast majority of SV events are small indels
• Human genomes differ more as a consequence of structural varia.on than of single-‐base-‐pair differences* – Causal events in hereditary diseases – somatic SV – markers for GWAS / mapping studies
![Page 49: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/49.jpg)
49
Copy Number Varia.on (CNVs)
so... how representative is the reference genome?
![Page 50: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/50.jpg)
![Page 51: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/51.jpg)
![Page 52: Dal progeo $genoma$umanoad oggi: evoluzione$delle ... · Structural Variation (SV) " Any"DNA"sequence"alteraon"other"than"asingle"nucleo.de" subs.tu.on" " copy number variations (CNV),](https://reader033.fdocuments.in/reader033/viewer/2022051808/600a77db5689071bbe315e3b/html5/thumbnails/52.jpg)
Applica.ons of NGS playorms
• DNA sequencing - genome resequencing (SNPs, CNV, GWAS) - de novo sequencing - identification of genome structural variants (cancer genome) - 3D chromatin interactions - Epigenomics (chromatin state and genome methylation) - Metagenomics (taxonomic analysis of environmental samples)
• RNA sequencing - Qualitative and quantitative analysis of the Transcriptome - Identification and characterization of miRNAs and other ncRNAs - RNA editing - Metatrancriptomics (functional analysis of envronmental samples)