DA Riechers et al. Nature 496 , 329-333 (2013) doi:10.1038/12050

1
DA Riechers et al. Nature 496, 329-333 (2013) doi:10.1038/12050 Redshift identification through molecular and atomic spectroscopy of HFLS 3.

description

Redshift identification through molecular and atomic spectroscopy of HFLS 3. DA Riechers et al. Nature 496 , 329-333 (2013) doi:10.1038/12050. - PowerPoint PPT Presentation

Transcript of DA Riechers et al. Nature 496 , 329-333 (2013) doi:10.1038/12050

Page 1: DA Riechers et al. Nature 496 , 329-333 (2013) doi:10.1038/12050

DA Riechers et al. Nature 496, 329-333 (2013) doi:10.1038/12050

Redshift identification through molecular and atomic spectroscopy of HFLS 3.

12050 CMS Report3

12050 CMS Report3

1 November 2007 doi:10.1038/nature06221 LETTERS

1 November 2007 doi:10.1038/nature06221 LETTERS

fixtures-8 · 2016. 2. 11. · W1265 0545 1-12050 MODEL-23 ftg W1204 0545 H2050 MODEL-25 ftþ W1265 0545 1-12050 MODEL-26 w1265 D545 H2150 MODEL-28 ftg W965 0545 H2150 MODEL-27 W1265

fixtures-8 · 2016. 2. 11. · W1265 0545 1-12050 MODEL-23 ftg W1204 0545 H2050 MODEL-25 ftþ W1265 0545 1-12050 MODEL-26 w1265 D545 H2150 MODEL-28 ftg W965 0545 H2150 MODEL-27 W1265

TEXAS BAY AND BAIT BUYBACK PROGRAM Robin Riechers Wade Griffin Richard Woodward.

TEXAS BAY AND BAIT BUYBACK PROGRAM Robin Riechers Wade Griffin Richard Woodward.

Aterramento Integrado Na Estrutura Do Poste - GED 12050 - 26-10-2007

Aterramento Integrado Na Estrutura Do Poste - GED 12050 - 26-10-2007

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

doi:10.1038/nature05150 LETTERS

doi:10.1038/nature05150 LETTERS

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

doi:10.1038/nature05202 LETTERS

doi:10.1038/nature05202 LETTERS

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Supplementary information - Nature · © 200 9 Macmillan Publishers Limited. ... 10.1038/nchem.290 Supplementary information 6 ... 10.1038/nchem.290 Supplementary information 7 Preparation

Supplementary information - Nature · © 200 9 Macmillan Publishers Limited. ... 10.1038/nchem.290 Supplementary information 6 ... 10.1038/nchem.290 Supplementary information 7 Preparation

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

17 September 2009 doi:10.1038/nature08355 LETTERS

17 September 2009 doi:10.1038/nature08355 LETTERS

Pressurized Portable Marine Fuel Tanks Mark Riechers.

Pressurized Portable Marine Fuel Tanks Mark Riechers.

Macroporous nanowire nanoelectronic scaffolds …cmliris.harvard.edu/assets/10.1038-nmat3404.pdfARTICLES PUBLISHED ONLINE: 26 AUGUST 2012 |DOI:10.1038/NMAT3404 Macroporous nanowire

Macroporous nanowire nanoelectronic scaffolds …cmliris.harvard.edu/assets/10.1038-nmat3404.pdfARTICLES PUBLISHED ONLINE: 26 AUGUST 2012 |DOI:10.1038/NMAT3404 Macroporous nanowire

Ronald Riechers, MD - Cleveland FES Center · 2019. 5. 2. · Health Care Heroes Award. OF PATES OV . Title: Ronald Riechers Created Date: 2/24/2016 8:32:29 AM ...

Ronald Riechers, MD - Cleveland FES Center · 2019. 5. 2. · Health Care Heroes Award. OF PATES OV . Title: Ronald Riechers Created Date: 2/24/2016 8:32:29 AM ...

DOI: 10.1038/NPHYS3211 Supplementary Information for ...

DOI: 10.1038/NPHYS3211 Supplementary Information for ...

JOANIE SAMMONS, MICHELLE RIECHERS, AND NICOLE ADAMSON Renaissance Art.

JOANIE SAMMONS, MICHELLE RIECHERS, AND NICOLE ADAMSON Renaissance Art.

GI Motility online (May 2006) | doi:10.1038/gimo12

GI Motility online (May 2006) | doi:10.1038/gimo12