Cytological Characterization of YpsB, a Novel Component of the … · MinD and is modulated by the...

JOURNAL OF BACTERIOLOGY, Nov. 2008, p. 7096–7107 Vol. 190, No. 210021-9193/08/$08.00�0 doi:10.1128/JB.00064-08Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Cytological Characterization of YpsB, a Novel Component of theBacillus subtilis Divisome�†

Jose Roberto Tavares, Robson F. de Souza, Guilherme Louzada Silva Meira, andFrederico J. Gueiros-Filho*

Departamento de Bioquímica, Instituto de Química, Universidade de Sao Paulo, Sao Paulo, Brazil

Received 13 January 2008/Accepted 25 August 2008

Cell division in bacteria is carried out by an elaborate molecular machine composed of more than a dozenproteins and known as the divisome. Here we describe the characterization of a new divisome protein in Bacillussubtilis called YpsB. Sequence comparisons and phylogentic analysis demonstrated that YpsB is a paralog ofthe division site selection protein DivIVA. YpsB is present in several gram-positive bacteria and likelyoriginated from the duplication of a DivIVA-like gene in the last common ancestor of bacteria of the ordersBacillales and Lactobacillales. We used green fluorescent protein microscopy to determine that YpsB localizesto the divisome. Similarly to that for DivIVA, the recruitment of YpsB to the divisome requires late divisionproteins and occurs significantly after Z-ring formation. In contrast to DivIVA, however, YpsB is not retainedat the newly formed cell poles after septation. Deletion analysis suggests that the N terminus of YpsB isrequired to target the protein to the divisome. The high similarity between the N termini of YpsB and DivIVAsuggests that the same region is involved in the targeting of DivIVA. YpsB is not essential for septum formationand does not appear to play a role in septum positioning. However, a ypsB deletion has a synthetic effect whencombined with a mutation in the cell division gene ftsA. Thus, we conclude that YpsB is a novel B. subtilis celldivision protein whose function has diverged from that of its paralog DivIVA.

It is currently recognized that many biochemical processes inbacterial cells are carried out by elaborate macromolecularmachines (36). The case of bacterial division is no exception, asit requires the coordinated action of at least 15 proteins thatexist as a dynamic assembly known as divisome or septalsome.The divisome is a contractile protein ring that promotes theinvagination of the different layers of the bacterial envelope(typically, cytoplasmic membrane and cell wall in the case ofgram positives and cytoplasmic membrane, cell wall, and outermembrane in the case of gram negatives), culminating with theformation of the division septum (for recent reviews, see ref-erences 15, 17, and 21).

Divisome proteins can be subdivided into three groups, orsubcomplexes, based on their presumed function and how theyassemble into the complex (53). The first of these groups hasbeen called the “cytoplasmic protoring” and contains the ubiq-uitous tubulin-like protein FtsZ and several proteins that in-teract directly with FtsZ (for reviews, see references 31 and44). Similarly to tubulin, FtsZ is capable of self-assembling intoorganized polymers. Polymerization of FtsZ into the properring structure and association of the ring with the inner face ofthe cytoplasmic membrane requires the aid of the FtsZ-bind-ing proteins, notably FtsA (26, 39), ZapA (18), and SepF(YlmF) (20, 25) in the case of Bacillus subtilis. The cytoplasmicprotoring is the structural scaffold of the divisome and deter-mines where division will happen by recruiting a group of

proteins that are known as the “peptidoglycan factory” sub-complex. The peptidoglycan factory, which includes the sep-tum-specific transpeptidase PBP 2B (PBP 3 in Escherichia coli)(7), the putative peptidoglycan precursor transporter FtsW,and, presumably, enzymes with transglycosylase and amidaseactivities, is responsible for redirecting cell wall synthesis,which occurs longitudinally during growth and becomes or-thogonal to cell length during septation. The connection be-tween the peptidoglycan factory and the cytoplasmic protoringis performed by the third divisome subcomplex. This complex,known as the “periplasmic connector,” includes the small bi-topic proteins DivIB (FtsQ in E. coli), DivIC (FtsB in E. coli),and FtsL (8, 9, 23, 28). No recognizable enzymatic function hasbeen attributed to any of these proteins. Recent evidence,however, suggests that the periplasmic connector may regulatethe timing of divisome maturation through the availability ofFtsL, one of its components (3).

In addition to the components described above, proper celldivision requires proteins that control the site of divisomeassembly to ensure that a progenitor cell will give rise to twoidentical daughter cells, each containing a complete chromo-some. The best-studied regulators of division position are theMinC and MinD proteins (for reviews, see references 30 and45). MinC is an inhibitor of FtsZ polymerization (24) that actsin conjunction with MinD to prevent improper divisome as-sembly at the cell poles. The ability of the MinCD complex toinhibit polar division stems from the fact that the MinCDproteins are themselves localized at the cell poles (32, 43). InE. coli, the polar localization of MinCD results from a peculiaroscillatory behavior of the MinCD complex, which shuttlesfrom one end of the cell to the other with a period of 1 minute(43). Oscillation of MinCD in E. coli is a self-organizing be-havior that originates from intrinsic biochemical properties of

* Corresponding author. Mailing address: Departamento de Bio-química, Instituto de Química, Universidade de Sao Paulo, Av. Prof.Lineu Prestes 748, 05508-000 Sao Paulo, SP, Brazil. Phone: 55-11-3091-8520. Fax: 55-11-3091-2186. E-mail: [email protected].

† Supplemental material for this article may be found at http://jb.asm.org/.

� Published ahead of print on 5 September 2008.

7096

on July 10, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

https://crossmark.crossref.org/dialog/?doi=10.1128/JB.00064-08&domain=pdf&date_stamp=2008-11-01

http://jb.asm.org/

MinD and is modulated by the protein MinE. In the absence ofMinE, oscillation does not occur (43). Thus, MinE is known asthe topological specificity factor of E. coli’s Min system. In B.subtilis, the MinCD complex is also polarly localized (32).However, targeting of MinCD to the poles occurs by a verydifferent mechanism. First, the MinCD complex does not ex-hibit oscillatory behavior in this species (32). In addition, B.subtilis lacks MinE and instead uses an unrelated protein,DivIVA, as its topological specificity factor (4, 11). DivIVA isa 165-amino-acid protein with extensive coiled-coil regionsthat has been shown to associate with the divisome complex ata late stage in its assembly (32). Thus, DivIVA targets theMinCD complex to the poles by first associating with the divi-sion complex at the nascent septum. Retention of DivIVA andthe associated MinCD at the division site after septation iscomplete results in the accumulation of the three proteins atthe newly formed cell poles. In addition to controlling divisionposition, DivIVA plays a second important function in B. sub-tilis, also related to its ability to associate with the cell poles. Atthe onset of sporulation, chromosomes must be rearrangedinto the axial filament, an extended structure in which theirorigin regions become fastened to the cell poles. Fastening ofthe origins to the cell poles appears to be mediated by aninteraction between DivIVA, at the cell poles, and two DNAbinding proteins, RacA and Soj, which serve as adapter pro-teins between the chromosome and DivIVA (2, 51, 57).

Here, we characterize YpsB, a new divisome protein of B.subtilis. YpsB is a paralog of DivIVA present in several gram-positive bacteria. Similarly to DivIVA, YpsB is a divisomecomponent that associates with the complex late in its assem-bly. In contrast with DivIVA, however, YpsB is not retained atcell poles and does not appear to be involved in division siteselection or axial filament formation. Instead, we found thatYpsB is a protein required for efficient division in cells lackingFtsA. Thus, YpsB is a new B. subtilis cell division proteinwhose function has diverged from that of its paralog DivIVA.

MATERIALS AND METHODS

General methods. All B. subtilis strains were derived from the prototrophicstrain PY79 (58) and are listed in Table 1. B. subtilis was grown in LB mediumat 37°C unless indicated otherwise. Preparation of competent cells and transfor-mation of B. subtilis were performed according to the protocol previously re-ported by Kunst and Rapoport (27). When necessary, various concentrations ofisopropyl-�-D-thiogalactopyranoside (IPTG), xylose, and/or antibiotics wereadded to the B. subtilis culture. Antibiotics were used at the following concen-trations: for chloramphenicol, 5 �g/ml; for erythromycin plus lincomycin, 1 �g/mland 25 �g/ml; for spectinomycin, 100 �g/ml; for kanamycin, 10 �g/ml; and fortetracycline, 10 �g/ml.

DNA methods. DNA manipulations and cloning were carried out according tostandard methods (46). Phusion DNA polymerase (NEB) was used in PCRs.Oligonucleotide primers were purchased from IDT (Coralville, IA) and are listedin Table 2. Sequencing was carried out by the sequencing service of the Depar-tamento de Bioquímica, IQ-USP. Plasmids and their relevant characteristics arelisted in Table 1. Plasmid construction is described in detail in the supplementalmaterial. Sequences and maps of the plasmids are available upon request.

Strain construction. The construction of the ypsB deletion is described below.For all other strains, see the supplemental material.

The ypsB deletion mutant was created by transformation of competent cellswith a PCR-generated fragment containing ypsB flanking sequences and a kandrug resistance cassette. The deletion of ypsB extends from nucleotide �6 to 291relative to the gene’s coding region. This fragment was constructed according toestablished “long flanking homology” PCR protocols (55). Briefly, ypsB upstreamand downstream flanking regions were amplified in a first round of PCR usingoligonucleotides OFG158 plus OFG159 and OFG160 plus OFG161, respec-

TABLE 1. Strains and plasmids

Strain or plasmid Relevant genotype Referenceor source

B. subtilis strainsPY79 Prototroph 58FG91 amyE::Pxyl-divIVA (cat) This workFG96 amyE::Pxyl-divIVA-gfp (cat) This workFG117 minD1 divIVA�::spc This workFG712 amyE::Pspac-ftsZ-mCherry(BS) (spc)

(cat)This work

FG718 ftsA� amyE::Pxyl-ftsA (cat) This workJR22 amyE::Pxyl-gfp-ypsB (cat) This workJR31 minD1 divIVA�::spc

amyE::Pxyl-gfp-ypsB (cat)This work

JR46 ypsB�::kan This workJR47 chr� ypsB-gfp (kan) This workJR61 ypsB�::Kan amyE::Pxyl-gfp-ypsB (cat) This workJR64 chr� Pspac-ftsZ (ble)

amyE::Pxyl-gfp-ypsB (cat)This work

JR104 chr� ypsB-gfp (kan)amyE::Pspac-ftsZ-mCherry(BS)

This work

JR125 div-355(Ts) chr� ypsB-gfp (kan) This workJR126 div-355(Ts) chr� ypsB-gfp (kan)

amyE::Pspac-ftsZ-mCherry(BS)This work

JR128 ftsA� amyE::Pxyl-ftsA (cat) chr� ypsB-gfp (kan)

This work

JR132 amyE::Pspac-ftsZ-mCherry(BS) (spc)(cat) chr� ypsB-gfp (kan)

This work

JR133 amyE::Pxyl-gfp-ypsB(N35) (cat) This workJR134 amyE::Pxyl-gfp-ypsB(N69) (cat) This workJR135 amyE::Pxyl-gfp-ypsB(30C) (cat) This workJR136 amyE::Pxyl-gfp-ypsB(70C) cat) This workJR137 amyE::Pxyl-gfp-ypsB(30-69) (cat) This workJR143 ypsB�::kan amyE::Pxyl-gfp-ypsB(N35)

(cat)This work

JR144 ypsB�::kan amyE::Pxyl-gfp-ypsB(N69)(cat)

This work

JR145 ypsB�::kan amyE::Pxyl-gfp-ypsB(30C)(cat)

This work

JR146 ypsB�::kan amyE::Pxyl-gfp-ypsB(70C)(cat)

This work

JR147 ypsB�::kan amyE::Pxyl-gfp-ypsB(30-69)(cat)

This work

JR162 chr� ypsB-gfp (kan) Pspac-ftsL�-pbpB

(cat)This work

JR166 ypsB�::kan ftsA� amyE::Pxyl-ftsA (cat) This work

E. coli strainDH5� supE44 �(lac)U169 �80dlacZ�M15

hsdR17 recA1 endA1 gyrA96 thi1relA1

PlasmidspEA18 amyE::Pxyl-gfp (cat) integration vector 18pGUI6 ftsZ-mCherry(BS) (spc) integration

vectorThis work

pJR20 amyE::Pxyl-gfp-ypsB (cat) integrationvector

This work

pJR47 ypsB-gfp (kan) integration vector This workpJR138 amyE::Pxyl-gfp-ypsB(N35) (cat)

integration vectorThis work

pJR139 amyE::Pxyl-gfp- ypsB(N69) (cat)integration vector

This work

pJR140 amyE::Pxyl-gfp- ypsB(30C) (cat)integration vector

This work

pJR141 amyE::Pxyl-gfp- ypsB(70C) (cat)integration vector

This work

pJR142 amyE::Pxyl-gfp ypsB(30-69) (cat)integration vector

This work

VOL. 190, 2008 YpsB IS A COMPONENT OF THE DIVISOME 7097


.org/D

ownloaded from

http://jb.asm.org/

tively. In parallel, a kan resistance cassette was amplified from plasmid pFG4with primers OFG112 and OFG113. The three fragments were purified andlinked in a second PCR in the absence of added primers. An aliquot (usually 1/10of a microliter) of the linked fragments from the second PCR was amplified ina third PCR with primers OFG158 and OFG161, purified, and transformed intoB. subtilis competent cells. The presence of the expected deletion in Kanr trans-formants was confirmed by PCR.

Sequence analysis. Sequences were retrieved from the SSDB (http://www.genome.jp/kegg/ssdb/) or STRING (http://www.bork.embl-heidelberg.de/STRING/) (54) databases. We used the bidirectional best-hit tool to selectYpsB and DiviVA orthologs from SSDB. The alignment was built usingClustalW (52) and manually edited and prepared in Jalview (6). The tree wasinferred by RAxML (49), using the amino acid substitution model WAG withgamma correction, with model parameters estimated by maximum likelihood.

Fluorescence microscopy. Microscopy was performed on a Nikon TE300 in-verted microscope equipped with filters for green fluorescent protein (GFP)(Endow GFP set, 41018; Chroma Technology) and FM4-64 and mCherry (TexasRed Brightline set, TXRED4040-B; Semrock). Images were captured with aRoper CoolSnap HQ camera. Exposure times varied from 0.5 to 3 s. Images wereprocessed and analyzed with MetaMorph version 7.1 (Universal Imaging) andImageJ (http://rsb.info.nih.gov/ij/) software.

To perform microscopy, cells were grown to exponential phase and mountedon slides covered with a layer of agarose-solidified minimal medium or phos-phate-buffered saline (PBS). Xylose was used at 0.25% and IPTG at 50 �M toinduce the expression of GFP or mCherry fusion proteins. Membranes werestained with FM4-64 (Molecular Probes) at a final concentration of 1 �g/ml.Stain was usually added directly to cells in medium 5 min before mounting andimaging. For some depletion experiments, cells were grown directly in home-made microscope chambers for visualization. These chambers were assembledthe following way: a small volume (1 to 2 �l) of the cells to be visualized wasspotted on a square (dimensions, 5 by 5 by 1 mm) of PBS solidified with 1.5%agarose and allowed to dry briefly. The agarose square was next adhered to acoverslip such that the cells would be sandwiched between the agarose and thecoverslip. To keep the agarose from moving, 1% low-melting-point agarose inPBS was used to glue the edges of the square to the glass. The coverslip/cell padassembly was attached to an aluminum slide with a circular hole (15 mm) by useof silicone grease. The chamber created this way was filled with medium con-taining FM4-64 (0.5 �g/ml) and inducers when appropriate. To avoid evapora-tion, a second coverslip was used to seal the top of the chamber. The chamberswere then incubated at 37°C for the period necessary for depletion to occur(usually 2 to 3 h). The use of the chambers allowed better visualization offilaments, which are fragile and tend to undergo damage during the manipula-

tions necessary for subjecting liquid cultures to microscopy (shaking and pipet-ting, etc.).

RESULTS AND DISCUSSION

YpsB is a paralog of DivIVA. YpsB is a 98-amino-acidprotein annotated in the B. subtilis genome databases (Sub-tilist [http://genolist.pasteur.fr/SubtiList/] and BSORF [http://bacillus.genome.jp/]) as “unknown; similar to unknown pro-teins.” The gene for YpsB is located at 200 degrees in the B.subtilis chromosome, apparently in an operon with ypsA, thegene for another hypothetical protein of unknown function.Comparison of the gene neighborhoods of ypsB in severalgenomes revealed that, besides ypsA, the genes for the Holli-day junction resolvase RecU and the type 1 penicillin bindingprotein PBP 1 are frequently found in the vicinity of ypsB. Thepotential significance of this gene order conservation is dis-cussed below.

YpsB is predicted to have a central coiled-coil region span-ning amino acids 32 to 70 according to the program Paircoil2(http://groups.csail.mit.edu/cb/paircoil2/paircoil2.html). Underlow-stringency conditions (high E-value cutoffs), YpsB can bedetected in BLAST searches using DivIVA as the query se-quence, and, indeed, there has been previous mention in theliterature that YpsB could be related to DivIVA (10, 34).Because coiled-coil-containing proteins tend to identify othercoiled-coil proteins in sequence similarity searches due to theconvergent, nonhomologous nature of this signature, and be-cause the similarity score between DivIVA and YpsB is verylow (25% for B. subtilis homologs), it was unclear whetherDivIVA and YpsB are truly related. To investigate this, wecarried out detailed sequence comparisons and phylogeneticanalysis of DivIVA and YpsB. A multiple sequence alignmentwas constructed using sequences of several proteins that couldbe unambiguously identified as DivIVA or YpsB orthologs.Inspection of this alignment (Fig. 1A) revealed that the simi-larity between DivIVA and YpsB was not restricted to theircoiled-coil regions. In fact, it is the N-terminal regions ofDivIVA and YpsB which exhibit the highest degree of similar-ity between the two proteins. This region, which comprisesabout 30 to 40 amino acids, contains several invariant or highlyconserved residues which define a signature motif for thisprotein family. Notably, owing to this conserved N-terminaldomain, we have detected several instances in which homologsof YpsB appear to be misannotated as DivIVA or DivIVA-likeproteins in databases. In contrast, the predicted coiled-coilsegments and the C-terminal portions of both proteins displaylower levels of similarity. The C terminus in particular is quitevariable both in sequence and in length among DivIVA pro-teins. We have noticed, however, that YpsB proteins have ahighly conserved block of amino acids at their extreme C ter-mini (Fig. 1A). This sequence block, whose consensus is TNFDILKRLSNLEKHVFG, can be used to clearly distinguishYpsB from DivIVA proteins. Another way to distinguish thetwo proteins is by their lengths: whereas YpsB proteins areusually less than 120 amino acids long, DivIVA is always longerthan 160 amino acids. Furthermore, in bacteria with genes forboth proteins, divIVA was always longer than ypsB.

To infer the evolutionary history of DivIVA and YpsB, wealigned all members of the DivIVA COG (COG3599) in the

TABLE 2. Oligonucleotides

Name Sequencea

OL1298 ..................5AAAGTCGACGTGATGATTCACGATACG3OL1299 ..................5CCAGGATCCTACAATTTACAAGCGCCA3OFG112 .................5Phos–GACGACGACAAGATTAGAGTCGAT

AAACCCAGCGA3OFG113 .................5Phos–GAGGAGAAGCCCGGTCAGGTCGAT

ACAAATTCCTCG3OFG137 .................5AAGCTAGCGGCCGCATGCTTGCTGATAA

AGT3OFG138 .................5AAGGATCCATCATAAAGCTTGCTGCC3OFG158 .................5GCTACGCATCAGCATTTTCA3OFG159 .................5AATCTTGTCGTCGTCCACCTCGTATCGTG

AATC3OFG160 .................5ACCGGGCTTCTCCTCTTGGCAGCAAGCT

TTATG3OFG161 .................5TTTCCCGTTATCAACCTTGC3OFG181 .................5CGGAGCTCCTCGAGGGATCCGGTGGAAT

GGTTTCCAAGGGCGA3OFG182 .................5ACATCCGCGGGCATGCTTATTTGTACAG

CTCATC3OFG219 .................5AAGGATCCTCAATCTAAAAATTTGTC3OFG220 .................5AAGGATCCTCACTGTTTTTTGCTGGC3OFG221 .................5GCTAGCGGCCGCGTTGACAAATTTTT3OFG222 .................5GCTAGCGGCCGCCCTGTGCAATCTAA3

a Phos, phosphate.

7098 TAVARES ET AL. J. BACTERIOL.


.org/D

ownloaded from

http://jb.asm.org/

STRING database (54) and the bidirectional best hits fromcomplete bacterial genomes from the SSDB database usingClustalW (52), followed by manual editing and selection ofsequences (Fig. 1A). A maximum likelihood phylogenetic tree,depicted in Fig. 1B, was then inferred. We used Clostridiumacetobutylicum as an outgroup since this organism is a memberof the Clostridium group, which is closely related to the ordersLactobacillales and Bacillales (41) and has no DivIVA ho-mologs located close to the recU-ponA locus or that match the

ypsB signature defined above (data not shown). This tree showsthat DivIVA and YpsB paralogs correspond to two well-de-fined groups that most likely originated from a duplication ofa DivIVA-like protein in the last common ancestor of theLactobacillales and Bacillales orders.

Subcellular localization of YpsB. The similarity betweenDivIVA and YpsB suggested that YpsB could be a divisionprotein. To test this, we created B. subtilis strains expressingN-terminal and C-terminal fusions of GFP to YpsB. The N-

FIG. 1. YpsB is a paralog of DivIVA. (A) Multiple sequence alignment of representative YpsB and DivIVA sequences. The conserved C-terminalresidues of YpsB are boxed. We have also marked the boundaries used to split YpsB in three segments (N-terminal, coiled-coil, and C-terminal segments)in the deletion analysis shown in Fig. 5. (B) Phylogenetic tree of the same sequences used in panel A. Sequences are identified by organism codes andaccession numbers from the SSDB database (http://www.genome.jp/kegg/ssdb/). Organisms are Bacillus anthracis A2012 (baa), Bacillus halodurans (bha),Bacillus subtilis (bsu), Clostridium acetobutylicum (cac), Lactobacillus casei (lca), Listeria monocytogenes EGD-e (lmo), Staphylococcus aureus N315 (sau),Streptococcus pyogenes MGAS10750 (serovar M3) (spi), and Streptococcus pneumoniae TIGR4 (spn).



.org/D

ownloaded from

http://jb.asm.org/

terminal fusion was placed under the control of the xylose-inducible Pxyl promoter and inserted at a nonessential locus(amyE) in the B. subtilis chromosome to generate a merodip-loid strain containing the fusion plus wild-type ypsB. The C-terminal fusion was integrated by single crossover at the ypsABoperon itself and therefore is expressed under the control ofthe native ypsAB promoter. Fluorescence microscopy experi-ments with strains bearing the N-terminal GFP-YpsB fusionrevealed strong midcell fluorescent bands in vegetative cellsgrowing in rich media (LB, CH) (Fig. 2A), or in minimal mediasuch as TSS (data not shown) (50). Localization of the GFP-YpsB fusion did not require the untagged copy of the protein,since similar results were obtained in a strain that had thewild-type copy of ypsB deleted (see the first row of Fig. 5below). This localization pattern, which suggests that YpsB is

indeed part of the division complex, was virtually identical forthe C-terminal YpsB-GFP fusion (Fig. 2B).

We have noticed in some of our pictures that the GFP fusionsto YpsB exhibited some peripheral membrane staining in addi-tion to the enrichment at the septum. This was clearer for theYpsB-GFP fusion (see Fig. 3 for an example) and was particularlyapparent for some filamentous cells in the dependency experi-ments shown in Fig. 4. The peripheral staining suggests that YpsBhas affinity for the membrane and, indeed, predictions using theprogram AmphipaSeeK (47) (http://npsa-pbil.ibcp.fr/) indicatethat the N terminus of YpsB is likely an amphipathic alphahelix capable of membrane association. We have tested thisprediction by cell fractionation experiments and found thatboth YpsB-GFP and GFP-YpsB are present in approximatelyequal amounts in the membrane and soluble fractions of B.subtilis cells, as one would expect for a peripherally associatedmembrane protein (see Fig. S1 in the supplemental material).Thus, YpsB is a membrane-associated protein. It is unclearwhy we cannot always see the peripheral pattern of YpsB byfluorescence microscopy. Because the peripheral staining byYpsB is subtle, we speculate that it is very sensitive to micros-copy conditions (focus precision, the physiological state of thecells on the slides, and the concentration of membrane dye,etc.) and thus not as reproducible as the septal signal. Anotherpossibility is that YpsB localization is dynamic, such that theprotein is associated with the membrane only transiently.

The localization of YpsB as bands at the division site wasfound preferentially in cells in which a septum (complete orincomplete) was already detectable with the FM4-64 mem-brane stain (compare GFP and membrane panels in Fig. 2Aand B). This was detected in 70% of 176 cells analyzed and isin contrast with what is seen for proteins such as ZapA, FtsA,and EzrA, which interact directly with FtsZ and localize beforeany sign of septum ingrowth. Thus, YpsB appears to be a late

FIG. 2. YpsB is a divisome-associated protein. (A) Localization ofGFP-YpsB. Strain JR22 was grown to mid-log phase (optical density at600 nm � 0.3 to 0.5) and imaged as described in Materials and Meth-ods. Note that besides the ring fluorescence there is significant cyto-plasmic fluorescence. Arrows point to examples of cells in which GFP-YpsB or YpsB-GFP (in panel B) are retained at the constricted septa(the new pole). (B) Localization of YpsB-GFP. Strain JR47 was grownto mid-log phase and imaged as described in Materials and Methods.Note here and in Fig. 3 and 4 that YpsB-GFP shows significant pe-ripheral staining besides the ring fluorescence. (C) Localization ofDivIVA-GFP. Strain FG96 was grown to mid-log phase and imaged asdescribed in Materials and Methods. Note the close spacing betweenDivIVA-GFP bands, which indicates that DivIVA is present both atold and new division sites. (D) Localization of GFP-YpsB duringsporulation. Strain JR22 was sporulated by the method of Sterlini andMandelstam (50) and imaged 2 h after resuspension. Arrows point toexamples of asymmetric GFP-YpsB rings. Bar � 5 �m.

FIG. 3. YpsB is a late division protein. Colocalization of FtsZ andYpsB. Strain JR132, expressing FtsZ-mCherry and YpsB-GFP fusions,was grown to mid-log phase (optical density at 600 nm � 0.3 to 0.5)and imaged as described in Materials and Methods. Arrows markZ-rings that are not decorated with YpsB. These presumably representyoung division complexes. Asterisks mark YpsB rings that are notdecorated with FtsZ. These should correspond to mature divisomes inthe final phase of cytokinesis, when FtsZ has already left the complex.Bar � 5 �m.



.org/D

ownloaded from

http://jb.asm.org/

division protein, as is the case for its paralog, DivIVA. Aside-by-side comparison of DivIVA and YpsB, however, re-vealed that their localizations were not identical. A feature ofDivIVA that is crucial for its function is its retention at thenewly formed cell pole after septation is completed (11, 32).The retention at the cell poles results in a localization patternin which a DivIVA band is present every 3.0 to 3.3 �m along achain of dividing B. subtilis cells (Fig. 2C). It also gives rise tocells that show crescent or dot-like accumulations of DivIVAat their mature poles (here defined as poles that have alreadybecome hemispherical as a consequence of cell separation)(11, 32). YpsB also seems to be retained, at least momentarily,at the newly formed pole after the septum is completed. Ex-amples of this are the marked cells in Fig. 2A and B, in whicha bright YpsB dot can still be seen in septa that are in theprocess of becoming mature poles. The frequency of such cellsin the population was 18% (n � 516). Nevertheless, the ob-servations that most old septa in a chain have no YpsB bands(thus the wider spacing between YpsB bands, i.e., 1 band per5.5 to 6.0 �m) and that cells with YpsB accumulation at theirmature poles are almost absent from the population suggest

that YpsB is less efficiently retained at cell poles than isDivIVA.

Recently, Dervyn et al. identified YpsB in a yeast two-hybridscreen as one of several proteins capable of interacting withScpA, a component of the bacterial condensin complex (10).This observation suggests that ScpA and YpsB should exhibitsimilar localization patterns. However, a comparison of thesubcellular localizations of YpsB and ScpA, which has beenshown to reside in a focus over nucleoids (33), indicates thatthe two proteins exhibit little if any overlap in their distribu-tions. Although this result per se does not rule out an interac-tion between YpsB and ScpA in vivo, it suggests that if aninteraction exists it must involve only a small fraction of themolecules of each protein present in a B. subtilis cell.

We also investigated the localization of YpsB during sporu-lation. A hallmark of sporulation in B. subtilis is the switch inthe positioning of the division machinery from a medial to apolar position (29). As shown in Fig. 2D, GFP-YpsB localizedas asymmetric bands in cells undergoing early sporulation.These cells frequently contained a single strong YpsB bandclose to one of the cell poles, a pattern indistinguishable from

FIG. 4. Localization dependence of YpsB-GFP. (A) Assembly hierarchy of the B. subtilis divisome. The question mark next to FtsW indicates thatthere are no published data to support its placement. Based on the results from panel B, YpsB (in gray) has been included in the appropriate positionin the pathway. (B) YpsB-GFP localization in division mutants. The C-terminal YpsB-GFP fusion was introduced into different division gene mutantsand localization was assayed in cells grown to mid-log phase. For mutations in essential genes, conditional (depletion or temperature-sensitive)alleles were used. In this case, mutants were grown for at least five generations under restrictive conditions before being imaged. For each mutant,a panel corresponding to the YpsB-GFP image (gray) and a panel with the overlay of the YpsB-GFP channel (green) and the correspondingmembrane (FM4-64) channel (red) are shown. JR64, ftsZ depletion strain; JR128, ftsA depletion strain; JR125, divIC temperature-sensitive mutant;JR162, pbpB (PBP 2B) depletion strain; JR31, divIVA minD mutant. Arrow points to minicell. (C) Colocalization of FtsZ-mCherry and YpsB-GFPin divIC(Ts) filaments (strain JR126). Bars � 5 �m.



.org/D

ownloaded from

http://jb.asm.org/

the one reported for several division proteins other than FtsZ(7, 14, 18). There were also some cells in which there was onestrong band at one of the poles and a weaker band at the otherpole. This pattern can also be detected for other division pro-teins such as ZapA and SpoIIE (F. Gueiros-Filho, unpublishedresults) and likely represents the transient assembly of a sec-ond polar divisome, before its inhibition by the action of pro-teins responsible for the maintenance of the sporangium’sasymmetry (40, 12). Thus, YpsB seems to follow the change indivisome positioning that occurs during sporulation. The pres-ence of YpsB in the sporulation septum represents anotherdifference between this protein and DivIVA. Apparently,DivIVA does not localize to the septum during sporulation (51).

One caveat of the sporulation experiments described aboveis that GFP-YpsB was expressed from an inducible promoter.We were unable to carry out a similar experiment with theC-terminal YpsB-GFP fusion under the control of the nativeypsB promoter because the strain bearing this fusion sporulatesvery inefficiently, presumably due to a polar effect of this in-sertion onto the RNase E RNA gene downstream of ypsB.Thus, it is not certain that YpsB is normally produced, or partof the divisome, during sporulation. Indeed, there is evidencefrom expression profiling and chromatin immunoprecipitationexperiments that ypsA, the gene upstream of ypsB, is repressedby Spo0A at the onset of sporulation (35). Because ypsA andypsB are likely to be in an operon, these data suggest that theremay be a programmed reduction of YpsB levels during sporu-lation. Nevertheless, the finding that YpsB, if present, canundergo the switch in localization that occurs to division pro-teins during sporulation reinforces the idea that YpsB is acomponent of the division machinery.

Timing of YpsB localization to the divisome. The data in Fig.2 suggest that YpsB associates with the divisome some timeafter the Z-ring is formed. To confirm this and to more pre-cisely assess the timing of YpsB association with the divisome,we colocalized YpsB and FtsZ in actively dividing cells express-ing YpsB-GFP and FtsZ-mCherry fusion proteins. Analysis ofthis strain showed that FtsZ and YpsB colocalized only in afraction of the cells in the population (Fig. 3). In cells in whicha clear Z-ring could be detected, we observed colocalizationbetween the Z-ring and YpsB in about 50% of them. In theother half of the cells, YpsB was still associated with the olddivision site, whereas new Z-rings had already formed to startthe next round of septation (Fig. 3). In line with this idea, thecells in which the Z-ring and YpsB did not colocalize tended tobe the smallest in the population, as expected for cells in theinitial stages of their cycle. Similar frequencies of colocaliza-tion have been reported for DivIVA and FtsZ (reference 22and A. R. Pancetti, G. L. S. Meira, and F. Gueiros-Filho,unpublished results), suggesting that the two proteins associatewith the divisome at a similar stage.

Given that under the conditions of the experiment shown inFig. 3 (rich medium, 37°C, generation time of �25 min) Z-rings are present in 90% of the population (data not shown), itcan be estimated that YpsB localizes in 45% (90% times 50%)of the cells in the same culture. Assuming that cell growth inthese experiments approaches a steady state, this means that itwill take, on average, 45% of a generation for YpsB to get tothe divisome. Similar delays have been estimated for the re-cruitment of E. coli late division proteins to the divisome (1).

In the case of E. coli, the delay has been proposed to reflect theneed for the division site to undergo some kind of maturation,probably related to peptidoglycan synthesis, before some of thedivision proteins can assemble into the complex (1). Alterna-tively, the delayed association of some division proteins withthe divisome may result from their expression being restrictedto a period of the cell cycle. At present we have no evidence tosupport either hypothesis in the case of YpsB.

Recruitment of YpsB to the divisome requires the late divi-sion proteins. Studies with E. coli and B. subtilis have foundthat the assembly of division proteins into the divisome exhibitsa complex pattern of interdependencies (for a summary of theB. subtilis work, see reference 13, and for an up-to-date view ofE. coli, see reference 16). These interdependencies translateinto an “assembly hierarchy” in which a certain protein de-pends on the proteins upstream of it in the pathway, but not onthe proteins downstream of it, to localize to the divisome (Fig.4A). In the case of B. subtilis, this hierarchy is composed offour main levels. First, there is FtsZ, which serves as the scaf-fold of the complex and thus is required for the localization ofall other division proteins. The next level includes the proteinsthat bind directly to FtsZ and whose association with the divi-some is likely to be independent of each other (FtsA, SepF,and ZapA). The third level includes the proteins with extra-cellular domains involved in peptidoglycan synthesis (DivIB,DivIC, FtsL, PBP 2B, and perhaps FtsW). These seem to bemutually interdependent for localization and thus are thoughtto exist as a subcomplex of the divisome (13). Lastly, there areDivIVA and the MinC and MinD proteins. DivIVA (and theaccompanying MinCD) have been proposed to go to the cellpoles, where they carry out their function by first associatingwith the divisome (32). Recently, it has been shown thatDivIVA can localize to the cell poles even in the absence ofdivisome assembly (19, 22). These findings show that DivIVAcan find the cell poles independently of its association with thedivisome. Nevertheless, DivIVA does associate with the divi-some, and this association was shown to depend on PBP 2B(and presumably also on the other components of the PBP 2Bsubcomplex) (32). Thus, DivIVA/MinCD represent the lastlevel in the divisome assembly hierarchy.

To place YpsB within the divisome hierarchy, we analyzedhow the localization of YpsB was affected in the absence ofproteins from each of the four levels (Fig. 4B). In the case ofessential proteins such as FtsZ, FtsA, DivIC, and PBP 2B,depletion or temperature-sensitive strains were used, whereasfor DivIVA a null mutant was used. In cells depleted of FtsZ,YpsB-GFP lost the band-like localization pattern and insteadappeared distributed throughout the cell (Fig. 4B). This find-ing was expected, because no assembly of the division complexoccurs in the absence of FtsZ, and confirms that YpsB isindeed recruited to the divisome. The depletion of FtsA, thenext protein in the assembly hierarchy, produced similar re-sults: YpsB-GFP was predominantly delocalized, although oc-casional bands were observed in the filaments. Since divisioncan still occur, albeit with lowered frequency, in the absence ofFtsA (25, 26), these bands likely correspond to the rare func-tional divisomes that manage to form in these cells. The gen-eral absence of YpsB bands, however, indicates that YpsB isincorporated into the divisome at some step after the associa-tion of FtsA. We next tested whether the targeting of YpsB



.org/D

ownloaded from

http://jb.asm.org/

depends on the late division proteins DivIC and PBP 2B. Byusing a DivIC temperature-sensitive mutant [divIC(Ts)] wefound that YpsB becomes completely delocalized in divIC(Ts)cells grown at the restrictive temperature (45°C) (Fig. 4B). Asimilar result was obtained in a PBP 2B depletion strain: noYpsB bands could be detected after 3 h of growth in theabsence of PBP 2B expression. Immunoblot analysis of YpsB-GFP in the different division mutant backgrounds showed thatthe stability of the protein is unaffected under filamentationconditions, thus ruling out the degradation of the fusion as theexplanation for the loss of localization detected in our exper-iments (see Fig. S2 in the supplemental material). To demon-strate that the early steps of divisome assembly still occur in theabsence of these late proteins, we simultaneously localizedFtsZ and YpsB in the divIC(Ts) filaments. As shown in Fig. 4C,the presence of Z-rings indicates that the assembly of at leastpart of the divisome occurs in the absence of DivIC. BecauseYpsB fails to associate with these “incomplete” divisomes (Fig.4C), we conclude that YpsB targeting requires the late divi-some proteins, perhaps the DivIB-DivIC-FtsL-PBP 2B com-plex itself, or proteins recruited to the divisome by this com-plex. Finally, we investigated whether YpsB required DivIVAfor its recruitment. Because DivIVA, similarly to YpsB, de-pends on PBP 2B for its association with the divisome (32), wethought that DivIVA could be the link between YpsB and therest of the divisome. This experiment was carried out in adivIVA minCD double mutant strain to allow efficient divisionin the absence of DivIVA (4, 11) and revealed that YpsBlocalizes normally in the absence of DivIVA (and MinCD)(Fig. 4B). Typical YpsB bands were found both in regular septaand in septa associated with minicells (Fig. 4B), which arefrequently produced by the divIVA minCD mutant strain. Areciprocal experiment showed that the localization of DivIVAis normal in a ypsB mutant (data not shown), suggesting thatYpsB and DivIVA associate independently with the divisome.From this analysis we conclude that the recruitment of YpsB tothe divisome is mediated by interaction either with the latedivision proteins or with other, yet-unidentified, division pro-teins whose recruitment is dependent on the late proteins.Another formal possibility is that the recruitment of YpsB isnot mediated by protein-protein interactions with divisomecomponents but instead would be due to modifications of themembrane and cell wall at the division site promoted by activeseptation. Unfortunately, we have no way to test this hypoth-esis at present.

The dependency pattern of YpsB, which is indistinguishablefrom the one exhibited by DivIVA (32), places YpsB among thelast group of proteins in the B. subtilis hierarchy (Fig. 4A). Giventhe relatedness of YpsB and DivIVA, it is conceivable that theyinteract with the same protein in the division complex.

In addition to assessing the dependency of YpsB on thedivisome proteins, we also investigated whether the condensinsubunit ScpA contributes to YpsB localization. Even thoughthe localization patterns of ScpA and YpsB are quite different,the proposed interaction between the two proteins suggeststhat they might affect each other’s localization. Microscopicobservation of YpsB-GFP in a scpA mutant, however, revealedthat YpsB still localizes to the division complex (data notshown), suggesting that ScpA plays no role in the targeting ofYpsB. Similarly, the localization of ScpA (determined using a

ScpA-YFP fusion) was not affected in ypsB mutant cells (datanot shown), indicating that YpsB is not required for ScpAtargeting.

Mapping of YpsB localization determinants. To define theregion (or regions) of YpsB required for its association withthe divisome, we constructed a series of YpsB deletions. Allthe deletions were fused at their N termini to GFP. Analysisof the YpsB multiple sequence alignment (Fig. 1A) shows thatthe B. subtilis protein has three clearly recognizable regions: anN-terminal region spanning amino acids 1 through 36, a coiled-coil segment spanning amino acids 37 through 70, and a C-terminal region from amino acid 71 to 98. Even though theseregions are unlikely to represent domains in a structural sense,they roughly correspond to the protein’s predicted segments ofsecondary structure and will be referred to loosely as domains.Using these boundaries, we constructed deletions containingthe N-terminal domain alone (GFP-N), the N-terminal domainplus the coiled-coil domain (GFP-N-cc), the C-terminal do-main alone (GFP-C), the C-terminal domain plus the coiled-coil domain (GFP-cc-C), and the coiled-coil domain alone(GFP-cc). Each of these fusions was introduced into a wild-type (PY79) strain and was assayed for localization by fluores-cence microscopy. Because the presence of a coiled coil sug-gests that YpsB can homo-oligomerize, we also assayed thetruncated fusions in a ypsB mutant strain. Comparison of theresults in the presence and absence of wild-type YpsB shouldallow the distinction between deletions that remain capable ofassociating with their target on the divisome and deletions thatassociate with the divisome indirectly, through an interactionwith endogenous YpsB.

As shown in Fig. 5, three of the truncated GFP-YpsB fu-sions, GFP-N-cc, GFP-C, and GFP-cc-C, showed some degreeof localization when expressed in a wild-type strain (wild-typecolumn). The localization was weak (as judged by the ratio offluorescence in the septum versus the cytoplasm) in the dele-tion containing just the C-terminal domain fused to GFP(GFP-C) but was significantly stronger in the deletions thatcontained the coiled-coil segment in addition to the N- orC-terminal domains. This suggests that the coiled-coil segmentis capable of enhancing the affinity of YpsB for the divisome,probably by promoting the oligomerization of YpsB chains.Indeed, Claessen et al. showed recently that YpsB is capable ofbinding to itself in a bacterial two-hybrid assay (5). It must benoted, however, that the coiled-coil region alone has a limitedcapacity to oligomerize, since the GFP-cc construct failed tolocalize in the wild-type strain (Fig. 5, last row). To rule outprotein degradation as the reason for the lack of localization ofsome mutants, we verified the presence of the fusion proteinsby immunoblotting with anti-GFP antibodies. This controlshowed that all mutant proteins (in both the wild-type and ypsBmutant backgrounds) were stable and produced at levels sim-ilar to that of the full-length protein (see Fig. S3 in the sup-plemental material).

Assaying localization in a strain lacking endogenous YpsBproduced quite different results. Whereas the GFP-N-cc fusionstill exhibited proper localization, the C terminus-containingfusions became delocalized (Fig. 5, ypsB mutant column). Lo-calization of the GFP-N-cc fusion in the ypsB mutant back-ground was significantly weaker than in the presence of endog-enous YpsB, suggesting that the full-length protein stabilizes



.org/D

ownloaded from

http://jb.asm.org/

the interaction of GFP-N-cc with the divisome. Nevertheless,the observation that only the GFP-N-cc fusion still localizesin the absence of full-length YpsB suggests that the N terminusis required for the recognition of the divisome. Because thefusion containing just the N-terminal part of YpsB (GFP-N)fails to localize, it is likely that the targeting domain extendsbeyond the N terminus, probably including the coiled-coil por-tion of the protein. However, at present we cannot rule out thepossibility that the N terminus contains all the signals neces-sary for YpsB targeting. In this case, the effect of the coiled-coil segment would be to allow the GFP-N-cc protein to oligo-merize, thus increasing the affinity of the N-terminal domainfor its target. In support of the conclusion that the N terminusof YpsB is necessary for divisome targeting, it should bepointed out that the similarity between YpsB and DivIVA ishighest in their N-terminal regions (Fig. 1A). Given that YpsBand DivIVA associate with the divisome at the same point inthe assembly hierarchy (Fig. 4), potentially by recognizing thesame divisome protein, it is possible that they will share tar-geting sequences. Furthermore, two previously described mu-tations that affect DivIVA localization (38) map to arginine(R23 in B. subtilis YpsB) and glycine (G24 in B. subtilis YpsB)residues that are highly conserved in the members of the

DivIVA/YpsB family (Fig. 1A). Regarding the role of YpsB’sC terminus, we propose it could be part of the self-oligomer-ization elements of YpsB, along with the coiled-coil region.The ability of the C terminus to self-associate would allow it tolocalize in the wild-type background, where it can bind to thefull-length protein, but would not allow it to localize in theypsB mutant strain. A role for the C terminus of YpsB inself-association is supported by the observation that the coiled-coil region alone does not seem sufficient for self-association ofYpsB (the GFP-cc fusion fails to localize even in the wild-typebackground).

YpsB is not essential for septum formation. To determinethe role of YpsB during division, we constructed a ypsB nullmutant by replacing the coding region of the gene with akanamycin resistance cassette by use of long flanking homologyPCR. Inspection of the mutant by fluorescence microscopyshowed that the ypsB mutant divides as well as its wild-typeparental strain (Fig. 6A). We tested the ypsB mutant also insporulation and found that both polar septum formation andspore titers were not affected (data not shown). Thus, YpsB isnot essential for division during vegetative growth or sporula-tion. Given the normal sporulation efficiency of the ypsB mu-tant, we conclude that YpsB is not required for events otherthan polar septation that are necessary for spore development.This is in contrast with DivIVA, which, besides its function asthe topological specificity factor of the Min system, plays a rolein the polar anchoring of chromosomes during sporulation(2, 51).

Several of the recently characterized division genes such aszapA, noc, and sepF (ylmF) cause no or very mild divisiondefects when inactivated. This suggests that these proteins playredundant roles or are involved in nonessential steps necessaryfor the fine-tuning of the division process. Mutations in these

FIG. 5. YpsB localization to the divisome is mediated by its N-terminal region. From top to bottom, we show the localization patternof full-length GFP-YpsB, GFP-N, GFP-N-cc, GFP-C, GFP-cc-C, andGFP-cc, both in the presence of endogenous YpsB (wild-type [WT]column) and in the absence of endogenous YpsB (ypsB mutant col-umn). WT strains are as follows: GFP-YpsB strain, JR22; GFP-Nstrain, JR133; GFP-N-cc strain, JR134; GFP-C strain, JR136; GFP-cc-C strain, JR135; and GFP-cc strain, JR137. ypsB mutant strains areas follows: GFP-YpsB strain, JR61; GFP-N strain, JR143; GFP-N-ccstrain, JR144; GFP-C strain, JR146; GFP-cc-C strain, JR145; andGFP-cc strain, JR147. Microscopy was carried out as described inMaterials and Methods with log-phase cells. No membrane stain wasadded to the samples to avoid potential deleterious effects on local-ization. That GFP-N-cc is the only deletion that still localizes in theabsence of endogenous YpsB suggests that the N terminus of YpsB isthe region responsible for targeting to the divisome. For a detaileddiscussion of these results, see the main text. Bar � 5 �m.

FIG. 6. Phenotypes of the ypsB mutant. (A) Comparison of log-phase cells of wild-type (WT) (PY79) and ypsB mutant (JR46) strains.No difference could be detected in the frequencies or regularities ofsepta. (B) Synthetic phenotypes of ypsB and ftsA mutants. The wild-type (PY79), the ypsB mutant (strain JR46), a conditional ftsA mutantin which FtsA expression is dependent on xylose (Pxyl-ftsA, strainFG718), and a conditional ftsA ypsB double mutant (strain JR166)were streaked on LB or LB plus 0.5% xylose and grown overnight at37°C before being photographed. Bar � 5 �m.



.org/D

ownloaded from

http://jb.asm.org/

genes, however, often exhibit synergistic or synthetic pheno-types when combined with mutations in other division genes.Well-documented examples are the synthetic division defectsof zapA ezrA (18), noc minD (56), sepF (ylmF) ezrA (20), andsepF (ylmF) ftsA (25) double mutants. To test if the same wastrue of ypsB, we combined the ypsB null allele with mutationsin several other division genes (ezrA, zapA, noc, minCD,divIVA, and ftsA). No synthetic phenotype could be detectedfor the ypsB ezrA, ypsB zapA, ypsB noc, and ypsB minCD doublemutants (data not shown). In the case of ftsA, however, wenoticed a synthetic effect. In contrast with E. coli, in which ftsAis essential and absolutely required for division, the inactiva-tion of ftsA in B. subtilis produces a viable mutant (25, 26)(Pancetti and Gueiros-Filho, unpublished). The ftsA mutantdivides at a low frequency but still produces colonies with highefficiency when plated on solid media. We used an ftsA deple-tion strain to investigate the interaction between ftsA and ypsBand found that depletion of FtsA in an ypsB mutant back-ground produced a phenotype much more severe than thatproduced by depletion of FtsA in a wild-type background. Thisphenotype could be easily observed on plates, where cells lack-ing FtsA and YpsB lysed after overnight growth, while cellslacking either YpsB or FtsA alone produced healthy colonies(Fig. 6B). The lysis of the ftsA ypsB double mutant could alsobe inferred from the reduced growth rate of this strain in liquidmedium (see Fig. S4 in the supplemental material). The ten-dency of the ftsA ypsB mutant strain to lyse suggested that thismutant was undergoing extreme filamentation. To test this, wecompared the cell sizes of the ftsA ypsB mutant strain withthose of the ftsA mutant strain after different times of FtsAdepletion (2, 3, and 5 h). We failed to detect a significantdifference in cell length between the two strains in these ex-periments. This may be due to the difficulty of faithfully mea-suring the very long cells generated by FtsA depletion. Thelongest filaments often coil into spaghetti-like swirls or extendbeyond the microscope field of view in ways that compromisetheir accurate scoring. Very long filaments are also more proneto lysis and thus may be selectively eliminated from the sam-ples we examined. Alternatively, the increased lysis of thedouble mutant could be a consequence of a defect in pepti-doglycan synthesis, as discussed below.

Even though the late recruitment of YpsB to the divisomesuggests it does not interact directly with FtsZ, the establishedrole of FtsA as a promoter of Z-ring formation led us toinvestigate whether YpsB could affect FtsZ polymer stability ororganization. One way to detect the stabilizing effects of aknown protein on Z-ring formation in vivo is to test whether itsoverexpression can overcome the lethal effect of excess MinD,a Z-ring inhibitor (18). Using this assay, we found that YpsBoverexpression was incapable of suppressing MinD lethality(data not shown), suggesting that YpsB does not act as apositive modulator of Z-ring formation. Thus, the synergismbetween the ypsB and ftsA mutations is unlikely to result fromextreme destabilization or disorganization of the FtsZ poly-mers in the cell. More likely, the absence of YpsB affects a latedivision event such as septal peptidoglycan synthesis. While theimpairment caused by the lack of YpsB may be too mild to benoticed on its own, it may have consequences in strains, such asthe ftsA mutant, in which divisome assembly is already signif-icantly weakened. How would YpsB affect septal peptidoglycan

synthesis? We speculate that YpsB may contribute to the re-cruitment of PBP 1 (encoded by ponA) to the divisome. PBP 1is a high-molecular-weight class A PBP with bifunctional trans-glycosylase/transpeptidase activities (42). Even though PBP 1has not been traditionally thought of as a divisome protein, itis expected that at least one PBP with transglycosylase activitymust be part of the cell wall-synthesizing complex associatedwith the division machinery, and localization experiments (37,48) have shown that PBP 1 is indeed enriched at septal loca-tions. The speculation that PBP 1 is a partner of YpsB is basedon the conserved presence of the ponA gene nearby the genefor ypsB in bacterial genomes. In most genomes in which ypsBand ponA (pbp1) are present, they are separated by only two orthree other genes. Another observation supporting the linkbetween YpsB and PBP 1 is the finding that PBP 1 orthologsof some bacteria that lack YpsB (notably, several enterobac-teria) display a potential DivIVA/YpsB signature amino acidsequence. This signature includes only the most conservedresidues of the N terminus of DivIVA and YpsB (F-x[4,6]-R-G-Y-x-x-x-x-x-x-x-F-L) and thus is too short to be detected inBLAST or PSI-BLAST searches. However, it is detected usingprograms such as Pattern Search. Assuming that, as suggestedby our deletion experiments, these N-terminal amino acids areindeed the main divisome-targeting determinant of YpsB/DivIVA, the addition of this sequence to the PBP 1 protein ofenterobacteria would allow it to associate with the divisomeeven in the absence of YpsB. In support of our speculations,recent work from the Errington lab that was published whileour manuscript was under revision (5) has shown that, indeed,YpsB interacts directly with PBP 1 and seems to promote theshuttling of this protein between the lateral and septal sites ofcell wall synthesis. Thus, YpsB is a late division protein thatmay play an important role in the regulation of peptidoglycansynthesis during the division cycle.

Conclusion. We have characterized YpsB, a newly identifiedB. subtilis divisome protein. YpsB is evolutionarily related toDivIVA and, indeed, it displays several properties that aresimilar to those of DivIVA. It associates with the divisome ata late stage in the division cycle and fits into the same step ofthe assembly hierarchy (depends on the late proteins DivICand PBP 2B to be recruited to the divisome). The molecularrole of YpsB, however, seems to be different from that ofDivIVA. YpsB is not essential for septum formation and doesnot affect positioning of the division septum. YpsB is not aswell retained at cell poles as DivIVA and thus there is noevidence that it serves as a pole-marking protein. Nevertheless,the synthetic phenotype observed between ftsA and ypsB mu-tations suggests that YpsB contributes to proper and efficientseptum formation, perhaps by regulating septal cell wall syn-thesis.

The identification of yet another division protein points toan ever-increasing complexity of the divisome. There are now16 proteins which are known to be part of the complex in B.subtilis. The future challenge will be to determine the roleplayed by each of these proteins during cytokinesis.

ACKNOWLEDGMENTS

We thank Jonathan Dworkin, Michael Elowitz, Alan Grossman, andPeter Graumann for plasmids and strains and Peter Graumann andDavid Rudner for suggestions and critical reading of the manuscript.



.org/D

ownloaded from

http://jb.asm.org/

We are also indebted to Walter Colli, Maria Julia Manso Alves, andtheir team for the lab space and hospitality during part of this project.

This work was supported by a Jovem Pesquisador grant from Fun-dacao de Amparo a Pesquisa do Estado de Sao Paulo (FAPESP).J.R.T. and R.F.D.S. were recipients of doctoral fellowships from Con-selho Nacional de Desenvolvimento Científico e Tecnologico (CNPq).G.L.S.M. was a recipient of a doctoral fellowship from FAPESP.

REFERENCES

1. Aarsman, M. E., A. Piette, C. Fraipont, T. M. Vinkenvleugel, M. Nguyen-Disteche, and T. den Blaauwen. 2005. Maturation of the Escherichia colidivisome occurs in two steps. Mol. Microbiol. 55:1631–1645.

2. Ben-Yehuda, S., D. Z. Rudner, and R. Losick. 2003. RacA, a bacterialprotein that anchors chromosomes to the cell poles. Science 299:532–536.

3. Bramkamp, M., L. Weston, R. A. Daniel, and J. Errington. 2006. Regulatedintramembrane proteolysis of FtsL protein and the control of cell division inBacillus subtilis. Mol. Microbiol. 62:580–591.

4. Cha, J. H., and G. C. Stewart. 1997. The divIVA minicell locus of Bacillussubtilis. J. Bacteriol. 179:1671–1683.

5. Claessen, D., R. Emmins, L. W. Hamoen, R. A. Daniel, J. Errington, andD. H. Edwards. 2008. Control of the cell elongation-division cycle by shut-tling of PBP1 protein in Bacillus subtilis. Mol. Microbiol. 68:1029–1046.

6. Clamp, M., J. Cuff, S. M. Searle, and G. J. Barton. 2004. The Jalview Javaalignment editor. Bioinformatics 20:426–427.

7. Daniel, R. A., E. J. Harry, and J. Errington. 2000. Role of penicillin-bindingprotein PBP 2B in assembly and functioning of the division machinery ofBacillus subtilis. Mol. Microbiol. 35:299–311.

8. Daniel, R. A., E. J. Harry, V. L. Katis, R. G. Wake, and J. Errington. 1998.Characterization of the essential cell division gene ftsL(yIID) of Bacillussubtilis and its role in the assembly of the division apparatus. Mol. Microbiol.29:593–604.

9. Daniel, R. A., M. F. Noirot-Gros, P. Noirot, and J. Errington. 2006. Multipleinteractions between the transmembrane division proteins of Bacillus subtilisand the role of FtsL instability in divisome assembly. J. Bacteriol. 188:7396–7404.

10. Dervyn, E., M. F. Noirot-Gros, P. Mervelet, S. McGovern, S. D. Ehrlich, P.Polard, and P. Noirot. 2004. The bacterial condensin/cohesin-like proteincomplex acts in DNA repair and regulation of gene expression. Mol. Micro-biol. 51:1629–1640.

11. Edwards, D. H., and J. Errington. 1997. The Bacillus subtilis DivIVA proteintargets to the division septum and controls the site specificity of cell division.Mol. Microbiol. 24:905–915.

12. Eichenberger, P., P. Fawcett, and R. Losick. 2001. A three-protein inhibitorof polar septation during sporulation in Bacillus subtilis. Mol. Microbiol.42:1147–1162.

13. Errington, J., R. A. Daniel, and D. J. Scheffers. 2003. Cytokinesis in bacteria.Microbiol. Mol. Biol. Rev. 67:52–65.

14. Feucht, A., I. Lucet, M. D. Yudkin, and J. Errington. 2001. Cytological andbiochemical characterization of the FtsA cell division protein of Bacillussubtilis. Mol. Microbiol. 40:115–125.

15. Goehring, N. W., and J. Beckwith. 2005. Diverse paths to midcell: assemblyof the bacterial cell division machinery. Curr. Biol. 15:R514–R526.

16. Goehring, N. W., M. D. Gonzalez, and J. Beckwith. 2006. Premature target-ing of cell division proteins to midcell reveals hierarchies of protein inter-actions involved in divisome assembly. Mol. Microbiol. 61:33–45.

17. Gueiros-Filho, F. 2007. Cell division. In P. L. Graumann (ed.), Bacillus:cellular and molecular biology. Caister Academic Press, Norfolk, UnitedKingdom.

18. Gueiros-Filho, F. J., and R. Losick. 2002. A widely conserved bacterial celldivision protein that promotes assembly of the tubulin-like protein FtsZ.Genes Dev. 16:2544–2556.

19. Hamoen, L. W., and J. Errington. 2003. Polar targeting of DivIVA in Bacillussubtilis is not directly dependent on FtsZ or PBP 2B. J. Bacteriol. 185:693–697.

20. Hamoen, L. W., J. C. Meile, W. de Jong, P. Noirot, and J. Errington. 2006.SepF, a novel FtsZ-interacting protein required for a late step in cell divi-sion. Mol. Microbiol. 59:989–999.

21. Harry, E., L. Monahan, and L. Thompson. 2006. Bacterial cell division: themechanism and its precison. Int. Rev. Cytol. 253:27–94.

22. Harry, E. J., and P. J. Lewis. 2003. Early targeting of Min proteins to the cellpoles in germinated spores of Bacillus subtilis: evidence for division appa-ratus-independent recruitment of Min proteins to the division site. Mol.Microbiol. 47:37–48.

23. Harry, E. J., and R. G. Wake. 1997. The membrane-bound cell divisionprotein DivIB is localized to the division site in Bacillus subtilis. Mol. Mi-crobiol. 25:275–283.

24. Hu, Z., A. Mukherjee, S. Pichoff, and J. Lutkenhaus. 1999. The MinCcomponent of the division site selection system in Escherichia coli interactswith FtsZ to prevent polymerization. Proc. Natl. Acad. Sci. USA 96:14819–14824.

25. Ishikawa, S., Y. Kawai, K. Hiramatsu, M. Kuwano, and N. Ogasawara. 2006.

A new FtsZ-interacting protein, YlmF, complements the activity of FtsAduring progression of cell division in Bacillus subtilis. Mol. Microbiol. 60:1364–1380.

26. Jensen, S. O., L. S. Thompson, and E. J. Harry. 2005. Cell division inBacillus subtilis: FtsZ and FtsA association is Z-ring independent, andFtsA is required for efficient midcell Z-ring assembly. J. Bacteriol. 187:6536–6544.

27. Kunst, F., and G. Rapoport. 1995. Salt stress is an environmental signalaffecting degradative enzyme synthesis in Bacillus subtilis. J. Bacteriol. 177:2403–2407.

28. Levin, P. A., and R. Losick. 1994. Characterization of a cell division genefrom Bacillus subtilis that is required for vegetative and sporulation septumformation. J. Bacteriol. 176:1451–1459.

29. Levin, P. A., and R. Losick. 1996. Transcription factor Spo0A switches thelocalization of the cell division protein FtsZ from a medial to a bipolarpattern in Bacillus subtilis. Genes Dev. 10:478–488.

30. Lutkenhaus, J. 2007. Assembly dynamics of the bacterial MinCDE systemand spatial regulation of the Z ring. Annu. Rev. Biochem. 76:539–562.

31. Margolin, W. 2005. FtsZ and the division of prokaryotic cells and organelles.Nat. Rev. Mol. Cell Biol. 6:862–871.

32. Marston, A. L., H. B. Thomaides, D. H. Edwards, M. E. Sharpe, and J.Errington. 1998. Polar localization of the MinD protein of Bacillus subtilisand its role in selection of the mid-cell division site. Genes Dev. 12:3419–3430.

33. Mascarenhas, J., J. Soppa, A. V. Strunnikov, and P. L. Graumann. 2002.Cell cycle-dependent localization of two novel prokaryotic chromosome seg-regation and condensation proteins in Bacillus subtilis that interact withSMC protein. EMBO J. 21:3108–3118.

34. Massidda, O., D. Anderluzzi, L. Friedli, and G. Feger. 1998. Unconventionalorganization of the division and cell wall gene cluster of Streptococcuspneumoniae. Microbiology 144:3069–3078.

35. Molle, V., M. Fujita, S. T. Jensen, P. Eichenberger, J. E. Gonzalez-Pastor,J. S. Liu, and R. Losick. 2003. The Spo0A regulon of Bacillus subtilis. Mol.Microbiol. 50:1683–1701.

36. Norris, V., T. den Blaauwen, A. Cabin-Flaman, R. H. Doi, J. Errington, R. M.Harshey, L. Janniere, A. Jimenez-Sanchez, D. J. Jin, P. A. Levin, E. Mileyk-ovskaya, A. A. Minsky, M. Saier, K. Skarstad, and M. Thellier. 2007. To-wards a hyperstructure taxonomy. Annu. Rev. Microbiol. 61:309–329.

37. Pedersen, L. B., E. R. Angert, and P. Setlow. 1999. Septal localization ofpenicillin-binding protein 1 in Bacillus subtilis. J. Bacteriol. 181:3201–3211.

38. Perry, S. E., and D. H. Edwards. 2004. Identification of a polar targetingdeterminant for Bacillus subtilis DivIVA. Mol. Microbiol. 54:1237–1249.

39. Pichoff, S., and J. Lutkenhaus. 2005. Tethering the Z ring to the membranethrough a conserved membrane targeting sequence in FtsA. Mol. Microbiol.55:1722–1734.

40. Pogliano, J., N. Osborne, M. D. Sharp, A. Abanes-De Mello, A. Perez, Y. L.Sun, and K. Pogliano. 1999. A vital stain for studying membrane dynamics inbacteria: a novel mechanism controlling septation during Bacillus subtilissporulation. Mol. Microbiol. 31:1149–1159.

41. Pollack, J. D., Q. Li, and D. K. Pearl. 2005. Taxonomic utility of aphylogenetic analysis of phosphoglycerate kinase proteins of Archaea,Bacteria, and Eukaryota: insights by Bayesian analyses. Mol. Phylogenet.Evol. 35:420–430.

42. Popham, D. L., and P. Setlow. 1995. Cloning, nucleotide sequence, andmutagenesis of the Bacillus subtilis ponA operon, which codes for peni-cillin-binding protein (PBP) 1 and a PBP-related factor. J. Bacteriol.177:326–335.

43. Raskin, D. M., and P. A. de Boer. 1999. Rapid pole-to-pole oscillation of aprotein required for directing division to the middle of Escherichia coli.Proc. Natl. Acad. Sci. USA 96:4971–4976.

44. Romberg, L., and P. A. Levin. 2003. Assembly dynamics of the bacterial celldivision protein FTSZ: poised at the edge of stability. Annu. Rev. Microbiol.57:125–154.

45. Rothfield, L., A. Taghbalout, and Y. L. Shih. 2005. Spatial control of bacte-rial division-site placement. Nat. Rev. Microbiol. 3:959–968.

46. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratorymanual, 3rd ed., vol. 1 and 2. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY.

47. Sapay, N., Y. Guermeur, and G. Deleage. 2006. Prediction of amphipathicin-plane membrane anchors in monotopic proteins using a SVM classifier.BMC Bioinformatics 7:255.

48. Scheffers, D. J., and J. Errington. 2004. PBP1 is a component of the Bacillussubtilis cell division machinery. J. Bacteriol. 186:5153–5156.

49. Stamatakis, A., T. Ludwig, and H. Meier. 2005. RAxML-III: a fast programfor maximum likelihood-based inference of large phylogenetic trees. Bioin-formatics 21:456–463.

50. Sterlini, J. M., and J. Mandelstam. 1969. Commitment to sporulation inBacillus subtilis and its relationship to development of actinomycin resis-tance. Biochem. J. 113:29–37.

51. Thomaides, H. B., M. Freeman, M. El Karoui, and J. Errington. 2001.Division site selection protein DivIVA of Bacillus subtilis has a second



.org/D

ownloaded from

http://jb.asm.org/

distinct function in chromosome segregation during sporulation. Genes Dev.15:1662–1673.

52. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W:improving the sensitivity of progressive multiple sequence alignment throughsequence weighting, position-specific gap penalties and weight matrix choice.Nucleic Acids Res. 22:4673–4680.

53. Vicente, M., and A. I. Rico. 2006. The order of the ring: assembly of Esch-erichia coli cell division components. Mol. Microbiol. 61:5–8.

54. von Mering, C., L. J. Jensen, B. Snel, S. D. Hooper, M. Krupp, M. Foglierini,N. Jouffre, M. A. Huynen, and P. Bork. 2005. STRING: known and predictedprotein-protein associations, integrated and transferred across organisms.Nucleic Acids Res. 33:D433–D437.

55. Wach, A. 1996. PCR-synthesis of marker cassettes with long flanking homol-ogy regions for gene disruptions in S. cerevisiae. Yeast 12:259–265.

56. Wu, L. J., and J. Errington. 2004. Coordination of cell division and chro-mosome segregation by a nucleoid occlusion protein in Bacillus subtilis. Cell117:915–925.

57. Wu, L. J., and J. Errington. 2003. RacA and the Soj-Spo0J system combineto effect polar chromosome segregation in sporulating Bacillus subtilis. Mol.Microbiol. 49:1463–1475.

58. Youngman, P. J., J. B. Perkins, and R. Losick. 1983. Genetic transpositionand insertional mutagenesis in Bacillus subtilis with Streptococcus faecalistransposon Tn917. Proc. Natl. Acad. Sci. USA 80:2305–2309.



.org/D

ownloaded from

http://jb.asm.org/

Cytological Characterization of YpsB, a Novel Component of the … · MinD and is modulated by the...

Documents

Transcript of Cytological Characterization of YpsB, a Novel Component of the … · MinD and is modulated by the...