COURSE OF BIOINFORMATICS2013-2014

Exam Simulation

Remember to annotate the source of the information

Insert the requested information:

•Name and Surname:

•Matricula Number:

•E-mail address:

Human FOXP2 gene

Remember to annotate the source of the information

1. Report the Gene_ID, the genomic (in bp) localization and the cytogenetic location of the human FOXP2 gene.

2. How many different transcript variants are reported for the FOXP2 gene, according to NCBI Gene? Are any non-coding RNA molecule encoded by this gene? Report all the RefSeq accession codes and specify if they are non-coding.

1. Is the FOXP2 gene involved in the etiology of any disorders? If yes, annotate disorder name and the disease MIM number. Is it a Mendelian or a complex disease?

Remember to annotate the source of the information

4. Which is the Uniprot accession code of the human reviewed protein?

4. Which is the subcellular location of the protein?

5. Which is the function of the protein?

Remember to annotate the source of the information

7.Is the given sequence corresponding to the human FOXP2 gene? Is the given sequence a genomic DNA sequence or a mRNA sequence? Why?

>seqCTTGAACCTTTGTCACCCCTCACGTTGCACACCAAAGACATACCCTAGTGATTAAATGCTGATTTTGTGTACGATTGTCCACGGACGCCAAAACAATCACAGAGCTGCTTGATTTGTTTTAATTACCAGCACAAAATGCCATCAGTCTGGGACGTGATCGGGCAGGGTGTACTCACAGTAGTGTAAATACTGCTGTAAATAGTTGTCTGATGGTGGCTTTGACAGTGAGCTAGCTTCTGAGTTTTCCCTTCTTTTTATACTGTTTTCTGTGCTGGCTTTTTTGAATCTTCCTAATTTTTCATCTCTTTAACAAACTCCTATGAAGTTGAAACCGGGAAGTTTGCTCTAACATTTCCAGAGAAGGTATTAAGTCATGATGCAGGAATCTGCGACAGAGACAATAAGCAACAGTTCAATGAATCAAAATGGAATGAGCACTCTAAGCAGCCAATTAGATGCTGGCAGCAGAGATGGAAGATCAAGTGGTGACACCAGCTCTGAAGTAAGCACAGTAGAACTGCTGCATCTGCAACAACAGCAGGCTCTCCAGGCAGCAAGACAACTTCTTTTACAGCAGCAAACAAGTGGATTGAAATCTCCTAAGAGCAGTGATAAACAGAGACCACTGCAGGAATTGCTTCCAGAAACAAAATTATGTATCTGTGGCCAC

Remember to annotate the source of the information

8. Compare the sequences of FOXP2 transcript isoforms II and IV (according to NCBI Gene nomenclature). Which is the sequence of the alternative exon contained in isoform II?

9. Retrieve a sequence comprising the exon of interest and 50 intronic nucleotides on each side. Analyze this sequence with ESEFinder. Which is the predicted binding site with the higher score (annotate the corresponding binding protein and the position)

10. Analyze the same sequence with the SFmap tool. Add a comment about putative similarities or discrepancy between the results of ESEFinder and SFmap tools about the binding sites of SRSF2.

Remember to annotate the source of the information

11. Using STRING, how many other proteins resulted directly correlated to FOXP2?

12. Which is/are the evidences suggesting a link between FOXP2 and NFATC2? Report the reference of the paper indicating an “experimental” correlation.

13. Is the correlation between between FOXP2 and NFATC2 confirmed by GeneMania? Add a comment about the evidences.

Remember to annotate the source of the information

14. Is the single nucleotide variant rs121908377 inside FOXP2? Which is the effect of this mutation on the protein? Has the mutation a clinical significance?

Remember to annotate the source of the information

15. Can you recognize some microRNA predicted to target the FOXP2 transcript? Which ones?