ARTICLE IN PRESS

Journal of Plant Physiology 167 (2010) 561–570

Contents lists available at ScienceDirect

Journal of Plant Physiology

0176-16

doi:10.1

Abbre

ROS, rean Corr

E-m

journal homepage: www.elsevier.de/jplph

Stress-induced co-expression of two alternative oxidase (VuAox1 and 2b)genes in Vigna unguiculata

Jose Helio Costa a, Erika Freitas Mota a, Mariana Virginia Cambursano b, Martin Alexander Lauxmann b,Luciana Maia Nogueira de Oliveira c, Maria da Guia Silva Lima a, Elena Graciela Orellano b,Dirce Fernandes de Melo a,n

a Department of Biochemistry and Molecular Biology, Federal University of Ceara, 60455-760 Fortaleza, Ceara, Brazilb Molecular Biology Division, Instituto de Biologıa Molecular y Celular de Rosario, Consejo Nacional de Investigaciones Cientıficas y Tecnicas,

Facultad de Ciencias Bioquımicas y Farmaceuticas, Universidad Nacional de Rosario, Suipacha 531, (S2002LRK) Rosario, Argentinac Academic Unit of Garanhuns, Federal Rural University of Pernambuco, Garanhuns, Pernambuco, Brazil

a r t i c l e i n f o

Article history:

Received 10 July 2009

Received in revised form

1 November 2009

Accepted 2 November 2009

Keywords:

Alternative oxidase

Evolution

Gene co-expression

Intron length

Stress

17/$ - see front matter & 2009 Elsevier Gmb

016/j.jplph.2009.11.001

viations: Aox, alternative oxidase; cDNA, DN

ctive oxygen species

esponding author. Tel.: +55 85 3366 9825; fa

ail address: dirmelo@ufc.br (D. Fernandes de

a b s t r a c t

Cowpea (Vigna unguiculata) alternative oxidase is encoded by a small multigene family (Aox1, 2a and

2b) that is orthologous to the soybean Aox family. Like most of the identified Aox genes in plants,

VuAox1 and VuAox2 consist of 4 exons interrupted by 3 introns. Alignment of the orthologous Aox genes

revealed high identity of exons and intron variability, which is more prevalent in Aox1. In order to

determine Aox gene expression in V. unguiculata, a steady-state analysis of transcripts involved in seed

development (flowers, pods and dry seeds) and germination (soaked seeds) was performed and

systemic co-expression of VuAox1 and VuAox2b was observed during germination. The analysis of Aox

transcripts in leaves from seedlings under different stress conditions (cold, PEG, salicylate and H2O2)

revealed stress-induced co-expression of both VuAox genes. Transcripts of VuAox2a and 2b were

detected in all control seedlings, which was not the case for VuAox1 mRNA. Estimation of the primary

transcript lengths of V. unguiculata and soybean Aox genes showed an intron length reduction for

VuAox1 and 2b, suggesting that the two genes have converged in transcribed sequence length. Indeed, a

bioinformatics analysis of VuAox1 and 2b promoters revealed a conserved region related to a cis-

element that is responsive to oxidative stress. Taken together, the data provide evidence for co-

expression of Aox1 and Aox2b in response to stress and also during the early phase of seed germination.

The dual nature of VuAox2b expression (constitutive and induced) suggests that the constitutive Aox2b

gene of V. unguiculata has acquired inducible regulatory elements.

& 2009 Elsevier GmbH. All rights reserved.

Introduction

The alternative respiratory pathway branches from themitochondrial electron transport chain at the ubiquinone pooland passes electrons to a terminal (alternative) oxidase (Aox). Thealternative pathway is not coupled to ATP synthesis and is notinhibited by cyanide. Alternative oxidases have been found in allplant mitochondria analyzed. Several factors have been identifiedthat are involved in the regulation of its activity such as theamount of Aox protein, the redox-active sulfhydryls of Aoxdimers, alpha-keto acids and cellular pH (Lima-Junior et al.,2000; Millenaar and Lambers, 2003). The always renewed interest

H. All rights reserved.

A complementary to RNA;

x: +55 85 3366 9829.

Melo).

in Aox studies is based on its apparent role in protecting plantmitochondria from reactive oxygen species (ROS) due to theability of this enzyme to catalyze non-coupled respiratoryelectron transport. Therefore, its activity promotes a moreoxidized state of the electron transport chain components, whichdecreases ROS formation (Purvis, 1997; Maxwell et al., 1999;Robson and Vanlerberghe, 2002). More recently, it has beenspeculated that Aox may play a crucial role in plant cellprogramming (Arnholdt-Schmitt et al., 2006; Clifton et al., 2006).

Aox is encoded in the nucleus and imported into mitochondriavia the general import pathway (Tanudji et al., 1999). It has alsobeen shown that Aox is encoded by a small family of three to fivemembers in several plant species and appears to undergoregulation during development and in different tissues (Finneganet al., 1997; McCabe et al., 1998; Considine et al., 2001; Thirkettle-Watts et al., 2003). These multigene families can be divided in twosubfamilies, Aox1 and Aox2, which are formed by variable genenumbers in several plants. The Aox1 family is present in both

ARTICLE IN PRESS

J.H. Costa et al. / Journal of Plant Physiology 167 (2010) 561–570562

monocot and eudicot plants and higher protein sequencesimilarity exists between different species than similarity toAox2 in the same species (Considine et al., 2002). It is well knownthat Aox is highly responsive to a variety of treatments that induceoxidative stress (Clifton et al., 2006). Several Arabidopsis studieshave described Aox1a as the most stress responsive Aox gene(Saisho et al., 1997; Clifton et al., 2005). More recent research hasexplored the role of Aoxla to combined abiotic/environmentalstresses (Giraud et al., 2008). Aox2 is only found in eudicots andonly one Aox2 gene is present in tobacco (Whelan et al., 1996),Arabidopsis (Saisho et al., 1997), mango (Considine et al., 2001)and tomato (Holtzapffel et al., 2003); however, two Aox2-types(Aox2a and Aox2b) are present in soybean (Whelan et al., 1996),cowpea (Costa et al., 2004) and carrot (Costa et al., 2009a). Aox2 istypically constitutive or related to development (Considine et al.,2002). Nevertheless, Arabidopsis Aox2 also plays a role in the stressresponse related to plastid-dependent signaling (Clifton et al.,2005). V. unguiculata roots also had Aox2b regulation under saltand osmotic stresses (Costa et al., 2007).

Approaches involving promoters combined with gene expres-sion of Aox genes indicated that the expression pattern betweenspecies is not conserved with gene orthology (Thirkettle-Wattset al., 2003). Recently, promoter mutagenesis revealed commoncis-elements in non orthologous Aox genes that may be involvedin Aox expression regulation by growth and developmentalsignals (Ho et al., 2007). cis-acting regulatory elements have alsobeen identified in AtAox1a as part of regulatory pathwayscontrolling gene expression in response to stress (Ho et al., 2008).

In spite of the great interest related to structure, function andevolution of Aox multigene family in plants, several aspects arenot well understood, creating a challenge in this particular field.In this paper, Vigna unguiculata Aox genes have been characterizedaddressing gene structure as a tool to compare evolutionarydivergence of Aox introns in the soybean. Furthermore, a clear rolefor V. unguiculata Aox1 was not found in previous papers of ourgroup (Costa et al., 2004, 2007). Thus, we carried out anexpression analysis of Aox transcripts in leaves, under severaltreatments (cold, PEG, salicylate and H2O2), in seed developmentand germination to provide insights into the regulation of Aox

expression. To support experimental data, a bioinformaticsanalysis of VuAox1 and VuAox2b promoters was performed insearch of cis-elements involved in oxidative stress signaling.

Materials and methods

Cloning and sequence analysis of Aox genes

Genomic DNA was extracted from dark-grown seedlings of7-day-old cowpea [Vigna unguiculata (L.) Walp] hypocotyls vianuclei isolation (Henfrey and Slater, 1988). In order to removepolysaccharides and polyphenols, an additional purification stepwas conducted using a cetyltrimethylammonium bromide (CTAB)protocol (Murray and Thompson, 1980).

The Aox1 gene of V. unguiculata was amplified by PCR in twosteps. First, an Aox gene fragment was obtained by PCR usingdegenerate primers, P1 (50 CTGTAGCAGCAGTVCCTGGVATGGT 30)and P2 (50 GGTTTACATCYCGYTGYTGWGCCTC 30) deduced of exon3 conserved regions (Saisho et al., 1997). The expected PCRproduct, a single band of 444 bp, was cloned into the pGEMT-Easy vector (Promega, Madison, WI), and the clones thatshowed different RFLP patterns were purified and sequenced(University of Maine Service). Second, the identified Aox1

fragment nucleotide sequence was aligned with the soybeanand V. unguiculata Aox genes (accession numbers X68702,U87906, U87907, AJ319899, AJ421015) to design specific primers

in the exon 3 region. To obtain the complete Aox1 gene, 50 and30 primers were designed from an alignment with soybean Aox1

and Arabidopsis Aox1a, 1b and 1c. Aox1 was amplified by PCR usingthe following primer pairs: P3 [50 ATGATGATGAGTCGCAGC 30

(sense)] and P4 [50 TTGTCCAATTCCTTGAGGA 30 (antisense)] toamplify the 50 end and P5 [50 TCCTCAAGGAATTGGACAA 30 (sense)]and P6 [50 AGTGATAACCAATWTGGAGC 30 (antisense)] to amplifythe 30 end. The Aox1 fragments were also cloned into the pGEMT-Easy vector and sequenced.

Aox2a and 2b of V. unguiculata were amplified by PCR usingspecific primers spanning the DNA complementary to RNA (cDNA)sequences (AJ319899 and AJ421015), respectively. After PCRamplification, the genes were cloned into the pGEM T-Easy vectorand sequenced (University of Maine Service).

Sequence data were analyzed using Clustal X algorithmsoftware (Thompson et al., 1997). The Aox1, 2a and 2b genesequences from V. unguiculata are available in the GenBankdatabase under the access numbers DQ100440, EF187463 andDQ100439, respectively.

The phylogenetic tree was constructed by the neighbor-joiningmethod (Saitou and Nei, 1987) of the CLUSTAL X program(Thompson et al., 1997). Accession numbers of Aox sequencesused in phylogenetic analyses published in the GenBank or TIGRdatabases are as follows: common dracunculus (Dracunculus

vulgaris) Aox1 (AB189673); cowpea (Vigna unguiculata) Aox1(DQ100440), Aox2a (AJ319899) and Aox2b (AJ421015); greenalgae (Chlamydomonas reinhardtii) Aox0A (AF047832) and Aox0B(AF285187); maize (Zea mays) Aox1a (AY059647), Aox1b(AY059648) and Aox1c (AY059646); mango (Mangifera indica)Aox2 (X79329); Novosphingobium aromaticivorans Aox0(CP000248); Neurospora crassa Aox0 (L46869); pacific oyster(Crassostrea gigas) Aox0 (BQ426710); poplar (Populus tremula)Aox1a (AJ251511) and Aox1b (AJ271889); rice (Oryza sativa)Aox1a (AB004864), Aox1b (AB004865) and Aox1c (AB074005);root-knot nematode (Meloidogyne hapla) Aox0 (BM901810); seavase (Ciona intestinalis) Aox0 (TC17302); soybean (Glycine max)Aox1 (X68702), Aox2a (U87906) and Aox2b (U87907); thale cress(Arabidopsis thaliana) Aox1a (NM_113135), Aox1b (NM_113134),Aox1c (NM_113678) and Aox2 (NM_125817); Trypanosoma brucei

Aox0 (AB070617); tobacco (Nicotiana tabacum) Aox1a (S71335);tomato (Lycopersicon esculentum) Aox1a (AY034148) and Aox1b(AY034149); voodoo lily (Sauromatum guttatum) Aox1 (M60330);wine grape (Vitis vinifera) Aox2 (TC46683); wheat (Triticum

aestivum) Aox1a (AB078882) and Aox1c (AB078883); yeast(Candida albicans) Aox0A (AF031229) and Aox0B (AF116872).

Plant material and growth conditions

Cowpea [Vigna unguiculata (L.) Walp], var. Vita 5 seeds wereobtained from the seed bank of the Departamento de Fitotecnia,Universidade Federal do Ceara, Fortaleza, Ceara, Brasil. Seeds weresurface sterilized for 5 min in 0.5% (w/v) CaOCl, exhaustivelyrinsed with water, and sowed in different conditions.

In order to evaluate the steady-state mRNA levels in seeddevelopment, plants were cultivated in the environmental field(Universidade Federal do Ceara) for 40–50 days under irrigatedcontrol conditions to obtain young or old flowers, 3- or 10-day-oldpods, and dry seeds (from 20-day-old pods). Flowers weredifferentiated through the coloration changes of green (young)to yellow (old). The seed germination experiment was carried outwith seeds sowed in filter paper imbibed with distilled water for24 h in the dark. Embryo and cotyledons from dry and soakedseeds (24 h) were also obtained for this study. All tissues (from atleast 3 plants or several seeds) were immediately frozen in liquidnitrogen and stored at �80 1C before total RNA was extracted.

ARTICLE IN PRESS

J.H. Costa et al. / Journal of Plant Physiology 167 (2010) 561–570 563

To analyze the effect of several stresses on Aox expression, ahydroponic system was performed. Seeds were sowed in the dark,on filter paper imbibed with distilled water. After 3 days, theseedlings were transferred to hydroponics systems and trans-ported to a greenhouse or growth chambers (cold stress) with alight intensity of 200 mE m�2 s�1 at leaf level for a 12 hphotoperiod at 70% relative humidity. The seedlings were grownin Knop medium (1.44 g L�1 Ca(NO3)2, 0.25 g L�1 KNO3, 0.25 gL�1 KH2PO4 and 0.246 g L�1 MgSO4 �7H2O) with micronutrients(65.7 mg L�1 iron-ethylene-diamine-tetra-acetic acid (FeEDTA),2.86 mg L�1 H3BO3, 2.84 mg L�1 MnCl2 �4H2O, 0.286 mg L�1

Na2O4Mo �2H2O, 0.22 mg L�1 ZnSO4 �7H2O, 0.079 mg L�1 CuSO4 �

5H2O and 0.0476 mg L�1 CoSO4 �7H2O) and the stresses wereinduced after 6 days of germination by adding 200.67 g L�1

polyethylene glycol (PEG) and 10 mM H2O2 to the nutrientmedium or by spraying the leaves with 0.5 mM sodium salicylate.For cold treatment, seedlings were maintained in growthchambers at 25 1C (control) or 4 1C (cold). Leaves from 3 plantsof each condition were harvested at 0, 6, 12 and 24 h, rinsed indistilled water at 4 1C, immediately frozen in liquid nitrogen andstored at �80 1C before extraction of total RNA.

Extraction of total RNA and semi-quantitative RT-PCR

Seeds, flowers, pods and leaves were pulverized with liquidnitrogen using a mortar and pestle. Total RNA was then extractedusing the RNeasy plant mini kit (Qiagen, Hilden, Germany). TotalRNA (1 mg) was heated to 70 1C in a water bath for 10 min andthen cooled on ice for 2 min. RT-PCR was performed using theReady To Go RT-PCR beads kit (Pharmacia) with specific spanningintrons primers for each Aox gene. The reactions were individuallycontrolled by amplification of V. unguiculata actin cDNA. TheVuAox1 primers were designed from the sequenced gene whilethe VuAox2a, VuAox2b and actin primers were designed accordingto Costa et al. (2004). The amplified cDNA fragments were 530,692, 1031 and 840 bp in length for actin, Aox1, Aox2a and Aox2b,respectively. PCR assays were carried out to establish the optimalannealing temperature of primers at 55, 55, 58 and 57 1C for actin,Aox1, Aox2a and Aox2b, respectively. Preliminary experimentswith various PCR cycle numbers indicated that in the RT-PCRconditions of this study, amplifications were not in the plateauphase, and therefore allowed for semi-quantitative estimations oftranscript levels. The cycle number used for each gene was 25, 27,28 and 35 for Actin, VuAox2b, VuAox2a and VuAox1, respectively.

The primer sequences were: VuAox1 sense: 50 GGTTTAAGCG-GTGAAGTTG 30 and antisense: 50 TTGTCCAATTCCTTGAGGA 30;VuAox2a sense: 50 GCATTGAGTTGTACGGTTCG 30 and antisense: 50

TGGTAAAGGACTGTACTAAGC 30; VuAox2b sense: 50 GGATGTC-CACTCTTCCAGAC 30 and antisense: 50 GCTCAATGGTAACCAATAGG30; Actin sense: 50 GCGTGATCTCACTGATGCC 30 and antisense:50 TCGCAATCCACATCTGTTGG 30.

The RT-PCR products were analyzed by electrophoresis in a1.5% (w/v) agarose gel, stained with ethidium bromide andphotographed with a gel imaging system (itf labortechnik-Germany). To compare the level of expression of Aox mRNAagainst the actin reference gene mRNA data, image analysis wasemployed. The band densities were analyzed with Scion Image –Release beta 3b software (Scion Corporation – USA).

Database search of VuAox1 and VuAox2b upstream promoter regions

The VuAox1 and 2b promoter regions were identified by BLAST(Altschul et al., 1997) search homology with 50 ends of therespective cDNAs against GenBank (NCBI) and CGKB (CowpeaGenomics Knowledge Base) (Chen et al., 2007). Nucleotide

sequences sharing the �325 (GenBank access number:EI910014) and �556 bp (CGKB access number: 962_91_14540664_16654_45477_013.ab1) upstream regions of the tran-scriptional start site (TSS) of VuAox1 and 2b, respectively, wereused in bioinformatics search for regulatory cis-elements.

Results

Identification of the V. unguiculata Aox1 gene

A 1543 bp genomic sequence (accession number DQ100440) wasobtained by PCR and revealed a precursor protein of 316 amino acidresidues homologous to alternative oxidase (Aox) proteins. A phylo-genetic tree based on the amino acid sequences of various Aoxproteins showed that this deduced protein was very similar tosoybean Aox1 and was very distinct from V. unguiculata Aox2a and2b (Fig. 1). Therefore, the novel protein encoded by the Aox1 genewas called V. unguiculata Aox1 (VuAox1).

An alignment of the deduced amino acid sequences ofV. unguiculata and soybean Aox1 reveals an identity of 89%(Fig. 2). These proteins presented the VRSEST conserved motif,which is the predicted site of cleavage of the putativemitochondrial-targeting presequence. The soybean Aox1 motifwas previously deduced by Whelan et al. (1995) while theV. unguiculata Aox1 motif was deduced by PSORT software(Nakai and Kanehisa, 1992). The deduced presequence and theputative mature sequence of VuAox1 showed 84% and 90% ofidentity to soybean Aox1, respectively. In this approach, VuAox1

may be considered orthologous to Aox1 from soybean.

Intron/exon structure and primary transcripts of Aox genes

Fig. 3 shows alignments of intron/exon structures (A) as wellas the estimated primary transcript lengths (B) of Aox genesbetween Glycine max (Gm) and V. unguiculata (Vu). The VuAox1-and VuAox2-type genes consist of 4 exons interrupted by 3introns. In comparing all the genes, a length similarity wasrevealed between VuAox2a and GmAox2a. VuAox1 and VuAox2b

were smaller than respective orthologous Aox genes in G. max. Thebars between exons of Aox2-type genes indicate intron regionswith high identities ranging from 70% to 95% (Fig. 3A). Theprimary transcript lengths of Aox of V. unguiculata and G. max

estimated from gene, cDNA or EST data (Fig. 3B) revealed adistinct profile between both species. VuAox1 and VuAox2b weresimilar lengths, and they were smaller than VuAox2a; however,the G. max Aox primary transcript lengths were variable comparedto each other.

Steady-state mRNA levels of Aox genes

The expression of VuAox1, 2a and 2b was studied by RT-PCR asshown in Fig. 4. The transcripts were evaluated in seeddevelopment [young and old flowers, 3- and 10-day-old pods(with seeds) and dry seeds] and germination (24 h soaked seeds)(Fig. 4A). The mRNA levels were also analyzed in embryos andcotyledons from dry and soaked seeds (Fig. 4B). The specificity ofAox2-type gene primers was tested according to Costa et al.(2004). The Aox1 primers specificity was certified after sequencingof RT-PCR fragment from soaked seeds (access numberDQ100441). These analyses demonstrated that VuAox1 andVuAox2b were expressed in all tissues. In dry seeds, thetranscripts were expressed at very low levels, and in soakedseeds, VuAox1 and 2b were expressed at high levels. ConcerningVuAox2a, it is regulated in an inconsistent manner in young to old

ARTICLE IN PRESS

Fig. 1. Phylogenetic tree of alternative oxidase from several plants, fungi (N. crassa and C. albicans), protists (T. brucei), green algae (C. reinhardtii), animalia (C. gigas,

C. intestinalis and M. hapla) and eubacteria (N. aromaticivorans) showing the orthologous pairs soybean and V. unguiculata Aox1 and Aox2 genes. Classification of Aox

proteins is according to Considine et al. (2002). Branches are drawn in proportion to genetic distance. The tree was constructed according to sequence data indicated in the

Material and Methods section.

J.H. Costa et al. / Journal of Plant Physiology 167 (2010) 561–570564

ARTICLE IN PRESS

Fig. 2. Alignment of the deduced amino acid sequences of orthologous Aox1 proteins of Vigna unguiculata (Vu) and Soybean (Gm). Identical amino acid residues are shown

on a black background. The predicted site of cleavage of the putative mitochondrial-targeting presequence is indicated by one filled, underlined triangle and grayish

background. Conserved Cys residues are shown on a gray background. Helical regions that are assumed to be involved in the formation of a hydroxy-bridged binuclear iron

center (Andersson and Nordlund, 1999; Berthold et al., 2000) are shown with lines above the amino acid sequences. E (glutamate) and H (histidine) amino acid residues

involved in the iron-binding are indicated by filled circles. Possible membrane-binding domains (Andersson and Nordlund, 1999; Berthold et al., 2000) are shown by two-

headed arrows above the amino acid sequences.

Fig. 3. Comparison of intron/exon structure and primary transcript lengths of

soybean and V. unguiculata Aox genes. (A) Scale diagram of the intron/exon

structure of the Aox1- and Aox2-type genes of soybean (GmAox) and V. unguiculata

(VuAox). Filled boxes represent exons and lines represent introns. Bars over introns

represent regions with high identity (70–95%). The scale bar corresponds to 500 bp

of chromosomal DNA. (B) Estimated primary transcripts lengths of the Aox1- and

Aox2-type genes of soybean (G. max) and V. unguiculata (VuAox). 50 and 30 UTRs

(untranslated regions) of primary transcript for VuAox2a and VuAox2b were

estimated by full-length cDNA (AJ319899; AJ421015) while the UTRs of VuAox1

were estimated by V. unguiculata EST data (FG920773; FG820441).

Fig. 4. Transcript steady-state level of the V. unguiculata Aox multigene family.

(A) Transcript level of Aox genes in seed development [young (Y) and old (O)

flowers, 3 (3 d) and 10-day-old (10 d) pods and dry (D) seeds] and seed germi-

nation [24 h soaked seeds (Sk)]. (B) Transcript level of Aox genes in embryos and

cotyledons of dry and soaked seeds. Actin cDNA was amplified as an RT-PCR

control and the gel profiles are representative of three independent RT and PCR

reactions from one set of total RNA.

J.H. Costa et al. / Journal of Plant Physiology 167 (2010) 561–570 565

tissues (flowers and pods) and an invariable transcript profile wasobserved between dry and soaked seeds (Fig. 4A). In order toexplore the Aox transcript levels in dry and soaked seeds, similaranalyses were carried out in embryos and cotyledons separately(Fig. 4B). The VuAox2a mRNA levels were constant in dry andsoaked tissues; however, the VuAox1 and 2b transcripts weredrastically enhanced in soaked tissues.

Effect of different treatments in Aox gene expression

The expression of the Aox multigene family was also studied inleaves of V. unguiculata at 0, 6, 12 and 24 h under the followingtreatments: cold (4 1C), osmotic stress (200.67 g L�1 PEG), salicylate(0.5 mM) and H2O2 (10 mM) (Fig. 5). To evaluate the amount of RNAtemplate in each RT-PCR reaction, Actin was amplified in parallel fromthe leaf samples. The amount of Aox transcripts was normalizedthrough a ratio of integrated densities of Aox and Actin cDNA bands(Figs. 5B and D). VuAox2a and VuAox2b transcripts were detected in all

ARTICLE IN PRESS

Fig. 5. Transcript level of the Aox multigene family in leaves of V. unguiculata under control conditions or the following stresses: cold (4 1C), 200.67 g/L PEG, 0.5 mM

salicylic acid and 10 mM H2O2. (A and C): RT-PCR products of Aox and Actin on 1.5% agarose gel stained with ethidium bromide. (B and D) Normalization of the quantity of

Aox transcripts through a ratio of integrated densities of the Aox cDNA and Actin cDNA bands. Data (B and D) are the average values 7SD of three independent RT and PCR

reactions/gels from one set of total RNA. Statistical analysis (t-test, po0.05) was applied to each gene separately. Different letters indicate significant transcript differences.

J.H. Costa et al. / Journal of Plant Physiology 167 (2010) 561–570566

control conditions, unlike VuAox1. VuAox2a was constitutivelyexpressed in all the leaves, whereas, VuAox1 and 2b were inducedby cold, PEG, salicylate and H2O2. The expression of VuAox1 and 2b

was visibly induced by cold at 24 h (Figs. 5A and B). The induction ofVuAox1 and 2b was time-dependent in response to PEG, salicylate andH2O2. The highest mRNA levels in response to PEG were attained at24 h for both genes. In response to salicylate, VuAox1 appears to beuniformly induced while in response to H2O2, the transcript wasdetected by 12 h and disappeared at 24 h. The highest mRNA levels of

VuAox2b were found at 6 h in response to salicylate, and it appears tobe induced by H2O2 only at 6 h (Figs. 5C and D).

Analyses of VuAox1 and VuAox2b upstream promoter regions

In accordance with the results shown in Fig. 5, which depictsVuAox1 and 2b co-expression in response to several treatments,a comparative analysis of VuAox1 and 2b upstream promoterregions was carried out studying the cis-elements involved in the

ARTICLE IN PRESS

Table 1Comparative analysis of Aox cis-elements involved in response to treatments with H2O2, rotenone or both (Ho et al., 2008) with upstream regions of the transcriptional start

site (TSS) of VuAox1 and VuAox2b.

Sequences in AtAox1a (Ho et al., 2008) Possible sequences in VuAox1 Possible sequences in VuAox2b

cis-elements playing a role in response to treatment with H2O2, rotenone, or bothA TGAAGC �175 to �180 �454 to �459

TGAACC TGAAGA(rev comp)

B CGTGAT �117 to �122 �97 to �102

AGTGAT CGTGGT

(rev comp). or � 49 to �54

CCTGAT.

(rev comp)

C ATCCG �283 to �287 �65 to �69

ATCCA ACCCG

(rev comp)

D CACACA �289 to �294 �36 to �41

CACATA CACAAA

(rev comp)

E CGGCTTT No significant similarity No significant similarity

F TCGTAAA �48 to �54. �361 to � 367

TCTTAAA TTGTAAA

(rev comp)

G TCTCT �24 to �28 �302 to � 306

TTTCT TCTCC(rev comp)

H GTCATC No significant Similarity �52 to �57

ATCATC

I ACGTG �106 to �110 �441 to �445

Identical ATGTG

J TTCGATCA No significant similarity �155 to �162

CTCAATCA

The cis-elements in the AtAox1a promoter are designated by a letter according Ho et al. (2008). Degenerated nucleotides are represented by bold and underlined letters.

Numbers with each sequence refer to the position at which the motifs are present within each upstream region.

J.H. Costa et al. / Journal of Plant Physiology 167 (2010) 561–570 567

AtAox1a response to H2O2, rotenone, or both (Ho et al., 2008). Theresults summarized in Table 1 revealed several possiblecis-elements in V. unguiculata Aox promoters. Ten cis-elements(A to J) of AtAox1a were analyzed and the majority presented atleast one degeneration in V. unguiculata Aox promoters except theI cis-element in VuAox1 that was identical.

Indeed, VuAox1 and 2b upstream promoter regions were runthrough the PLACE database (http://www.dna.affrc.go.jp/PLACE) usingthe ‘‘Signal Scan program’’ or through PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html) using the ‘‘search forCARE’’, and a total of 5 common cis-acting elements were found:classical TATA and CAAT boxes, the AAGAA-motif (unknown func-tion), G-boxes (light regulatory elements) and a CORE (Coordinateregulatory element for antioxidant defense). Among these commoncis-elements the CORE appeared to be related to stress-induced co-expression of VuAox genes. This CORE, a cis-element responsive tooxidative stress, is found as a 28 bp conserved motif on the promoterof 3 antioxidant defense genes in rice (Tsukamoto et al., 2005) andreveals high identity with regions (35 bp) in the promoters of bothV. unguiculata genes. The VuAox1 and VuAox2b 35 bp regions alignedwith the rice CORE showed identities of 64% and 85%, respectively,while VuAox1 and VuAox2b 35 bp regions presented 68% identitywhen compared with each other (Fig. 6).

Discussion

Our results revealed that V. unguiculata Aox is encoded by asmall gene family that has at least three genes: Aox1, 2a and 2b.

These three genes present a similar profile to the Aox1 and Aox2

genes of the well-studied soybean. The phylogenetic tree (Fig. 1)shows that a clear division of homology exists between Aox1-type(monocots and dicots) and Aox2-type (dicots) proteins. The highdegree of identity between soybean and V. unguiculata Aox1proteins indicate that VuAox1, identified here, is orthologous tothe soybean Aox1 as it was the case of both V. unguiculata andsoybean Aox2-type genes described by Costa et al. (2004). Thealignment between the orthologous Aox1 proteins of soybean andV. unguiculata (Fig. 2) confirms the high degree of identityindicated in the phylogenetic tree (Fig. 1). The amino acidsequences of these proteins are conserved, including the mito-chondrial-targeting signal, which is present in orthologous Aoxproteins of proximal plant species (Costa et al., 2004).

In the process of identifying Aox1 in V. unguiculata, severalclones were obtained from PCR products and three distinct RFLPpatterns were found corresponding to Aox2-type genes and oneAox1 gene. Indeed, a BLAST search against a cowpea gene-richspace database (Chen et al., 2007) with more than 95% openreading frames revealed several Aox sequence fragments corres-ponding only to allelic variations of the 3 genes in the diploidgenome of the cowpea (data not shown).

The structure of VuAox1- and VuAox2-type genes consists of 4exons interrupted by 3 introns like the majority of plant Aox genes(Considine et al., 2002). Conserved intron regions in V. unguiculata

and soybean orthologous Aox2-type genes in contrast to Aox1

intron variability (Fig. 3A) could be representative of differencesin Aox chromosomal allocation between both species. In Arabi-

dopsis, Aox1 and Aox2 genes are located on different chromosomes(Clifton et al., 2006). The chromosomal position of Aox genes inV. unguiculata is unknown. A BLASTn search in the preliminary

ARTICLE IN PRESS

Fig. 6. Alignment of the Rice CORE (Coordinate regulatory element for antioxidant defense) with possible homologous cis-elements found in VuAox1 and VuAox2b

promoters. In black, conserved nucleotides on the promoter regions of three antioxidant genes in rice: SodCc1 (cytosolic CuZn-SOD1); trxh (cytosolic thioredoxin) and grx

(glutaredoxin) according to Tsukamoto et al. (2005). In gray, conserved nucleotides on the VuAox1 and VuAox2b promoters presenting divergence with conserved

nucleotides of Rice CORE.

J.H. Costa et al. / Journal of Plant Physiology 167 (2010) 561–570568

assembly and annotation of the soybean genome, available by theUS Department of Energy Joint Genome Institute (DOE JGI, 2008),indicates that Aox1- and Aox2-type genes are on differentchromosomes. Soybean Aox1 is on chromosome 4 and soybeanAox2a and 2b are in a tandem arrangement on chromosome 8. ForMedicago truncatula, a close related species to soybean andV. unguiculata, a different scenario of chromosomal Aox organiza-tion is found. Aox1 (CU914135) and Aox2b (FP102223) appear intwo different fragments of chromosome 5. The determination ofthe chromosomal sequence of Vigna unguiculata will be of greataid to discover if the co-expressed VuAox1 and VuAox2b areproximal. On average, genes in close proximity in the genomeshow co-expression, even if they are not immediate neighbors,perhaps this phenomenon is due to transcriptional controlsimilarity (Hershberg et al., 2005) and/or due to chromatinremodeling (Batada et al., 2007).

The alignment of the intron/exon structure of V. unguiculata

and soybean Aox genes (Fig. 3A) revealed intron positioningconservation and intron length reduction (except VuAox2a). Thesefindings may be reflected in reduced primary transcript lengths ofV. unguiculata Aox genes (Fig. 3B) compared to the transcriptlengths soybean Aox genes.

Considering that ‘‘transcription is a slow and expensiveprocess: in eukaryotes, approximately 20 nucleotides can betranscribed per second at the expense of at least two ATPmolecules per nucleotide’’ (Castillo-Davis et al., 2002), severaldifferent models have been proposed to explain small intronswithin genes such as ‘‘economy selection’’ and ‘‘time-economyselection’’ (Chen et al., 2005). In this study, we found that VuAox1

and VuAox2b, both genes that are stress-induced, have smallintrons (Fig. 3A) in agreement with ‘‘economy and time-economyselections’’. In fact, both VuAox genes have been grouped amongthe smallest primary transcripts in comparing several dicots andmonocots species (Costa et al., 2009b). Interestingly, the smallintrons are accompanied by similar primary transcript lengths(Fig. 3B) supporting the idea that the two genes have converged intranscribed sequence length establishing a time synchronism ofmRNA synthesis for co-expression.

In previous work, a clear role for Aox1 in V. unguiculata was notachieved (Costa et al., 2004, 2007). Thus, the steady-statetranscripts of Aox genes were investigated in seed development(young and old flowers, 3- and 10-day-old pods and dry seeds)and seed germination (24 h soaked seeds) (Fig. 4). It is well knownthat Aox2a expression is related to green (photosynthetic) tissues(Finnegan et al., 1997; Considine et al., 2002; Costa et al., 2004).VuAox2a is cyclically regulated from young (green) to old tissues(not green) in accordance with the fact that Aox2a is expressed ingreen tissues. Alternatively, for the first time, high levels ofVuAox2a mRNA in dry and soaked seeds (24 h) were shown. Thetranscript level remained constant, suggesting that VuAox2a

mRNA had already accumulated in dry seeds and was preservedat the early stages of germination (24 h). Unlike VuAox2a, VuAox1

and 2b were co-expressed during seed development and germi-nation. Furthermore, their transcript levels were in dry seeds andwere drastically enhanced in soaked seeds (24 h). Regardless ofdivergences of Aox gene responsiveness with orthologous genes

(Thirkettle-Watts et al., 2003), these data are in accordance withthe data found in early stages of Arabidopsis germination. Forexample, only AtAox2 mRNA accumulated in dry seeds withsimilar levels at 24 h of imbibition while AtAox1a, a typical Aox

gene responsive to stress (Saisho et al., 1997; Clifton et al., 2005,2006; Giraud et al., 2008; Ho et al., 2008), was induced afterimbibition (Saisho et al., 2001). Therefore, considering thatincreased cellular levels of ROS occur during seed germina-tion (Job et al., 2005), the transcript level enhancement of VuAox1

as well as VuAox2b in soaked seeds may be related to acooperative ROS-induced response. Indeed, Aox gene expressionin V. unguiculata seeds was similar in both embryos andcotyledons, suggesting a systemic response occurred (Fig. 4B).

In order to elucidate stress-induced co-expression of Aox

genes, transcript analysis in V. unguiculata leaves was conductedunder cold (4 1C), PEG, salicylate (salicylic acid) and H2O2

treatments (Fig. 5). VuAox1 and VuAox2b clustered in responseto stress signaling. The patterns of transcript abundance over timerevealed a further prevalent response of VuAox2b, which was alsoexpressed in control conditions (Fig. 5). Despite the prevalentVuAox1 response to cold stress, VuAox1 mRNA appeared to alwaysbe at a lower level than VuAox2b mRNA because more PCR cycles(35) were needed for amplification. Here, it was found thatVuAox2b is both constitutive and stress inducible, and a similarsituation occurs with AtAox1a. In Arabidopsis, Aox1a is very stressinducible, and it is also by far, the highest expressed member ofthe Aox gene family under normal growth conditions (Cliftonet al., 2006). Recently, Campos et al. (2009) observed a similar co-expression pattern of Daucus carota Aox1a and Aox2a duringgrowth and development.

In a previous study, PEG treatments failed to induce VuAox1

and induced only VuAox2b in the roots of Vita 5 cultivar (Costa etal., 2007). However, these results were obtained under differentconditions than the treatments reported here (Vita 5 leaves);therefore, it impossible to suggest that VuAox1 and 2b co-expression is tissue-specific. Furthermore, considering the differ-ential Aox expression between cultivars (Vita 3 and Vita 5) (Costaet al., 2007), it will be important to examine if co-expression is ageneral feature of these V. unguiculata genes.

Taking into account our results compared to the soybean, acrucial difference exists because the transcript patterns of theGmAox genes revealed only GmAox1 to be stress responsive (Millaret al., 1997; Djajanegara et al., 2002; Thirkettle-Watts et al.,2003). In fact, differences in Aox regulation (protein and activitylevels) in response to cold treatment were also previously foundin the soybean and the mung bean (Vigna radiata), a species fromthe Vigna genus (Gonz�alez-Meler et al., 1999).

In spite of the paradigm statement that Aox1 is induced by arange of stress stimuli and Aox2 is constitutively expressed,admitted as playing a ‘‘housekeeping’’ role in respiratorymetabolism (Considine et al., 2002), Clifton et al. (2005) indicateda role for Arabidopsis Aox2 in stress responses, reinforcing ourpresent results and the results also obtained with V. unguiculata

roots (Costa et al., 2007). Furthermore, several EST data fromsubtracted libraries of cold aerial tissues (FE898183; FD792528)or infected leaves with rust pathogen (FE700224; FE700225;

ARTICLE IN PRESS

J.H. Costa et al. / Journal of Plant Physiology 167 (2010) 561–570 569

FE700226; FE700227) of the common bean (Phaseolus vulgaris)Aox2b, indicate that in a plant species that is very closely relatedto V. unguiculata, Aox2b also appears to be stress inducible.

The stress-induced co-expression of VuAox1 and VuAox2b alsosuggests regulation occurs at the post-translational level. Thepresence of multiple Aox subunits in the same tissue/condi-tions raises the possibility that subunit heterodimerism occurs(Finnegan et al., 1997). Both VuAox1 and 2b isoenzymes may beneeded for Aox activity adjustment in stress conditions. All VuAoxproteins have both conserved cysteine residues, CysI and CysII,which are assumed to be involved in dimer formation and in thedifferential regulation of plant Aox proteins (Crichton et al., 2005;Umbach et al., 2006). Recently, conserved amino acids residues,on the vicinity of both sides of the first cysteine residue (CysI),clearly distinguish Aox1 from Aox2 and have been speculated topresent structural significance to regulatory function (Costa et al.,2009a).

In order to gain insight into V. unguiculata Aox regulatorycis-elements, a comparative analysis with established Arabidopsis

Aox1a cis-elements involved in stress (Ho et al., 2008) wasperformed using �325 and �556 bp upstream regions of thetranscriptional start site (TSS) of VuAox1 and VuAox2b, respec-tively. Despite the partial sequences of V. unguiculata Aox

promoter regions, the mutagenesis analyses with Arabidopsis

Aox1a performed by Ho et al. (2008) showed that the majority ofcis regulatory elements for Aox genes are located until 300 bpupstream of the TSS. It was revealed that both V. unguiculata Aox

genes have degenerate sequences (except one in VuAox1),suggesting that the stress-induced co-expression of VuAox1 and2b may be regulated by different pathways than Arabidopsis

Aox1a. In this context, the comparison of upstream promoterregions of VuAox1 and 2b revealed a common region presentinghigh identity with a 28 bp conserved motif on the promoter of3 antioxidant defense co-expressed genes in rice, designated asCORE (Coordinate regulatory element for antioxidant defense)(Tsukamoto et al., 2005). The presence of a cis-element possiblyresponsive to oxidative stress in VuAox1 and 2b corroborate thedata demonstrating stress-induced co-expression (Fig. 6).

In conclusion, our results support, for the first time, that Aox1

and Aox2b are co-expressed in response to stress, which revealscoordination in gene length as well as the possibility that acis-element is involved in this regulation. Mutagenesis studieswill be of great aid in establishing the actual role of this commoncis-element. Indeed, the constitutive and induced nature ofVuAox2b expression suggests that initially it was a constitutivegene that has acquired inducible regulatory elements.

Acknowledgements

We are grateful to Ivan de Godoy Maia from the GeneticDepartment IB – UNESP, Botucatu, S~ao Paulo, Brazil, for discus-sions and comments on the manuscript. We also want to expressour gratitude to Jo~ao Henrique Frota Cavalcanti from the FederalUniversity of Ceara for his helpful contribution on experimentalessays. This research was supported by CAPES/SeCyT, CNPq andFUNCAP.

References

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, et al. GappedBLAST and PSI-BLAST: a new generation of protein database search programs.Nucleic Acids Res 1997;25:3389–402.

Andersson ME, Nordlund P. A revised model of the active site of the alternativeoxidase. FEBS Lett 1999;449:17–22.

Arnholdt-Schmitt B, Costa JH, Fernandes de Melo D. AOX – a functional marker forefficient cell reprogramming under stress?. Trends Plant Sci 2006;11:281–7.

Batada NN, Urrutia AO, Hurst LD. Chromatin remodelling is a major source ofcoexpression of linked genes in yeast. Trends Genet 2007;23:480–4.

Berthold DA, Andersson ME, Nordlund P. New insight into the structure andfunction of the alternative oxidase. Biochim Biophys Acta 2000;1460:241–54.

Campos MD, Cardoso HG, Linke B, Costa JH, Fernandes de Melo D, Justo L, et al.Differential expression and co-regulation of carrot Aox genes (Daucus carota).Physiol Plant 2009; doi:10.1111/j.1399-3054.2009.01282.x.

Castillo-Davis CI, Mekhedov SL, Hartl DL, Koonin EV, Kondrashov FA. Selection forshort introns in highly expressed genes. Nat Genet 2002;31:415–8.

Chen J, Sun M, Hurst LD, Carmichael GG, Rowley JD. Human antisense genes haveunusually short introns: evidence for selection for rapid transcription. TrendsGenet 2005;21:203–7.

Chen X, Laudeman WT, Rushton PJ, Spraggins TA, Timko MP. CGKB: an annotationknowledge base for cowpea (Vigna unguiculata L.) methylation filteredgenomic genespace sequences. BMC Bioinformatics 2007;8:129.

Clifton R, Lister R, Parker KL, Sappl PG, Elhafez D, Millar AH, et al. Stress-inducedco-expression of alternative respiratory chain components in Arabidopsisthaliana. Plant Mol Biol 2005;58:193–212.

Clifton R, Millar AH, Whelan J. Alternative oxidases in Arabidopsis: a comparativeanalysis of differential expression in the gene family provides new insightsinto function of non-phosphosrylating bypasses. Biochim Biophys Acta2006;1757:730–41.

Considine MJ, Daley DO, Whelan J. The expression of alternative oxidase anduncoupling protein during fruit ripening in mango. Plant Physiol 2001;126:1619–1629.

Considine MJ, Holtzapffel RC, Day DA, Whelan J, Millar AH. Molecular distinctionbetween alternative oxidase from monocots and dicots. Plant Physiol2002;129:949–53.

Costa JH, Hasenfratz-Sauder MP, Pham-Thi AT, Silva Lima MG, Dizengremel P,Jolivet Y, et al. Identification in Vigna unguiculata (L.) Walp. of two cDNAsencoding mitochondrial alternative oxidase orthologous to soybean alter-native oxidase genes 2a and 2b. Plant Sci 2004;167:233–9.

Costa JH, Jolivet Y, Hasenfratz-Sauder MP, Orellano EG, Silva Lima MG,Dizengremel P, et al. Alternative oxidase regulation in roots of Vignaunguiculata cultivars differing in drought/salt tolerance. J Plant Physiol2007;164:718–27.

Costa JH, Cardoso HC, Campos MD, Zavattieri A, Frederico AM, Fernandes de MeloD, et al. Daucus carota L. – an old model for cell reprogramming gains newimportance through a novel expansion pattern of alternative oxidase (Aox)genes. Plant Physiol Biochem 2009a;47:753–9.

Costa JH, Fernandes de Melo D, Gouveia Z, Cardoso HG, Peixe A, Arnholdt-SchmittB. The alternative oxidase family of Vitis vinifera reveals an attractive model tostudy the importance of genomic design. Physiol Plant 2009b; doi:10.1111/j.1399-3054.2009.01267.x.

Crichton PG, Affourtit C, Albury MS, Carre J, Moore AL. Constitutive activity ofSauromatum guttatum alternative oxidase in Schizosaccharomyces pombeimplicates residues in addition to conserved cysteines in a-keto acid activa-tion. FEBS Lett 2005;579:331–6.

Djajanegara I, Finnegan PM, Mathieu C, McCabe T, Whelan J, Day DA. Regulation ofalternative oxidase gene expression in soybean. Plant Mol Biol 2002735–42.

Finnegan PM, Whelan J, Millar AH, Zhang Q, Smith MK, Wiskich JT, et al.Differential expression of the multigene family encoding the soybeanmitochondrial alternative oxidase. Plant Physiol 1997;114:455–66.

Giraud E, Ho LHM, Clifton R, Carroll A, Estavillo G, Tan Y-F, et al. The absence ofalternative oxidase 1a in arabidopsis results in acute sensitivity to combinedlight and drought stress. Plant Physiol 2008;147:595–610.

Gonz�alez-Meler MA, Ribas-Carbo M, Giles L, Siedow JN. The effect of growth andmeasurement temperature on the activity of the alternative respiratorypathway. Plant Physiol 1999;120:765–72.

Henfrey RD, Slater RJ. Isolation of plant nuclei. In: Walker JM, editor. Methods inmolecular biology. Totowa, New Jersey: Humana Press; 1988. p. 447–52.

Hershberg R, Yeger-Lotem E, Margalit H. Chromosomal organization is shaped bythe transcriptional regulatory network. Trends Genet 2005;21:138–42.

Ho LHM, Giraud E, Lister R, Thirkettle-Watts D, Low J, Clifton R, et al.Characterization of the regulatory and expression context of an alternativeoxidase gene provides insights into cyanide-insensitive respiration duringgrowth and development. Plant Physiol 2007;143:1519–33.

Ho LHM, Giraud E, Uggalla V, Lister R, Clifton R, Glen A, et al. Identification ofregulatory pathways controlling gene expression of stress-responsive mito-chondrial proteins in arabidopsis. Plant Physiol 2008;147:1858–73.

Holtzapffel RC, Casteli J, Finnegan PM, Millar AH, Whelan J, Day DA. A tomatoalternative oxidase protein with altered regulatory properties. BiochimBiophys Acta 2003;1606:153–62.

Job C, Rajjou L, Lovigny Y, Belghazi M, Job D. Patterns of protein oxidation inarabidopsis seeds and during germination. Plant Physiol 2005;138:790–802.

Lima-Junior A, Fernandes de Melo D, Costa JH, Orellano EG, Jolivet Y,Jarmuszkiewicz W, et al. Effect of pH on CN-resistant respiratory activityand regulation on Vigna unguiculata mitochondria. Plant Physiol Biochem2000;38:765–71.

Maxwell DP, Wang Y, McIntosh L. The alternative oxidase lowers mitochondrialreactive oxygen production in plant cells. Proc Natl Acad Sci USA 1999;96:8271–8276.

ARTICLE IN PRESS

J.H. Costa et al. / Journal of Plant Physiology 167 (2010) 561–570570

McCabe PC, Finnegan PM, Millar H, Day DA, Whelan J. Differential expression ofalternative oxidase genes in soybean cotyledons during postgerminativedevelopment. Plant Physiol 1998;118:675–82.

Millar AH, Finnegan PM, Whelan J, Drevon JJ, Day DA. Expression and kinetics ofthe mitochondrial alternative oxidase in nitrogen-fixing nodules of soybeanroots. Plant Cell Environ 1997;20:1273–82.

Millenaar FF, Lambers H. The alternative oxidase: in vivo regulation and function.Plant Biol 2003;5:2–15.

Murray MG, Thompson WF. Rapid isolation of high molecular weight plant DNA.Nucleic Acids Res 1980;8:4321–5.

Nakai K, Kanehisa M. A knowledge base for predicting protein localization sites ineucaryotic cells. Genomics 1992;14:897–911.

Purvis AC. Role of the alternative oxidase in limiting superoxide production byplant mitochondria. Physiol Plant 1997;100:165–70.

Robson CA, Vanlerberghe GC. Transgenic plant cells lacking mitochondrialalternative oxidase have increased susceptibility to mitochondria-dependentand independent pathways of programmed cell death. Plant Physiol2002;129:1908–20.

Saisho D, Nambara E, Naito S, Tsutsumi N, Hirai A, Nakazono M. Characterization ofthe gene family for alternative oxidase from Arabidopsis thaliana. Plant MolBiol 1997;35:585–96.

Saisho D, Nakazono M, Lee KH, Tsutsumi N, Akita S, Hirai A. The gene foralternative oxidase-2 (Aox2) from Arabidopsis thaliana consists of five exons

unlike other AOX genes and is transcribed at an early stage duringgermination. Genes Genet Syst 2001;76:89–97.

Saitou N, Nei M. The neighbor-joining method: a new method for reconstructingphylogenetic trees. Mol Biol Evol 1987;4:406–25.

Tanudji M, Sjoling S, Glaser E, Whelan J. Signals required for the import andprocessing of the alternative oxidase into mitochondria. J Biol Chem 1999;274:1286–1293.

Thirkettle-Watts D, McCabe TC, Clifton R, Moore C, Finnegan PM, Day DA, et al.Analysis of the alternative oxidase promoters from soybean. Plant Physiol2003;133:1158–69.

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The Clustal X.windows interface: flexible strategies for multiple sequence alignment aidedby quality analysis tools. Nucleic Acids Res 1997;25:4876–82.

Tsukamoto S, Morita S, Hirano E, Yokoi H, Masumura T, Tanaka K. A novel cis-element that is responsive to oxidative stress regulates three antioxidantdefense genes in rice. Plant Physiol 2005;137:317–27.

Umbach AL, Ng VS, Siedow JN. Regulation of plant alternative oxidase activity: atale of two cysteines. Biochim Biophys Acta 2006;1757:135–42.

Whelan J, Hugosson M, Glaser E, Day DA. Studies on the import and processing ofthe alternative oxidase precursor by isolated soybean mitochondria. Plant MolBiol 1995;27:769–78.

Whelan J, Millar AH, Day DA. The alternative oxidase is encoded in a multigenefamily in soybean. Planta 1996;198:197–201.