Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes...
Transcript of Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes...
![Page 1: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/1.jpg)
Conifer Translational Genomics Network
Coordinated Agricultural Project
www.pinegenome.org/ctgn
Genomics in Tree Breeding and
Forest Ecosystem Management
-----
Module 2 – Genes, Genomes, and
Mendel
Nicholas Wheeler & David Harry – Oregon State University
![Page 2: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/2.jpg)
www.pinegenome.org/ctgn
Quick review: Genes and genomes
In eukaryotes, DNA is found in
the...
– Nucleus
– Mitochondria
– Chloroplasts (plants)
Organelle inheritance is often
uniparental, making it powerful
for certain types of
applications
Figure Credit: Wikipedia Contributors, http://commons.wikimedia.org/w/index.php?title=File:Plant_cell_structure.png&oldid=45093602
![Page 3: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/3.jpg)
www.pinegenome.org/ctgn
Chromosomes
Linear strands of DNA and associated
proteins in the nucleus of eukaryotic cells
Chromosomes carry the genes and function in
the transmission of hereditary information
Diploid cells have two copies of each
chromosome
One copy comes from each parent
Paternal and maternal chromosomes may have
different alleles
Image Credit: Jane Ades, National Human Genome Research Initiative (NHGRI)
![Page 4: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/4.jpg)
www.pinegenome.org/ctgn
Genes
Units of information on heritable traits
In eukaryotes, genes are distributed along
chromosomes
Each gene has a particular physical
location: a locus
Genes encompass regulatory switches
and include both coding and non-coding
regions
Genes are separated by intergenic
regions whose function is not understood
Figure Credit: Darryl Leja, National Human Genome Research Initiative
![Page 5: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/5.jpg)
www.pinegenome.org/ctgn
The central dogma of molecular biology
Figure Credit: Modified from Jeff Dean, University of Georgia
![Page 6: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/6.jpg)
www.pinegenome.org/ctgn
Alleles
Alternative forms of a gene
A diploid cell has two copies of each gene (i.e. two
alleles) at each locus
New alleles arise through mutation
Alleles on homologous chromosomes may be the
same or different (homozygous vs. heterozygous)
Figure Credit: Megan McKenzie-Conca, Oregon State University
![Page 7: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/7.jpg)
www.pinegenome.org/ctgn
Markers reflect genetic polymorphisms that
are inherited in a Mendelian fashion
DNA markers 'mark' locations where DNA sequence varies (2 or
more alleles)
– Such polymorphisms can vary within and among individuals (e.g.
heterozygotes vs. homozygotes) and populations
Markers may be located in genes or elsewhere in the genome
– Historically, we've had too few markers to inform breeding
Genomics tools provide an almost unlimited supply of markers
![Page 8: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/8.jpg)
www.pinegenome.org/ctgn
Mutations may take many forms
Figure Credit: Modified from Lewin, 2000.
Some simple, single
nucleotide mutations
can totally alter a
protein product by
producing a
frameshift. This results
in a new amino acid
being produced
Insertions and
deletions: The addition
or loss of one or more
nucleotide(s) in coding
sequence
![Page 9: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/9.jpg)
www.pinegenome.org/ctgn
Single Nucleotide Polymorphisms
(SNPs) embedded within a DNA sequence
DNA sequences are aligned
Polymorphic sites are identified
Haplotypes (closely linked markers of a specific configuration) are
deduced by direct observation or statistical inference
* * * atggctacctgaactggtcaactcatcgaaagctaa 1 atggctacctgaactggtcaactcatcgaaagctaa 1 atgcctacctgaactggtcaactcatcgaaagctaa 2 atgcctacctgaactggtcaactcatcgaaggctaa 3 atgcctacctgaactggtcaacacatcgaaggctaa 4
Figure Credit: David Harry, Oregon State University
![Page 10: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/10.jpg)
www.pinegenome.org/ctgn
Single Nucleotide Polymorphism (SNP)
Tree 1 is heterozygous Trees 2 and 3 are homozygous
A C G T G T C G G T C T T A Maternal chrom.
A C G T G T C A G T C T T A Paternal chrom.
A C G T G T C G G T C T T A Maternal chrom.
A C G T G T C G G T C T T A Paternal chrom.
A C G T G T C A G T C T T A Maternal chrom.
A C G T G T C A G T C T T A Paternal chrom.
Tree 1
Tree 2
Tree 3
SNP
Figure Credit: Glenn Howe, Oregon State University
![Page 11: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/11.jpg)
www.pinegenome.org/ctgn
The genome
An individual’s complete genetic complement
For eukaryotes, a haploid set of chromosomes
For bacteria, often a single chromosome
For viruses, one or a few DNA or RNA molecules
Genome size is typically reported as the number of base pairs (nucleotide pairs) in one genome complement (i.e. haploid for eukaryotes)
Until recently, we studied genes and alleles one, or a few at a time (genetics)
Aided by high throughput technologies we can now study virtually all genes simultaneously (genomics)
![Page 12: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/12.jpg)
www.pinegenome.org/ctgn
Genome size
Image Credit: Modified from Daniel Peterson, Mississippi State University
0
5000
10000
15000
20000
25000
30000
35000
40000
0
1000
2000
3000 ArabidopsisOryzaPopulusSorghumGlycineZea
Triticum
aestivum
Taxodium
distichum
Picea
abies
Picea
glauca
Pinus
taeda
Pinus
pinaster
1C
DN
A c
onte
nt (M
b)
![Page 13: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/13.jpg)
www.pinegenome.org/ctgn
How large are genes?
The longest human gene is 2,220,223 nucleotides long. It has 79
exons, with a total of only 11,058 nucleotides, which specify the
sequence of the 3,685 amino acids and codes for the protein
dystrophin. It is part of a protein complex located in the cell
membrane, which transfers the force generated by the actin-myosin
structure inside the muscle fiber to the entire fiber
The smallest human gene is 252 nucleotides long. It specifies a
polypeptide of 67 amino acids and codes for an insulin-like growth
factor II
The quest for genes
![Page 14: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/14.jpg)
www.pinegenome.org/ctgn
How many genes are there in a genome?
Organism Number of genes (predicted)
C. Elegans (Roundworm) 20,000
Ancestral flowering plants 12,000 to 14,000
Arabidopsis 26,500
Medicago 40,000
Poplar 45,000
Humans 25,000
![Page 15: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/15.jpg)
www.pinegenome.org/ctgn
Why so much DNA?
Genome size / Gene number do not add up
Duplicated genes
Repetitive elements
Regulatory elements
(Other?)
(Gibson and Muse, 2004)
![Page 16: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/16.jpg)
www.pinegenome.org/ctgn
The central dogma of molecular biology
Figure Credit: Modified from Randy Johnson, U.S. Forest Service
![Page 17: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/17.jpg)
www.pinegenome.org/ctgn
Applied genetics
Applying genomics to breeding and resource management requires an introduction to sub-disciplines of genetics…
Mendelian genetics describes inheritance from parents to offspring – Discrete qualitative traits (including genetic markers)
– Predicts frequencies of offspring given specific matings
Population genetics describes allele and genotype frequencies over space and time, including – Changes in allele frequencies between generations
– Environmental factors contributing to fitness
– Models are limited to a small number of genes
– Analyzes variation within and among populations
Quantitative genetics describes variation in traits influenced by multiple genes (continuous rather than discrete attributes) – Relies on statistical tools describing correlations among relatives
– Many genes, each with a small effect, influence a specific trait
![Page 18: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/18.jpg)
www.pinegenome.org/ctgn
Mendelian genetics (and the basis of genetic markers)
![Page 19: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/19.jpg)
www.pinegenome.org/ctgn
Mendelian inheritance
How do we explain family resemblance?
![Page 20: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/20.jpg)
www.pinegenome.org/ctgn
Mendel’s experiments
Selected 14 garden pea
varieties to conduct breeding
trials
These represented alternative
forms of seven distinct traits
Cross bred alternative forms,
followed by inbreeding the
progeny of those crosses (F2)
Figure Credit: Modified from Strickberger, Genetics. 1976.
![Page 21: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/21.jpg)
www.pinegenome.org/ctgn
Segregation
Segregation – Members of an
allelic pair separate cleanly
from each other in germ cells
Figure Credit: White, T. L., W. T. Adams, and D. B. Neale. 2007. Forest Genetics. CAB
International, Wallingford, United Kingdom. Used with permission.
![Page 22: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/22.jpg)
www.pinegenome.org/ctgn
Independent assortment
Independent assortment –
Members of different pairs of
alleles assort independently of
each other
Exceptions:
– When loci are linked
– When loci are in linkage
disequilibrium
Figure Credit: White, T. L., W. T. Adams, and D. B. Neale. 2007. Forest Genetics. CAB International, Wallingford, United Kingdom.
Used with permission.
![Page 23: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/23.jpg)
www.pinegenome.org/ctgn
Genetic linkage and recombination
Genes on different chromosomes are inherited independently
Genes located on the same chromosome tend to be inherited
together because they are physically linked – except that widely
separated genes behave as if they are unlinked
Recombination during gametogenesis breaks up parental
configurations into new (recombinant) classes
The relative frequency of parental and recombinant gametes
reflects the degree of genetic linkage
Genetic mapping is the process of determining the order and
relative distance between genes or markers
![Page 24: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/24.jpg)
www.pinegenome.org/ctgn
Parental and recombinant chromosomes
Gardner, E. J., M. J. Simmons, and D. P. Snustal. 1991. Principles of Genetics. 8th Edition. Reprinted with permission of John Wiley and Sons, Inc.
![Page 25: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/25.jpg)
www.pinegenome.org/ctgn
Markers track inheritance
Markers allow for tracking of
inheritance
Linkage between markers
allows for the creation of
genetic maps
Association between markers
and phenotypic traits,
observed within crosses,
allows for mapping of QTL
Figure Credit: David Harry, Oregon State University
![Page 26: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/26.jpg)
www.pinegenome.org/ctgn
Linkage disequilibrium
The correlation of alleles at different loci
LD is a measure of non-random association among alleles – it
describes the extent to which the presence of an allele at one locus
predicts the presence of a specific allele at a second locus
Though partly a function of physical distance, LD has several other
causes, including recombination frequency, inbreeding, and
selection
LD is the basis upon which association genetics functions
![Page 27: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/27.jpg)
www.pinegenome.org/ctgn
Genotype and phenotype
Genotype refers to the particular gene or genes an individual carries
Phenotype refers to an individual’s observable traits
Only rarely can we determine genotype by observing phenotype
Genomics offers tools to better understand the relationship between
genotype and phenotype (genetic markers in abundance)
![Page 28: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/28.jpg)
www.pinegenome.org/ctgn
Single-gene traits in trees are rare…
Here’s one in alder (F. pinnatisecta)
F1 x F1
(crossed or
selfed)
Mendel’s predictions
hold up
xP F1
3 : 1F2
Image Credit: David Harry, Oregon State University
![Page 29: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/29.jpg)
www.pinegenome.org/ctgn
Traits run in families but are not typically
simply inherited
Sib 2
Sib 1
Family 1
Sib 3
Sib 4
Family 2
Image Credit: David Harry, Oregon State University
![Page 30: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/30.jpg)
www.pinegenome.org/ctgn
Landscape genomics
Image Credit: Nicholas Wheeler, Oregon State University
![Page 31: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/31.jpg)
www.pinegenome.org/ctgn
References cited
Gardner, E. J., M. J. Simmons, and D. P. Snustal. 1991. Principles of Genetics. 8th
Ed. John Wiley and Sons, Hoboken, NJ.
Gibson, G., and S. V. Muse. 2004. A primer of genome science. Sinauer Associates,
Sunderland, MA.
Lewin, B. 2000. Genes VII. Oxford University Press, New York.
Strickberger, M. W. 1976. Genetics 2nd edition. Macmillan Publishing, New York.
White, T. L, W. T. Adams, and D. B. Neale. 2007. Forest genetics. CAB
International, Wallingford, United Kingdom. (Available online at:
http://bookshop.cabi.org/?page=2633&pid=2043&site=191) (verified 27 Apr 2011).
![Page 32: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/32.jpg)
www.pinegenome.org/ctgn
External Links
The quest for genes [Online]. Microbial Genomics Workshop, DOE
Joint Genome Institute, U.S. Department of Energy, Office of
Science. The Regents of the University of California. Available at:
www.jgi.doe.gov/education/microbialworkshop/The_Quest_for_Gen
es.ppt (verified 31 May 2011).
Wikipedia contributors. 2010. File: Plant cell structure. Wikipedia,
The Free Encyclopedia. Available at:
http://commons.wikimedia.org/w/index.php?title=File:Plant_cell_stru
cture.png&oldid=45093602 (verified 31 May 2011).
![Page 33: Conifer Translational Genomics Network Coordinated ...pbgworks.org/sites/pbgworks.org/files/Genes and Genomes.pdf · Conifer Translational Genomics Network Coordinated Agricultural](https://reader031.fdocuments.in/reader031/viewer/2022022418/5a71e9fc7f8b9aa7538d3911/html5/thumbnails/33.jpg)
www.pinegenome.org/ctgn
Thank You. Conifer Translational Genomics Network
Coordinated Agricultural Project