Comte Surface Microbiology

7/31/2019 Comte Surface Microbiology

1/13

International Dairy Journal 11 (2001) 293305

Origin and diversity of mesophilic lactobacilli in Comt!e cheese,

as revealed by PCR with repetitive and species-specific primers

Francoise Berthier*, Eric Beuvier, Andr!e Dasen, R!emy Grappin

INRA, Station de Recherches en Technologie et Analyses Laiti"eres, B.P. 89, 39801 Poligny Cedex, France

Abstract

The objectives of this work were to describe the diversity of mesophilic lactobacilli in Comt!e cheese at the strain and species levels,to determine the origin(s) of this non-starter microflora, and to get a collection of well characterised strains from Comt !e cheeses.

Strains were isolated from milks, starter cultures and eight cheeses from two factories, with four cheeses made from the same vat in

each factory. Strain and species assignations were performed with a combination of two PCR-based methods, amplification with the

pairs of repetitive primers ERIC1/ERIC2 and REP1R-Dt/REP2-D, and amplification with specific primers for Lactobacillus zeae,

Lactobacillus paracasei and Lactobacillus rhamnosus. The reliability and reproducibility of these methods were assessed using 49

collection strains of mesophilic lactobacilli commonly detected in cheeses. A total of 488 isolates of mesophilic lactobacilli was

collected and was assigned to 44 different strains and three different species. Lactobacillus paracasei and Lactobacillus rhamnosus

were the predominant species in milks, starter cultures and cheeses, and constituted 98.7% of the isolates. Strain diversity was found

at both individual cheese and factory levels. Thirteen and fifteen different strains were detected throughout cheesemaking and

ripening in two individual cheeses made in different factories; only 11 different strains were detected in the two corresponding

mature cheeses. The data strongly suggest that most mesophilic lactobacilli strains originate from raw milk. r 2001 Elsevier Science

Ltd. All rights reserved.

Keywords: Species-specific PCR; Strain typing; Lb. paracasei; Lb. rhamnosus; Lb. zeae; REP-PCR; ERIC-PCR; Comt!e cheese; Raw milk; Mesophilic

lactobacilli

1. Introduction

Comt!e cheese is a hard-cooked ripened cheese variety

manufactured from raw cows milk in a limited region in

the East of France, and labelled Appellation dOrigine

Prot!eg!ee (AOP) (Beuvier, 1996). Thermophilic and

mesophilic whey starter cultures, including selected

strains of Lactobacillus helveticus, Streptococcus thermo-

philus and Lactococcus lactis, are added during the

cheesemaking process. Mesophilic lactobacilli are de-

tected as a dominant non-starter microflora in Comt !e

cheese, where their viable numbers increased from 103 to

104 cfug1 cheese at the beginning of ripening to

108 cfug1 after four weeks of ripening, and remain at

this level throughout a ripening period of at least five

months (Grappin, Beuvier, Bouton, & Pochet, 1999).

Mature Comt!e cheeses exhibit complex and varied

sensory properties (St"evenot, B!erodier, & Schlich, 1997),

which could originate from various mechanisms, includ-

ing the activities of the microbial ecosystem. This was

demonstrated with experimental mini Comt!e-type

cheeses, where changes in the level or origin of the milk

microflora were shown to affect notably the sensory

properties of the mature cheeses (Beuvier, Berthaud,

Cegarra, Dasen, Pochet, & Duboz, 1997; Demarigny,

Beuvier, Dasen, & Duboz, 1996). The mesophilic

lactobacilli could participate to the elaboration of the

sensory properties of mature Comt!e cheese because of

their abundance and time of presence during ripening, as

suggested and investigated in other cheese varieties

(Fox, McSweeney, & Lynch, 1998; Sollberger, 1990).

To investigate this aspect, and especially to explain

and understand the diversity of the sensory properties in

mature Comt!e cheese, there is a need to know the origin

and to characterise the microflora of Comt!e cheese at

the strain level, as different strains of a same species

often have different enzymatic potentialities in terms of

flavour compound production (Williams, Felipe, &Banks, 1998). A collection of well-characterised strains

*Corresponding author. Fax: +33-3-84-37-37-81.

E-mail address: [email protected] (F. Berthier).

0958-6946/01/$- see front matter r 2001 Elsevier Science Ltd. All rights reserved.

P I I : S 0 9 5 8 - 6 9 4 6 ( 0 1 ) 0 0 0 5 9 - 0


2/13

from Comt!e cheese is also essential to conduct experi-

ments in cheesemaking.

The objectives of this study were to evaluate the

diversity of mesophilic lactobacilli in Comt!e cheese

according to cheesemaking and ripening conditions, andto investigate the origin(s) of the strains found in cheese

to elucidate at least partially the role of the raw milk

microflora on the sensory properties of mature cheese.

In these respects, a new and reliable approach which

allowed a rapid and easy assignment of isolates at the

strain and species levels was developed and applied to

isolates of mesophilic lactobacilli from milks, starter

cultures and Comt!e cheeses collected in two cheese

factories.

2. Materials and methods

2.1. Samples

Bacterial strains were isolated at the same time in two

different factories, 1 and 2, equipped with four cheese

vats. These factories were known to produce cheeses

with different sensory properties. Cheeses were ripened

between 5.6 and 9.3 months according to four different

schemes (ad) used in Comt!e technology. According to

Scheme a, cheeses were ripened at 131C for 2 weeks, at

171C for 5 weeks, and at 61C until their optimal ripening

time. According to Scheme b, cheeses were ripened at

131

C for 7 weeks, at 171

C for 6 weeks, and at 61

C untiltheir optimal ripening time. According to Scheme c,

cheeses were ripened at 131C for 2 weeks, at 101C for 5

weeks, at 171C for 4 weeks, and at 61C until their

optimal ripening time. According to Scheme d, cheeses

were ripened at 131C for 7 weeks, at 191C for 5 weeks,

and at 61C until their optimal ripening time. Cheeses

1ad and 2ad were graded by the same sensory analyst

to determine their ripening endpoint. Milk 1 and milk 2

were from factories 1 and 2, respectively.

Bacterial strains from the two cheeses 1b and 2b,

which were ripened under the same conditions, were

isolated at 1, 7, 21, 49, 63, 91, 122 days, and at their

optimal ripening time. Strains from the six other cheeses

were isolated only at their optimal ripening time. In

addition, strains were isolated from the two raw milks,

from the five starter cultures and from curds before

pressing. Cheese samples of 10 g without rind were taken

at the mid-radius of each Comt!e wheel. The isolate

numbers in each sample are given in Table 1.

2.2. Isolation of mesophilic lactobacilli

Milks, starter cultures, curds and cheeses were

aseptically sampled. Samples were emulsified in sterile

2% (wt/vol) trisodium citrate (pH 8.5), diluted, platedon MRS agar pH 6.5 (De Man, Rogosa, & Sharpe,

1960) and on FH agar ( Isolini, Grand, & Gl.attli, 1990)

and incubated anaerobically for 5 days at 201C and 3

days at 371C, respectively. About 20 different colonies

were randomly picked up from the MRS plates, and in a

few cases also from FH plates, and purified twice on

MRS agar plates. All isolates were checked for growth

at 151C and were examined microscopically prior to

storing. They were maintained at 201C i n a 1 : 1

glycerolMRS mixture and routinely streaked on MRS

plates before use.

2.3. Collection strains

A selection of 49 type strains or well-characterised

strains of mesophilic lactobacilli were obtained from

different culture collections, DSMZ (Deutsche Samm-

lung von Mikroorganismen und Zellkulturen, Braunsch-

weig, Germany), LMG (Laboratorium voor

Microbiologie, Universiteit Gent, Gent, Belgium),

ATCC (American Type Culture Collection, Rockville,

Md., USA), CNRZ (Centre National de Recherches

Zootechniques, INRA Jouy-en-Josas, France), NCFB

(National Collection of industrial Bacteria, Shinfield,

Reading, Berkshire, UK), NCDO (National Collectionof Dairy Organisms, Shinfield, Reading, Berkshire, UK)

Table 1

Isolation of mesophilic lactobacilli

Source of isolates No. of isolates

Factory 1 Factory 2

Milks 20 16a

Starter cultures:

Lb. culture 15 0

Lc. culture 16a F

St. culture 1a 1a

Cheese curd b 20 4a

Ripening cheese b

1 day 17 0

7 day 19 0

21 day 20 20

49 day 20 20

63 day 20 2091 day 20 20

122 day 20 20

Mature cheese

1a 20

1b 20

1c 20

1d 19

2a 19

2b 20

2c 20

2d 19

aIsolated on FH medium.

F. Berthier et al. / International Dairy Journal 11 (2001) 293305294


3/13

or from different laboratories, Station de Recherches sur

la Viande, INRA Theix, France, Laboratoire de

Recherches sur la viande, INRA Jouy-enJosas, France

and IRTA Meat Technology Centre, Monells, Spain

(Berthier & Ehrlich, 1999). Details of the species andstrain numbers are given in Fig. 2.

2.4. DNA isolation from lactobacilli isolates

DNA was extracted from 1 mL samples of fresh MRS

cultures in the exponential growth phase. Total DNA

was either phenol extracted as described previously

(Berthier et al., 1999), or rapidly extracted with the

Instagene matrix as described by the manufacturer

(Biorad, Ivry sur Seine, France). Instagene isolated

DNA was ethanol precipitated and resuspended in 10 mL

10 mm Tris (pH 8.0), 1 mm EDTA. The quantity of

DNA obtained by the first method was estimated by

comparison with known standards in ethidium bromide-

stained 0.7% agarose gels.

2.5. Rep-PCR

Primer sets ERIC1R/ERIC2 and REP1R-Dt/REP2-

D (Versalovic, Koeuth, & Lupski, 1991) were used for

ERIC- and REP-PCR amplifications, respectively. They

were synthesised by Genosys Biotechnologies (Cam-

bridge, UK). PCR amplification was performed in a

final volume of 20 mL containing 1x PCR buffer

(Applig"ene), 420 ng phenol-extracted DNA, or 5mL

Instagene-extracted DNA, 1.0 mm MgCl2, 0.25mm each

primer, 200 mm each dNTP, and one unit Taq DNA

polymerase (Applig"ene Oncor, Illkirch, France). PCR

reactions were carried out in a thermal cycler Gene Amp

PCR system 9600 apparatus (PerkinElmer Applied

Biosystems) programmed for 30 cycles of amplification

of 1 min at 941C, 1 min at 401C, 6 min ramping to 721C,

and 1 m in at 721C, preceded by 5 min at 941C.

Electrophoresis and computer analysis were performed

as previously described (Berthier et al., 1999), except

that a GS 670 Molecular Imager System (Biorad, Ivry

sur Seine, France) and the version 4.0 instead of 3.1 of

the software package GelCompar were used.

2.6. Species-specific PCR

The oligonucleotide primers were obtained from

Genosys Biotechnologies (Cambridge, UK) and are

listed in Table 2, together with the references of their

description. The primers zeae16S and zeaeITS were

designed from the nucleotide sequences listed in Table 2.

The primer 16reverse was paired with primers para-

casei16S, rhamnosus16S or zeae16S. The primer 16 was

paired with primers paracaseiITS, rhamnosusITS or

zeaeITS. PCR reactions were performed in 10mL 1xPCR buffer (Applig"ene) supplemented with 1.0 mm T

able

2

Sequencesoftheoligonucleotideprimersusedfo

rspecies-specificPCRamplification

Primer

Location/Gene-Bankaccessionnumber

Oligonucleot

idesequence(50

-30)

Reference

Pr

imerspecificity

16

16SrRNAgene,50end,forw

ard

GCTGGATCACCTCCTTTC

(Berthier&Ehrlich,1999)

Universal

16rev

erse

16SrRNAgene,50end,reve

rsedprimer16S

GAAAGGA

GGTGATCCAGC

Universal

zeae1

6S

16SrRNAgeneofLb.zeae

typestrain,50end,

forward/d86516

GCATCGTG

ATTCAACTTAA

Lb

.zeae

rhamnosus16S

16SrRNAgeneofLb.rham

nosustypestrain,50end,

forward/d16552

TTGCATCT

TGATTTAATTTTG

(Ward&Timm

ins,1999),withan

additionalTat

50end

Lb

.rhamnosus

parac

asei16S

16SrRNAgeneofLb.caseiATCC334,50end,

forward/d86517

CACCGAGATTCAACATGG

(Wardetal.,1999)

Lb

.paracasei

zeaeITS

Short16S23Sintergenicsp

acerofLb.caseiATCC

393,50end,reverse/z75479

CGATGCGAATTTCTAAATT

Lb

.zeae

rhamnosusITS


acerofLb.rhamnosus

G1,50end,reverse/u32966

CGATGCGAATTTCTATTATT

(Tilsala-Timisja

rvi&Alatossava,1997)withoutG

withanadditio

nalTat50end

Lb

.rhamnosus

parac

aseiITS


acerofLb.paracasei

ATCC27092,50end,reverse/u32964

CGATGCGAATTTCTTTTTC

(Tilsala-Timisja

rvietal.,1997)

withoutthesecondCat50end

Lb

.paracasei

F. Berthier et al. / International Dairy Journal 11 (2001) 293305 295


4/13

MgCl2, 0.3 mm each primer, 200mm each dNTP, 0.5 unit

Taq DNA polymerase (Applig"ene Oncor, Illkirch,

France), and 210 ng phenol-extracted DNA, or 1.5mL

Instagene-extracted DNA. All the ingredients, except

specific primers, were first mixed together, aliquoted and

then specific primers were added. PCR reactions were

carried out in a thermal cycler Gene Amp PCR system

9600 apparatus (PerkinElmer Applied Biosystems)

programmed for 30 cycles of amplification of 1 min at

941C, 0 min at 551C (ITS pairs), or 0 min at 531C (16S

pairs), and 1 min at 721

C, preceded by 5 min at 941

C;The 10mL were electrophoresed in a 1% agarose gel and

were subsequently visualised by UV illumination after

ethidium bromide staining. Two PCR products of 350

and 185 bp were observed when DNA could be

amplified.

3. Results

3.1. Isolates

Altogether, 488 isolates of mesophilic lactobacilli

were collected, 287 from factory 1 and 201 from factory

2, with twenty isolates of mesophilic lactobacilli

collected from each sample, except from some of them

(Table 1). As shown in Table 1, mesophilic lactobacilli

were isolated from two out of the five starter cultures,

and from all the cheese and milk samples. MRS plating

at 201C was effective to select mesophilic lactobacilli

from most samples, but not all, selecting cocci in milk 2,

curd 2 and cheese 2b at 1day, or selecting no bacteria in

cheese 2b at 7 days. From the latter samples, FH plating

at 371C selected mesophilic lactobacilli in milk 2,

mesophilic lactobacilli together with thermophilic lacto-

bacilli in curd 2b and only thermophilic lactobacilli fromthe other samples, cheese 2b at 1 and 7 days.

MRS incubated at 201C selected almost exclusively

mesophilic lactobacilli in cheeses after seven days of

ripening, even if pediococci were occasionally isolated.

As shown in Fig. 1, MRS and FH enumerations were

systematically higher on MRS compared with FH forcheese 1b, mainly because one dominant strain in cheese

1, Lb. paracasei A12 (see below), was unable to grow at

371C, which is the incubation temperature recom-

mended for selecting Lb. paracasei on FH (Isolini

et al., 1990). Enumeration was higher on MRS

compared with FH for milk 2, curd 2b and cheese 2b

at 1 day because of the presence of cocci, presumably

enterococci according to their phenotypic characterisa-

tion. Lactococci were never isolated on MRS medium at

201C, even in the curds or the young cheeses, although

added as starter culture.

The isolates of mesophilic lactobacilli collected on FH

medium in factory 2 from milk, curd and young cheese

were included in the study because they will not impede

comments relating to strain diversity, despite the fact

that two different media at two different temperatures

were used. If present in older cheeses, they would indeed

have grown on MRS under the conditions used, and all

isolates from older cheeses of factory 2 were able to

grow on both MRS and FH under the conditions used.

3.2. Strain typing by Rep-PCR

MgCl2, primers and DNA concentrations, as well as

the temperature profile in the PCR cycle were optimisedto obtain reproducible fingerprints with a sufficient

number of bands. A ramping was thus introduced in the

original and usually used procedure (Versalovic et al.,

1991) to ensure the reliability of the method (Sobral &

Honeycutt, 1993). The annealing temperature recom-

mended for REP primers, 401C, was used with both

REP- and ERIC-primers. Finally, amplifications with

pairs of primers were found more informative than with

a single primer.

(i) Type strains and collection strains. The reproduci-

bility and the discriminatory power of Rep-PCR to

strain level was assessed. Rep-PCR analysis was applied

to 49 type strains or collection strains of mesophilic

lactobacilli (Table 3) which are commonly found in

cheese or closely related to them genetically. The strains

used are listed in Fig. 2. Most of these strains were

assigned to different species by DNA/DNA hybridisa-

tion (Bringel, Curk, & Hubert, 1996; Collins, Phillips, &

Zanoni, 1989; Dellaglio, Botazzi, & Vescovo, 1975;

Dellaglio, Dicks, du, & Torriani, 1991; Montel, Talon,

Fournaud, & Champomier, 1991) and/or species-specific

PCR amplification (Berthier & Ehrlich, 1998; Berthier

et al., 1999). As shown in Fig. 2, fingerprints which were

visually identical merged at the 88% similarity coeffi-

cient following cluster analysis of combined REP- andERIC-fingerprints, DNA being isolated by the phenol

Fig. 1. Comparison of enumeration after FH and MRS plating of

samples from identically ripened Comt!e cheeses 1b and 2b.



5/13

method. Identical fingerprints with both REP- and

ERIC-primers were obtained for all strains provided

from different collections and known as identical, Lb.

plantarum ATCC 14917T/CNRZ 211T, Lb. paracasei

CNRZ 62T/NCDO 151T, Lb. rhamnosus CNRZ 212T/

LMG 6400T/DSM 20247T. Identical fingerprints were

also obtained for Lb. plantarum CNRZ 211T/CNRZ

1228 and Lb. pentosus CNRZ 1555/CNRZ 1537 as

found with RAPD fingerprints (Tailliez, Qu!en!ee, &

Chopin, 1996), and for Lb. rhamnosus CNRZ 442/

CNRZ 205, Lb. pentosus CNRZ 1570/CNRZ 1537, Lb.

rhamnosus DSM 20247/DSM 20711, and Lb. paracasei

subsp. tolerans DSM 20012/LMG 9191T. Different

fingerprints were obtained from the other 33 strains

with both REP- and ERIC-primers, except from three

strains, Lb. curvatus CTC 448, Lb. curvatus CTC 243

and Lb. pentosus CNRZ 1547, which exhibited different

fingerprints only with REP primers.

(ii) Isolates. According to the above results, we

decided to fingerprint all cheese isolates with REP

primers, and then to confirm REP-based fingerprintdiscrimination with ERIC-based fingerprint discrimina-

tion of isolates subsets representing each putative

strains. As Instagene-isolated DNA gave the same

fingerprints as phenol-extracted DNA from the collec-

tion strains (data not shown) when similar DNA

concentration were added in the PCR mixture, it was

used in Rep-PCR analysis of isolates because of rapidity

in isolating DNA. The similarity between different Rep

fingerprints of the same strain was lower with Instagene-

isolated DNA because of the more variable DNA

concentration in the PCR mixture, which sometimes

led to differences in band intensity between fingerprints,

less or more DNA increasing or decreasing the intensity

of bands with low molecular weight compared to the

intensity of bands with high molecular weight, respec-

tively. In that respect, and to avoid the erroneous

assessment of two different fingerprints instead of one,

fingerprint identity was deduced from both clustering

analysis and visual inspection, and new fingerprints were

generated changing the DNA concentration when

doubtful fingerprint were detected. REP-based finger-

print discrimination was further confirmed with ERIC-based fingerprint discrimination.

Table 3

Lb. paracasei, Lb. rhamnosus and Lb. zeae affiliation of collection strains

Strain Current name Species affiliation with Species affiliation

CNRZ 313 Lb. casei DNA/DNA hybridisationa,b Lb. zeae

Lb. zeae species-specific PCRcDSM 20178T Lb. zeae Lb. zeae species-specific PCRc Lb. zeae

LMG 9191T Lb. paracasei DNA/DNA hybridisationb Lb. paracasei

subsp. paratolerans Lb. paracaseispecies-specific PCRc

ATCC 334 Lb. casei Lb. paracasei species-specific PCRc Lb. paracasei

CNRZ 320 Lb. paracasei Lb. paracasei species-specific PCRc Lb. paracasei



DSM 4905 Lb. paracasei DNA/DNA hybridisationa Lb. paracasei

Lb. paracasei species-specific PCRc

DSM 20006 Lb. paracasei DNA/DNA hybridisationd Lb. paracasei


DSM 20008 Lb. paracasei DNA/DNA hybridisationa,b Lb. paracasei




DSM 20020 Lb. paracasei DNA/DNA hybridisationb Lb. paracasei




NCDO 151T=CNRZ 62T Lb. paracasei DNA/DNA hybridisationd,b Lb. paracasei


LMG 6400T=CNRZ 212T, DSM 20247T Lb. rhamnosus Lb. rhamnosus species-specific PCRc Lb. rhamnosus

CNRZ 205 Lb. rhamnosus Lb.rhamnosus species-specific PCRc Lb. rhamnosus

CNRZ 442 Lb. rhamnosus Lb. rhamnosus species-specific PCRc Lb. rhamnosus

DSM 20023 Lb. rhamnosus Lb. rhamnosus species-specific PCRc Lb. rhamnosus

DSM 20711 Lb. rhamnosus DNA/DNA hybridisationa Lb. rhamnosus

Lb. rhamnosus species-specific PCRc

aDellaglio et al. (1975).b

Collins et al. (1989).cThis work.dDellaglio et al. (1991).



6/13

Forty-four different fingerprints among the 448

isolates collected were identified in this manner

(Fig. 3). All were different with REP primer amplifica-

tion alone, except five of them, A1, A31, A32, A33 A34

and A35, which were discriminated only with ERICprimer amplification.

3.3. Presumptive species assignation by Rep-PCR

fingerprint

Rep-PCR fingerprints could be used to give pre-

sumptive assignation of strains to species. Indeed, as canbe seen in Fig. 3, combined REP and ERIC fingerprints

Fig. 2. REP- and ERIC-PCR fingerprints of collection strains of mesophilic lactobacilli, and generated dendrogram from combined fingerprints. Lb.

paracasei CNRZ 62 and Lb. paracasei NCDO 151 are synonyms, as well as Lb. plantarum ATCC 14917 and Lb. plantarum CNRZ 211, and Lb.

rhamnosus LMG 6400, Lb. rhamnosus CNRZ 212 and Lb. rhamnosus DSM 20247. Species assignation after species-specific PCR amplification was

indicated in italics when there were discrepancies with the current name of strains.



7/13

from strains assigned to the same species merged in most

cases at 40% or more similarity, while those of strains

assigned to different species merged at less than 40%

similarity. Nevertheless, in some cases, fingerprints from

species represented by a few strains, such as Lb. zeae,

merged with those from other species, leading to the

misclassification of species if the 40% similarity is taken

as the criteria for species discrimination. In contrast, all

fingerprints from strains assigned to the same species

sometimes merged at less than 40% similarity, as those

of different species. In this case, the presumptiveassignation depended on the identification library used.

The 49 fingerprints from collection strains were

compared to the 44 fingerprints from this work (results

not shown). Strains B1 and B3 merged at 72.4%

similarity into the cluster including Lb. rhamnosus

LMG 6400T, and strains B2 merged at 58.7% similarity

with Lb. rhamnosus DSM 20023; strains A1 to A34,

except three, merged at 38% similarity into the cluster

including Lb. casei ATCC 334. Strains C1, C2 and C3

merged at 49% similarity with Lb. parabuchneri LMG

17769. All fingerprints from these strains exhibited

several common bands with the fingerprints from thecollection strains they merged into, strengthening their

Fig. 3. REP- and ERIC-PCR fingerprints diversity among 488 isolates of mesophilic lactobacilli from raw milks, starter cultures and Comt!e cheeses

of factories 1 and 2, and generated dendrogram from combined fingerprints. The strains isolated from milk, starter cultures and cheeses of factory 2

are preceded by a black dot. A1A35, Lb. paracasei strains; B1B3, Lb. rhamnosus strains; C1C3, presumed Lb. parabuchneri strains; D1F1,

unassigned strains. The number of isolates per strain is given in bracket.



8/13

presumptive assignation. Fingerprints from strains A11,

A27, A28, A35, D1, E1 and F1 exhibited similarity

coefficients of less than 40% with the fingerprints from

the 49 collection strains, as well as the type strains of

other mesophilic lactobacilli, Lb. farciminis, Lb. alimen-tarius, Lb. maltoromicus, Lb. coryneformis, Lb. amylo-

philus, Lb. bifermentans and Lb. sharpeae (results not

shown). Strains D1, E1 and F1 were obligatory

heterofermentative, whereas strains A11, A27, A28,

and A35 were facultatively heterofermentative.

3.4. Species assignation by species-specific PCR

We used PCR to specifically affiliate strains or isolates

to the three closely related species Lb. paracasei (type

strains: strains NCDO 151T; and ATCC 25599T;

synonym: LMG 9191T), Lb. rhamnosus (type strain

ATCC 7469T; synonyms: LMG 6400T and CNRZ

212T), and Lb. zeae (type strain ATCC 15820T;

synonym: DSM 20178T). Newly- designed primers were

used to amplify Lb. zeae DNA. The primers derived

from the 16S23S intergenic spacer were paired with

primer 16, which was formerly used in other species-

specific PCR amplification of Lactobacillus (Berthier

et al., 1998).

(i) Type and collection strains. The specificity of the

different PCR reactions, described in the method

section, was assessed as follows. The six sets of PCR

primers were used with each DNA of the Lb. casei, Lb.

rhamnosus, Lb. paracasei and Lb. zeae strains listed inTable 2. The 16reverse/rhamnosus16S and 16/rhamno-

susITS pairs amplified only Lb. rhamnosus DNA. The

16reverse/paracasei16S and 16/paracaseiITS pairs am-

plified Lb casei 334 and all Lb. paracasei DNA. The

16reverse/zeae16S and 16/zeaeITS pairs amplified Lb.

casei CNRZ 313 and Lb. zeae DSM 20178T DNA.

(ii) Isolates. Representative isolates of each strain

discriminated by Rep-PCR were subjected to Lb.

paracasei, Lb. rhamnosus and Lb. zeae specific PCR

amplification. 35 strains, A1A35, and three strains,

B1B3, were thus assigned to Lb. paracasei and Lb.

rhamnosus, respectively.

3.5. Strain diversity in factories 1 and 2

The strains isolated in factory 1 were genetically

different from those isolated in factory 2. As seen in

Fig. 3, no identical Rep fingerprints were indeed found

between the 23 and 21 fingerprints from factories 1 and

2, respectively, even if some were very similar, for

example A1 and A18.

As seen in Fig. 4, six and ten different strains were

isolated in milks 1 and 2. Strains B1 and A17 were the

dominant strains in milks 1 and 2, representing 55% and

25% of the milk isolates. Six and seven different strainswere isolated from the starter cultures of Lactococcus

and thermophilic lactobacilli used in factory 1, respec-

tively, with strain B1 being dominant in both. Thirteen

and fifteen different strains were isolated in cheeses 1b

and 2b throughout cheesemaking and ripening. Three

strains, B1, A12 and A31, and six strains, A14, A27,A22, A13 A15 and B3, dominated, 88% in cheese 1b

and 2b, respectively.

At the end of ripening, similar numbers of mesophilic

lactobacilli were found between differently ripened

cheeses from the same factory (for cheeses 1b and 2b,

Fig. 1), but the number of strains between cheeses varied

from two to nine, with an average of five strains (Fig. 5).

One to two strains represented between 80% and 85%

of the isolates in all cheeses, except one. Most of the

dominant strains in cheeses 1b and 2b throughout

ripening were dominant in the eight mature cheeses, but

some strains were only detected at the end of ripening.

In factory 1, only one strain, A12, was common to all

mature cheeses and was the most dominant, represent-

ing from 50% to 85% of the isolates. Strain B1 was the

second dominant strain in cheeses 1a and 1c. These two

strains represented from 80% to 85% of the isolates

from cheeses 1a to 1d. A more variable and complex

pattern was observed at the end of ripening of cheeses

manufactured in factory 2. In contrast to factory 1, three

strains, A13, A14 and A27, were common to all cheeses.

In cheeses 2a, 2b and 2d, strain A14 was dominant

representing between 30% and 65% of cheese isolates,

while in cheeses 2a, 2c and 2d A14 together with a

second strain represented 8085% of the cheese isolates.In cheese 2b, six strains made up 85% of the cheese

isolates.

3.6. Species diversity

The same two predominant species of mesophilic

lactobacilli, Lb. paracasei and Lb. rhamnosus, were

identified in milks, in two starter cultures, and in cheeses

from factories 1 and 2, but in very different proportions

between factories. For instance, in cheeses, Lb. rhamno-

sus and Lb. paracasei represented respectively 48% and

52% in cheese 1, and 90.9% and 8.3% in cheese 2b

throughout cheesemaking and ripening. Furthermore,

Lb. rhamnosus was only present in two of the eight

mature cheeses at the end of ripening. A minor species,

Lb. parabuchneri was detected in milk 2 and in two

cheeses from factory 1 at the end of ripening.

3.7. Strain origin(s)

Data from this study indicated that a large number of

the mesophilic lactobacilli strains in Comt!e cheese could

originate from raw milk. However, the data were not

conclusively proving because we did not detect all cheese

strains in the raw milks. Indeed, with 20 isolatescollected per sample, strains could only be detected



9/13

from the different samples if they represented 5% or

more of the bacterial population enumerated after

plating.

As seen in Fig. 4, four different situations were

observed among the strains of cheese 1b: (i) one minor

strain, A2, was found only in the milk; (ii) two major

strains, A12 and B1, and two minor strains A1 and A11,

were found in both the milk and in at least one of the

starter culture; (iii) the third major strain, A31, was only

found in starter cultures; and (iv) the seven other minor

strains were not found in either the milk or the starter

cultures. These results suggest four different ways of

contamination, depending on the strains considered:

milk for A2, both milk and starter culture(s) for A12,

B1, A1 and A11, starter culture(s) for A31, and the

equipment and/or the factory environment for the

others. The initial levels of strains in milk, the relative

contribution of starter microflora and raw milk micro-

flora to these levels, and the levels they reached in the

curd, should be considered to choose between raw milk

and starter cultures, or both, as source of mesophilic

lactobacilli. Strain A2 was present at 7102 cfug1 in

curd 1b, a level corresponding to that postulated from

its level in milk, provided that no growth took place

during cheesemaking. Strain A2 could then originatefrom milk. The strains A1, A11, A12 and B1 most

probably originated also from milk rather than from

starter culture(s), as they were detected in curd 1b at

levels similar with those postulated from their respective

levels in milk without any growth, and as the contribu-

tion of starter cultures to the final cell number of

mesophilic lactobacilli in milk was 200 times less than

that of raw milk microflora. The relative contribution of

starter cultures to the initial level of mesophilic

lactobacilli strains favoured also a milk origin for the

major strain A31. To reach the 2.7103 cfug1

enumerated in curd 1 and if it originated from the

starter cultures, strain A31 should indeed grow with a

generation time of 20 min postulating that growth was

exponential from the beginning of cheesemaking (if not,

generation time would be still lower), which is impos-

sible. But, if inoculated from milk at a level below the

detection limit of the method, strain A31 should grow

with a minimum generation time of 7.4 h, which is

possible. If so, all the minor strains which were not

detected in milk could also originate from milk. The

mesophilic lactobacilli detected in starter cultures

probably originated from the whey which was used as

a growth medium for the starter cultures. This whey was

collected a day before the cheeses used in this study were

manufactured. All starter strains, except A4, B2 and F1,were also detected in curd 1 (not shown). Moreover

Fig. 4. Strain diversity among mesophilic lactobacilli isolates from milks, starter cultures, and Comt!e cheeses 1b and 2b throughout cheesemaking

and ripening. Milk 1, starter cultures 1 and cheese 1b were from factory 1. Milk 2 and cheese 2b were from factory 2. , strains which were detected

only in milk or curd. &, minor strains in cheese. All strains, except those from milk 2 and Lc. starter culture 1, were isolated on MRS medium.

Strains from milk 2 and Lc. starter culture 1 were isolated on FH medium. Strain A12 did not grow on FH medium in the incubation conditions used.

A1A35, Lb. paracasei strains; B1B3, Lb. rhamnosus strains; C1C3, presumed Lb. parabuchneristrains; D1F1, unassigned strains.



10/13

strains A4, B2 and F1 were never detected in cheese 1

throughout cheesemaking and ripening. This indicates

that the same strains of mesophilic lactobacilli were

present in curd of cheeses manufactured on two

consecutive days, from daily collected milk.

Among strains of cheese 2b, only the situations (i) and

(iv) described above for cheese 1b were found for both

minor and major strains. The strains A13, A15, A16,

A17, A20 and B3 could thus originate from milk, while

the other strains could originate either from the milk,

where they were then below the detection limit of the

method, or from the equipment and/or the factory

environment. The small number of isolates we obtained

from curd 2b did not allow to choose definitively

between these two hypotheses. The four isolates we

obtained in curd were one of strain A15, two of strain

A16 and one of strain A17, reflecting the profile of milk

strains presented in Fig. 4, and favouring thus the milkorigin of all the strains of cheese 2b. The level of

mesophilic lactobacilli present in milk was very low,

1020 cfu mL1 milk.

4. Discussion

To describe in detail the diversity of mesophilic

lactobacilli in Comt!e cheeses, a new, rapid, easy and

reliable approach was developed to assign a large

number of uncharacterised isolates at both the strain

and the species levels. This approach was based on

strain typing and presumptive species assignation of the

isolates with Rep-PCR, followed by reliable species

assignation with species-specific PCR of representative

isolates for each strain. The present work showed

that Rep-PCR analysis was very well adapted to

strain discrimination of mesophilic lactobacilli. In

terms of rapidity and ease of performance, the otheravailable strain typing method is RAPD. Rep-PCR

Fig. 5. Strain diversity among mesophilic lactobacilli isolates from eight mature Comt!e cheeses manufactured in factories 1 and 2 according to four

different ripening Schemes, ad, used in Comt!e cheese technology.&, strains which were detected only in mature cheeses. All strains were isolated on

MRS medium. A5A35, Lb. paracasei strains; B1, Lb. rhamnosus strains; C1C2, presumed Lb. parabuchneristrains.



11/13

reproducibility was the same as that for RAPD under

similar conditions of fingerprint analysis (Berthier et al.,

1999). However, Rep-PCR analysis presents three

advantages over RAPD analysis. First, contrary to

RAPD, the same primers can reliably discriminatestrains of many different Gram-positive and Gram-

negative species (Rademaker, Louws, & de Bruijn,

1998), which was not possible with RAPD primers,

even among mesophilic lactobacilli (Berthier, unpub-

lished); thus, Rep-PCR can be applied to completely

uncharacterised isolates. The second advantage of Rep-

PCR is that each REP- and ERIC-PCR fingerprints of

mesophilic lactobacilli strains contained more bands

than the single RAPD fingerprints previously obtained

for the same strains (Berthier et al., 1999; Tailliez et al.,

1996), as was previously observed for Listeria strains

(Jersek, Tcherneva, Rijpens, & Herman, 1996); thus, the

number of different PCR reactions to perform for

obtaining the same discrimination level is reduced. The

third advantage is that Rep-PCR amplification is less

sensitive than RAPD amplification to minor changes in

reaction conditions, because REP and ERIC primers are

longer (Gillings & Holley, 1997). The robustness and

reproducibility of Rep fingerprints was improved in this

work by increasing the ramp time from the annealing to

the extension steps (Sobral et al., 1993). In other

respects, two sets of primers designed from two different

sequences, the 16S rRNA coding sequence and the 16S

23S small intergenic spacer, are now available together

with reliable PCR conditions to specifically amplifyDNA from each of the three related species Lb.

paracasei , Lb. rhamnosus and Lb. zeae. Newly-designed

primer pairs, which combined previously-and newly-

designed primers, were used to specifically amplify with

PCR these three related species. The reliability of

species-specific PCR amplification was assessed using a

large selection of well-studied and different strains of

each species. Our optimised PCR conditions ensured a

species assignation in accordance with all previous

results (Collins et al., 1989; Dellaglio et al., 1975;

Dellaglio et al., 1991). In particular, the two strains Lb.

zeae DSM 20178T and Lb. caseiATCC 393, classified in

Lb. zeae after DNA/DNA hybridisation, but harbour-

ing different 16S rRNA coding sequences (Mori et al.,

1997) were identically assigned to the same species with

the two sets of primers. In this work, 0.06% of isolates

were not species assigned; and 0.06% were assigned to a

presumptive lactobacilli species. The successful applica-

tion of Rep-PCR combined with species-specific PCR to

assign directly the isolates of mesophilic lactobacilli at

the species level, without ambiguities or discrepancies

between the results of the two methods, avoided the use

of the ambiguous phenotypic species assignation (Col-

lins et al., 1989; Curk, Hubert, & Bringel, 1996).

It is striking to note that 35 different strains of Lb.paracasei, but only three different strains of Lb.

rhamnosus were detected in this work. Lb. paracasei

seems to exhibit a different intraspecies genomic

variability from that of Lb. rhamnosus. This difference

can be observed both among the collection and Comt !e

cheese strains. Lb. paracasei and Lb. rhamnosus strainscan exhibit very different Rep fingerprints. But Lb.

rhamnosus fingerprints varied discontinuously and were

grouped into three distinct subclusters, while Lb.

paracasei fingerprints varied more continuously and

were grouped in a main cluster, when the collection and

cheese strains were analysed together.

This work showed that mesophilic lactobacilli from

milk, starter cultures and Comt!e cheese at different ages

could be selectively isolated and enumerated on FH

medium incubated at 201C and not 371C as recom-

mended (Isolini et al., 1990). These lactobacilli can be

facultative or obligatory-heterofermentative lactobacilli.

The MRS medium was insufficient for selecting lacto-

bacilli from some milks, starter cultures and cheeses in

the early stages. The temperature of 201C, not 371C,

allowed the growth of all mesophilic lactobacilli strains.

The dynamics of mesophilic lactobacilli population

enumerated on FH incubated at 371C presented in this

work is typical of that found in Comt!e cheese (Grappin

et al., 1999).

A striking result of this work is that diversity among

mesophilic lactobacilli from Comt!e cheeses of two

different origins was found at the strain, but not at the

species level. Each Comt!e cheese origin could be

identified by its profile of mesophilic lactobacilli strains,with no strain overlapping between profiles. Qualita-

tively, the strain profile in individual mature cheese of

the same manufacturing batch varied little according to

four different ripening conditions used in Comt!e

technology, some minor strains appearing or disappear-

ing; the most important changes were in the different

predominant strains found in the mature cheeses of one

cheese batch. The stability of the strain profiles of

mesophilic lactobacilli over different time periods for the

same Comt!e factory remains to be explored. The origin-

specific strain profile, but not the species profile, of

mesophilic lactobacilli was recently observed in mature

Irish Cheddar cheese (Fitzsimons, Cogan, Condon, &

Beresford, 1999).

The same mean number of different mesophilic

lactobacilli strains were identified in Comt !e (this work)

and Irish Cheddar mature cheeses. However, twice as

many were identified throughout Comt!e cheese ripening.

Thus, there is a need to examine precisely the strain

dynamics throughout cheesemaking and ripening. That

will be developed in a further report.

As mentioned above, diversity among mesophilic

lactobacilli from different Comt!e cheeses was not found

in their species profile. Indeed, the same two species, Lb.

paracasei and Lb. rhamnosus, were predominant, albeitat different proportions, in the two Comt!e cheeses



12/13

monitored throughout ripening. It should be noted

however that Lb. rhamnosus was absent in the dominant

population at the end of ripening. Whereas Lb.

paracasei was previously detected as a predominant

species in many different cheese varieties, Lb. rhamnosuswas only detected in some mature hard cheeses, Swiss-

type, Idia$zabal, Swedish, and Parmigiano Reggiano

cheeses (Coppola et al., 1997; Elortondo, Echobarria,

Albisu, & Barcina, 1998; Jimeno, Lazaro, & Sollberger,

1995; Lindberg, Christiansson, Rukke, Eklund, &

Molin, 1996). A third minor species, Lb. parabuchneri

was detected in two cheeses from one factory. This last

species was also mentioned in three English Cheddar

mature cheeses (Williams & Banks, 1997). The species

diversity of mesophilic lactobacilli in individual mature

Comt!e cheese was of the same magnitude order as that

reported for mature Irish Cheddar cheese (Fitzsimons

et al., 1999), but lower than that reported by in mature

English Cheddar cheeses (Williams et al., 1997). The

mesophilic lactobacilli population in Comt!e cheese was

almost exclusively composed of facultatively heterofer-

mentative lactobacilli, as in Irish Cheddar and Parmi-

giano Reggiano cheeses (Coppola et al., 1997;

Fitzsimons et al., 1999).

This work strongly suggests that a large number of

the mesophilic lactobacilli strains in Comt!e cheese

originated from the raw milk, and that this source was

probably more important than factory-environment,

processing equipment or starter culture. This result

supports the milk origin of mesophilic lactobacilli thatcould be previously hypothesised (Demarigny et al.,

1996). The origin, associated to the specific strain profile

of raw milk mesophilic lactobacilli according to milk

origin, could partly explain the differences in sensory

properties of experimental Swiss-type cheeses which

differed only by the origin of the raw milk microflora

that were present (Demarigny, Beuvier, Buchin, Pochet,

& Grappin, 1997). The origin of the other non-starter

populations present in Comt!e cheese throughout chee-

semaking and ripening remains to be elucidated. On the

other hand, it would be also interesting to understand

why all of the mesophilic lactobacilli strains detected in

the dominant population in milk were not detected in

the dominant mesophilic lactobacilli population in

cheese throughout cheesemaking and ripening.

Acknowledgements

The technical support of Franck Dufrene is greatly

appreciated. This work was financially supported by the

INRA grant A.I.P. Structure et dynamique des

"ecosyst"emes bact!eriens, and by the region council of

Franche-Comt!e and the European Community

contract no. 96/9 R00202003. The authors would liketo thank S. Pochet for critical reading of the manuscript,

and Helen Lamprell and Jean M. Banks for revising the

English language.

References

Berthier, F., & Ehrlich, S. D. (1998). Rapid species identification

within two groups of closely related lactobacilli using PCR primers

that target the 16S/23S rRNA spacer region. FEMS Microbiology

Letters, 161, 97106.

Berthier, F., & Ehrlich, S. D. (1999). Genetic diversity within

Lactobacillus sakei and Lactobacillus curvatus and design of PCR

primers for its detection using randomly amplified polymorphic

DNA. International Journal of Systematic Bacteriology, 49,

9971007.

Beuvier, E. (1996). Comt!e cheese. In T. M. Cogan, & M. C. Rea (Eds.),

Artisanal European cheeses (pp. 6368). Brussels: Office for Official

Publications of the European Communauties.

Beuvier, E., Berthaud, K., Cegarra, S., Dasen, A., Pochet, S., &

Duboz, G. (1997). Ripening and quality of Swiss-type cheese madefrom raw, pasteurized or microfiltered milk. International Dairy

Journal, 7, 311323.

Bringel, F., Curk, M. C., & Hubert, J. C. (1996). Characterization of

lactobacilli by Southern-type hybridization with a Lactobacillus

plantarum pyrDFE probe. International Journal of Systematic

Bacteriology, 46(2), 588594.

Collins, M. D., Phillips, B. A., & Zanoni, P. (1989). Deoxyribonucleic

acid homology studies of Lactobacillus casei, Lactobacillus para-

casei sp. nov., subsp. paracasei and subsp. tolerans, and Lactoba-

cillus rhamnosus sp. nov., comb. nov. International Journal of

Systematic Bacteriology, 39(2), 105108.

Coppola, R., Nanni, M., Iorizzo, M., Sorrentino, A., Sorrentino, E., &

Grazia, L. (1997). Survey of lactic acid bacteria isolated during the

advanced stages of the ripening of Parmigiano Reggiano cheese.

Journal of Dairy Research, 64, 305310.Curk, M. C., Hubert, J. C., & Bringel, F. (1996). Lactobacillus

paraplantarum sp. nov., a new species related to Lactobacillus

plantarum. International Journal of Systematic Bacteriology, 46(2),

595598.

De Man, J. C., Rogosa, M., & Sharpe, M. E. (1960). A medium for the

cultivation of lactobacilli. Journal of Applied Bacteriology, 23,

130135.

Dellaglio, F., Botazzi, V., & Vescovo, M. (1975). Deoxyribonucleic

acid homology among Lactobacillus species of the subgenus

Streptobacterium Orla-Jensen. International Journal of Systematic


Dellaglio, F., Dicks, L. T., du, T. M., & Torriani, S. (1991).

Designation of ATCC 334 in place of ATCC 393 (NCDO 161)

as the neotype strain of Lactobacillus casei subsp. casei and

rejection of the name Lactobacillus paracasei (Collins et al., 1989).International Journal of Systematic Bacteriology, 41(2), 340342.

Demarigny, Y., Beuvier, E., Buchin, S., Pochet, S., & Grappin, R.

(1997). Influence of raw milk microflora on the characteristics of

Swiss-type cheese: II. Biochemical and sensory characteristics. Lait,

77, 151167.

Demarigny, Y., Beuvier, E., Dasen, A., & Duboz, G. (1996). Influence

of raw milk microflora on the characteristics of Swiss-type cheeses:

I. Evolution of microflora during ripening and characterization of

facultatively heterofermentative lactobacilli. Lait, 76, 371387.

Elortondo, F. J. P., Echobarria, P. A., Albisu, M., & Barcina, Y.

(1998). Indigenous lactic acid bacteria in Idiazabal ewes milk

cheese. International Dairy Journal, 8, 725732.

Fitzsimons, N. A., Cogan, T. M., Condon, S., & Beresford, T. (1999).

Phenotypic and genotypic characterization of non-starter lactic

acid bacteria in mature cheddar cheese. Applied and Environmental

Microbiology, 65(8), 34183426.



13/13

Fox, P. F., McSweeney, P. L., & Lynch, C. M. (1998). Significance of

non-starter lactic acid bacteria in cheddar cheese. Australian

Journal of Dairy Technology, 53, 8389.

Gillings, M., & Holley, M. (1997). Amplification of anonymous DNA

fragments using pairs of long primers generates reproducible DNA

fingerprints that are sensitive to genetic variation. Electrophoresis,18(9), 15121518.

Grappin, R., Beuvier, E., Bouton, Y., & Pochet, S. (1999). Advances in

the biochemistry and microbiology of Swiss-type cheeses. Lait, 79,

322.

Isolini, D., Grand, M., & Gl.attli, H. (1990). Selektivmedien zum

Nachweis von obligat und fakultativ heterofermentativen Lakto-

bazillen. Schweiz Milchwirtschaft Forschung, 19, 5759.

Jersek, B., Tcherneva, E., Rijpens, N., & Herman, L. (1996). Repetitive

element sequence-based PCR for species and strain discrimination

in the genus Listeria. Letters in Applied Microbiology, 23(1), 5560.

Jimeno, J., Lazaro, M. J., & Sollberger, H. (1995). Antagonistic

interactions between propionic acid bacteria and non-stater lactic

acid bacteria. Lait, 75, 401413.

Lindberg, A.-M., Christiansson, A., Rukke, E.-O., Eklund, T., &

Molin, G. (1996). Bacterial flora of Norwegian and Swedish semi-hard cheese after ripening, with special reference to Lactobacillus.

Netherlands Milk and Dairy Journal, 50, 563572.

Montel, M. C., Talon, R., Fournaud, J., & Champomier, M. C. (1991).

A simplified key for identifying homofermentative Lactobacillus

and Carnobacterium spp from meat. Journal of Applied Bacteriol-

ogy, 70, 469472.

Mori, K., Yamazaki, K., Ishiyama, T., Katsumata, M., Kobayashi,

K., Kawai, Y., Inoue, N., & Shinano, H. (1997). Comparative

sequence analyses of the genes coding for 16S rRNA of

Lactobacillus casei-related taxa. International Journal of Systematic


Rademaker, J. L. W., Louws, F. J., & de Bruijn, F. J. (1998).

Characterization of the diversity of ecologically important

microbes by rep-PCR genomic fingerprinting. In Molecular

microbial ecology manual (pp. 127). Dordrecht: Kluwer Academic

Publishers.

Sobral, B. W., & Honeycutt, R. J. (1993). High output genetic

mapping of polyploids using PCR-generated markers. Theoretical

and Applied Genetics, 86, 105112.

Sollberger, H. (1990). Der Einfluss fakultativer Milchs .aurebakterienauf die Propions.aureg.arung und die K.asequalit .at im Emmenthaler.

International Report FAM (pp. 117).

St"evenot, C., B!erodier, F., & Schlich, P. (1997). Typologie aromatique

des fromages de Comt!e. Sciences des Aliments, 17, 547553.

Tailliez, P., Qu!en!ee, P., & Chopin, A. (1996). Estimation de la diversit!e

parmi les souches de la collection CNRZ: Application de la RAPD

"a un groupe de lactobacilles. Lait, 76, 147158.

Tilsala-Timisjarvi, A., & Alatossava, T. (1997). Development of

oligonucleotide primers from the 16S23S rRNA intergenic

sequences for identifying different dairy and probiotic lactic acid

bacteria by PCR. International Journal of Food Microbiology, 35(1),

4956.

Versalovic, J., Koeuth, T., & Lupski, J. R. (1991). Distribution of

repetitive DNA sequences in eubacteria and application to

fingerprinting of bacterial genomes. Nucleic Acids Research,19(24), 68236831.

Ward, L. J. H., & Timmins, M. J. (1999). Differentiation of

Lactobacillus casei, Lactobacillus paracasei and Lactobacillus

rhamnosus by polymerase chain reaction. Letters of Applied

Microbiology, 29, 9092.

Williams, A. G., & Banks, J. M. (1997). Proteolytic and other

hydrolytic enzyme activities in non-starter lactic acid bacteria

(NSLAB) isolated from Cheddar cheese manufactured in the

United Kingdom. International Dairy Journal, 7, 763774.

Williams, A. G., Felipe, X., & Banks, J. M. (1998). Aminopeptidase

and dipeptidyl peptidase activity of Lactobacillus spp. and non-

starter lactic acid bacteria (NSLAB) isolated from cheddar cheese.

International Dairy Journal, 8, 255266.


Comte Surface Microbiology

Documents

Transcript of Comte Surface Microbiology