Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in...
-
Upload
phungtuong -
Category
Documents
-
view
222 -
download
0
Transcript of Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in...
![Page 1: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/1.jpg)
![Page 2: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/2.jpg)
Complexity in Evolutionary Processes
Peter Schuster
Institut für Theoretische Chemie, Universität Wien, Austriaand
The Santa Fe Institute, Santa Fe, New Mexico, USA
7th Vienna Central European Seminar onParticle Physics and Quantum Field Theory
Vienna, 26.– 28.11.2010
![Page 3: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/3.jpg)
Web-Page for further information:
http://www.tbi.univie.ac.at/~pks
![Page 4: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/4.jpg)
1. Exponential growth and selection
2. Evolution as replication and mutation
3. A phase transition in evolution
4. Fitness landscapes as source of complexity
5. Molecular landscapes from biopolymers
6. The role of stochasticity
7. Neutrality and selection
8. Computer simulation of evolution
![Page 5: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/5.jpg)
1. Exponential growth and selection
2. Evolution as replication and mutation
3. A phase transition in evolution
4. Fitness landscapes as source of complexity
5. Molecular landscapes from biopolymers
6. The role of stochasticity
7. Neutrality and selection
8. Computer simulation of evolution
![Page 6: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/6.jpg)
1,0; 1011 ==+= −+ FFFFF nnn
Leonardo da Pisa„Fibonacci“
~1180 – ~1240
Thomas Robert Malthus1766 – 1834
1, 2 , 4 , 8 ,16 , 32 , 64, 128 , ...
geometric progression
exponential growthn
nf ⎟⎟⎠
⎞⎜⎜⎝
⎛ +≈
251
51
The history of exponential growth
![Page 7: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/7.jpg)
Three necessary conditions for Darwinian evolution are:
1. Multiplication,
2. Variation, and
3. Selection.
Darwin discovered the principle of natural selection from empirical observations in nature.
![Page 8: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/8.jpg)
Pierre-François Verhulst, 1804-1849
( ) trexCxCxtx
Cxxr
dtdx
−−+=⎟
⎠⎞
⎜⎝⎛ −=
)0()0()0()(,1
The logistic equation, 1828
![Page 9: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/9.jpg)
1.01
12 =−
=f
ffs
Two variants with a mean progeny of ten or eleven descendants
![Page 10: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/10.jpg)
Num
bers
N1(
n)an
d N
2(n)
N1(0) = 9999 , N2(0) = 1 ; s = 0.1 , 0.02 , 0.01
Selection of advantageous mutants in populations of N = 10 000 individuals
![Page 11: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/11.jpg)
( )ΦrxxCΦxr
xrCxxrx
Cxxrx
−==≡
−=⇒⎟⎠⎞
⎜⎝⎛ −=
dtd:1,)t(
dtd1
dtd
Darwin
[ ]
( ) ( ) ∑∑
∑
==
=
=−=−=
===
ni iijj
ni iijj
j
ni iiin
xfΦΦfxxffxx
Cxx
11
121
;dt
d
1;X:X,,X,X K
( ) { } 0var22dt
d 22 ≥=><−><= fffΦ
Generalization of the logistic equation to n variables yields selection
![Page 12: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/12.jpg)
1. Exponential growth and selection
2. Evolution as replication and mutation
3. A phase transition in evolution
4. Fitness landscapes as source of complexity
5. Molecular landscapes from biopolymers
6. The role of stochasticity
7. Neutrality and selection
8. Computer simulation of evolution
![Page 13: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/13.jpg)
Taq = thermus aquaticus
Accuracy of replication: Q = q1 · q2 · q3 · … · qn
The logics of DNA replication
![Page 14: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/14.jpg)
Point mutation
![Page 15: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/15.jpg)
Manfred Eigen1927 -
∑∑
∑
==
=
=
=−=
n
i in
i ii
jin
i jij
xxfΦ
njΦxxWx
11
1,,2,1;
dtd
K
Mutation and (correct) replication as parallel chemical reactionsM. Eigen. 1971. Naturwissenschaften 58:465,
M. Eigen & P. Schuster.1977. Naturwissenschaften 64:541, 65:7 und 65:341
![Page 16: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/16.jpg)
∑∑
∑∑
==
==
=
=−=−=
n
i in
i ii
jiin
i jijin
i jij
xxfΦ
njΦxxfQΦxxWx
11
11,,2,1;
dtd
K
Factorization of the value matrix W separates mutation and fitness effects.
![Page 17: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/17.jpg)
integrating factor transformation
eigenvalue problem
Solution of the mutation-selection equation
![Page 18: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/18.jpg)
1. Exponential growth and selection
2. Evolution as replication and mutation
3. A phase transition in evolution
4. Fitness landscapes as source of complexity
5. Molecular landscapes from biopolymers
6. The role of stochasticity
7. Neutrality and selection
8. Computer simulation of evolution
![Page 19: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/19.jpg)
Error rate p = 1-q0.00 0.05 0.10
Quasispecies Uniform distribution
Stationary population or quasispecies as a function of the mutation or errorrate p
![Page 20: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/20.jpg)
The no-mutational backflow or zeroth order approximation
![Page 21: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/21.jpg)
quasispecies
The error threshold in replication and mutation
![Page 22: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/22.jpg)
1. Exponential growth and selection
2. Evolution as replication and mutation
3. A phase transition in evolution
4. Fitness landscapes as source of complexity
5. Molecular landscapes from biopolymers
6. The role of stochasticity
7. Neutrality and selection
8. Computer simulation of evolution
![Page 23: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/23.jpg)
single peak landscape
„Rugged“ fitness landscapes
![Page 24: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/24.jpg)
Error threshold on the single peak landscape
![Page 25: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/25.jpg)
linear andmultiplicativelandscape
Smooth fitness landscapes
![Page 26: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/26.jpg)
The linear fitness landscape shows no error threshold
![Page 27: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/27.jpg)
Make things as simple as possible, but not simpler !
Albert Einstein
Albert Einstein‘s razor, precise refence is unknown.
![Page 28: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/28.jpg)
Sewall Wright. 1931. Evolution in Mendelian populations. Genetics 16:97-159.
-- --. 1932. The roles of mutation, inbreeding, crossbreeding, and selection in evolution. In: D.F.Jones, ed. Proceedings of the Sixth International Congress on Genetics, Vol.I. Brooklyn Botanical Garden. Ithaca, NY, pp. 356-366.
-- --. 1988. Surfaces of selective value revisited. The American Naturalist 131:115-131.
![Page 29: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/29.jpg)
Build-up principle of binary sequence spaces
![Page 30: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/30.jpg)
![Page 31: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/31.jpg)
single peak landscape
Rugged fitness landscapesover individual binary sequences with n = 10
„realistic“ landscape
![Page 32: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/32.jpg)
Error threshold: Individual sequences
n = 10, = 2, s = 491 and d = 0, 1.0, 1.875
![Page 33: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/33.jpg)
d = 0.100
Case I: Strong Quasispecies
n = 10, f0 = 1.1, fn = 1.0, s = 919
d = 0.200
![Page 34: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/34.jpg)
d = 0.100
Case III: Multiple transitions
n = 10, f0 = 1.1, fn = 1.0, s = 637
d = 0.195
![Page 35: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/35.jpg)
d = 0.199
Case III: Multiple transitions
n = 10, f0 = 1.1, fn = 1.0, s = 637
d = 0.200
![Page 36: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/36.jpg)
Paul E. Phillipson, Peter Schuster. (2009) Modeling by nonlinear differential equations. Dissipative and conservative processes. World Scientific, Singapore, pp.9-60.
![Page 37: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/37.jpg)
W = G F
1 , 1 largest eigenvalue and eigenvector
diagonalization of matrix W„ complicated but not complex “
fitness landscapemutation matrix
„ complex “( complex )
sequence structure
„ complex “
mutation selection
Complexity in molecular evolution
![Page 38: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/38.jpg)
1. Exponential growth and selection
2. Evolution as replication and mutation
3. A phase transition in evolution
4. Fitness landscapes as source of complexity
5. Molecular landscapes from biopolymers
6. The role of stochasticity
7. Neutrality and selection
8. Computer simulation of evolution
![Page 39: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/39.jpg)
N = 4n
NS < 3n
Criterion: Minimum free energy (mfe)
Rules: _ ( _ ) _ {AU,CG,GC,GU,UA,UG}
A symbolic notation of RNA secondary structure that is equivalent to the conventional graphs
![Page 40: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/40.jpg)
![Page 41: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/41.jpg)
The inverse folding algorithm searches for sequences that form a given RNA secondary structure under the minimum free energy criterion.
![Page 42: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/42.jpg)
What is neutrality ?
Selective neutrality = = several genotypes having the same fitness.
Structural neutrality == several genotypes forming molecules with the same structure.
![Page 43: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/43.jpg)
A mapping and its inversion
Gk = ( ) | ( ) = -1 US I Sk j j kI
( ) = I Sj k
Space of genotypes: = {I
S
I I I I I
S S S S S
1 2 3 4 N
1 2 3 4 M
, , , , ... , } ; Hamming metric
Space of phenotypes: , , , , ... , } ; metric (not required)
N M
= {
![Page 44: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/44.jpg)
many genotypes one phenotype
![Page 45: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/45.jpg)
AUCAAUCAG
GUCAAUCAC
GUCAAUCAUGUCAAUCAA
GUCAAUCCG
GUCAAUCG
G
GU
CA
AU
CU
G
GU
CA
AU
GA
G
GUC
AAUU
AG
GUCAAUAAGGUCAACCAG
GUCAAGCAG
GUCAAACAG
GUCACUCAG
GUCAGUCAG
GUCAUUCAGGUCCAUCAG GUCGAUCAG
GUCU
AUCA
G
GU
GA
AUC
AG
GU
UA
AU
CA
G
GU
AA
AU
CA
G
GCC
AAUC
AGGGCAAUCAG
GACAAUCAG
UUCAAUCAG
CUCAAUCAG
GUCAAUCAG
One-error neighborhood
The surrounding of GUCAAUCAG in sequence space
![Page 46: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/46.jpg)
One error neighborhood – Surrounding of an RNA molecule of chain length n=50 in sequence and shape space
![Page 47: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/47.jpg)
One error neighborhood – Surrounding of an RNA molecule of chain length n=50 in sequence and shape space
![Page 48: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/48.jpg)
One error neighborhood – Surrounding of an RNA molecule of chain length n=50 in sequence and shape space
![Page 49: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/49.jpg)
One error neighborhood – Surrounding of an RNA molecule of chain length n=50 in sequence and shape space
![Page 50: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/50.jpg)
GGCUAUCGUAUGUUUACCCAAAAGUCUACGUUGGACCCAGGCAUUGGACGGGCUAUCGUACGUUUACCCAAAAGUCUACGUUGGACCCAGGCAUUAGACGGGCUAUCGUACGUUUACUCAAAAGUCUACGUUGGACCCAGGCAUUGGACGGGCUAUCGUACGCUUACCCAAAAGUCUACGUUGGACCCAGGCAUUGGACGGGCCAUCGUACGUUUACCCAAAAGUCUACGUUGGACCCAGGCAUUGGACGGGCUAUCGUACGUUUACCCAAAAGUCUACGUUGGACCCAGGCAUUGGACGGGCUAUCGUACGUGUACCCAAAAGUCUACGUUGGACCCAGGCAUUGGACGGGCUAACGUACGUUUACCCAAAAGUCUACGUUGGACCCAGGCAUUGGACGGGCUAUCGUACGUUUACCCAAAAGUCUACGUUGGACCCUGGCAUUGGACGGGCUAUCGUACGUUUACCCAAAAGUCUACGUUGGACCCAGGCACUGGACGGGCUAUCGUACGUUUACCCAAAAGUCUACGUUGGUCCCAGGCAUUGGACGGGCUAGCGUACGUUUACCCAAAAGUCUACGUUGGACCCAGGCAUUGGACGGGCUAUCGUACGUUUACCCGAAAGUCUACGUUGGACCCAGGCAUUGGACGGGCUAUCGUACGUUUACCCAAAAGCCUACGUUGGACCCAGGCAUUGGACG G
GC
UAU
CG
UAC
GU
UUA
CCC A
AAAG U
CUACG UUGGACC C AG
GCAU
UGGACG
One error neighborhood – Surrounding of an RNA molecule of chain length n=50 in sequence and shape space
![Page 51: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/51.jpg)
Number Mean Value Variance Std.Dev.Total Hamming Distance: 150000 11.647973 23.140715 4.810480Nonzero Hamming Distance: 99875 16.949991 30.757651 5.545958Degree of Neutrality: 50125 0.334167 0.006961 0.083434Number of Structures: 1000 52.31 85.30 9.24
1 (((((.((((..(((......)))..)))).))).))............. 50125 0.3341672 ..(((.((((..(((......)))..)))).)))................ 2856 0.0190403 ((((((((((..(((......)))..)))))))).))............. 2799 0.0186604 (((((.((((..((((....))))..)))).))).))............. 2417 0.0161135 (((((.((((.((((......)))).)))).))).))............. 2265 0.0151006 (((((.(((((.(((......))).))))).))).))............. 2233 0.0148877 (((((..(((..(((......)))..)))..))).))............. 1442 0.0096138 (((((.((((..((........))..)))).))).))............. 1081 0.0072079 ((((..((((..(((......)))..))))..)).))............. 1025 0.006833
10 (((((.((((..(((......)))..)))).))))).............. 1003 0.00668711 .((((.((((..(((......)))..)))).))))............... 963 0.00642012 (((((.(((...(((......)))...))).))).))............. 860 0.00573313 (((((.((((..(((......)))..)))).)).)))............. 800 0.00533314 (((((.((((...((......))...)))).))).))............. 548 0.00365315 (((((.((((................)))).))).))............. 362 0.00241316 ((.((.((((..(((......)))..)))).))..))............. 337 0.00224717 (.(((.((((..(((......)))..)))).))).).............. 241 0.00160718 (((((.(((((((((......))))))))).))).))............. 231 0.00154019 ((((..((((..(((......)))..))))...))))............. 225 0.00150020 ((....((((..(((......)))..)))).....))............. 202 0.001347 G
GC
UAU
CG
UAC
GU
UUA
CCC A
AAAG U
CUACG UUGGACC C AG
GCAU
UGGACG
Shadow – Surrounding of an RNA structure in shape space: AUGC alphabet, chain length n=50
![Page 52: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/52.jpg)
1. Exponential growth and selection
2. Evolution as replication and mutation
3. A phase transition in evolution
4. Fitness landscapes as source of complexity
5. Molecular landscapes from biopolymers
6. The role of stochasticity
7. Neutrality and selection
8. Computer simulation of evolution
![Page 53: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/53.jpg)
Stochastic phenomena in evolutionary processes
ODEs (in population genetics) describe expectation valuesin infinite populations.
1. Finite population size effects
2. Low numbers of individual species
3. Selective neutrality
Every mutant starts from a single copy.
Populations drift randomly in the space of neutral variants.
![Page 54: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/54.jpg)
probabilistic notion of particle numbers Xj
master equation
flow reactor
![Page 55: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/55.jpg)
Evolution of RNA molecules as a Markow process
![Page 56: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/56.jpg)
Evolution of RNA molecules as a Markow process
![Page 57: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/57.jpg)
Evolution of RNA molecules as a Markow process
![Page 58: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/58.jpg)
Evolution of RNA molecules as a Markow process
![Page 59: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/59.jpg)
RNA replication and mutation as a multitype branching process
![Page 60: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/60.jpg)
![Page 61: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/61.jpg)
1. Exponential growth and selection
2. Evolution as replication and mutation
3. A phase transition in evolution
4. Fitness landscapes as source of complexity
5. Molecular landscapes from biopolymers
6. The role of stochasticity
7. Neutrality and selection
8. Computer simulation of evolution
![Page 62: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/62.jpg)
Population size Ne = 10000 , s = 0
Stochastic population genetics of neutral, asexually reproducing species
![Page 63: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/63.jpg)
Motoo Kimura‘s population genetics of neutral evolution.
Evolutionary rate at the molecular level. Nature 217: 624-626, 1955.
The Neutral Theory of Molecular Evolution. Cambridge University Press. Cambridge, UK, 1983.
![Page 64: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/64.jpg)
The average time of replacement of a dominant genotype in a population is the reciprocal mutation rate, 1/ , and therefore independent of
population size.
Fixation of mutants in neutral evolution (Motoo Kimura, 1955)
![Page 65: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/65.jpg)
Is the Kimura scenario correct for frequent mutations?
Fixation of mutants in neutral evolution (Motoo Kimura, 1955)
![Page 66: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/66.jpg)
5.0)()(lim 210 ==→ pxpxp
dH = 1
apx
apx
p
p
−=
=
→
→
1)(lim
)(lim
20
10
dH = 2
dH ≥ 3
1)(lim,0)(lim
or0)(lim,1)(lim
2010
2010
==
==
→→
→→
pxpx
pxpx
pp
pp
Random fixation in thesense of Motoo Kimura
Pairs of neutral sequences in replication networks
P. Schuster, J. Swetina. 1988. Bull. Math. Biol. 50:635-650
![Page 67: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/67.jpg)
A fitness landscape including neutrality
![Page 68: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/68.jpg)
Neutral network: Individual sequences
n = 10, = 1.1, d = 1.0
![Page 69: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/69.jpg)
Consensus sequence of a quasispecies of two strongly coupled sequences of Hamming distance dH(Xi,,Xj) = 1.
![Page 70: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/70.jpg)
Neutral network: Individual sequences
n = 10, = 1.1, d = 1.0
![Page 71: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/71.jpg)
Consensus sequence of a quasispecies of two strongly coupled sequences of Hamming distance dH(Xi,,Xj) = 2.
![Page 72: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/72.jpg)
N = 7
Neutral networks with increasing : = 0.10, s = 229
Adjacency matrix
![Page 73: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/73.jpg)
1. Exponential growth and selection
2. Evolution as replication and mutation
3. A phase transition in evolution
4. Fitness landscapes as source of complexity
5. Molecular landscapes from biopolymers
6. The role of stochasticity
7. Neutrality and selection
8. Computer simulation of evolution
![Page 74: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/74.jpg)
Computer simulation using Gillespie‘s algorithm:
Replication rate constant:
fk = / [ + dS(k)]
dS(k) = dH(Sk,S )
Selection constraint:
Population size, N = # RNA molecules, is controlled by
the flow
Mutation rate:
p = 0.001 / site replication
NNtN ±≈)(
The flowreactor as a device for studies of evolution in vitro and in silico
![Page 75: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/75.jpg)
Evolution in silico
W. Fontana, P. Schuster, Science 280 (1998), 1451-1455
![Page 76: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/76.jpg)
Phenylalanyl-tRNA as target structure
Structure of randomly chosen initial sequence
![Page 77: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/77.jpg)
In silico optimization in the flow reactor: Evolutionary Trajectory
![Page 78: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/78.jpg)
28 neutral point mutations during a long quasi-stationary epoch
Transition inducing point mutations change the molecular structure
Neutral point mutations leave the molecular structure unchanged
Neutral genotype evolution during phenotypic stasis
![Page 79: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/79.jpg)
Evolutionary trajectory
Spreading of the population on neutral networks
Drift of the population center in sequence space
![Page 80: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/80.jpg)
![Page 81: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/81.jpg)
![Page 82: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/82.jpg)
Coworkers
Peter Stadler, Bärbel M. Stadler, Universität Leipzig, GE
Walter Fontana, Harvard Medical School, MA
Ivo L.Hofacker, Christoph Flamm, Universität Wien, AT
Martin Nowak, Harvard University, MA
Christian Reidys, Nankai University, Tien Tsin, China
Christian Forst, Los Alamos National Laboratory, NM
Kurt Grünberger, Michael Kospach , Andreas Wernitznig, Stefanie Widder,Stefan Wuchty, Jan Cupal, Stefan Bernhart, Lukas Endler, Ulrike Langhammer,
Rainer Machne, Ulrike Mückstein, Erich Bornberg-Bauer, Universität Wien, AT
Thomas Wiehe, Ulrike Göbel, Walter Grüner, Stefan Kopp, Jaqueline Weber, Institut für Molekulare Biotechnologie, Jena, GE
Universität Wien
![Page 83: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/83.jpg)
Acknowledgement of support
Fonds zur Förderung der wissenschaftlichen Forschung (FWF)Projects No. 09942, 10578, 11065, 13093
13887, and 14898
Wiener Wissenschafts-, Forschungs- und Technologiefonds (WWTF) Project No. Mat05
Jubiläumsfonds der Österreichischen NationalbankProject No. Nat-7813
European Commission: Contracts No. 98-0189, 12835 (NEST)
Austrian Genome Research Program – GEN-AU: BioinformaticsNetwork (BIN)
Österreichische Akademie der Wissenschaften
Siemens AG, Austria
Universität Wien and the Santa Fe Institute
Universität Wien
![Page 84: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/84.jpg)
Thank you for your attention!
![Page 85: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/85.jpg)
Web-Page for further information:
http://www.tbi.univie.ac.at/~pks
![Page 86: Complexity in Evolutionary Processes - TBIpks/Presentation/wien-physik10.pdf · Complexity in Evolutionary Processes Peter Schuster ... 4. Fitness landscapes as source of complexity](https://reader031.fdocuments.in/reader031/viewer/2022022519/5b15b8f27f8b9a332f8db072/html5/thumbnails/86.jpg)