Virus Research 113 (2005) 16–25

Complete genome sequence of an Ebola virus (Sudan species)responsible for a 2000 outbreak of human disease in Uganda

Anthony Sanchez∗, Pierre E. RollinSpecial Pathogens Branch, Division of Viral and Rickettsial Diseases, National Center for Infectious Diseases,

Centers for Disease Control and Prevention, 1600 Clifton Road N.E., Building 15, Room SB611, Mail Stop G-14, Atlanta, GA 30333, USA

Received 12 January 2005; received in revised form 16 March 2005; accepted 16 March 2005Available online 29 April 2005

Abstract

The entire genomic RNA of the Gulu (Uganda 2000) strain of Ebola virus was sequenced and compared to the genomes of other filoviruses.This data represents the first comprehensive genetic analysis for a representative isolate of the Sudan species of Ebola virus. The genomeorganization of the Sudan species is nearly identical to that of the Zaire species, but the presence of a gene overlap (between GP and VP30genes) and a longer trailer sequence distinguish it from that of the Reston species. As has been observed with other filoviruses, stemloops gree ofs rable level ofi on speciest y the VP40a (mucin-liker©

K

1

tatcnmbvclav

-

ome(fore

a-O-Z

f thespec-henon-e

out-

reak

0d

tructures were predicted to form at the 5′ end of Ebola Sudan mRNA molecules, and the genomic RNA termini showed a high deequence complimentarity. Comparisons of the amino acid sequences of encoded gene products shows that there is a compadentity or similarity between Ebola virus species, with Sudan and Zaire actually showing a slightly closer relationship to the Resthan to one another. These comparisons also indicated that the VP24 is the most conserved Ebola virus protein (followed closely bnd L proteins), while the GP is the least conserved gene product. The most divergent regions were seen in the C-terminus of GP1egion) and within the C-terminal third of the nucleoprotein sequence.

2005 Elsevier B.V. All rights reserved.

eywords: Ebola; Sudan; Filovirus; Virus; Genome; RNA

. Introduction

Ebola (EBO) viruses are highly pathogenic, exotic agentshat can cause severe hemorrhagic fever disease in humannd/or nonhuman primates (Sanchez et al., 2001). Due to

he hazards associated with these viruses, they have beenlassified as biosafety level 4 (BSL4) agents, and safe ma-ipulation of infectious particles requires maximum contain-ent facilities (http://www.cdc.gov/od/ohs/biosfty/bmbl4/mbl4s3.htm). The potential for EBO viruses to cause se-ere harm to public health has also led to its currentlassification as both a biothreat category A and a se-ect agent (http://www.bt.cdc.gov/agent/agentlist-category.sp; (http://www.cdc.gov/od/sap/). Taxonomically, EBOirus and the related Marburg (MBG) virus are classified in

∗ Corresponding author. Tel.: +1 404 639 1115; fax: +1 404 639 1118.E-mail address: ASanchez1@cdc.gov (A. Sanchez).

the orderMononegavirales, family Filoviridae, and the generaEbolavirus andMarburgvirus (Fauquet et al., 2005). Aswith other members of the orderMononegavirales, EBO andMBG virus particles are enveloped and contain a gencomposed of a single, negative-sense RNA moleculefiloviruses the length is∼19,000 nucleotides). Within thEbolavirus genus, there are currently four species:Zaire(EBO-Z),Sudan (EBO-S),Reston (EBO-R), andIvory Coast(EBO-IC). EBO virus was first identified following simultneous (but separate) outbreaks in 1976 involving the EBand EBO-S species in northern Democratic Republic oCongo (formerly Zaire) and extreme southern Sudan, retively (WHO, 1978a,b). EBO-S and EBO-Z viruses are tmore pathogenic of the four species, both for human andhuman primates (Fisher-Hoch et al., 1992), and have been thpredominant forms of EBO virus associated with knownbreaks (Mahanty and Bray, 2004; Sanchez et al., 2001). In thelater part of 2000, the largest documented filovirus outb

168-1702/$ – see front matter © 2005 Elsevier B.V. All rights reserved.oi:10.1016/j.virusres.2005.03.028

A. Sanchez, P.E. Rollin / Virus Research 113 (2005) 16–25 17

was caused by EBO-S virus in Uganda. This episode rep-resented a reemergence of this species of EBO virus (after21 years) and originated in an area close to the northern cityof Gulu (Baron et al., 1983; CDC, 2001), which is locatedin the northern region of Uganda near the border with Su-dan. In 2004, a smaller epidemic of EBO-S transmission tookplace in the area around the southern Sudan city of Yambio(http://www.who.int/csr/don/200408 07/en/), once again inthe same locale as prior episodes (1976 and 1979). EBO-Z infections in humans have resulted in∼90% mortality,while EBO-S infections have been less lethal (∼50%) (CDC,2001; Georges-Courbot et al., 1997; Mahanty and Bray, 2004;Sanchez et al., 2001, 2004; Towner et al., 2004). Biochemical,serological, and genetic analyses have shown EBO and MBGviruses to be separate forms of filoviruses, and examinationof various EBO isolates has also shown a high degree of se-quence divergence between species at both the nucleotide andamino acid levels (∼35–40%) (Sanchez et al., 1996). How-ever, within EBO species there is a remarkably low variationin sequence (∼2–3%), indicating a high degree of stasis inthe wild (Sanchez et al., 1996, 1999).

The complete sequences for the genomic RNA moleculesfor EBO-Z, EBO-R, and MBG viruses have been determined,and together with transcription and replication studies, thegenetic organization and replication of filoviruses have beenrevealed and are similar to those of paramyxoviruses andr al.,2 offi somet othern mple,fib , (2)g ide seq tionale (4)so ta

irusi n fort g. Ina therfi A oft ribet O-Sg ationt thoseo

2

2

L-1 duc-

tion of genomic RNA from virions (vRNA). E6 cells werecultured in either Eagle’s minimal essential medium or Dul-becco’s minimal essential medium (high glucose) contain-ing 2 mM l-glutamine, 100 units/ml penicillin G, 100 ng/mlstreptomycin sulfate, 250 ng/ml amphotericin B, and 10%heat inactivated (56◦C) fetal bovine serum. Cells were cul-tured to confluency, infected with a low-passage virus stock(stock no. 808894; isolated in and passaged once in E6 cells),then incubated for 1 week or until prominent cytopathic ef-fects were evident. Virion particles were purified from EBO-S-infected culture fluids as previously described (Feldmannet al., 1994a,b) and stored in a nitrogen vapor freezer untilneeded.

2.2. RNA extraction, PCR amplification, and DNAsequencing

Extraction of vRNA from purified virions was accom-plished using a QIAGEN RNeasy Mini kit that yielded iso-lated RNA in RNase-free water. The vRNA was used togenerate cDNA (random and specific priming) using a Su-perScript First-Strand Synthesis System for RTPCR (Invit-rogen, Life Technologies) and was performed as describedelsewhere (Sanchez et al., 2004). PCR amplification of vi-ral sequences from cDNA template was performed usingprimers previously utilized in the sequencing and PCR oft andNg No.U teing n ofl nd oft gin-n d (3)m ingk nti-fi oleda ditiont mpli-c encei e de-tR cesR ced.A d tov onsw yec gp ions.S ISM3 enc-i twareS . Se-q cingd mes

habdoviruses (Feldmann et al., 1994a,b; Groseth et002; Sanchez et al., 1993). However, the genomesloviruses have some unique characteristics, as well asraits that are variations on genetic elements seen inonsegmented, negative-strand RNA viruses. For exaloviruses have: (1) a conserved sequence (3′ UAAUU) inoth transcription start and stop (polyadenylation) sitesene overlaps centered on this conserved pentanucleotuence are present in their genomes, (3) a transcripditing site in the glycoprotein gene of EBO viruses, andtemloop structures that are predicted to form at the 5′ endf gene transcripts (Feldmann et al., 1994a,b; Muhlberger el., 1996; Sanchez et al., 1993, 1996).

Despite the large number of documented human filovnfections caused by EBO-S virus, sequence informatiohe genome of this important pathogen has been lackinn effort to further characterize the biology of this and oloviruses, we have sequenced the entire genomic RNhe Gulu strain of EBO-S. The following sections desche methodologies used to derive and analyze the EBenome sequence, as well as comparisons of its organiz

ranscriptional signals, and encoded gene products tof other filoviruses.

. Materials and methods

.1. Virus propagation and purification

E6 cells, a cloned line of Vero cells (ATCC No. CR586), were used to replicate EBO-S virus in the pro

-

,

he EBO-S Gulu strain GP (GenBank No. AY316199)P genes (Sanchez et al., 2004; Towner et al., 2004), the Lene of the Maleo (1979) strain of EBO-S (GenBank23458), and primers derived from an EBO-S nucleoproene sequence (GenBank No. AF173836). Amplificatio

ong (4–6 kb) regions of the genome, spanning (1) the ehe GP gene to the beginning of the L gene, (2) the being of the NP gene to the beginning of the GP gene, anost of the L gene, were cloned using a Topo-TA clon

it (Invitrogen). Separate groups of positive inserts (ideed by restriction analysis; 10–20 per group) were pond used as templates for sequencing reactions. In ad

o cloned sequences, direct sequencing of shorter PCR aons was performed to bridge, extend, and confirm sequnformation. The terminal sequences of the genome werermined by ligating the 3′ and 5′ ends of the vRNA with T4NA ligase (New England Biolabs), the joined sequenTPCR amplified, and amplicons were directly sequendditionally, amplicons were TA cloned and sequenceerify terminal nucleotides. Cycle sequencing of amplicas performed using Applied Biosystems’ PRISM BigDhemistry (v.1 and v.3) in 20�l reactions contained 100 nrimer and performed as per manufacturer’s instructequencing reactions were analyzed using an ABI PR100 Genetic Analyzer (Applied Biosystems) and sequ

ng data edited and assembled using the computer sofequencher (Version 4.1.4, Gene Codes Corporation)uence files were combined with prior GP gene sequenata (Sanchez et al., 2004) to generate the entire genoequence.

18 A. Sanchez, P.E. Rollin / Virus Research 113 (2005) 16–25

2.3. Computer sequence analysis

Genetic analysis of the derived nucleotide sequence of theGulu/2000 strain of EBO-S was performed using softwarefrom the Genetics Computer Group (GCG) Wisconsin Pack-age (Accelrys) and the SeqLab Xwindows interface.

3. Results

The complete sequence of the genomic RNA of the Gulustrain of EBO-S was determined (GenBank No. AY729654)and inFig. 1its general organization is shown schematicallyalongside those of EBO-Z, EBO-R, and MBG viruses. Thegene order, lengths of coding and noncoding regions, and po-sitioning of gene overlaps for the EBO-S genome is consistentwith other EBO viruses, but some outward differences are ev-ident. EBO-S and EBO-Z have much longer trailer sequences(381 and 677 bases, respectively) than does the genome ofEBO-R (25 bases), which is closer in length to that of theMBG virus trailer (76 bases; 95 bases for the Ozolin strain,GenBank No. AY358025). The three gene overlaps for EBO-S and EBO-Z are identically positioned, while EBO-R differsin lacking an overlap between the GP and VP30 gene. Com-parison of the transcriptional signals and intergenic regionsof EBO-S with those described for other filovirus genomes iss tarts n( theE ionsa

ini(ds lus-s s.

The stemloop structures are similar to those described forEBO-Z and MBG viruses in earlier studies (Muhlberger etal., 1996; Sanchez et al., 1993), with free energy values rang-ing from−7.8 to−26.8 kcal/mole.

Table 2 shows the percent similarity and identity ofpredicted amino acid sequences for the gene products ofEBO-S, EBO-Z, and EBO-R, as determined from computer-assisted alignments. These comparisons indicate that theVP40, VP24, and L sequences are the most conserved ofthe eight proteins, with the VP24 showing a slightly higherlevel of similarity, while the VP40 is comparable to the VP24in identity. The greatest example of conservation was seenin the alignment between VP24 sequences of EBO-Z andEBO-R, which was highest in both similarity and identity.Comparisons of the EBO-Z and EBO-R sequences also yieldthe highest averages for the combined protein sequences, butis only slightly higher than those derived from the EBO-Sversus EBO-R alignments. From the values seen inTable 2,the conservation of the proteins can be grouped and rankedas follows: VP40, VP24, and L (high) > NP, VP35, SGP, andVP30 (medium) > GP (low).

Dot matrix comparisons of the predicted amino acid se-quences encoded in the genomes of EBO-S (Gulu) and EBO-Z are shown inFig. 3. Regions showing the highest degree ofdivergence were found in the C-terminal region of NP and thecentral area of GP (corresponding to the C-terminus of GP1,t ed-i n ofNs ofG gent,w oft No.A ankN weda .4%

F es of -S (GenBankA C0025 161; RestonS usoke s r, intergen( these o gr ic sequ

hown inTable 1. A consensus sequence for EBO virus sites is 3′ YACUMCUUCUAAUU and the polyadenylatiostop) site is UAAUUC(U)5/6. Consensus sequences forBO GP gene editing site and the leader and trailer regre also shown inTable 1.

The complementarity of the EBO-S genome termleader and trailer sequences) is illustrated inFig. 2A, whichemonstrates the similarity of these sequences.Fig. 2B showstemloop structures that are predicted to form in the pense leader sequence and at the 5′ end of gene transcript

ig. 1. Schematic representation of the complete genome sequencY729654; Sudan species, 2000, Gulu, Uganda), EBO-Z (GenBank Npecies, 1989 Reston, Virginia USA), and MBG (GenBank Z12132; M

IR), gene overlap, editing site, and trailer sequences. Deviations fromegions are shown in color, noncoding regions in white, and extragen

he mucin-like region, and the region immediately precng it). Strict alignments (no gaps) of the divergent regioP (residues 414–648 of EBO-S inFig. 3) showed a 38.7%imilarity and 31.9% identity, while the mucin-like regionP (residues 299–495 of EBO-S) was even more diverith a 19.7% similarity and 16.2% identity. Alignments

he NP gene of the Boniface (1976) strain (GenBankF173836) and L gene of the Maleo (1979) strain (GenBo. U23458) of EBO-S to those of the Gulu strain sho94.8 and 95.7% nucleotide identity and 97.4 and 98

EBO and MBG viruses. Sequences used in comparisons are: EBO49; Zaire species, 1976, Yambuku, DRC), EBO-R (GenBank NC004train, 1980, Nzoia, Kenya). Identified on the EBO-S genome are leadeicrganizational features are identified on the genomes of the other filoviruses. Codinences in black. Genome lengths are shown at the 5′ end.

A. Sanchez, P.E. Rollin / Virus Research 113 (2005) 16–25 19

Table 1Comparison of transcriptional signals and termini of EBO genomesa

Gene Virus Start Stop IRb

NP EBO-S UACUCCUUCUAAUU UAAUUCUUUUUU AAGEBO-Z UACUCCUUCUAAUU UAAUUCUUUUUU GAUEBO-R UACUCCUUCUAAUU UAAUUCUUUUU GUAAA

VP35 EBO-S UACUACUUCUAAUU UAAUUCUUUUU (Overlap)EBO-Z UACUACUUCUAAUU UAAUUCUUUUU (Overlap)EBO-R CUACUUCUAAUU UAAUUCUUUUU (Overlap)

VP40 EBO-S CUACUUCUAAUU UAAUUCUUUUU GUUUAGAEBO-Z CACUACUUCUAAUU UAAUUCUUUUUU AGCCGEBO-R CACUACUUCUAAUU UAAUUCUUUUU CUAUAUG

GP EBO-S CUACUUCUAAUU UAAUUCUUUUU (Overlap)EBO-Z CUACUUCUAAUU UAAUUCUUUUU (Overlap)EBO-R CUACUUCUAAUU UAAUUCUUUUU GAA

VP30 EBO-S CUACUUCUAAUU UAAUUCUUUUU CUU(N)120UGGEBO-Z CUACUUCUAAUU UAAUUCUUUUU GAC(N)136GAUEBO-R UACUGCUUCUAAUU UAAUUCUUUUUU AGU(N)124GUC

VP24 EBO-S UACUACUUUUAAUU UAAUUCUUUUU (Overlap)EBO-Z UACUACUUCUAAUU UAAUUCUUUUUU (Overlap)EBO-R CUACUUCUAAUU UAAUUCUUUUU (Overlap)

L EBO-S CUCCUUCUAAUU UAAUUCUUUUUUEBO-Z CUCCUUCUAAUU UAAUAUUUUUUEBO-R CUCCUUCUAAUU UAAUAUUUUUUConsensusc YACUMCUUCUAAUU UAAUUC(U) 5/6 NA

vRNA location Virus Editing sited

GP Gene EBO-S UAACCACUUACCCGAAAAACCCUUUUAUUUUUUUAGAGEBO-Z UAGCCCCUCACCCGGAAGACCCUUUGAUUUUUUUGGAGEBO-R CAACCACUCACCCGGAAGACCCUUUGAUUUUUUUGAAAConsensus YARCCMCUYACCCGRAARACCCUUUKAUUUUUUURRRR

Leader3′ End EBO-S GCCUGUGUGUUUUUCUUUCUUUUCAAAAAAU

EBO-Z GCCUGUGUGUUUUUCUUUCUUCUUAAAAAUCEBO-R GCCUGUGUGUUUUUCUUUUUUCCAAAAAAUUConsensus GCCUGUGUGUUUUUCUUUYUUYYHAAAAAWY

Trailer5′ End EBO-S AUUUUUUAGACAUAAAAGAGAAAAAACACACAGGU

EBO-Z UUUUUAUUUAGAUAAAGAAGAAAAAACACACAGGUEBO-R AUAUUUUUUGGUUAAAAAAGGAAAAACACACAGG-Consensus WUWUUWUWKRSWUAAARRAGRAAAAACACACAGGU

a Genbank sequences used in comparisons are: EBO-S (AY729654; 2000 Gulu, Uganda), EBO-Z (NC002549; 1976 Yambuku, Zaire/DRC), and EBO-R(NC004161; 1989 Reston, VA USA).

b Intergenic regions for EBO-S and EBO-R are predicted and have not been confirmed. NA = not applicable.c Consensus sequences for the transcription start and stop sites represent bases occurring more than twice. Consensus sequences for the editing site and the

termini of genomic RNA take all bases into account.d Shown are the editing/slippage site (underlined) and conserved flanking sequences.

amino acid identity, respectively. Comparison of the GP genesequences of the Gulu strain of EBO-S with either the Boni-face or Maleo strains showed a 95% nucleotide identity, whileat the amino acid level a 98.1 and 94.7% identity was deter-mined for the SGP and GP, respectively. InFig. 3, the identitydot plot for the VP35 comparison shows that the N-terminalregion (∼100 residues) contains the greatest variation in thatmolecule. Similarly, the VP40 and VP30 proteins show vari-ation at the N-terminus (∼40–50 residues), but there is alsosome smaller areas of divergence internally, and in the case ofVP30, also at the C-terminus. The SGP is most variable in the

C-terminal half, while the VP24 show only very short regionsof variation along its entire length. The polymerase dot plotshows that a region near the N-terminus (∼100 residues) anda larger region (∼250 residues) within the C-terminal thirdof the sequence exhibit the highest level of divergence.

Cysteine residues usually have an important role in thestructure (formation of intra- and intermolecular disulfidebridges) of a protein, and often exhibit a high degree of con-servation. The positions of these residues for the EBO-S,EBO-Z, and EBO-R virus proteins are shown inFig. 4A (plot-ted from multiple sequence alignments) to identity conserved

20 A. Sanchez, P.E. Rollin / Virus Research 113 (2005) 16–25

Fig. 2. Termini of the EBO-S genomic RNA and predicted mRNA stemloop structures. (A) The complementarity of the 3′ and 5′ ends of the genome of EBO-S(Gulu strain) is shown as a panhandle structure. (B) Predicted stemloop structures located at the 5′ end of viral transcripts are shown along with their freeenergy values. Asterisks indicate G-U base pairing and solid lines running along the side of the stemloops identify the complimentary sequence of theconservedtranscription start site. Structures were generated using the GCG MFOLD computer program.

A. Sanchez, P.E. Rollin / Virus Research 113 (2005) 16–25 21

Table 2Amino acid sequence similarity and identity in comparisons of predicted EBO virus gene productsa

Comparison NP VP35 VP40 SGP GP VP30 VP24 L Averageb

EBO-S vs. EBO-Z Similarity 72.9 76.1 78.5 70.6 63.2 74.9 81.3 79.8 74.7Identity 67.2 68.9 75.2 62.4 56.3 69.7 74.5 74.2 68.6

EBO-S vs. EBO-R Similarity 73.6 77.1 83.1 74.5 65.6 72.1 82.5 79.6 76.0Identity 67.6 69.3 80.1 69.0 60.5 65.0 75.3 74.1 70.1

EBO-Z vs. EBO-R Similarity 74.4 74.0 79.4 73.2 64.5 76.7 87.3 80.3 76.2Identity 67.8 68.7 75.2 65.9 59.3 70.0 81.3 74.8 70.4

a Values were derived from the Bestfit computer program with a gap creation penalty setting of 10 and a gap extension penalty of 5; similarity was determinedusing the blosum62.cmp file. Columns in bold font identify the three protein sequences showing the greatest conservation.

b Average of all eight sequences.

and nonconserved residues. This comparison revealed thatthe cysteines are completely conserved in the NP, SGP, andVP24. The molecules showing a single change in the po-sition or number of cysteines are the VP40 molecule (oneresidue of EBO-S appears shifted to C-terminus) and the GP(terminal cysteine present in EBO-S and EBO-R is absentin EBO-Z). Less conserved are the VP35, VP30, and L pro-teins, with the VP35 and L showing the greater number ofdifferences per unit alignment length (1.46 and 0.95 per hun-dred residues, respectively). Cysteines in the NP and VP24

are positioned in the N-terminal region, while those of VP40are located very near the C-terminus. The N-terminal regionof the VP35 contains all five of the nonconserved cysteineresidues, while there appears to be variation along the entirelength of the L sequence. However, over half of the posi-tions of nonconserved cysteines in L are concentrated in astretch of∼600 residues (alignment sequence 1474–2060)in the C-terminal third of that protein. Based on the over-all pattern of cysteine residues in the eight gene products, itappears that the differences are somewhat evenly distributed

Fipw

ig. 3. Dot matrix comparison of the amino acid sequences of the EBO-S adentity in the comparison. In the lower right hand corner is shown the percenrogram was used to perform comparisons and generate dot plots (similarindow = 4, stringency = 35).

nd EBO-Z gene products. The top panel shows similarity, while the bottom showt similarity or identify and were taken fromTable 2. The GCG Compare computerity: blosum62.cmp file, window = 30, stringency = 10; identity: identpep.cmp file,

22 A. Sanchez, P.E. Rollin / Virus Research 113 (2005) 16–25

Fig. 4. Cysteine residues in EBO virus proteins and SDS-PAGE analysis. (A) Shown is a schematic view of the locations of cysteine residues in the geneproducts of EBO-S (2000), EBO-Z (1976), and EBO-R, as determined from multiple sequence alignments. Alignments were performed using the GCG PileUpcomputer program (blosum62.cmp file, gap weight = 4, gap length weight = 4, end gaps penalized). Vertical lines identify cysteine residues along the alignmentand black diamonds along the top indicate positions where differences occur; open triangles at the bottom mark every 100 residues from the N-terminusof thealignment. At the end of each protein bar are total number of cysteine residues in the sequence. Lengths of the amino acid alignments are: NP = 744, VP35 =343,VP40 = 332, SGP = 373, GP = 682, VP30 = 289, VP24 = 251, L = 2220. (B) Shown is a photograph of EBO-S and EBO-Z purified virion proteins separated bySDS-PAGE (Feldmann et al., 1994) as reduced (2%�-mercaptoethanol treatment) or nonreduced preparations and subsequently stained with coomassie blue.

within this group of EBO viruses, and consequently cannotbe used to determine which viruses are most alike. InFig. 4Bare shown preparations of purified EBO-S and EBO-Z virionproteins separated by SDS-PAGE under reduced or nonre-duced conditions. The decrease or complete absence of L,VP30, and VP35 bands in the nonreduced lanes indicate thatsome form of covalent bonding involving cysteine residuesis occurring with these proteins. All or combinations of theseproteins could be linked together or with other molecules,which would cause them to be unresolved in a nonreducedgel or too large to penetrate the matrix.

4. Discussion

In a comparison of the general organization of filovirusgenomes (Fig. 1), it would appear that those of EBO-S andEBO-Z are most alike, as both have long trailer sequencesand an overlap between the GP and VP30 genes (missingfrom the EBO-R genome). The overlap between the VP24and L genes in EBO species is conserved, but in the EBO-Zgenome there is an extra transcriptional stop (polyadenyla-tion) sequence five bases in front of the overlap. This extrasignal is totally absent from those of EBO-R and EBO-S, andit remains unclear if this polyadenylation sequence is func-tional. Identification of variations in the genomic compositiono tax-o otherE inet

rig-i ab-d theirn -t nals s), ish

this common sequence deviates only in the L gene stop site ofEBO-Z and EBO-R (UAAUA), which was noted earlier whenthe EBO-R genome (1996 isolate) was determined (Ikegamiet al., 2001).

Transcriptional editing, a feature of the GP genes of EBOviruses, takes place at a conserved run of seven uridines (U7)on the vRNA template (Table 1). This event presumably re-sults from a slippage of the polymerase in a-1 direction thatleads to the addition of an extra adenosine in the transcript.The sequence immediately upstream (3′) of the U7 site islengthier and more conserved than the downstream sequence(limited to four bases composed of purines). This sequencepreceding the editing site does not appear capable for form-ing a stable stemloop structure in the vRNA, but could stillinfluence the editing event in some undefined manner.

The complementarity of the terminal sequences for thegenomic RNA molecules of filoviruses and the presence ofpotential stemloop structures at the 5′ end of filovirus mRNAhave been reported (Crary et al., 2003; Muhlberger et al.,1996; Sanchez et al., 1993), and these feature are also foundin the EBO-S genome (Fig. 2). The panhandle structure ofthe base paired genomic termini (Fig. 2A) is more extensivethan that reported previously byCrary et al. (2003), as thesequence is not identical to the EBO-S isolate used in thatstudy, but the stemloop structures for the 3′ and 5′ ends ofthe genomic RNA are nearly identical. The lengths of thep -p thatt . It isi struc-t byv mostt dest.I virusp ores ationa

f EBO viruses may help to define evolutionary and/ornomic relationships, but additional sequence data forBO viruses (particularly EBO-IC) is needed to determ

heir significance.The transcriptional signals of filovirus genes were o

nally noted as being functionally similar to those of rhoviruses and paramyxoviruses, yet were unique inucleotide sequence (Sanchez et al., 1993). A common pen

anucleotide sequence UAAUU, found in both transcriptiotart and stop sites of filovirus genes (unique to filoviruseighly conserved. As can be seen inTable 1, for EBO viruses

redicted stemloops at the 5′ end of mRNA molecules apear to be similar for EBO-S and EBO-Z, suggesting

hese structures affect expression of the gene productnteresting to note that the shortest and least stableure (−7.8 kcal/mole) is found in the VP35 mRNA, whichirtue of its position in the genome should be the second-ranscribed gene, but the level of VP35 expression is mon contrast, the VP40 gene is the most abundant EBOrotein produced, which may result from a lengthier, mtable stemloop structure that could improve the translnd/or increase the half-life of the transcript.

A. Sanchez, P.E. Rollin / Virus Research 113 (2005) 16–25 23

An early comparison of the NP genes of EBO-Z and MBG(Sanchez et al., 1992) indicated that the sequence for theC-terminal half of the encoded protein was divergent. Pre-dictably, a comparison of the NP amino acid sequences ofEBO-S and EBO-Z (Fig. 3) revealed a large region withinthe C-terminal third of these proteins that is divergent. TheN-terminal region of the NP contains all three cysteineresidues (conserved and located within the first 180 residues)(Fig. 4A), and likely play an important role in the struc-ture of the molecule. SDS-PAGE of reduced and nonreducedpurified virion proteins (Fig. 4A) shows that the NP doesnot form disulfide-bonded oligomers, so the cysteines mayform intramolecular disulfide bonding or participate in hy-drogen bonding within the more hydrophobic N-terminalhalf.

The VP35 protein of EBO-Z has been shown to have an an-tagonistic effect on type I interferon responses by inhibitingIRF-3 phosphorylation (Basler et al., 2000, 2003). A motifthat is similar to a RNA-binding domain of the influenza NS1protein (also an interferon antagonist) has been identified andmutational studies have shown that this motif may confer theantagonistic property of VP35 (Hartman et al., 2004). Thismotif is located in the conserved C-terminal region of VP35(EBO-Z 304PRACQKSLRPV314) and only single conserva-tive amino acid differences are seen in the VP35 proteins ofEBO-S and EBO-R (corresponding to R305K and V314A oft con-s TheN iner is re-g BO,p rase(

APa ithteb irusp senti arst irusa

haveb BO-S 6,1 lus ndd non-s ark-a beens ules( horne n-s teinei P ofE

The VP30 protein of EBO-Z, a minor nucleoprotein,was shown byHartlieb et al. (2003)to oligomerize, andthat a tetraleucine sequence (∼100 residues from the N-terminus) was found to be important in the interaction ofVP30 molecules cotranslationally. This tetraleucine sequenceand the sequences flanking it are identical in the EBO-S VP30sequence (residues 91–111). In the case of the EBO-R VP30,the LLLL sequence is present, but the flanking residues areless conserved. The presence of a zinc-binding motif impor-tant in the functionality of the VP30 protein has been de-scribed (Modrof et al., 2003) for EBO-Z and EBO-R viruses,and this motif is also present in the VP30 of EBO-S. The firstthree cysteines in the VP30 proteins of EBO viruses are con-tained in this motif, andFig. 4show that there is no variationin the cysteine residues in this conserved region (Fig. 3). TheC-terminal half of the molecule contains some variation incysteine residues, suggesting that like the NP, this region con-tains properties that are more distinctive to species of EBOvirus.

VP24 is a membrane-associated protein, yet lacks stronghydrophobic regions or membrane-spanning sequences. Thefunction of the VP24 protein of EBO has yet to be re-vealed, butHan et al. (2003)determined that it can formoligomers (possibly tetramers) and is released from cells inassociation with lipid; formation of VP24 multimers is in-fluenced by pH and divalent cation changes. In addition,t tot rvedc ma-t 24m hath cy-l bic-i V-2 orE n ofo

insm pro-t O-S ng,( nu-c -t itht hlyc al tot thata lo-c idues1 per-t e Lp pro-t d inc eL t ares

he EBO-Z sequence, respectively); this motif is alsoerved in MBG virus (consensus = PRPCQKSLRAV).-terminal third of VP35 is the most variable, with cyste

esidues showing no conservation. This suggests that thion contains properties that are peculiar to species of Eossibly linked to variations in the structure of the polymesee below).

The VP40 protein of EBO-Z contains overlapping PT/Snd PPXY motifs (PTAPPEY), that are known to interact w

he cellular proteins Tsg101 and Nedd4, respectively (Hartyt al., 2000; Licata et al., 2003; Timins et al., 2003), and areelieved to be important in the assembly and budding of varticles. A nearly identical sequence (PTAPPAY) is pre

n the VP40 of both EBO-S and EBO-R virus, so it appeo be a conserved feature of the matrix protein; MBG vppears to have only the PPXY motif (PPPY).

The GP genes and gene products of EBO viruseseen extensively studied, including early isolates of E(Feldmann et al., 1994a,b; Sanchez et al., 1993, 199

998a,b, 1999; Volchkov, 1999). The GP gene of the Gutrain of EBO-S differs only slightly from prior isolates, aifferences in predicted amino acid sequences for thetructural SGP and structural GP molecules are unremble. The role of cysteine residues in SGP and GP havehown to be important in the structure of these molecBarrientos et al., 2004; Jeffers et al., 2002; Weissent al., 1998). From Fig. 4A one sees that the SGP is coerved in all cysteine residues, while the C-terminal cysn the GP (GP2) of EBO-S and EBO-R is absent in the GBO-Z.

hey showed that deletion of the N-terminal region ledhe formation of high MW aggregates. The single conseysteine residue (residue 27) is not involved in the forion of multimers through disulfide linkages between VPolecules (Fig. 4B), but this cysteine is located in a somewydrophobic region that could potentially undergo fatty a

ation. Such a modification would increase the hydrophoty of this region of VP24 molecules (11-VVFSDLCNFL1 for both EBO-S and EBO-Z; 11-VIFSDLCNFLI-21 fBO-R) and could facilitate and/or stabilize the formatioligomers.

As with the other virus proteins, the L protein contaotifs that are highly conserved. Comparisons of the L

eins of the Gulu (2000) and Maleo (1979) strains of EBshow that motifs linked to (1) RNA/template bindi

2) phosphodiester bonding (catalytic site), and (3) riboleotide triphospate binding (Volchkov et al., 1999) are idenical for both the Gulu and Maleo strains of EBO-S. As whe other EBO virus proteins, the L contains runs of higonserved sequences that likely represent motifs critiche function of the protein. But it also contains areasre highly divergent. One such area of the L protein isated in the center of the sequence (Gulu strain res646–1755), which undoubtedly confer distinctive pro

ies to the molecule. It is clear from this study that throtein is not the most conserved of the EBO virus

eins, and variation in the L sequence is also reflecteysteine residues (Fig. 4A). This variability implies that thproteins of EBO viruses contain structural features thapecies-specific.

24 A. Sanchez, P.E. Rollin / Virus Research 113 (2005) 16–25

The reasons for the significant degree of variation in thegene products of EBO species are unclear, but when the nat-ural hosts of filoviruses are eventually identified, it may beeasier to comprehend this diversity when ecological factorscan be taken into consideration. Despite the high degree ofsequence variation between species, the differences withinspecies is usually less than 5%. The comparable degree ofconservation for the amino acid sequences of VP40, VP24,and L proteins of EBO-S and EBO-Z (Fig. 3) was unexpected,but Groseth et al. (2002)did note in a comparison of EBO-R and EBO-Z genomes that the VP24 was most conserved.In the EBO-S versus EBO-Z comparison (Fig. 3) the VP24is also the most conserved protein. The reasons for the con-servation of VP24 cannot be addressed, since little is knowabout its function. However, its role in the biology of EBOviruses could be more intimately linked to some aspect of thebiology of the natural hosts than are other EBO proteins. Thehypothesis that of all the EBO proteins the functionality ofVP24 is most influenced by the host cell is pure speculation,but is supported by findings that changes in the VP24 proteinare associated with increased replication of EBO-Z virusesadapted to cause lethal infections in guinea pigs (Volchkovet al., 2000).

In conclusion, the genome organization and transcrip-tional signals of EBO-S are extremely similar to those of otherEBO virus species, yet the amino acid sequences of their genep l ev-i iquev d inE morec log-i It ish efuli andp

R

B sul-SGP.

B J.,, A.,ron

B nk,pro-

USA

B se inBull.

C gust73–

C S.T.,s in

Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U., Ball, L.A.,2004. Virus Taxonomy: VIIIth Report of the International Committeeon Taxonomy of Viruses.. Academic Press, New York, pp. 645–653.

Feldmann, H., Muhlberger, E., Randolf, A., Will, C., Kiley, M.P., Sanchez,A., Klenk, H.D., 1994a. Marburg virus, a filovirus: messenger RNAs,gene order, and regulatory elements of the replication cycle. VirusRes. 24, 1–19.

Feldmann, H., Nichol, S.T., Klenk, H.D., Peters, C.J., Sanchez, A., 1994b.Characterization of filoviruses based on differences in structure andantigenicity of the virion glycoprotein. Virology 199, 469–473.

Fisher-Hoch, S.P., Brammer, L.T., Trappier, S.G., Hutwanger, L.C., Farrar,B.B., Ruo, S.L., Brown, B.G., Hermann, L.M., Perez-Oronoz, G.I.,Goldsmith, C.S., Hanes, M.A., McCormick, J.B., 1992. Pathogenicpotential of filoviruses: role of geographic origin of primate host andvirus strain. J. Infect. Dis. 166, 753–763.

Georges-Courbot, M.C., Sanchez, A., Lu, C.Y., Baize, S., Leroy, E.,Lansout-Soukate, J., Tevi-Benissan, C., Georges, A.J., Trappier, S.G.,Zaki, S.R., Swanepoel, R., Leman, P.A., Rollin, P.E., Peters, C.J.,Nichol, S.T., Ksiazek, T.G., 1997. Isolation and phylogenetic char-acterization of Ebola viruses causing different outbreaks in Gabon.Emerg. Infect. Dis. 3, 59–62.

Groseth, A., Stroher, U., Theriault, S., Feldmann, H., 2002. Molecularcharacterization of an isolate from the 1989/90 epizootic of Ebolavirus Reston among macaques imported into the United States. VirusRes. 87, 155–163.

Han, Z., Boshra, H., Sunyer, J.O., Zwiers, S.H., Paragas, J., Harty, R.N.,2003. Biochemical and functional characterization of the Ebola virusVP24 protein: implications for a role in virus assembly and budding.J. Virol. 77, 1793–1800.

Hartlieb, B., Modrof, J., Muhlberger, E., Klenk, H.D., Becker, S., 2003.Oligomerization of Ebola virus VP30 is essential for viral transcription

278,

H inoronain

irus.

H 0. Aysi-us

I ne,bolaVirol.

J ations

L , J.,thedo-

. 77,

M agic

M ip-4–

M .D.,rus:

S eters,.M.,

s

S enceents,

roducts differ significantly. These findings are additionadence for the notion that EBO virus species represent uniral entities. The identification of novel motifs conserveBO viruses is a challenge for researchers, but perhapshallenging is the discovery and characterization of biocally important motifs masked in divergent sequences.oped that information generated in this study will be us

n advancing these and other investigations of the biologyathogenesis of EBO viruses.

eferences

arrientos, L.G., Martin, A.M., Rollin, P.E., Sanchez, A., 2004. Difide bond assignment of the Ebola virus secreted glycoproteinBiochem. Biophys. Res. Commun. 323, 696–702.

asler, C.F., Mikulasova, A., Martinez-Sobrido, L., Paragas,Muhlberger, E., Bray, M., Klenk, H.D., Palese, P., Garcia-Sastre2003. The Ebola virus VP35 protein inhibits activation of interferegulatory factor 3. J. Virol. 77, 7945–7956.

asler, C.F., Wang, X., Muhlberger, E., Volchkov, V., Paragas, J., KleH.D., Garcia-Sastre, A., Palese, P., 2000. The Ebola virus VP35tein functions as a type I IFN antagonist. Proc. Natl. Acad. Sci.97, 12289–12294.

aron, R.C., McCormick, J.B., Zubeir, O.A., 1983. Ebola virus diseasouthern Sudan: hospital dissemination and intrafamilial spread.World Health Organ. 61, 997–1003.

DC, 2001. Outbreak of Ebola hemorrhagic fever Uganda, Au2000–January 2001. M.M.W.R. Morb. Mortal. Wkly. Rep. 50,77.

rary, S.M., Towner, J.S., Honig, J.E., Shoemaker, T.R., Nichol,2003. Analysis of the role of predicted RNA secondary structureEbola virus replication. Virology 306, 210–218.

and can be inhibited by a synthetic peptide. J. Biol. Chem.41830–41836.

artman, A.L., Towner, J.S., Nichol, S.T., 2004. A C-terminal basic amacid motif of Zaire ebolavirus VP35 is essential for type I interfeantagonism and displays high identity with the RNA-binding domof another interferon antagonist, the NS1 protein of influenza A vVirology 328, 177–184.

arty, R.N., Brown, M.E., Wang, G., Huibregtse, J., Hayes, F.P., 200PPxY motif within the VP40 protein of Ebola virus interacts phcally and functionally with a ubiquitin ligase: implications for filovirbudding. Proc Natl. Acad. Sci. USA 97, 13871–13876.

kegami, T., Calaor, A.B., Miranda, M.E., Niikura, M., Saijo, M., KuraI., Yoshikawa, Y., Morikawa, S., 2001. Genome structure of Evirus subtype Reston: differences among Ebola subtypes. Arch.146, 2021–2027.

effers, S.A., Sanders, D.A., Sanchez, A., 2002. Covalent modificof the Ebola virus glycoprotein. J. Virol. 76, 12463–12472.

icata, J.M., Simpson-Holley, M., Wright, N.T., Han, Z., ParagasHarty, R.N., 2003. Overlapping motifs (PTAP and PPEY) withinEbola virus VP40 protein function independently as late buddingmains: involvement of host proteins TSG101 and VPS-4. J. Virol1812–1819.

ahanty, S., Bray, M., 2004. Pathogenesis of filoviral haemorrhfevers. Lancet Infect Dis. 4, 487–498.

odrof, J., Becker, S., Muhlberger, E., 2003. Ebola virus transcrtion activator VP30 is a zinc-binding protein. J. Virol. 77, 3333338.

uhlberger, E., Trommer, S., Funke, C., Volchkov, V., Klenk, HBecker, S., 1996. Termini of all mRNA species of Marburg visequence and secondary structure. Virology 223, 376–380.

anchez, A., Khan, A.S., Zaki, S.R., Nabel, G.J., Ksiazek, T.G., PC.J., 2001. Filoviridae: Marburg and Ebola viruses. In: Knipe, DHowley, P.M. (Eds.), Fields virology, fourth ed. Lippincott William& Wilkins, Philadelphia, pp. 1279–1304.

anchez, A., Kiley, M.P., Holloway, B.P., Auperin, D.D., 1993. Sequanalysis of the Ebola virus genome: organization, genetic elem

A. Sanchez, P.E. Rollin / Virus Research 113 (2005) 16–25 25

and comparison with the genome of Marburg virus. Virus Res. 29,215–240.

Sanchez, A., Kiley, M.P., Klenk, H.D., Feldmann, H., 1992. Sequenceanalysis of the Marburg virus nucleoprotein gene: comparison to Ebolavirus and other non-segmented negative-strand RNA viruses. J. Gen.Virol. 73, 347–357.

Sanchez, A., Ksiazek, T.G., Rollin, P.E., Miranda, M.E., Trappier, S.G.,Khan, A.S., Peters, C.J., Nichol, S.T., 1999. Detection and molec-ular characterization of Ebola viruses causing disease in humanand nonhuman primates. J. Infect. Dis. 179 (Suppl. 1), S164–S169.

Sanchez, A., Lukwiya, M., Bausch, D., Mahanty, S., Sanchez, A.J., Wag-oner, K.D., Rollin, P.E., 2004. Analysis of human peripheral bloodsamples from fatal and nonfatal cases of Ebola (Sudan) hemorrhagicfever: cellular responses, virus load, and nitric oxide levels. J. Virol.78, 10370–10377.

Sanchez, A., Trappier, S.G., Mahy, B.W.J., Peters, C.J., Nichol, S.T., 1996.The virion glycoproteins of Ebola viruses are encoded in two readingframes and are expressed through transcriptional editing. Proc. Natl.Acad. Sci. USA 93, 3602–3607.

Sanchez, A., Trappier, S.G., Stroher, U., Nichol, S.T., Bowen, M.D., Feld-mann, H., 1998a. Variation in the glycoprotein and VP35 genes ofMarburg virus strains. Virology 240, 138–146.

Sanchez, A., Yang, Z.Y., Xu, L., Nabel, G.J., Crews, T., Peters, C.J.,1998b. Biochemical analysis of the secreted and virion glycoproteinsof Ebola virus. J. Virol. 72, 6442–6447.

Timins, J., Schoehn, G., Ricard-Blum, S., Scianimanico, S., Vernet, T.,Ruigrok, R.W.H., Weissenhorn, W., 2003. Ebola virus matrix proteinVP40 interaction with human cellular factors Tsg101 and Nedd4. J.Mol. Biol. 326, 493–502.

Towner, J.S., Rollin, P.E., Bausch, D.G., Sanchez, A., Crary, S.M., Vin-cent, M., Lee, W.F., Spiropoulou, C.F., Ksiazek, T.G., Lukwiya, M.,Kaducu, F., Downing, R., Nichol, S.T., 2004. Rapid diagnosis of Ebolahemorrhagic fever by reverse transcription-PCR in an outbreak set-ting and assessment of patient viral load as a predictor of outcome.J. Virol. 78, 4330–4341.

Volchkov, V.E., 1999. Processing of the Ebola virus glycoprotein. Curr.Top. Microbiol. Immunol. 235, 35–47.

Volchkov, V.E., Chepurnov, A.A., Volchkova, V.A., Ternovoj, V.A., Klenk,H.D., 2000. Molecular characterization of guinea pig-adapted variantsof Ebola virus. Virology 277, 147–155.

Volchkov, V.E., Volchkova, V.A., Chepurnov, A.A., Blinov, V.M., Dolnik,O., Netesov, S.V., Feldmann, H., 1999. Characterization of the L geneand 5′ trailer region of Ebola virus. J. Gen. Virol. 80, 355–362.

Weissenhorn, W., Carfi, A., Lee, K.H., Skehel, J.J., Wiley, D.C., 1998.Crystal structure of the Ebola virus membrane fusion subunit, GP2,from the envelope glycoprotein ectodomain. Mol. Cell. 2, 605–616.

WHO, 1978a. Ebola haemorrhagic fever in Sudan. 1976. Report ofa WHO/International Study Team. Bull. World Health Organ. 56,247–270.

WHO, 1978b. Ebola haemorrhagic fever in Zaire. 1976. Bull. WorldHealth Organ. 56, 271–293.