Complete Genome Sequence and Biological Characterizations of A NovelGoose Paramyxovirus-SF02 Isolated in China*

JIAN ZOU,1 SONGHUA SHAN,2 NENGTAO YAO3 & ZUXUN GONG1,y1Key Laboratory of Proteomics, Institute of Biochemistry and Cell Biology, Shanghai Institute for Biological Sciences,

Chinese Academy of Sciences, Shanghai 200031, China2Shanghai Import-&-Export Inspection and Quarantine Bureau, Shanghai, China

3Fengxian Veterinary Station, Shanghai, China

Revised June 21, 2004; Accepted July 8, 2004

Abstract. A Paramyxovirus designated as APMV-1 (NDV) Isolate SF02 (abbre. as SF02) was recentlyisolated from goose in China. SF02 was identified as a member of Newcastle disease virus (NDV) genotypeVII. NDV strains are generally pathogenic only for fowls, including chicken and pigeon, and not forwaterfowls such as goose and duck, whereas SF02 is highly pathogenic for both fowls and waterfowls. Inthe present study the complete genome consisting of 15, 192 nucleotides of SF02 was sequenced. Genomesof SF02 and all known APMV-1, Strains contain 6 ORFs in the order of NP-P-M-F-HN-L, and that ofSF02 had an extra 6 nts between NP and P genes. Moreover, an anti-sense ORF consisting of 549 nt at the1960 to 1412 and deduced 182 amino acids was found in SF02. The SF02 genome shared 83% identity andits 6 ORFs 81.9–86.1% identities with the reference APMV-1 strains. The possible mechanism determiningdifferent host range and pathogenicity is discussed based on genetic analyses.

Key words: APMV-1 (NDV), biological characterization, genomic sequence, pathogenicity, phylogenetic,SF02

Introduction

Newcastle disease is one of the most serious dis-eases that has caused severe economic losses ofpoultry. The causative agent is the Newcastle dis-ease virus (NDV), a member of avian paramyxo-virus serotype-1 (APMV-1) [1]. The virus is nowplaced in the genus Avulavirus of subfamilyParamyxovirinae in Paramyxoviridae [2]. AllAPMV-1 isolates are categorized as three patho-types depending on the severity of disease caused,i.e., velogenic, mesogenic, and lentogenic [1]. Thevelogenic strains are highly pathogenic for chickenand other fowls including pigeon. Generally,

APMV-1 strains are infectious to waterfowls, suchas geese and ducks, without causing overt clinicalsymptoms. The waterfowls have shown strongresistance to APMV-1 infections and they act onlyas carriers of the virus [3,4].

The genomes of several APMV-1 strains and amember of avian paramyxovirus 6 (APMV-6) hadbeen sequenced [5–8]. The APMV-1 genome is anon-segmented negative-stranded RNA consistingof 15,186 nucleotides. The genomic RNAcomprises six genes that encode the nucleocapsidprotein (NP), the phosphoprotein (P), thematrix protein (M), the fusion protein (F), thehaemagglutinin-neuraminidase (HN), and a largepolymerase protein (L). The key for APMV-1pathogenicity is the sequence of the cleavage site ofthe fusion protein [9–11]. Another factor involvedin the pathogenicity of APMV-1 is the length ofthe HN protein [12]. The HN proteins of all

*The nucleotide sequence data reported in this paper have been

submitted to the GenBank nucleotide sequence database and

have been assigned the accession number of AF473851.yAuthor for all correspondence:

E-mail: gongzx@sunm. shcnc.ac.cn

Virus Genes 30:1, 13–21, 2005� 2005 Springer Science+Business Media, Inc. Manufactured in The Netherlands.

virulent APMV-1 strains are expressed directly asactive forms containing 577 or 571 amino acids,respectively, for different strains, while a HNprotein precursor (HN0) containing 616 aminoacids is only expressed in avirulent strains and isactivated after its processing. A conserved RNAediting site is found in P gene of all members of thesubfamily Paramyxovirinae. Two additional pro-teins (designated as V and W proteins) are pro-duced by a RNA-editing processing (1 or 2 Gtemplate-independent insertion, respectively) inthis RNA-editing site during transcription of the Pgene [13]. Based on the sequence of the F gene,APMV-1 strains were phylogenetically classifiedinto 8 genotypes, I–VIII [14–17].

The goose paramyxovirus (abbrev. as GPMV)infection outbreaks have occurred frequently since1997 in China. The disease is featured by its highincidence and mortality rates of the poultry. In1999, there was an outbreak of the disease in goosefarms in Shanghai. The incidence and mortalityrate of the disease in adult geese were 50–70% and10–20%, respectively. The mortality rate in younggeese under 15 days of age was 100%. A novelvirus isolate designated as SF02 was determined asthe causal agent for the disease outbreaks [18].

In this study we have characterized the isolateSF02, and compared it with other APMV-1strains. We have determined the complete genomesequence of SF02 isolate. The phylogenetic anal-ysis showed that it is a member of APMV-1genotype VIIa.

Materials and Methods

Biological Characterizations of SF02

Virus was isolated from a diseased goose byinoculating with the tissue homogenates into10-day-old embryonated specific-pathogen-free(SPF) hens’ eggs [19]. The mean death time inchicken embryonated hens’ eggs (MDT) of viruswas determined as described [19]. The 50%embryo-infectious dose (EID50) of virus was con-ducted according to the Reed–Muench method.The pathogenicity of virus in chicken was per-formed as following: the stock virus preparationwas diluted in 1:100. One hundred microlitersof each dilution was inoculated into chickens.

Number of infected chickens were calculated.Haemagglutination-inhibition (HI) tests of SF02were carried out as described [3].

Cell Culture and Virus Infection

Chicken embryo fibroblasts (CEFs) were preparedand maintained as described [20]. Goose embryofibroblasts (GEFs) were prepared under the samecondition using 17-day-old goose embryos. Cellswere distributed in 24-well cell culture plates at5 · 105 per well, and cultured for 24 h, and theninfected with SF02 as described [3]. Four to sixdays after infection the culture medium containingdead cells and virus was discarded. The number ofsurvival cells attached to the dishes was checked bymethylthiazolydiphenyl-tetrazoliumbromide (MTT)assay following manufacturer’s instructions(SIGMA). A total of 3 wells for each sample werechecked and the MTT values were recorded.

Virus Propagation, Purification and RNA Isolation

Virus was propagated in 9- to 11-day-old embry-onated SPF hens’ eggs. A total of 40 ml infectedallantoic fluid was centrifuged at 3000 · g for30 min at 4�C. The supernatant was collected andcentrifuged at 40,000 · g for 120 min at 4�C. Thepellet was resuspended in 100 ll of TNE buffer(100 mM Tris, pH 7.2, 100 mM NaCl, 1 mMEDTA). Viral RNA was extracted by Trizolreagent (Life Technologies) following manufac-turer’s instructions, kept in 50 ll DEPC–H2Ocontaining 1 ll RNase inhibitor (20 U/ll, TaKa-Ra) and stored at)20�C until use.

RT-PCR Primers and Generations of RT-PCRFragments

Thirty-one primers were designed and synthesizedbased on the consensus sequences of the genomesof NDV strains (La Sota, B1, and clone 30,with GenBank accession numbers AF077761,NC002617, and NDVY 18898, respectively)(Table 1). Reverse transcription (RT) was carriedout at 42�C for 60 min in 50 ll reaction mixturecontaining 10 ll of 5· AMV reverse transcriptasebuffer, 2 ll dNTPs (25 mM each of four dNTPs),1 ll AMV reverse transcriptase (10 U/ll,TaKaRa), 1 ll RNase inhibitor (20 U/ll), 5 ll of

14 Zhou et al.

RT-primer (10 pmol/ll), 2 ll of viral RNA tem-plate and 29 ll of DEPC–H2O. PCRs were per-formed in 50 ll reaction mixture containing 5 ll of10· Pyrobest DNA polymerase buffer, 4 ll dNTPs(2.5 mM each of four dNTPs), 1 ll Pyrobest DNApolymerase (5 U/ll, TaKaRa), 1 ll of each PCRprimer (10 pmol/ll), 3 ll of RT products and35 ll of ddH2O.

Amplification of Genomic Termini byLigation-anchored PCR (LA-PCR)

LA-PCR protocol was performed as describedwith slight modifications [21]. To determine thesequence of the genomic 50 terminal end primer14A was used to generate single-strand cDNA

with AMV reverse transcriptase as describedabove. Residual RNA was removed after cDNAsynthesis by 5 min boiling in 12.5 ll of 150 mMNaOH and 1 ll of 0.5 M EDTA, and then neu-tralizing with 12.5 ll of 1 M HCl. The cDNA waspurified by PCR purification kit (QIAGEN) andrestored in 20 ll DEPC–H2O. Anchored-primers(AP) was phosphorylated at 50 end with T4 poly-nuclectide; kinase (TaKaRa) and blocked byddCTP at 30 end using terminal deoxynucleotidyltransferase (TaKaRa) as described [22]. Tenmicroliters of single-stranded cDNA was ligatedto 100 pmol, phosphorylated and blocked APwith T4 RNA ligase (TaKaRa) for 24 h at 15�C.The ligation product was purified by PCR purifi-cation kit and used as the template of PCR. One

Table 1. List of RT-PCR primers

Name Primer sequence (50–30) Genomic site

P1A CGATAAAAGGCGAAGGAGCA 25—44

P1B ACTGATGCCATACCCATGGC 1140–1121

P2A ATGCGTTTGTATCGGATGA 1013–1031

P2B TTTCCGTGCTTCTCCCATGC 2059–2040

P3A ATTCAGAGACCAGGGCAAGT 1827–1846

P3B AATGATCGCACAACTGCAAC 3229–3210

P4A CGTCACACGGAATCCCTCGG 3119–3138

P4B CAGACTCTTCTACCCGTGTT 4520–4501

P5A TGCTTATAGTTAGTTCACCTGTC 4463–4485

P5B CACATAGGCTGTTGTTGGG 6254–6236

P6A ATCAGATGAGAGCCACTACA 6183–6202

P6B TAGACTGGGAACCATACGCG 7367–7348

P7A GGGTTTGACGGCCAATACCA 7243—7262

P7B TCTGCCCTTTCAGGACCGGA 8415—8396

P8A ATCAGCCAGTGCTCATGCGA 8269—8288

P8B ACATCTCAGCTGCTTGATTC 9446—9427

P9A TCAGGTACATTTGCAGGAGA 9288—9306

P9B AACATCGTAGTGTCCATCAG 10,431–10,412

P10A TCGCTCATGCCATCAATCAG 10,350–10,369

P10B TTGCTTTCTCCTACCTACAG 11,536–11,517

P11A GCAGAAGAGAAGGCATTGGC 11,432–11,451

P11B TAGCTAAGTCAAGTCTCGC 12,549–12,567

P12A TGTTGCGGTTCCTTTCGAGC 12,446–12,465

P12B GTCCCTATCCCTCTGAACAA 13,626–13,607

P13A CCAGCAAGGTATGACGCATT 13,521–13,540

P13B CCAAACAAAGATTTGGTGAATGAC 15,185–15,163

P14A CTGCGCTTTAGGTATGTCCT 14,785–14,804

P14B AGGACATACCTAAAGCGCAG 14,826–14,845

P14C CACTGTTAGCAAAGCCATCG 433–452

AP GCTCTGATGAATGTCTTGCCACGATGCT –

AAP GGCAAGACATTCATCAGAGC –

These were designed on the basis of the consensus sequences of genes or genomes of several APMV-1 strains (La Sota, B1, and

clone 30, GenBank accession number is AF077761, NC002617, NDVY18898, respectively). AP is the anchor primer and AAP is the

anti-anchor primer.

Genome Sequence of an APMV-1 Isolate 15

microliter of template and 1 ll of primer 14B(10 pmol/ll) as well as 1 ll of anti-anchoredprimer (AAP) (10 pmol/ll) were used in the PCRamplification with Pyrobest DNA polymerase. Todetermine the sequence of the genomic 30 terminalend the phosphorylated and blocked AP wereligated to the 30 end of genomic RNA of SF02under the same condition. The ligation productswere purified and used as the template of RT-PCRusing primers AAP and 14C.

Cloning and Sequencing of RT-PCR Products

RT-PCR products were cloned into pUC19 vector.Recombinant plasmids containing the RT-PCRproducts were purified and sequenced in bothdirections with primers flanking the inserts usingan ABI 373 automatic sequencer (Perkin–Elmer).Sequencing of each genomic nucleotide of SF02was performed no less than 3 times.

Phylogenetic Analysis of Genomic Sequence

The open reading frames (ORFs) were predictedusing the TRANSLATION program in the soft-ware package GCG (Accelrys, SeqWeb version 2).The identity analyses of nucleotide and proteinsequences were accomplished using the GAP

program in the same package. Phylogenetic tree wasconstructed by the software package DNASTARwith the CLUSTER V method. All the rest ofdata on nucleotide sequences of APMV-1 strainsused in phylogenetic analysis were obtained fromGenBank, with their accession numbers [15–17, 23].

Results

Biological Characterizations of SF02

The virions of SF02 were spherical in shape withthe size about 260 nm in diameter under the elec-tron microscope. MDT of the virus was 48 h andEID50 was 109.6/ml. HI titers of diseased goosesera against SF02, NDV antigen (La Sota), andavian influenza (subtypes H5, H7, and H9) were211, 26, and no reaction, respectively. Pathogenic-ity tests in birds had shown that SF02 was a highlypathogenic strain both for fowls and waterfowls.(Table 2).

Infections of Cells

SF02 infection of both CEFs and GEFs resulted inheavy cell death within 5 days (Table 3), as shownwith the control, F48E9, the standard velogenic

Table 2. Pathogenicity tests of SF02 isolate in poultry

Animals

No. of

virus-treated

Age of animals

(in days)

No. of infected

animals

No. of

death

Infectivity

rate (%)

Mortality

rate (%)

Goose 6 14 6 6 100 100

Pigeon 6 30 6 6 100 100

Partridge 6 17 6 3 100 50

Pheasant 5 22 5 5 100 100

Fraucolin 5 22 5 5 100 100

Chicken 5 27 5 3 100 60

Duck 5 30 5 5 100 100

Keet 5 30 3 1 60 20

Table 3. Survival rates of the GEFs and CEFs 5 days after infected with different APMV-1 strains as determined by MTT assays

Virus strains

Cells F48E9 SF02 Komarov La Sota V4/66 control

CEFs 0.01 0.13 0.23 0.42 0.69 0.67

GEFs 0.01 0.27 0.72 1.15 1.31 1.34

A total of 3 wells for each sample were analyzed and the average MTT calculated. Control cells were not inoculated with the virus.

Differences in controls between CEFs and GEFs were due to different growth behaviors under identical cultural conditions.

16 Zhou et al.

APMV-1 strain in China, which also causedcomplete death of both cells after infection. Themesogenic strain, Komarov, induced only a partialcell death of CEFs and GEFs, and the lentogenicstrain, La Sota, showed only a low mortality rate.The avirulent strain, V4/66, did not cause celldeath at all. Since the virus grew much better in theGEFs than CEFs, hence the MTT value for CEFsis much lower than that of GEFs.

Cloning and Sequencing of NDV SF02 Genome

A total of 15 overlapping cDNA clones coveringthe entire genome of GPMV SF02 was obtained byRT-PCR and LA-PCR. Sequences compiledfrom these clones showed that SF02 genome con-tained 15, 192 nt (GenBank accession numberAF473851), whereas the genomes of all otherAPMV-1 strains known were 15, 186 nt in length[5,7]. The extra 6 nts ‘‘ACACTC’’ of SF02 genomewere at position 1, 652-1, 657 in the untransla-tional region (UTR) between NP and P genes.

The genome organization of SF02 was the sameas those of other APMV-1 strains [24], consistingof 6 ORFs in the order of NP-P-M-F-HN-L. Thestart and end positions of NP gene were consensuswith other APMV-1 strains, whereas the remainedfive genes had their starts and ends 6 nts down-stream. An anti-sense ORF containing 549 nt atgenomic position 1, 960-1, 412, including the extra6 nt fragment was found in the genome of SF02 incontrast with a very short anti-sense ORF forother APMV-1 strains (Figs 1 and 2). The flankingsequences of the AUG codon of this anti-senseORF accorded with the Kozak sequence [25]. Thecleavage site of the F protein of SF02 possessedthe amino acid sequence of 112R-R-Q-K-R-F117

characteristic for the velogenic strain. The deducedamino acid sequence of the HN protein of SF02

consisted of 571 amino acids. A putative RNAediting site was found at position 2, 286-2, 293.The sequence of the editing site of SF02,UUUUUCCC, was well conformed to the con-served sequence of UU(U/C)UCCC found in allmembers of subfamily Paramyxovirinae [13]. Thegenome shared 83.1% identity with the NDVvaccine strain-La Sota. The identities of each geneshared by SF02 and La Sota were 85.2%, 82.8%,84.7%, 84.3 %, 81.9%, and 86. 1%, respectively(Table 4).

The lengths of both termini of SF02 isolate werethe same as in other APMV-1 viruses. The 30 lea-der and 50 trailer were 55 nt and 114 nt in length,respectively (Fig. 3A and B). The leader sequenceof SF02 shared high identity with other APMV-1viruses (85.5%), but for the trailer only 69.3%. The30 leader and 50 trailer of paramyxovirus werepartially complementary and could have someroles in genomic and anti-genomic replications ofthe virus [8]. The complementarity was foundbetween 30 and 50ends of SF02 (Fig. 3C). Seven-teen out of 20 terminal nucleotides were comple-mentary to each other.

Phylogenetic Analysis

APMV-1 has been classified into 8 genotypes(I–VIII), based on sequence of the complete orpartial F gene [14,15–17,23]. The epidemic APMV-1 genotypes VI–VIII reported recently were ana-lyzed and a phylogenetic tree was constructed. Itwas shown that SF02 should be ascribed toAPMV-1 genotype VIIa (Fig. 4).

Discussion

It has been generally acknowledged that thewaterfowls such as the geese act only as APMV-1carriers in the wild [3,26]. Takakuwa et al. [4]had isolated several APMV-1 strains containingthe virulent type F cleavage site sequence frommigratory waterfowls, but these are avirulent fororiginal hosts and chickens. Bolte et al. [27] hadinvestigated the response of domestic geese tolentogenic and velogenic NDV strains and foundout that geese do not readily excrete NDVs indetectable amounts and do not contain detectableamounts of virus in their tissues 14 days after virus

Fig. 1. Schematic diagram of the SF02 genome with six ORFs, -

NP-P-M-F-HN-L- and a possible anti-sense ORF (A). An extra

6 nt fragment (B), ACACTC, is shown at the position 1, 652-1,

657 in UTR between NP and P genes. The anti-sense ORF

containing the extra 6 nt fragment is located at the position 1,

960-1, 412.

Genome Sequence of an APMV-1 Isolate 17

challenge. In contrast, SF02 was isolated fromdiseased geese with overt ND symptoms andpathogenicity tests had suggested that SF02 is avelogenic strain. The isolate is highly infectious toboth fowls and waterfowls including geese, ducks,chickens, and pigeons, and the mortality rate ishigh and lethal for young birds. This is importantnot only for its academic interests but also for itspractical implications relevant to poultry.

The complete sequence of SF02 genome iscomposed of 15,192 nt. This number conforms to

the ‘‘rule of six’’ which had been suggested recentlyto play an important role in paramyxovirus repli-cation [28,29]. The SF02 genome shares highidentity with the genome of other APMV-1 virusesand other features, such as the genome organiza-tion, the cleavage site of F gene, and editing site ofP gene. Therefore, we suggest that SF02 from agoose in China is one of APMV-1 strains. How-ever, we have also noted some unique features ofits genome that shows clearly some differenceswith other APMV-1 viruses. First, there is an extra

Fig. 2. Nucleotide and deduced amino acid sequences of the anti-sense ORF in SF02 compared with the nucleotide sequence of La Sota

strain. The flanking nucleotide in accordance with the Kozak sequence was underlined. Start and end codons are shown in boldface.

18 Zhou et al.

6 nt fragment, ACACTC, in UTR between the NPand P genes Second, an additional anti-sense ORFcontaining the same extra 6 nt fragment is present.Third, 30 leader of SF02 genome shares highidentity with APMV-6 and other APMV-1 viruses,whereas its 50 trailer is more variable.

We have noted also that the difference in thehost range between SF02 and other APMV-1

strains is somewhat related to differences intheir host pathogenicities. The pathogenicity ofAPMV-1 is dependent on many factors, such asthe cleavability of the F protein and the interac-tions between host and virus. Since our results ofcell infections showed that there was no apparentdifference in the pathogenicity in the cellular levelfor chicken and goose with SF02 and APMV-1, it

Table 4. The nucleotide identities (%) between SF02 isolate and other APMV-1 strains

NP P M F HN L

gene gene gene gene gene gene

SF02 (%) (%) (%) (%) (%) (%)

Ulster2C-67 87.8 – 86.9 86.7 84.4 –

V4/66 – 84.7 85.4 86.4 84.5 –

La Sota 85.2 82.8 84.7 84.3 81.9 86.1

Texas GB 85.7 82.2 84.8 84.4 82.5 –

BeaudetteC-45 85.6 83.4 85.4 84.4 82.7 86.4

Herts-33 – 85.9 87.9 88.7 – –

Taiwan95 – – – 94.2 94.3 –

F48E9 – 85.3 86.6 86.6 82.7 87.9

The values were calculated using GAP program in the software package GCG (Accelrys, SeqWeb version 2). Dash lines indicate that

no data are available in GenBank.

Fig. 3. Alignment of the 30 leader and the 50 trailer of SF02 isolate with several APMV-1 strains and APMV-6. All sequences are

shown in genomic RNA-sense. (A) Alignment of the 30 leader of SF02 and APMV-1 strains. (B) Alignment of the 50 trailer of SF02 andseveral APMV-1 strains. (C) Paired nucleotides at 30 and 50 ends of SF02 genome are underlined.

Genome Sequence of an APMV-1 Isolate 19

might be assumed that the difference of the hostpathogenicities between APMV-1 and SF02 forthe fowls and waterfowls could be traced to theregulations on the higher level than in the cellularone. More recently it had been shown that anRNA-editing process that occurs during tran-scription of P gene produces a V protein [13]. Vprotein has multiple functions, involved in virusreplication and also serves probably as a virulencefactor by inhibiting the activation of host inter-feron [30–34]. The expression of V protein isdetermined by the editing efficiency of P gene.Recombinant APMV-1 with low expression of Vprotein is avirulent for 9–11 day of age or olderchicken embryos, but it is lethal for 8-day of age oryounger chicken embryos. It seems therefore thatthe activation of interferon is age-dependent forchicken embryos [35]. Therefore, the low level of Vprotein is unable to inhibit the activation ofinterferon of older animals [34]. The present datashows that the extra 6 nt fragment of SF02 is

located between NP and P genes and at upstreamof 153 nt of mRNA start site of P gene (1810), andthat both NDV and SF02 could cause cells deathof CEFs and GEFs. These results suggested thatthe difference between the sequences in the intra-genic regions of HN and P genes of NDV andSF02 might cause the differences of RNA editingefficiency of P gene and of the expression of Vprotein and therefore, it might be one of the causesleading to differences in viral pathogenicities forfowls and waterfowls. Indeed, more studies areneeded before this could be substantiated.

Interestingly, an anti-sense ORF containingextra 6 nt fragment has been found in SF02 gen-ome. It is absent in genomes of any other APMV-1strains. The Kozak sequence flanking the AUGinitiator codon of this anti-sense ORF indicatedthat the AUG codon could be recognized byeukaryotic ribosomes and the anti-sense ORFcould be translated during the viral life cycle. Ourpreliminary results of Northern blot analysis withrandom primers on this anti-sense ORF sequencetemplate showed that there is indeed a transcriptwith about 1200 bp size in CEFs infected withSF02 (data not shown).

It is a firmly established fact that there are manyVI–VIII genotypes among NDV isolates knownthat cause epidemics in chickens and pigeons allover the world [15–17,23,36–38]. Now we haveSF02 of even higher calibre adding to the list andthat is our commitments to work harder to find abetter solution.

Acknowledgments

This work was supported by a grant from Shang-hai Agricultural Key Promoted by Science andTechnology. We are indebted to Miss JianHua Wufor her excellent assistance and to Professor DeminSu for his English revision.

References

1. Alexander D.J., in Calnek B.W. (ed), Diseases of Poultry.

Iowa State University Press, Ames, 1997, pp. 541–569.

2. Mayo M.A., Arch Virol 147, 1655–1656, 2002.

3. Yin Z. and Liu J.H., Animal Virology 2nd edn. Scientific

Publishers, Beijing, 1997, pp. 323–435.

4. Takakuwa H., Ito T., Takada A., Okazaki K., and Kida H.,

Jpn J Vet Res 45, 207–215, 1998.

Fig. 4. Phylogenic tree of SF02 isolate and recent epidemic

APMV-1 based on nucleotide sequences between positions 1

and 374 of F gene. SF02 is subtyped into genotype VIIa

(see text). Phylogenetic tree was constructed by the software

package DNASTAR with the CLUSTER V method. Accession

numbers of F genes of NDV isolates are given in references

[15–17,23].

20 Zhou et al.

5. Krishnamurthy S. and Samal S.K., J Gen Virol 79, 2419–

2424, 1998.

6. Phillips R.J., Samson A.C.R., and Emmerson P.T., Arch

Virol 143, 1993–2002, 1998.

7. de Leeuw O. and Peeters B.J., J GenVirol 80, 131–136, 1999.

8. Chang P.C., Hsieh M.L., Shien J.H., Graham D.A., Lee

M.S., and Shien H.K., J Gen Virol 82, 2157–2168, 2001.

9. Collins M.S., Bashiruddin J.B., and Alexander D.J., Arch

Virol 128, 363–370, 1993.

10. Peeters B.P.H., de Leeuw O.S., Koch G., and Giekens

A.L.J., J Virol 73, 5001–5009, 1999.

11 Yu S.Q., Kishida N., Ito H., Kida H., Otsuki K., Kawaoka

Y., and Ito T., Virology 301, 206–211, 2002.

12. Toyoda T., Sakaguchi T., Hirota H., Gotoh B., Kuma K.,

Miyata T., and Magai Y., Virology 169, 273–282, 1989.

13. Steward M., Vipond I.B., Millar N.S., and Emmerson P.T.,

J Gen Virol 76, 2519–2527, 1993.

14. Lomniczi B., Wehmann E., Herczeg J., Ballagi-Pordany A.,

Kaleta E.F., Werner O., Meulemans G., Jorgensen P.H.,

Mante A.P., Gielkens A.L.J., Capua I., and Damoser J.,

Arch Virol 143, 49–64, 1998.

15. Herczeg J., Wehmann E., Bragg R.R., Travassos D.P.M.,

Hadjiev G, Werner O., and Lomniczi B., Arch Virol 144,

2087–2099, 1999.

16. Yu L., Wang Z.L., Jiang Y.H., Chang L., and Kwang, J., J

Clin Microbiol 39, 3512–3519; 2001.

17. Liang R., Cao D.J., Li J.Q., Chen J., Guo X., Zhuang F.F.,

and Duan M.X., Vet Microbiol 87, 193–203, 2002.

18. Zou J., Shan S.H., Yao N.T., and Gong Z.X., Acta Bioch

Bioph Sin 34, 439–444, 2002.

19. Alexander D.J., in Purchase H.G., Arp L.H., Hitchner S.H.,

Domermuth C.H., and Pearson J.E., (eds), Newcastle Dis-

ease. American Association of Avian Pathologists, Texas,

1989, pp. 110–112.

20. Ferreira A., in Spector D.L., Goldman R.D., and Leinwand

L.A., (eds), A Laboratory Manual. Cold Spring Harbor

Laboratory Press, New York, 1998, pp.

21. Schaefer B.C., Anal Biochem 227, 255–273, 1995.

22. Tessier D.C., Brousseau R., and Vernet T., Anal Biochem

158, 171–178, 1986.

23. Ke G.M., Liu H.J., Lin M.Y., Chen J.H., Tsai S.S., and

Chang P.C., J Virol Methods 97, 1–11,2001.

24. Millar N.S. and Emmerson P.T., in Alexander D.J. (ed),

Molecular Cloning and Nucleotide Sequencing of Newcastle

Disease Virus. Kluwer Academic Publishers, Boston, 1988,

pp. 79–97.

25. Kozak M., Nucleic Acids Res 9, 5233–5262, 1981.

26. Muller T., Hlinak A., Muhle R.U., Kramer M., Liebherr

H., Ziedler K., and Pfeiffer D.U., Avian Dis 43, 315–319,

1999.

27. Bolte A.L., Voss M., Vielitz E., and Kaleta E.F., Deut

Tierarztl Woch 108, 155–159, 2001.

28. Peeters B.P.H., Gruijthuijsen Y.K., de Leeuw O.S., and

Gielkens A.L.J., Arch Virol 145, 1829–1845, 2000.

29. Kolakofsky D., Pelet T., Garcin D., Hausmann S., Curran

J., and Roux L., J Virol 72, 891–899, 1998.

30. Kato A., Kiyotani K., Sakai Y., Yoshida T., Shioda T., and

Nagai Y., J Virol 71, 7266–7272, 1997.

31. Didcock L., Young D.F., Goodbourn S., and Randall R.E.,

J Virol 73, 3125–3133, 1999.

32. Didcock L., Young D.F., Goodbourn S., and Randall R.E.,

J Virol 73, 9928–9933, 1999.

33. Patterson J.B., Thomas D., Lewicki H., Billeter M.A., and

Oldstone M.B., Virology 267, 80–89, 2000.

34. Mebatsion T., Verstegen S., de Vaan L.T.C., Romer-

Oberdorfer A., and Schrier C., J Virol 75, 420–428, 2001.

35. Morahan P.S. and Grossberg S.E., J Infect Dis 121, 615–

623, 1970.

36. Gould A.R., Kattenbelt J.A., Selleck P., Hansson E., Della-

Porta A., and Westbury H.A., Virus Res 77, 51–60, 2001.

37. Seal B.S., King D.J., and Meinersmann R.J., Virus Res 66,

1–11, 2000.

38. Seal B.S., Crawford J.M., Sellers H.S., Locke D.P., and

King D.J., Virus Res 83, 119–129, 2002.

Genome Sequence of an APMV-1 Isolate 21