Comparison of the late HI histone genes of the sea urchins ...

Volume 14 Number 20 1986 Nucleic Acids Research

Comparison of the late HI histone genes of the sea urchins Lytechinus pictus andStrvngelocentrotus purpuratus

James A.Knowles and Geoffrey J.Chiids*

Department of Genetics, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY10461, USA

Received 24 July 1986; Revised and Accepted 11 September 1986

ABSTRACTWe have i s o l a t e d and sequenced a gene encoding a l a t e HI h i s tone subtype

from the sea urchin spec ies L_. p i c t u s . The primary s tructure of the l a t e HIsubtype encoded by t h i s gene I s 209 amino ac ids in l eng th , and has a netp o s i t i v e charge of 67. This gene i s present in a s i n g l e copy per haploldgenome and encodes an mRNA of 752 n u c l e o t l d e s . Late HI t ranscr ip t s aredetected in the u n f e r t i l l i e d egg and are most prevalent in gas tru la tingembryos. Comparison of 375 bp of 5' f lanking sequences of the L_. plctua l a t eHI gene and the Hl-gaauna gene of a d i s t a n t l y re la ted sea urchin s p e c i e s , £ .purpuratus, revea l s large blocks of sequences that are i d e n t i c a l between thetwo genes . To determine i f these conserved 5' sequences are present in othermembers of the sea urchin HI gene family, the analogous region of £ .purpuratus Hl-alpha, an ear ly HI gene, was sequenced. The homology betweenthe flanking sequences of the ear ly and l a t e f a m i l i e s was H a l t e d to consensussequences which are found upstream of a l l HI genes . The poss ib le regulatoryimpl icat ions of these f indings are d i scussed .

INTRODUCTION

Sea urchin h i s tones are encoded by several multlgene f a m i l i e s which are

regulated in both a temporal and t i s sue s p e c i f i c fash ion . The two best

characterized f a m i l i e s are those encoding the ear ly and l a t e h i s tone subtypes.

The ear ly h i s tone gene family contains c lus tered sequences encoding the alpha

subtypes of a l l f i v e h i s tone prote ins which are repeated in several hundred

nearly i d e n t i c a l tandem arrays ( 1 - 4 ) . Lytechinus p i c t u s contains three

separate ly maintained tanden arrays of ear ly genes , the A-D, B-C, and E

subfami l i e s , which d i f f e r primarily in t h e i r spacer sequences ( 5 - 7 ) .

Transcripts of these ear ly h i s tone genes are found as stored mRNAs in the

u n f e r t i l i z e d egg, are synthesized during c l eavage , and become most abundant In

the ear ly b ias tula stage of development ( 3 , 4 ) .

The genes encoding the l a t e core h i s tones have been cloned and are

repeated only 8-10 times in the sea urchin genome. Unlike the i r ear ly gene

counterparts , the l a t e core hi stone genes are not arranged In tanden arrays

( 8 - 1 0 ) . The coding regions of the ear ly and l a t e H3 genes of L. p i c tus d i f f e r

©IRL Press Limited, Oxford, England. 8 1 2 1

Downloaded from https://academic.oup.com/nar/article-abstract/14/20/8121/1081298by gueston 06 April 2018

Nucleic Acids Research

by 19Z In nucleotlde sequence (11). Late gene transcripts for the core

histories are also stored In eggs, but are 100-fold less abundant than early

gene transcripts (12). The genes encoding the late core histories are

activated in cleavage stage embryos at the same time as the early hi stone

genes, but late gene transcripts continue to accuoulate up to the onset of

gastrulatlon, long past the the peak of early hi stone oRNA accumulation. At

least part of this accumulation can be accounted for by an Increase in the

relative rate of transcription of the late gene family at about the bias tula

stage (7-14 hrs. post fert i l izat ion) (12).

Recently, a gene encoding the S. purpuratua late HI subtype, Hl-gamma,

has been isolated (13). Unlike Its core hi stone gene counterparts, Hl-gamma

i s not clustered with other late hi stone genes, and i s present In only a

single copy per haplold genome. The temporal pattern of expression of

Hl-garma Is similar to that of the late core histories. Hl-gamma aRNA Is

stored in the unfertilized egg, and Is aost abundant during gastrulatlon.

This report detai ls the cloning and sequencing of a late HI gene from the

distantly related species, L_. plctus. A comparison of the upstream region of

the two late HI genes revealed striking homologies. To ascertain whether

these conserved sequences are common to a l l members of the sea urchin HI class

of genes, the upstream region of the S. purpuratua early HI genes was

sequenced. The upstream region of the early gene shares l i t t l e homo logy with

upstream regions of either of the late genes. The significance of this

observation to a model for the regulation of these genes i s discussed.

MATERIALS AND METHODS

P r e p a r a t i o n of RNA

SNA was prepared from L_. p l c t u s embryos a s p r e v i o u s l y d e s c r i b e d ( 1 2 ) .

Isolation of Genoalc Clones

S_. purpuratus late HI cDKA was subcloned Into rapl8 (13), radiolabeled by

primer extension (12), and used to screen several L. plctus genomic l ibraries

(BamHl and EcoRl) as described (14). Purified phage were grown In liquid

culture and DNA was purified as described (15).

DMA Sequencing

A 3.5 kb Xbal-EcoRI fragment of ALplHl-1 was subcloned into M13mpl8 and a

series of nested deletions was constructed as described (16). To provide

clones to sequence the opposite strand, restriction fragments of the 3.5 kb

Xbal-EcoRI fragment were subloned Into appropriately cut H13 vectors. For ^.

purpuratus early HI, an 800 bp Smal-EcoRI fragment of pSplO2 (17) was cloned

8122



into H13mpl8. Ml3 clones were sequenced by the dideoxy sequencing technique

(18). DMA and protein sequences were analyzed using the BIONET National

Computer Resource.

Filter Hybridisations

All hybridizations were done in 50Z formamide, 5X SSC, 5X Denhardt's

solution, 50mm sodium phosphate pH 6.8, and 0.1 ng/nl sonicated salmon sperm

DMA (50% formamide hybridization buffer) (15). S_. purpuratus la te HI cDKA

(pJK-1) was hybridized to h. plctus genomic libraries at 37°C in this buffer,

and the f i l t ers were washed at 65°C in 0.5X SSC, 0.1Z SDS, 1Z sodium

pyrophosphate (0.5X wash buffer). Genomic DHA hybridizations were carried out

at 42°C with the addition of 102 dextran sulfate. A nick translated (19)

SspI-EcoRI fragment was used as a probe (figure 1). For northern blots , an

SspI-EcoRI fragsent was subcloned Into pGem2 and the resulting p la said was

linearized with Hind III yielding a 1.2 kb template. The Sp6 probe was made

as described (20) and hybridized to the blot at 58°C In 50Z formamide

hybridization buffer. The blot was then washed at 65°C In 0.5X wash buffer.

Autoradlographlc Intensity was quantltated using a Cambridge Instruments

Quantlnat 920 Image Analysis Systea.

A EH XbXo BS**• ilnlHI-1 Hi JJ iL_XLplHH

BXbXoHSXbEHE XbEH XbXoH B 1 U

XLplHl-2 N^ II I Iff 1 * M I I

°- E HKHI Si SU XbHn SmXo

pLplH-1 M l I I LJLJT _500 bp

Figure 1. Restriction endonuclease maps of DNA segments containing an L .plctus late HI gene. Bars denote hi stone HI coding sequences and arrows thedirection of transcription. Each nap Is aligned such that the l e f t and rightarms of phage DNA are on the l e f t and right of the figure, respectively. Hapswere generated from examination of single and double enzyme digestions ofphage and plasmid DNA. A.) Two overlapping lambda clones containing a late HIgene are shown. ALP1H1-1 was Isolated from an EcoRI generaic library(generously provided by Dr. Eric Davidson) while ALP1H1-2 was Isolated from aBanHl library (8 ) . The map for ALplHl-1 contains only those s i t e s detected byhybridization of pJK-1 to appropriately digested ALplHl-1 DNA. B.) pLplHl-1Is a subclone containing the 3.5 Xho-EcoRI fragment of ALplHl-1 cloned Intothe vector pUC9. The Sspl s i t e was determined from the DNA sequence.Abbreviations used for restriction endonucleases are, B-BamHI, E-EcoRI,H-Hindlll, HII-Hindll, K-Kpnl, S-SacI, Sm-Smal, Ss-Sspl, Su-StuI, Xb-Xbal,Xm-XmnI, Xo-Xhol.

8123



Hours

Figure 2. Accumulation of late HI mRNA during development. A.) RNA wasprepared from embryos at various times after f er t i l i za t ion . This RNA wasfractionated on a 2X agarose gel containing formaldehyde, blotted tonitrocellulose, and probed with an Sp6 transcript complementary to the late HImRNA. B.) Relative autoradiographic ueuoiLiio vsrc determined from this andlonger and shorter exposures of this blot and then plotted.

RESULTS and DISCUSSION

I go la t Ion of a Late HI gene

A pJK-1 cDNA clone encoding a £ . purpuratus late HI protein (13),

wts used to screen several L_. pIctus genomlc l ibraries . Several highly

homologous clones were Isolated. Restriction endonuclease maps were generated

for two of these clones (figure 1), and each appear to be overlapping DNA

segments encoding the same HI gene. Neither clone Is homologous to any of the

core hie tone genes (data not shown). Therefore, the _L. plctus late HI gene,

like the £ . purpuratus Hl-gamma gene (13), Is not tightly clustered with other

his tone genes. In order to further localize the region homologous to pJK-1

a 3.5 Xho-EcoRI fragment of ALplHl-1 was sub cloned and mapped In more detail

(figure 1).

Temporal Expression of Late HI aRNA

When the HI gene encoded by XLplHl-1 i s used to probe a northern blot

containing L_. plctus RNA from several developmental time points, a single RNA

of about 750 nucleotldes that accumulates In a temporal pattern typical of the

late his tone gene family (13,21-23) i s observed (figure 2) . Like the core

late hlstone mRNA a (12) and S . purpuratus Hl-gamma mRNA (13), the L_. plctus

late HI mRNA Is detected in the egg as well as a l l subsequent developmental

stages. Longer exposures clearly show that the HI mRNA detected by this probe

8124



Individual*!

am HI

CD

coRI

UJ

s•DCX

individual #3

XEom

coRI

U l

H•DC

X

Individual #4II . ,

XEom

i—i

oUJ

1

C

X

kb

23.1-

9.4-

6 .6-

4.4-

2.3-2.0-

-.1-

Figure 3. Genoalc organization of I,, plctua late HI genes. Sperm DNA fromthree Individuals was digested with the restriction endonucleases Indicated;the digestion products were separated on a 0.6Z agarose gel , blotted tonitrocellulose, and hybridized to late HI as described In Materials andMethods.

Is the same size as late HI (data not shown). Therefore, this gene encodes a

sonatlc HI protein (either Hl-gamma or Hl-beta) that Is also expressed

whenever the embryonic early HI gene Is active.

Genoalc Organization of the Late HI gene

The late HI gene was used to probe genomlc DNA by Southern blotting

(figure 3 ) . One or two bands were detected with restriction endonucleases

that do not cleave within the HI gene, while three or four fragments were

detected when genomlc DHA Is cut with Hind III , (an enzyne that cleaves within

the HI gene). In the case where three bands are detected (Individuals tl and

#4), one of the bands Is twice as Intense as the other two. This result Is

most consistent with there being only a single Hl-gasuna gene. HindiII cleaves

within Hl-gasma (Figure 1) normally yielding two bands of equal Intensity.

8125



10 20 10 40 SO 60 70TSTTCTCTCA TETTATCTAT CTETTTTTCT SBAAAATATT ATTTTACACA ASATTTCAOC eTTTSTTTTT

SO 90 100 110 120 130 140SSATTTTAAA CT6CCATTGT CAAAOTSTAA aTTTCaAGaT AAATTACTCT CCAATAOAAT AACCATSGTT

1 M 160 170 1S0 1W> 200 210ATTTTTTAAO ATOTCAAOTO AAASATTQAA ASCTCCTCTT TC8TTT0AT8 06TATTTTTTC TCCTTACC6T

USE_U_120 230 240 240 280 270 280

ASCACSAACA ABAAACAAAA ACOATATATT CCAA£A£CTT ACTAA£A£AT CCAAAAA£A£ OATTSCCAAA

200 100 310 320 330 340 350ATACACSOTA CATSTACAAA ACAACCCflCC TCTACACACe CTATASCC8A CTT8ACTeCA TT8TTTTCCC

ISO 370 ISO 380 400 410 420CCACSTCCGC ' n " ' O T T ^ IAIAICTATQ CSATAOCGCS BAAATTSAAC_ATIA£BTTTC TCOCTCACTS

430 440 450 4SSACAACACASC CSSAATCTAT CTCACTCACC ATB TCT SCC SCC AA8 CCA AAA ACC SCA

UET tar All Ala Lyi Pro Lyi Thr All

4S0 4S3 510 925AAS AAB SCC CCT 8CT OCC CCA CCA CAC CCA CCT ACC TCT CAB ATS ETA QTT OCTL y i Lya A H Arg A l l A l l Pro A l l H I . Pro Pro Thr Ssr B i n Uot V i l V . I A H

540 55.5 570 ?»«acr ATC ACC acc CTC AAS BAB COT BET BET TCC TCA AAC CAB sec ATC AAS AAEA l l I I * T h r A l l L « i L y a B l u A r g S l y B l y t a r t a r A a n S i n A l a I l a L y a L y a

800 816 ( 3 0TAC ATC BCT 8CC AAC TAC AAB BTT SAC ATC AAC AAB CAB OCT ACT TTC ATC AABTyr I la A l l A l l Aan Trr Lya Val A m I la Aan Lya Bin Ala Thr Pha I la Lya

S4S 8*0 875 BOOCST BCC CTS AAB 6CT 6flT ETT SCC AAT GET ACC CTC STC CAA ETC AAA SEA AAEArg A l l Lau Lya A H Bly V . I A H A m Bly Thr Lau Val Bin V i l Lya Sly Lya

705 720 718S B A e C C A B T e a A T C T T T C A A e C T C B E C A A a a T C A A a a C T S S C A A S A C C S A S E C Ca i y A l l Sar Ely ta r Pha Lya Lau Sly Lya V . I Lya Ala 8 l y Lya Thr filu A H

750 70S 780 7»5CAB AAS sec car SCT sec sec AAB AAS sec AAB err BCT acc AAS AAS AAS SAASin Lya A l l Arg A l l A H A H Lya Lya Ala Lya Lau Ala A l l Lya Lya Lya Olu

010 825 840 855C A S A A f i e A e A A e A A a S C T C C T A A e A C C A A S S C C A f i e A A B e A e A A A C T A S C C S C Ca m Lya S lu Lya Lya A l l A H Lya Thr Lya A l l Arg Lya e i u Lya Lau A l l A H

870 SSS gooAAeAAcecTecAAAaAASeccaccAAaAAeaTTAAaAAscccacceccAASEccLya Lya Ala Ala Lyi Lya A l l A l t Ly» Lya Vi l Lya Lya Pro AH AH Lya AH

»16 810 945 get)

AABAAaCCAeCTAAEAASSCABCCAAaAAeCCCSCCSCCAASAASaCASCCAABLya Lya Pro A l l L Y . I in AH A l . Lv. I v . p™ A H A I . l y . i , i > i . M . i Y 1

•76 990 1005

AABCCCBCCECTAAeAAaCCABCTAASAASSCCBCCAAaAABCCTSCTBCTAASL»« Prn A l l A l l Lyi Lya Pro A l l Lv« I V . A l l A l l Irn L Y I f ro Ala A l l Lya

1020 1015 1060 \oe>

AAaeCCeCCAABCCASCAAAEAASeCAECCAAEAAECCCeCCaCCAA6AABaCALya Ala A l l Lya Pro A I » m l . i A H A I . L Y . I V . trr, Ala Ala Lya Lya AH

1080 1091 1103 1113 1123 1133SCC AAE AAB TAA ATTCTTASC8 CCACTTEETS TATTSAOCTT TTTCAECTCC ACCCCAACSBAH Lya Lyi .

1141 1U3 1183CTCTTATCAB ACrT-Arry.il ACTTCAAKAA tCAATTr

8126



However, due to the large amount of genomlc polymorphism (41 sequence

difference) seen between Individual sea urchins (24,8) , the two bands of lower

Intensity l ikely result from polymorphism In the flanking HindiII s i t e s .

Consistent with this Is the observation that each of the three Individuals

contain many bands that differ In s i ze . If the Hl-gamma gene were present In

more than one or two copies per haplold genome, polymorphism would have surely

resulted In the generation of a greater number of hybridizing bands as Is the

case with the late core hlstone genes (8 ,9 ) . The faint bands on the

autoradlogran are oust l ikely due to cross-hybrldlzatlon with an HI gene

encoding a different late subtype.

Nucleotlde Sequence of the L. plctus Late HI Gene

The entire late HI coding region and 400 bp of 5' flanking sequence of

ALplHl-1 was then sequenced (figure 4) . The nucleotlde sequence contains an

open reading frame of 209 ami no acids. Based on the overall similarity of Its

prlaary structure to that of other HI proteins, this HI protein probably has the

tripartite structure (nose, head, and ta l l ) typical of this class of hi stones

(25-26). The N-tennlnus of the protein Is a variable region that Is very basic

and rich in alanine and prollne. The central domain Is the most highly

conserved region of HI proteins and has an anlno acid distribution typical of

most globulin proteins while the C-terminus i s extreaely variable In size and

sequence but Is highly basic. Comparison of the I., plctus late HI protein to

Hl-gamna of S_. purpuratus Indicates that the two proteins are only 75Z

homologous. Although they differ significantly In primary sequence, a plot of

the hydropboblclty of the two proteins Is nearly Identical (figure 5) . The two

late HI proteins therefore contain a large number of conservative amlno acid

changes. Like Hl-gamna (13), the L_. plctus late HI C-terminal ta l l does not

contain serlne and Is composed of repeating amlno acid sequences. The

octapeptlde, AKKAAKKP, i s repeated five t ines, linked together by pentapeptldes

similar to those of £• purpuratus Hl-gamma. The large number of lyslne residues

gives this protein a net positive charge of 67.

Examination of the DKA sequences bordering the open reading frame reveals

several conserved sequences that define the 5' and 3' ends of most hlstone

mRNAs. The 5' end of the mRNA Is probably coincident with bp 401, which l i e s in

the middle of a degenerate form of a conserved cap box sequence (CATTAC) seen in

Figure 4. DMA sequence of the L . plctus late HI gene. The derived amlno acidsequence Is shown below the corresponding nucleotlde sequence. Conserved DNAsequences are underlined and discussed In the text. The mRNA cap s i t e Isdenoted by an arrow.

8127



x -i .

IBB

A mi no Acid

Figure 5. Comparison of the hydrophoblcltles of the protein encoded by the L .pIctus late HI gene to £ . purpuratus Hl-gamma. Hydrophoblclties werecalculated using the parameters of Kyte and Doollttle (38) and plotted using aTextronlcs graphics plotter.

many sea urchin hi stone genes (27 ,4) . The 3' end of the non-polyadenylated oRNA

Is assumed to be at the adenlne residue at bp 1152, following a highly conserved

region, capable of forming a hairpin loop, observed at the 3' end of many sea

urchin hlstone mRNA a (4) . Therefore, this late HI gene probably encodes a

transcript of 752 nucleotides. Downstream of the mRNA Is another conserved

elenent, CAAGAAAGA, which appears to be necessary for the binding of U7 snRNPs

Involved In the processing of the 3' end of the mRNA (28).

Comparison of the nucleotlde sequence of the L. plctus late HI gene to

the £ . purpuratus Ul-ganma gene (13), reveals that the two genes are 801

homologous In their coding regions. The nucleotlde sequence homology

comparable to the affllno acid sequence conservation reflects a bias In codon

usage In the genes of these two species. When the 5' upstream regions

(to -375) of these two genes are compared they are 77Z homologous over the

entire region, with long sequences of near 1001 homology (figure 6 ) . This Is

quite suprlslng as these two sea urchin species diverged froo a common

ancestor more than 65 million years ago (29). The Hl-speclflc upstream

8128



* •» • .« • • • • •» « «- 3 7 3 TTTTCGGGAAAACGTTITTAATA--TAAGATATT-GGCGTTrATTTTCGGATTTrAAABT- 3 7 6 TTTTCTGGAAAATATTATT-TTACAaUl6AT-TTCAGCBTTTGTTTTTG6ATTTTAAAGT

MMM MM

S. p. GC-ATTGTCAAAGTGTAA8TTTCGTGeTAAATTTCTCTATGATGAAATAATTATGTATGAL. p. GCCATTGTCAAAGTGTAAGTTTC6AGgrAAATTACTCTCCAATAGAATAACCAT6-GTTA

CTTTTAAGG-TGCCAAGTGGAACATTGAAAGCTCCTCTTGATTT-GAGfiflTATTTT--CATTTTTTAAGATGTCAAGTGAAAGATTGAAAeCrCCTCTTTCGTTTGATGGTATTTTTTCT

CCAGTTTTGATTTAGC-CAA-CAAAAGAGAAAAACAATATTTTCCAACACCTTACTAACAC--G—TTACCGTAGCACGAACAAGAAAGAAAAACGATATATTCCAACACCTTACTAACA

USE II USE I

CATTTAAAAACACGATTGCCAAAATACACACTACGTGCACAAAACAABCGGGCTGTACACCATCCAAAAACACGATTGCCAAAATACACGfiTACATGTACAAAACAAGCGfiGCTGTACAC

GTCCTACGGGCGACCTCACCGTACCGTTTTCCCCCACGTCCGCAAeAA—CGTTATAT—ACCCTATAGGCGACTTGACTGCATTGTTTTCCCCCACGTCCGCAAAAAGGCGATATATCT

ATGCCCGAGAAGCCGCGGAAATCAAACATTACQATTTTTGTTGA +17ATGGG—A-TAG-CGCG6AAATTGAACATTACGTTTCTCGCTCA

RNA START

Figure 6. 5' upstream homology of the L. plctua late HI gene and the £ .purpuratus Hl-ganoa gene. The underlined sequences are discussed In thetext. The top sequence Is that of the £ . purpuratua Hl-gamma gene and thebottom the L . plctus late HI. (*) denote mismatched bases between the twosequences and an arrow denotes the mRNA start s i te for the £ . purpuratus genedetermined by SI nuclease analysis (13).

sequence elements (USE elements) 1 and II (30,31) that are found In the S_.

purpuratus Hl-ganma gene (13) are 100X conserved In the L. plctus late HI

gene. A core sequence of element II (AACAC) Is repeated upstream twice oore,

within a 62 bp conserved region, with the same phasing In both late genes.

Further upstream In a region of high homology between the two genes are three

copies per gene of a 10 nucleotlde consensus sequence, GTGGAAGATT. This

sequence Is s lul lar to the core consensus sequence (GGTGTGGAAAG) derived from

several enhancer elements (32). This Is quite different from what Is known

about 2 non-allel lc pairs of late H3 and H4 genes from _L. plctus. When the

sequences of these genes are compared the coding regions are 96Z homologous,

but the 5* flanking sequences are l ess than 40Z homologous, with the exception

of short DSE homologles (11). The large degree of sequence conservation

8129



10 20 30 40 SOGGATATTAGG GTSACCATeC AGGGCAAAAT ATTATCTTTT TAGTCSGCAT

80 70 80 90 100ATTAATSCSA AACTATGAAT ATSCAATTTC CCATGAATTT CAA6A6GGGT

110 120 130 140 1S06ACGATCAGG GGTTGATGGT GTTATCGCCA TTTGATTTCA TTTTTTTCTT

100 170 180 190 200CAAATTCATA TAATGATTSA GTACATTATA CGTGGTAGGA GAGGATGAAG

210 220 230 240 2S0AAOAAQAGGQ ATGAGAAGAA GACGGAGAAA GAGAAGAAGG A8AAGGCGGT

260 270 280 2S0 300GGTGGAATAA GASCATGTAT GGATGGAAAA GAAfiGGAGAA AAGTTTCTTT

USE II USE I310 320 330 340 350

AAACAAACAC AAACTQCCAA TCCACTCATC acfiCCaflACC ACCCGGGACT

380 370 380 3«0 400QTCTCCTCCC ACCTACOCAA CAATCCCTTA T^TTGACCQT TGCCSAGCCG

410AT6CTTA.TTC

Figure 7. DNA sequence of the 5' flanking region of the £ . purpuratuaHl-alpha gene. The underlined sequences are discussed In the text. The DNAsequence from bp 345 to bp 410 was determined by Sure» et al (27).

upstream of the late HI genes indicates that some of these sequences oust be

crucial to the functioning of these genes.

To determine whether these striking homologles were a common feature of

sea urchin hi stone HI genes or specific to the late ganes, the 5' upstream

region of an Hl-alpha (early) gene was sequenced (figure 7) . The upstream

sequence element IX of the early gene contains only one copy of the AACAC

sequence, in the middle of a complete USE II . This DSE II Is 521 homologous

to tha consensus sequence of Perry et al (TTTTGAGACTCTAGAAACACAGACTG) (31).

The upstream region of this gene also has an upstream sequence element I that

Is similar to the consensus sequence (61Z) (ATGGGCGGGGT) (31). Both the DSEs

of this gene are 1001 homologous to the shorter consensus sequence of Coles

and Wells (USE I-GGGCGG; USE II-AAACACA) (30). Within the USE I there i s a

potential Spl transcription factor binding s i t e (GGGCGG) (33), which Is not

present in the USE I of the late HI genes. One additional sequence that Is

shared between the early and late HI genes Is a 16-mer (consensus;

CCCACGTNCGCAANAA) centered at -45 (between the TATA box and USE I) that Is 88Z

conserved between the early and la te HI genes. This appears to be a sea

urchin specific sequence. The upstreao sequence of the early HI contains no

other regions of homo logy to the two late HI genes, but does contain two long

8130



purlne rich regions. The f i r s t of these Is just upstream of USE II and

consists of 19 consecutive purlnes (bp 275-293). Further upstream, there Is a

region that Is 63 nucleotldes In length that contains 95Z purlnes (bp

187-249).

In one model for the differential temporal expression of multlgene

families during developoent, different members of the gene family compete for

Halt ing amounts of shared positive transcription factors (34). As

development proceeds, ce l l division exponentially Increases the number of

genes In the embryo, but the quantity of transcription factor remains constant

or declines. The genes best able to compete for the limiting quantities of

transcription factors are able to form stable transcription complexes and

therefore continue to be expressed later In development. The Xenopus 5S gene

ays ten Is the best documental example of this type of regulation (34).

If one aspect of the early/ late hlstone gene switch entails competition

for common transcription factors (34), then either a greater number of binding

domains (35), or binding domains of higher aff inity for regulatory oolecules

would be predicted to occur within the late gene consensus sequences. The

OSE I and II regions or the 16-oer centered at position -45 are logical

candidates for binding domains of coamon regulatory proteins. Consistent with

this hypothesis, the late HI genes contain three copies of a sequence, AACAC,

In DSE II , whereas the early HI gene contains only one copy of this sequence.

Conpetltlon for a single shared transcription factor goes a long way to

explaining the mechanism of the late gene switch, however, several aspects of

the early to late hlstone gene transition during eabryogenesls are

Inconsistent with a simple nodal where one positive transcription factor

becomes Halt ing during embryogenesls. The nost sal ient observation that Is

Inconsistent with this model Is the a 5-6 fold Increase In the relative rate

of transcription of the late genes between 7 and 14 hours post-fertl l lxatlon

(12). Two gene families competing for a gene specif ic transcription factor,

as In the case of the 5S genes (34), would be either transcribed or s i lent but

the rate of transcription would not be modulated. It Is reasonable to assume

that the late genes contain at least one sequence not present In the early

genes that serves either as a s i t e for a negative regulator that H a l t s the

transcription rate until early bias tula or for an additional late gene

specific positive transcription factor appearing at early bias tula (7-14 hrs.

pos t - fer t i l i sa t ion) . The three repeated copies of the late gene specific

consensus sequence GTGGAAGATT, or any of the other hooologles shared between

the I-. plctus and £ . purpuratuB late HI genes represent candidates for such

8131



cis-icting sequences. Site directed mutageneais of these conserved DNA

sequences followed by assays In sea urchin In vitro transcription systems (36)

or transient expression In embryos following Injection Into sea urchin eggs

(37) should Identify these els acting regulatory sites.

ACKNOWLEDGEMENTSWe would l i k e to thank E r i c Davidson f o r p r o v i d i n g the EcoRI genomlc

l i b r a r y of L_. p l c t u s DNA and to Ken Krauter f o r h e l p f u l comments. T h i s workwas s u p p o r t e d by g r a n t #GM30333 from the NIH. Jim Knowles I s suppor ted by ap r e d o c t o r a l M.D. /Ph .D . t r a i n i n g g r a n t NIH g r a n t # T32GH7288. Computerr e s o u r c e s p r o v i d e d by t h e BIONET N a t i o n a l Computer Resource f o r M o l e c u l a rB i o l o g y whose funding I s p r o v i d e d by NIH g r a n t f 1U41 RR-01685.

T o whom correspondence should be addressed

REFERENCES1 . Conn, R . H . , Lowry, J . C . , and K e d e s , L.H. ( 1 9 7 6 ) . C e l l 9 , 1 4 7 - 1 6 1 .2 . S c h a f f n e r , W., G r o s s , K . , T e l f o r d , J . , and B l r n s t l e l , M. ( 1 9 7 6 ) . C e l l 8 ,

471-478.3. Kedes, L.H. (1979). Ann. Rev. Blocheo. 45, 537-070.4. Hentschel, C.C. and Blrnstlel , M.L. (1981). Cell 25, 301-313.5. Cohn, R.H. and Kedes, L.H. (1979). Cell 18, 843-853.6. Cohn, R.H. and Kedes, L.H. (1979). Cell 18, 855-864.7. Holt, C.A. and Chllds, G. (1984). Nucleic Acids Res. 12, 6455-6471.8. Chllds, G., Nocente-McGrath, C., Lelber, T., Holt C , and Knowles, J.

(1982). Cell 31, 383-393.9. Maxson, R., Mohun, T. , Gromeiano, G., Chllds, G., Kedes, L. (1983).

Nature 301, 120-125.10. Kaumeyer, J.F. and Welnberg, E.S. (1986). Nucleic Acids Res. 14, 4557-

4576.11. Roberts, S.B., Weisser, K.E., and Chllds, G. (1984). J. Mol. Blol. 174,

647-662.12. Knowles, J.A. and Childs, G. (1984). Proc. Nat. Acad. Scl. 81,

2411-241513. Knowles, J.A., Lai, Z.C. and Chllds, G. (1986). Mol. & Cell B lo l . ,

submitted.14. Benton, W.D. and Davis, R.W. (1977). Science 196, 180-183.15. Maniatls, T., Fritsch, E.F. and Sambrook, J. (1982). "Molecular Cloning:

A Laboratory Manual." Cold Spring Harbor Laboratory, Cold SpringHarbor, New York.

16. Dale, R.M.K., McClure, B.A., and Houchins, J.P. (1985). Plasmld 5,31-40.

17. Sures, I . , Lowery, J . , and Kedes, L.H. (1978). Cell 15, 1033-1044.18. Sanger, F.S. , Nlcklen, S . , and Coulson, A.R. (1977). Proc. Nat. Acad.

Scl. 74, 5463-5467.19. Rigby, C.W., Dleckaann, M., Rhodes, C , and Berg, P. (1977). J. Mol.

Biol. 113, 237-251.20. Melton, D.A., Krleg, P.A., Rebagllatl, M.R., Maniatls, T., Zlnn, K., and

Green, M.R. (1984). Nucleic Acids Res. 12, 7035-7056.21. Rudernan, J.V. and Gross, P.R. (1974). Dev. Blol. 36, 286-298.22. Cohen, L.H., Newrock, K.M. and Zweldler, A. (1975). Science 190, 994-997.23. Chllds, G., Maxson, R. and Kedes, L.H. (1979). Dev. Biol. 73, 153-173.24. Britten, R., Etton, A., and Davidson, E. (1978). Cell 15, 1175-1186.

8132



25. Bustln, M. and Cole, R.D. (1968). J. Blol. Chem. 243, 4500-4505.26. Hartnan, P.G., Chapman, T.M., and Bradbury, E.M. (1977). Eur. J. Blochem.

77, 45-51.27. Sures, I . , Levy, S. , and (Cedes, L.H. (1980). Proc. Nat. Acad. Set. 77,

1215-1269.28. Strub, K., Gall l , G., Bussllnger, M. , and Birnetiel , H.L. (1984). EMBO

Journal 3, 2801-2807.29. Snlth, A.B. (1981). Paleontology 24, 779-801.30. Coles, L.S. and Wells, J.R.E. (1985). Nucleic Acids Res. 13, 585-594.31. Perry, M., Thomson, G.H. and Roeder, R.G. (1985). J. Mol. Biol. 185,

479-499.32. Khoury, G., and Gruss, P. (1983). Cell 33, 313-314.33. Dynan, W.S. and Tjlan, R. (1985). Nature 316, 774-778.34. Brown, D.D. (1984). Cell 37, 359-368.35. Reeder, R.H. and Roan, J.A. (1984). 38, 39-44.36. Morris, G.F., Price, D.H. and Marxluff, W.F. (1986). Proc. Nat. Acad.

S c l . 83, 3674-3678.37. McMahon, A.P., Novak, R.T., Britten, R.J. and Davidson, G.S. (1984).

Proc. Nat. Acad. Scl. 81, 7490-7494.38. Kyte, J. and Dool l t t le , R.F. (1982). J. Mol. Blol. 157, 105-132.

8133


Comparison of the late HI histone genes of the sea urchins ...

Documents

Transcript of Comparison of the late HI histone genes of the sea urchins ...