Comparative analysis of gene expression regulation in mouse,

rat and human

By Constantina Mylona

BSc. Human Biology

Spring 2016

Project Supervisor: Dr.K.Felekkis, Department of Life Health Sciences, School of Sciences and Engineering

University of Nicosia

Outline Introduction Animal model Importance Gene Expression CRISPR/Cas 9 Materials and Methods Cell line Selection Mutation-Disease Selection Target sequence design

Results Human, mouse and rat Cell line Mutation Design of the Target sequence Discussion Summary Future Work Limitations

The aim of this work is to show that mouse is not the most suitable model for human

diseases

Introduction Animal modeling is non-human animal used to investigate a disease

Animal Model Importance Animal modeling is important for basic research: much of our knowledge about

the molecular events in embryological development is held in drosophila studies. Animal modeling is important for biomedical research: animal experimentation

has helped in comprehension of a biological process and the major cause of a disease.

Animal modeling is important for clinical research: a new drug before being released to the market it undergoes a preclinical study phase where, with animal testing evaluates the drugs’ efficacy, toxicity, pharmacokinetics and pharmacodynamics

1. Short life cycle2. Small size3. Easy to handle4. Have similar anatomical and biological

features to humans 5. Have high degree of DNA similarity6. Affected by human diseases 7. Unethical to expose human beings to

health risks in order to develop a new drug

The Rattus-norvegicus – Norway rat. At http://www.bibsnbobs.co.uk/triviafile/mamclips/BrownRat.jpg

Mus-musculus – House mouse. At ttps://c2.staticflickr.com/4/3206/3130915987_353af56089_b.jpg

Animal experimentation is feasible due to :

Gene expression and regulation Gene Expression is the Central Dogma

of Biology: transcription of DNA to mRNA and then translation of mRNA into protein

The conversion of DNA to mRNA and then to protein. At http://www.ignyc.com/wp-content/uploads/2012/11/transcription-translation.png.

Gene expression regulation involves:

a. Activator proteins that bind to enhancer regions allowing transcription

b. Suppressor proteins that bind to enhancer regions not allowing activator proteins to interacts with them thus heterochromatin structures are favoured

c. Chromatin Modifications like methylation, hydroxylation formylation and carboxylation lead to gene silencing

d. Epigenetic changes involve cross talk of histone modifications favouring either turning ‘‘on’’ or ‘‘ off ’’ genes

e. Non-coding RNAs including siRNAs and miRNAs are 18-25nts long promote gene silencing by inducing mRNA degradation and inhibition of translation respectively

The CRISPR/Cas 9 system.

(Yang, 2015)

The Clustered Regular Short Interspaced Palindromic Repeats/Cas Associated Sequences 9 System

Material and methods

Cell line selection- there was an inquiry from ATCC Company, ThermoFisher and Applied biological Materials. All cell lines had to be of the same origin, same type and with fewer as possible genetic variations

Mutation-Disease selection- A monogenic disease common to all three species, with a clear quantifiable cellular phenotype mean time there was a search on animal blood disease ,where in that case patient’s blood sample would be used instead of human cell line

Target Sequence Design- designing of the target sequence for the desired mutation based on literature review, while the construction of it was done using Blueheronbio the Gene synthesis Company an OriGENE company and CRISPR manual provided by the OriGENE technology Inc.

Results Human mouse and rat Share a common ancestor of 195 million

years old and in 162million years ago years later the rodents have evolved from a lagomorph like ancestor

Equally affected by Age Related Hearing Loss, respiratory diseases, metabolic syndromes, neurodegenerative disease, brain disorders and cancer

Have different physiological, anatomical and genomic characteristics

The evolution of rodents At http://sysbio.oxfordjournals.org/content/55/6/936/F6.medium.gif

Rodents used and compared for modeling human diseases

Animal modeling with genome editing tools: ZFNs, TALENs and CRISPR/Cas 9

Rats preferred over mice for mechanistic behavioral and quantitative genetic studies due to their larger body size and more complex behavior

8.Are there Normal cell lines ?

9. Are there hTERT cell lines ?

10. Are there iPSCs lines ?

12. Are there primary cell lines?

13.Are there Immortalised cell lines

?

Yes

Yes

No

Yet rejected due to their limiting life span

Immortalised hepatocytes with SV40 T large Ag

11. Are there stem cell lines ?

No

Cell line

No

No

Mutation Cystic Fibrosis was rejected due to not sufficient literature review on hepatic

cells. Animal blood diseases Thalassemia, Sickle cell anemia and hereditary

Spherocytosis because of no available cell lines from ATCC and Applied Biological Materials.

Lysosomal Acid lipase Deficiency was rejected as in vitro studies included fibroblasts, pancreatic B-cells, macrophages and iPSCs, which in turn were transformed into macrophages.

The final choice: The Z variant of the Alpha 1 Antitrypsin enzyme, which is associated with a more severe clinical manifestation of the Alpha 1 Antitrypsin Deficiency (A1ATD)

An autosomal recessive disorder affecting both lungs and liver, characterized of low A1AT serum levels (<150-300mg/dl) and a high frequency in Caucasians with European descent.

In humans and rats the disease arises from a mutation in the SERPINA 1 gene where as for mouse the mutation occurs at the SERPIN 1-C gene.

A1ATD patients develop emphysema due to no neutrophil elastase inhibition and liver damage due to the accumulated A1AT protein levels.

The Z variant is strongly associated with the more severe clinical implications of he deficiency and accounts for the accumulated Z A1AT. The hepatocytes are Periodic acid-Schiff (PAS) positive and resistant to diastase digestion

Therapies include delivery of synthesized enzyme and functional enzyme from donors.

The Globule containing and globule devoid mouse hepatocytes from transgenic PiZ mice (Khan, 2016)

A1ATD

A1AT gene

The A1AT gene in (A) Human, (B)Mouse and (C) Rat(Chromosome 14: 94,367,747- 94,390,637 - Region in detail – Homo Sapiens – Ensembl genome browser 84, 2016) ; (Chromosome 12: 103,895,007 – 103,896,003 – Region in detail – Mus Musculus – Ensembl genome browser 84, 2016) and Transcript: Serpina 1 – 201 (ENSENOT 00000012577) – Protein summary – Rattus norvegicus – Ensembl genome browser 84, 2016

The A1AT structure and function: The inhibitory action of A1AT. The PI1-PI (Met 358-Ser 359) residue is cleaved, the RCL is accepted by the β-sheet strand entrapping the serine or cysteine protease.

(Nyon et al., 2015; Pearce et al., 2008; Serpins, Serpinopathies, and Conformational Diseases, 2015)

A1AT structure and Function

The genomic sequence of A1AT on chromosome 14: highlighted in grey the sequence used as to create the gRNA vectors(Homo sapiens serpin family A member 1 (SERPINA1), RefSeqGene on chromo - Nucleotide - NCBI, 2016)

The Target Sequence

Forward

5’gatcgGTGCTGACCATCGACGAGAA3’

Reverse Complement

3’aaaac TTCAGTCCCTTTCTCGTCGA 5’

Discussion Report of the anatomical, physiological and genomic differences

between the three species Raised questions like whether the two rodents are affected by human

diseases, have they been used as animal models, compared and even been subjected to the latest genome editing tools.

The final cell line choice was the the Immortalized Hepatocytes SV4O Large Antigen

The mutation was the Z A1AT. The two target sequences 5’gatcgGTGCTGACCATCGACGAGAA3’ and

3’aaaac TTCAGTCCCTTTCTCGTCGA 5’ had 0 mismatch for human SEPINA 1but with no full or no identity for the two rodents

The two constructs for CRISPR/Cas genome editing

(OriGene Technologies Inc., 2011) 

Future Work

Limitations Limited number of literature stating clearly that mouse is not the best model. Limited literature review for a disease of a clear and quantifiable cellular phenotype Cell line choice - immortalized hepatocytes with SV40L as a method of

immortalization. The ideal would be a normal phenotype cell line common to all three species

A1AT gene is not the same for all three species Construction of gRNA and the donor template vector would mean to use the whole

human gene as to achieve the generation of the Z variant in both rodents, giving rise to the question as to whether this is feasible.

Acknowledgments

My deepest gratitude to my supervisor Dr.K.Felekkis. I have been very fortunate to have a supervisor, who gave me the freedom to explore the theme of this project on my own and at the same time guiding me along the way, as to achieve the best as possible. I am indebted to him for his patience and encouragement throughout this work. His introduction to modern genomics and bioinformatics course and knowledge have greatly helped me for completing the thesis.

Last but not least I would like to thank my family and friends for their enormous support and understanding they have given me over these four years.

References

Ades, E., n.d. Species Specific Information: Mouse. [online] Web.jhu.edu. Available at: <http://web.jhu.edu/animalcare/procedures/mouse.html> [Accessed 14 Feb. 2016].

Aida, T., Imahashi, R. and Tanaka, K., 2013. Translating human genetics into mouse: The impact of ultra-rapid in vivo genome editing. Development, Growth & Differentiation, [online] 56(1), pp.34-45. Available at: <http://onlinelibrary.wiley.com/doi/10.1111/dgd.12101/abstract> [Accessed 16 Mar. 2016].

Alberto Mendoza, A., 2010. Rat Anatomy and Biology

Alopez, 2013. OMIM Allelic Variants - 107400. [online] Omim.org. Available at: <http://www.omim.org/allelicVariant/107400> [Accessed 9 Apr. 2016].

Animalresearch.info, 2015. Read the four main reasons why animals are used in medical research. [Online] Available at: <http://www.animalresearch.info/en/designing-research/why-animals-are-used/> [Accessed 27 Nov. 2015].

Alpha 1 Foundation, 2016.| Alpha1.org. [Online] Alpha1.org. Available at: <http://www.alpha1.org/> [Accessed 4 Apr. 2016].

Alpha 1 Foundation, 2016. Treatment. [Online] Alpha1.org. Available at: <http://www.alpha1.org/Newly-Diagnosed/Living-with-Alpha-1/Treatment> [Accessed 15 Apr. 2016].

Asia. Ensembl.org, 2016. Chromosome 14: 94,376,747-94,390,637 - Region in detail - Homo sapiens - Ensembl genome browser 84. [Online] Available at: <http://asia.ensembl.org/Homo_sapiens/Location/View?db=core;g=ENSG00000197249;r=14:94376747-94390637;t=ENST00000440909> [Accessed 11 Mar. 2016]

Asia. Ensembl.org, 2016. Chromosome 12: 103,895,007-103,896,003 - Region in detail - Mus musculus - Ensembl genome browser 84. [Online]. Available at: <http://asia.ensembl.org/Mus_musculus/Location/View?db=core;g=ENSMUSG00000079015;r=12:103895007-103896003;t=ENSMUST00000074051> [Accessed 13 Mar. 2016].

Asia. Ensemble.org, 2016. Transcript: Serpina1-201 (ENSRNOT00000012577) - Protein summary - Rattus norvegicus - Ensembl genome browser 84. [Online]. Available at: <http://asia.ensembl.org/Rattus_norvegicus/Transcript/ProteinSummary?g=ENSRNOG00000032669;r=6:127610243-127620296;t=ENSRNOT00000012577> [Accessed 12 Mar. 2016

Berg, J., Tymoczko, J. and Stryer, L., 2012. Biochemistry. Basingstoke: Palgrave Macmillan. Pp.469-507.

Bestor, T., Edwards, J. and Boulard, M., 2014. Notes on the role of dynamic DNA methylation in mammalian development. Proceedings of the National Academy of Sciences, 112(22), pp.6796-6799.

Blueheronbio, 2012. Guide RNA Target Design Tool... [online] Available at: <https://wwws.blueheronbio.com/external/tools/gRNASrc.jsp> [Accessed 5 May 2016].

BOLMER,, S. and KLEINERMAN, J., 1986. Isolation and Characterization of a,--Antitrypsin in PAS-Positive Hepatic Granules from Rats With Experimental a, -Antitrypsin Deficiency. Am J Pathol., [online] 123(2), pp.377-389. Available at: <http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1888309/pdf/amjpathol00158-0193.pdf> [Accessed 14 Jan. 2016].

BOOTH, C et al., 2010. WAG-F8m1Ycb rats harboring a factor VIII gene mutation provide a new animal model for hemophilia A. Journal of Thrombosis and Haemostasis, [online] 8(11), pp.2472-2477. Available at: <http://onlinelibrary.wiley.com/doi/10.1111/j.1538-7836.2010.03978.x/epdf> [Accessed 6 Mar. 2016].

Brantly, M., Nukiwa, T. and Crystal, R., 1988. Molecular basis of alpha-1-antitrypsin deficiency. The American Journal of Medicine, [online] 84(6), pp.13-31. Available at: <http://www.sciencedirect.com/science/article/pii/0002934388901544> [Accessed 7 Jan. 2016].

Cai, M. and Yang, Y., 2014. Targeted Genome Editing Tools for Disease Modeling and Gene Therapy. CGT, [online] 14(1), pp.2-9. Available at: <http://www.ingentaconnect.com/content/ben/cgt/2014/00000014/00000001/art00002> [Accessed 20 Mar. 2016].

Castel-Branco, M., Alves, G., Figueiredo, I., Falcao, A. and Caramona, M., 2009. The maximal electroshock seizure (MES) model in the preclinical assessment of potential new antiepileptic drugs. Methods and Findings in Experimental and Clinical Pharmacology, [online] 31(2), p.101. Available at: <https://estudogeral.sib.uc.pt/bitstream/10316/11809/1/mf310101.pdf> [Accessed 7 Mar. 2016].

Chan, Y., Göke, J., Ng, J., Lu, X., Gonzales, K., Tan, C., Tng, W., Hong, Z., Lim, Y. and Ng, H., 2013. Induction of a Human Pluripotent State with Distinct Regulatory Circuitry that Resembles Preimplantation Epiblast. Cell Stem Cell, [online] 13(6), pp.663-675. Available at: <http://www.sciencedirect.com/science/article/pii/S1934590913005067> [Accessed 2 Dec. 2015].

Chao, S., Chai, K., Chao, L. and Chao, J., 1990. Molecular cloning and primary structure of rat .alpha.1-antitrypsin. Biochemistry, [online] 29(2), pp.323-329. Available at: <http://www.ncbi.nlm.nih.gov/pubmed/2302382> [Accessed 6 Apr. 2016].

Chen, A., Nishimoto, K., Nanba, K. and Rainey, W., 2015. Potassium channels related to primary aldosteronism: Expression similarities and differences between human and rat adrenals. Molecular and Cellular Endocrinology, [online] 417, pp.141-148. Available at: <http://www.sciencedirect.com/science/article/pii/S0303720715300770> [Accessed 14 Oct. 2015].

Chui, Y, Rana, M.T (2002) RNAi in human cell: Basic structural & functional features of small interfering RNA. Molecular cell. 10. p.549- 561

CHIU, Y., 2003. SiRNA function in RNAi: A chemical modification analysis. RNA, 9(9), pp.1034-1048.

Cho, S., Kim, S., Kim, J. and Kim, J., 2013. Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat Biotechnol, [online] 31(3), pp.230-232. Available at: <http://www.nature.com/nbt/journal/v31/n3/full/nbt.2507.html> [Accessed 2 Dec. 2015].

Churakov, G., Sadasivuni, M., Rosenbloom, K., Huchon, D., Brosius, J. and Schmitz, J., 2010. Rodent Evolution: Back to the Root. Molecular Biology and Evolution, [online] 27(6), pp.1315-1326. Available at: <http://mbe.oxfordjournals.org/content/27/6/1315.full.pdf+html> [Accessed 13 Feb. 2016].

Dycaico, M., Grant, S., Felts, K., Nichols, W., Geller, S., Hager, J., Pollard, A., Kohler, S., Short, H., Jirik, F. and et, a., 1988. Neonatal hepatitis induced by alpha 1-antitrypsin: a transgenic mouse model. Science, [online] 242(4884), pp.1409-1412.Abstract Available at: <http://www.sciencemag.org/content/242/4884/1409.long> [Accessed 8 Jan. 2016].

Dweep, H., et al., 2015. Homo sapiens exhibit a distinct pattern of CNV genes regulation: an important role of miRNAs and SNPs in expression plasticity. Sci. Rep., [online] 5, p.12163. Available at: <http://www.nature.com/articles/srep12163> [Accessed 13 Oct. 2015].

Egger, G., Liang, G., Aparicio, A. and Jones, P., 2004. Epigenetics in human disease and prospects for epigenetic therapy. Nature, 429(6990), pp.457-463.

Fda.gov, 2015. Step 3: Clinical Research. [Online] Available at: <http://www.fda.gov/ForPatients/Approvals/Drugs/ucm405622.htm#The_Investigational_New_Drug_Process> [Accessed 4 Dec. 2015].

Ensembl, 2016. Gene: SERPINA1 (ENSG00000197249) - Paralogues - Homo sapiens - Ensembl genome browser 84. [Online] Asia.ensembl.org. Available at: <http://asia.ensembl.org/Homo_sapiens/Gene/Compara_Paralog?db=core;g=ENSG00000197249;r=14:94376747-94390637;t=ENST00000440909> [Accessed 4 Apr. 2016]

Ensembl, 2016. Transcript: Serpina1a-002 (ENSMUST00000085056) - Summary - Mus musculus - Ensembl genome browser 84. [Online] Asia.ensembl.org. Available at:<http://asia.ensembl.org/Mus_musculus/Transcript/Summary?db=core;g=ENSMUSG00000066366;r=12:103853591-103863551;t=ENSMUST00000085056> [Accessed 5 Apr. 2016].

Fra, A., Gooptu, B., Ferrarotti, I., Miranda, E., Scabini, R., Ronzoni, R., Benini, F., Corda, L., Medicina, D., Luisetti, M. and Schiaffonati, L., 2012. Three New Alpha1-Antitrypsin Deficiency Variants Help to Define a C-Terminal Region Regulating Conformational Change and Polymerization. PLoS ONE, [online] 7(6), p.e38405. Available at: <http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0038405> [Accessed 12 Apr. 2016].

Frankel, W., 2009. Genetics of complex neurological disease: challenges and opportunities for modeling epilepsy in mice and rats. Trends in Genetics, [online] 25(8), pp.361-367. Available at: <http://www.cell.com/trends/genetics/abstract/S0168-9525%2809%2900134-6?_returnURL=http%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS0168952509001346%3Fshowall%3Dtrue> [Accessed 28 Nov. 2015].

Frye, J., Ananthanarayanan, R. and Modha,, D., 2007. BBC NEWS | Technology | Mouse brain simulated on computer. [online] Newsvote.bbc.co.uk. Available at: <http://newsvote.bbc.co.uk/mpapps/pagetools/print/news.bbc.co.uk/2/hi/technology/6600965.stm> [Accessed 22 Dec. 2015].

Green, E., 1966. Biology of the laboratory mouse. New York: Blakiston Division, McGraw-Hill.

Guenet, J., Benavides, F., Panthier, J. and Montagutelli, X., n.d. Genetics of the mouse. Berlin: Springer, pp.268-273.

Gulinello, M., 2016. /Rodent-Estrous-Cycle. 1st ed. [ebook] New York: Albert Einstein College of Medicine, pp.1-7. Available at: <http://www.biobserve.com/downloads/maria-gulinello/Rodent-Estrous-Cycle.pdf>

[Accessed 3 Feb. 2016].

Guo, S et al 2013. Antisense oligonucleotide treatment ameliorates alpha-1 antitrypsin–related liver disease in mice. Journal of Clinical Investigation, [online] 124(1), pp.251-261. Available at: <http://www.jci.org/articles/view/67968> [Accessed 9 Jan. 2016].

Gupta, R. and Musunuru, K., 2014. Expanding the genetic editing tool kit: ZFNs, TALENs, and CRISPR-Cas9. Journal of Clinical Investigation, [online] 124(10), pp.4154-4161. Available at: <http://www.jci.org/articles/view/72992> [Accessed 18 Mar. 2016].

Ha, M. and Kim, V., 2014. Regulation of microRNA biogenesis. Nature Reviews Molecular Cell Biology, [online] 15(8), pp.509-524. Available at: <http://www.nature.com/nrm/journal/v15/n8/full/nrm3838.html> [Accessed 27 Nov. 2015].

https://www.abmgood.com/Immortalized-Hepatocytes-SV40-T0050.html

https://www.abmgood.com/Immortalized-Mouse-Hepatocytes-SV40-T0101.html

https://www.abmgood.com/Immortalized-Rat-Hepatocytes-SV40-T0078.html#references

http://www.bibsnbobs.co.uk/triviafile/mamclips/BrownRat.jpg

https://c2.staticflickr.com/4/3206/3130915987_353af56089_b.jpg

http://www.korambiotech.com/upload/bbs/2/CRISPR%20manual.pdf

http://www.ignyc.com/wp-content/uploads/2012/11/transcription-translation.png.

http://sysbio.oxfordjournals.org/content/55/6/936/F6.medium.gif

Jayaraj, A., 1988. Alpha-l-antitrypsin hepatic cell globules in autotransplanted liver of rats. Br J Exp Pathol, [online] 69(2), pp.321–326. Available at: <http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2013218/?page=3> [Accessed 22 Jan. 2016].

Jiang, F. and Doudna, J., 2015. The structural biology of CRISPR-Cas systems. Current Opinion in Structural Biology, [online] 30, pp.100-111. Available at: <http://www.sciencedirect.com> [Accessed 2 Dec. 2015].

Khan Z (2016) Pathogenesis of Alpha-1 Antitrypsin Deficiency in the Liver: New Approaches to Old Questions. J Liver Res Disord Ther 2(2): 00023. DOI: 10.15406/jlrdt.2016.02.00023

Lomas, D., 2004. 1-Antitrypsin deficiency * 4: Molecular pathophysiology. Thorax, [online] 59(6), pp.529-535. Available at: <http://www.thoraxjnl.com> [Accessed 10 Apr. 2016].

Ma, Y., Shen, B., Zhang, X., Lu, Y., Chen, W., Ma, J., Huang, X. and Zhang, L., 2014. Heritable Multiplex Genetic Engineering in Rats Using CRISPR/Cas9. PLoS ONE, [online] 9(3), p.e89413. Available at: <http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0089413> [Accessed 23 Mar. 2016].

Makarova, K., Haft, D., Barrangou, R., Brouns, S., Charpentier, E., Horvath, P., Moineau, S., Mojica, F., Wolf, Y., Yakunin, A., van der Oost, J. and Koonin, E., 2011. Evolution and classification of the CRISPR–Cas systems. Nature Reviews Microbiology, [online] 9(6), pp.467-477. Available at: <http://www.nature.com/nrmicro/journal/v9/n6/full/nrmicro2577.html> [Accessed 2 Dec. 2015].

Mashimo, T., Takizawa, A., Voigt, B., Yoshimi, K., Hiai, H., Kuramoto, T. and Serikawa, T., 2010. Generation of Knockout Rats with X-Linked Severe Combined Immunodeficiency (X-SCID) Using Zinc-Finger Nucleases. PLoS ONE, [online] 5(1), p.e8870. Available at: <http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0008870#s1> [Accessed 3 Feb. 2016].

Mashimo, T., 2013. Gene targeting technologies in rats: Zinc finger nucleases, transcription activator-like effector nucleases, and clustered regularly interspaced short palindromic repeats. Development, Growth & Differentiation, [online] 56(1), pp.46-52. Available at: <http://onlinelibrary.wiley.com/doi/10.1111/dgd.12110/epdf> [Accessed 19 Mar. 2016].

McMahon, M., Contreras, A. and Ruggero, D., 2014. Small RNAs with big implications: new insights into H/ACA snoRNA function and their role in human disease. Wiley Interdisciplinary Reviews: RNA, [online] 6(2), pp.173-189. Available at: <http://onlinelibrary.wiley.com/doi/10.1002/wrna.1266/pdf> [Accessed 27 Nov. 2015].

NCBI, 2016. Home - HomoloGene -. [Online] Ncbi.nlm.nih.gov. Available at: <http://www.ncbi.nlm.nih.gov/homologene> [Accessed 6 Apr. 2016].

Ncbi.nlm.nih.gov, 2016. Reference SNP (refSNP) Cluster Report: rs28929474                 ** With Pathogenic allele **. [online] Available at: <https://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=28929474> [Accessed 11 May 2016].

NCBI, 2016. SERPINA1 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 [Homo sapiens (human)] - Gene - [Online] Ncbi.nlm.nih.gov. Available at: <http://www.ncbi.nlm.nih.gov/gene/5265> [Accessed 5 Apr. 2016].

NCBI, 2016. Homo sapiens serpin family A member 1 (SERPINA1), RefSeqGene on chromo - Nucleotide - NCBI. [online] Available at: <http://www.ncbi.nlm.nih.gov/nuccore/NG_008290.1?from=5001&to=18946&report=genbank> [Accessed 5 May 2016].

NCBI, 2016. Serpina1 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 [Rattus norvegicus (Norway rat)] - Gene - NCBI. [Online] Ncbi.nlm.nih.gov. Available at: <http://www.ncbi.nlm.nih.gov/gene/24648> [Accessed 5 Apr. 2016].

Neavs.org, 2015. Biomedical Research | Animal Use in Research. [Online] Available at: <http://www.neavs.org/research/biomedical> [Accessed 28 Nov. 2015].

Nelson, T.P & Wang, W. (2008) RNA interference, mechanisms & proteins involved in. In John Willey & Sons. Willey Encyclopaedia of chemical Biology. University of Kentucky: London.

News.bbc.co.uk, (2015). BBC NEWS | Technology | Mouse brain simulated on computer. [Online] Available at: http://news.bbc.co.uk/go/pr/fr/-/2/hi/technology/6600965.stm [Accessed 30 Nov. 2015].

Nlm.nih.gov, 2016. MeSH Browser Record. [online] Nlm.nih.gov. Available at: <http://www.nlm.nih.gov/cgi/mesh/2016/MB_cgi?field=uid&term=D019896> [Accessed 11 Apr. 2016].

OriGene Technologies Inc., 2011. Quick learning of CRISPR/Cas 9. [video] Available at: <https://www.youtube.com/watch?v=0dRT7slyGhs> [Accessed 11 May 2016].

Parker, C., Chen, H., Flagel, S., Geurts, A., Richards, J., Robinson, T., Solberg Woods, L. and Palmer, A., 2014. Rats are the smart choice: Rationale for a renewed focus on rats in behavioral genetics. Neuropharmacology, [online] 76, pp.250-258. Available at: <http://www.sciencedirect.com/science/article/pii/S0028390813002694> [Accessed 19 Mar. 2016].

Pearce, M., Morton, C., Feil, S., Hansen, G., Adams, J., Parker, M. and Bottomley, S., 2008. Preventing serpin aggregation: The molecular mechanism of citrate action upon antitrypsin unfolding. Protein Sci., [online] 17(12), pp.2127-2133. Available at: <http://onlinelibrary.wiley.com/doi/10.1110/ps.037234.108/abstract;jsessionid=6F001E8F2185516B9BD9584C635765E5.f02t01> [Accessed 8 Apr. 2016].

Peprotech, (2015). Serpins, Serpinopathies, and Conformational Diseases. [Online] Available at: <https://www.peprotech.com/Lists/PTPublications/Serpins, %20Serpinopathies%20and%20Conformational%20Diseases.pdf> [Accessed 15 Apr. 2016]

RGD curator number 68., 2016. An association has been curated linking Serpina1c and Alpha 1-Antitrypsin Deficiency in Mus musculus.. GENE - TERM ANNOTATION REPORT. [online] Available at: <http://rgd.mcw.edu/rgdweb/report/annotation/main.html?id=1614437&term=RDO:0000032> [Accessed 8 Mar. 2016].

Suckow, M., Weisbroth, S. and Franklin, C., 2006. The laboratory rat. Amsterdam: Elsevier, pp.774-776

Tong, C. et al., 2012. Rapid and Cost-Effective Gene Targeting in Rat Embryonic Stem Cells by TALENs. Journal of Genetics and Genomics, [online] 39(6), pp.275-280. Available at: <http://www.sciencedirect.com/science/article/pii/S1673852712000793> [Accessed 18 Mar. 2016].

Uniprot.org, 2016. SERPINA1 - Alpha-1-antitrypsin precursor - Homo sapiens (Human) - SERPINA1 gene & protein. [Online]. Available at: <http://www.uniprot.org/uniprot/P01009#sequences> [Accessed 11 Mar. 2016] 

Uniprot.org, 2016. Serpina1c - Alpha-1-antitrypsin 1-3 precursor - Mus musculus (Mouse) - Serpina1c gene & protein. [Online]. Available at: <http://www.uniprot.org/uniprot/Q00896#ptm_processing> [Accessed 15 Mar. 2016]. 

Uniprot.org, 2016. Serpina1 - Alpha-1-antiproteinase precursor - Rattus norvegicus (Rat) - Serpina1 gene & protein. [online] Available at: <http://www.uniprot.org/uniprot/P17475#sequences> [Accessed 12 Mar. 2016].

Vance, K. and Ponting, C., 2014. Transcriptional regulatory functions of nuclear long noncoding RNAs. Trends in Genetics, [online] 30(8), pp.348-355. Available at: <http://www.cell.com/trends/genetics/pdf/S0168-9525 (14)00086-9.pdf> [Accessed 30 Nov. 2015]. 

Vidigal, J. and Ventura, A., 2015. The biological functions of miRNAs: lessons from in vivo studies. Trends in Cell Biology, 25(3), pp.137-147.

Wang, H., Yang, H., Shivalila, C., Dawlaty, M., Cheng, A., Zhang, F. and Jaenisch, R., 2013. One-Step Generation of Mice Carrying Mutations in Multiple Genes by CRISPR/Cas-Mediated Genome Engineering. Cell, [online] 153(4), pp.910-918. Available at: <http://dx.doi.org/10.1016/j.cell.2013.04.025> [Accessed 3 Dec. 2015].

Weick, E. and Miska, E., 2014. PiRNAs: from biogenesis to function. Development, 141(18), pp.3458-3471

Williams, G. and Farzaneh, F., 2012. Are snoRNAs and snoRNAs host genes new players in cancer?. Nature Reviews Cancer.

Wilson, A., et al, 2015. Emergence of a Stage-Dependent Human Liver Disease Signature with Directed Differentiation of Alpha-1 Antitrypsin-Deficient iPS Cells. Stem Cell Reports, [online] 4(5), pp.873-885. Available at: <http://www.sciencedirect.com/science/article/pii/S2213671115000776#bib13> [Accessed 23 Jan. 2016].

Wu, Y., Liang, D., Wang, Y., Bai, M., Tang, W., Bao, S., Yan, Z., Li, D. and Li, J., 2013. Correction of a Genetic Disease in Mouse via Use of CRISPR-Cas9. Cell Stem Cell, [online] 13(6), pp.659-662. Available at: <http://www.sciencedirect.com/science/article/pii/S1934590913004621> [Accessed 2 Dec. 2015].

 

Wu, Y., Zhou, H., Fan, X., Zhang, Y., Zhang, M., Wang, Y., Xie, Z., Bai, M., Yin, Q., Liang, D., Tang, W., Liao, J., Zhou, C., Liu, W., Zhu, P., Guo, H., Pan, H., Wu, C., Shi, H., Wu, L., Tang, F. and Li, J., 2014. Correction of a genetic disease by CRISPR-Cas9-mediated gene editing in mouse spermatogonial stem cells. Cell Res, 25(1), pp.67-79.

Yang, X., 2015. Applications of CRISPR-Cas9 mediated genome engineering. Military Med Res, [online] 2(1), pp.1-6. Available at: <http://mmrjournal.biomedcentral.com/articles/10.1186/s40779-015-0038-1> [Accessed 2 Dec. 2015].

Yin, H., Xue, W., Chen, S., Bogorad, R., Benedetti, E., Grompe, M., Koteliansky, V., Sharp, P., Jacks, T. and Anderson, D., 2014. Genome editing with Cas9 in adult mice corrects a disease mutation and phenotype. Nat Biotechnol, [online] 32(6), pp.551-553. Available at: <http://www.nature.com/nbt/journal/v32/n6/full/nbt.2884.html> [Accessed 2 Dec. 2015].

Xue, W., Chen, S., Yin, H., Tammela, T., Papagiannakopoulos, T., Joshi, N., Cai, W., Yang, G., Bronson, R., Crowley, D., Zhang, F., Anderson, D., Sharp, P. and Jacks, T., 2014. CRISPR-mediated direct mutation of cancer genes in the mouse liver. Nature, [online] 514(7522), pp.380-384. Available at: <http://www.nature.com/nature/journal/v514/n7522/abs/nature13589.html> [Accessed 18 Mar. 2016].

Yoshimi, K., Kaneko, T., Voigt, B. and Mashimo, T., 2014. Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR–Cas platform. Nature Communications, [online] 5(4240), pp.1-9. Available at: <http://www.nature.com/ncomms/2014/140626/ncomms5240/full/ncomms5240.html#/additional-information> [Accessed 3 Feb. 2016].

Zhao, S., Shetty,, J., Hou, L., Delcher, A., Zhu, B., Osoegawa,, K., de Jong, P., Nierman, W., Strausberg, R. and Fraser, C., 2004. Human, Mouse, and Rat Genome Large-Scale Rearrangements: Stability versus Speciation. Genome Research, [online] 14(10a), pp.1851-1860. Available at: <http://www.ncbi.nlm.nih.gov/pmc/articles/PMC524408/#!po=72.5806> [Accessed 29 Nov. 2015].

Shen, B., Zhang, W., Wang, J., Yang, J., Chen, L., Zhang, N., Zhu, K., Xu, J., Hu, B., Leng, Q. and Huang, X., 2014. One-step generation of different immunodeficient mice with multiple gene modifications by CRISPR/Cas9 mediated genome engineering. The International Journal of Biochemistry & Cell Biology, [online] 46, pp.49-55. Available at: <http://www.sciencedirect.com/science/article/pii/S1357272513003270> [Accessed 19 Mar. 2016].