Comgen Final Poster
-
Upload
eric-carpenter -
Category
Documents
-
view
94 -
download
3
Transcript of Comgen Final Poster
![Page 1: Comgen Final Poster](https://reader036.fdocuments.in/reader036/viewer/2022082720/589f37061a28ab4d568b72f5/html5/thumbnails/1.jpg)
Pseudomonas flourescens: Sequencing of Strain L5.1-96 Clone PF003-D08
Acknowledgments We would like to acknowledge Bellevue College, Washington State
University, the National Science Foundation and the United States
Department of Agriculture for the opportunity to participate.
RK Razumovich and Eric Carpenter
Biology 211 Spring 2013 Abstract
The purpose of the ComGen project was to sequence the
genome of the L5.1-96 strain of Psuedomas fluorescens in
order to find the genes that account for its supercolonizing
ability, and what genes it shares in common with other
strains of P. fluorescens and other species of
Psuedomonas. This was done by purifying the plasmid DNA
of Escherichia coli (first culturing it), in which a plasmid had
been added that contained part of the genome from P.
fluorescens L5.1-96. The DNA was then sequenced using
PCR, then the DNA sequence analyzed and input into a
program called BLAST, which determined from the NCBI
database what proteins the sequence may possibly code
for.
Methods Bacteria Culture - Our first step is to Inoculate our Luria Broth. We put our clone,
PF003-D08, into the broth. The broth contains Kanamycin which
we use to kill cells that do not have our Plasmid’s resistance
gene. Our Plasmid contains the Pseudomonas fluorescens
gene insert and resistance to Kanamycin.
Plasmid Purification - With our broth inoculated we need to purify our plasmid in order
to study it. To do this we followed our Qiagen procedure
provided to us and a centrifuge to isolate our DNA from proteins
and other substrates.
Checking DNA Quality -
Our next step was to use a technique with Gel Electrophoresis,
a process used to check DNA quality and approximate length, to
determine if we have enough DNA to perform a Polymerase
Chain Reaction.
Sequencing Reaction –
Amplify the DNA fragments into different sized strands that can
be read by the sequencer. We are going to use two different
primers, SL1 and SR2, as well as Deoxynucleotides and
Dideoxynucleotides, and Big dye Terminator. These primers are
short pieces of DNA made in a lab and are necessary for DNA
Polymerase to attach to
Sequencing Reaction Clean-up –
With our DNA fragments amplified our next step was to clean up
the reaction so that our sequence can be read without
interference. Big Dye X Terminators act like a sponge, trapping
unreacted nucleotides, enzymes, and small fragments.
Bioinformatics –
With our sequence in hand, we utilize Blast (Basic Local
Alignment Search Tool) to compare to other known sequences
in the NCBI Database. We use the information we obtained from
this program to learn what our sequence codes for.
These Images Show the Difference Between Healthy
and Diseased Wheat Roots
Discussion
Blast Analysis from NCBI Database
SL1: For SL1 we blasted with a query length of 719
nucleotide bases. Our top results code for a
Glycine/Betaine Catabolism Protein with 98% Query
Coverage, 99% Max Identity and an E-value of 2e^-
171. Accession Number ( YP 004354986.1). This
transport protein is an enzyme called
Oxidoreductase that catalyzes the oxidation of one
compound with the reduction of another and can be
found in the complete genomes of Pseudomonas
brassicacearum subsp. brassicacearum NFM421 and
Pseudomonas fluorescens F113.
SR2: For SR2 we blasted with a query length of 415
nucleotide bases. Our tope results code for a
Phenylacetic Acid Degradation-Like Protein with 98%
Query Coverage, 99% Max Identity and an E-value of
4e^-94. Accession Number (YP 005207507.1) This
protein is responsible for Phenylacetic Acid
degradation in bacteria and can be found in the
complete genomes of Pseudomonas brassicacearum
subsp. brassicacearum NFM421 and Pseudomonas
fluorescens F113.
References
Bangera, M. G. Take-all, Wheat, and the Genetics of Pseudomonas
fluorescens. PDF Presented April 2013.
https://bc.instructure.com/courses/814475/files/24715009?module_ite
m_id=5231716
BLAST: Basic Local Alignment Search Tool. Used April-May 2013 via
National Center for Biotechnology Information
http://www.ncbi.nlm.nih.gov
Introduction
The ComGen project addresses the issue of take-all disease,
a fungus (Gaeumannomyces Graminis var. tritici), that
grows into and binds to the rhizosphere of the wheat
(Triticum aestivum) root, and chokes off the water and
nutrient supply, causing the plant to die. Take-all is able to
thrive in Eastern Washington because of the prevalent
moisture. There have been many different techniques
attempted to control the disease, most unsuccessful.
Pesticides and chemicals are unsuccessful and cause
pollution, burning causes pollution, crop rotation is not
economically viable, growing resistant varieties has been
unsuccessful, and tilling leads to soil erosion. The most
effective method is biological control, which is using an
organism or its products to remove undesirable organisms.
Suppressive soils which contain very high levels of the
bacteria Pseudomonas fluorescens are effective in treating
take-all disease and causing take-all decline. This is
because of 2,4-diacetylphloroglucinol, or DAPG, an
antibiotic that P. fluorescens produces. One strain of P.
fluorescens, L5.1-96, seems to fare better than any other
strain previously isolated. It grows very aggressively, is a
super colonizer (rapidly and readily colonizes the
rhizosphere of wheat roots), and is very hardy. It survives
longer in the rhizosphere than any other strain of P.
fluorescens.
Results
SL1AGCTTGATTCGTTCTCACCGGTCATTGGCGGGCAGACCCTCTTCCGCTGCTACACCCTG
TCGTCCTCCCCGACCCGGCCCTTTGCGTTTTCCATTACCGTCAAACGTGTGCCGGGGGGCGCG
GTATCGAACTGGCTGCATGACCACCTCAAGCCCGGCGACAGCCTGAAGGCGTCCGGTCCGGC
GGGCAGCTTTACACCGGTCGGCCATCCTGCGACCAAGTTGTTGTACCTGTCGGCCGGCTCGGG
TGTAACGCCCCTGATGTCGATGACCCGGGCCGCCTGCGACATGGCCGGCAACCTCGACATTGT
CTTCGTACACAGCGCGCGTACTCCTGCCGATATCATCTTCCACGCAGAATTGACGCGCATGCAG
GCCGCCATGTCGGGACTGCGGGTCATCAGTGTGTGCGAAGGACTTGGCGACACCGCTCAATG
GCAGCAACCGATAGGCCGGCTCGATTTGCCGTTGCTGAGCCAGCAAGTGCCGGACTACAAGG
AACGGGAAATCTTTACCTGTGGTCCCCAGGGCTACATGGAAGCGGTCAAGTCGCTGCTCAGGG
AAGCGGCGTTCGATTTCGCCCACTATCATCAGGAAAGCTTCGACATCAGCGCACTGAACGAGG
AACCGTTGCTCGAGCAAGCCCCTTCCCTCGATCAGCAGGAGGTGTTCACGGTAACCTTGTCGC
GCTCGGGGAAGACGTTCAGCATGCCGGGCAAT
SR2GTTGGCCCGTCCGCTTTCAGCAATATGGCCTGCCAGATGGCACCGTATTTCGGCACCAT
CAACCCGGAAATTTCTGTGTTGACCCCCGGTCGCGGTGAAGTGAAGGTGCCGTTTCGCAAGGA
AATCACCAATCACCTGGCGTCCGTTCACGCGATCGCGTTGTGCAACGCGGCAGAACTGGCGGG
TGGGATGATGACCGAGGTGTCCATCCCCAGCGGCGCGCGCTGGATTCCCAAAGGCATGACCGT
CGAGTACTTGGCCAAGGCCAAGACCTCCATCCATGCGATTGCCGACGGTAGCGAAATCGACTG
GCAGACTTCGGGCGACAAGATTGTCCCGGTCGAGATCTTCGACGAGGCTGGGGTGAAGGTCTT
CACGGCGCGCATCACCATGAATGTGAAAATCGGCTAGGTCG
Our Gel Electrophoresis Results
Example of Glycine/Betaine Protein (Left) and
Phenylacetic Acid Degradation Protein (Right)