Combination effect of PectaSol and Doxorubicin on viability, cell cycle arrest and apoptosis in...

Combination effect of PectaSol and Doxorubicin on viability,cell cycle arrest and apoptosis in DU-145 and LNCaPprostate cancer cell linesNajmeh Tehranian*, Houri Sepehri1*, Parvin Mehdipour{, Firouzeh Biramijamal1, Arash Hossein-Nezhad",I, AbdolfattahSarrafnejadI and Ebrahim Hajizadeh*** Animal Biology Department, School of Biology, University College of Sciences, University of Tehran, PO Box 1415, Tehran, Islamic Republic of Iran{ Department of Medical Genetics, School of Medicine, Tehran University of Medical Sciences, PO Box 1417613151, Tehran, Islamic Republic of Iran1

National Institute of Genetic Engineering and Biotechnology, PO Box 14965/161, Tehran, Islamic Republic of Iran"

Bio and Nanotechnology group, Endocrinology and Metabolism Research Center, Shariati Hospital, Tehran University of Medical Sciences,PO Box 14965/161, Tehran, Islamic Republic of Iran

IDepartment of Pathology, School of Public Health, Tehran University of Medical Sciences, PO Box 1417613151, Tehran, Islamic Republic of Iran

**Department of Biostatistics, Faculty of Medical Sciences, Tarbiat Modares University, PO Box 14115-111, Tehran, Islamic Republic of Iran

AbstractThe effect of PectaSol on Dox (Doxorubicin) cytotoxicity in terms of apoptosis and cell cycle changes in PCa (prostate

cancer) cell lines (DU-145 and LNCaP) has been investigated. Combination of PectaSol and Dox resulted in a viability of

29.4 and 32.6% (P,0.001) in DU-145 and LNCaP cells. The IC50 values decreased 1.5-fold and 1.3-fold in the DU-145 and

LNCaP cells respectively. In the DU-145 cells, combination of PectaSol and Dox resulted in a reduction in p27 gene

and protein expression (P,0.001). In LNCaP cells, this combination increased p53, p27 and Bcl-2 expression. Treatment

with both drugs in DU-145 cells led to an increase in sub-G1 arrest (54.6% compared with 12.2% in Dox). In LNCaP cells,

combination of the drugs led to an increased in G2/M arrest (61.7% compared with 53.6% in Dox). Based on these findings,

progressive cytotoxicity effect of Dox and PectaSol together rapidly induce cell death in DU-145 through apoptosis and in

LNCaP cells through cell cycle arrest (G2/M arrest).

Keywords: Doxorubicin (Dox); gene expression; PectaSol; prostate cancer (PCa) cell lines (DU-145; LNCaP); protein expression; viability

1. Introduction

PectaSol MCP (modified citrus pectin), a complex water-soluble

indigestible polysaccharide obtained from the peel and pulp of

citrus fruits and modified by means of high pH treatment, which

was invented by Isaac Eliaz and uses as a dietary supplement has

emerged as one of the most promising anti-metastatic drugs

(Glinsky and Raz, 2009) that decreases PSA (Pisum sativum

agglutinin) in prostatic cancer patients (Guess et al., 2003; Elsadek

et al., 2011). PCa (prostate cancer) is the world’s most common

malignancy and the second leading cause of death from cancer

(Sanches et al., 2009). It is an androgen-dependent tumour, and

therefore hormone ablation therapy is often used as a primary

treatment option for symptomatic advanced patients, but 20% of

patients are refractory to treatment. Furthermore patients who

exhibit an initial therapeutic response will relapse within 3 years

with androgen-independent carcinoma that is rapidly fatal (Nehme

et al., 2001). Cytotoxic chemotherapy is currently used to control

and treat PCa. Dox (Doxorubicin) has broad spectrum therapeutic

activity against various types of cancers, including PCa. It induces

apoptosis in LNCaP (androgen-dependent; Kang et al., 2005) and

DU-145 (androgen-independent; Tyagi et al., 2002) cell lines (Wu

et al., 2002). Treatment with high doses of Dox causes .40% of

LNCaP cells to have fragmented DNA in a dose-dependent

manner. Also Dox in low doses activates the G1 checkpoint via a

p53 pathway (Collins et al., 2006). Chemotherapy or irradiation

primarily act by triggering apoptosis in cancer cells (Opel et al.,

2008), and Dox induces apoptosis by a p53-dependent (Wang

et al., 2004). The Bcl-2 family plays a critical role in the regulation

of apoptosis by functioning as promoters (e.g. Bax) or inhibitors

(Bcl-2 or Bcl-xL) of cell death (Mantena et al., 2006). The

knockdown of anti-apoptotic genes [Bcl-2, Bcl-xL and XIAP (X-

linked inhibitor of apoptosis)] should enhance chemosensitivity to

the Dox (Kim et al., 2009), and therefore the effects of combining

Dox and PectaSol on the expression of p53, p21, p27, Bax and

Bcl-2 genes were examined. The use of Dox in patients with PCa

is limited because concentrations required to kill cancerous cells

cannot be attained without systemic toxicity, including severe

immunosuppression and cardiomyopathy (Tyagi et al., 2002).

There has been intense public and scientific interest in finding

other approaches to controlling and treating PCa, resulting in the

use of natural substances and/or combination chemotherapy

(Tyagi et al., 2002; Rabi et al., 2009). Combination therapy draws

on PectaSol MCP with its high anticancer effects and low toxicity

to normal tissues, as well as dietary supplements and anticancer

drugs (Johnson et al., 2007). The exact mechanism by which MCP

produces its effects has not been established, but is probably

mediated via the regulation of cell cycle arrest and apoptosis

(Glinsky and Raz, 2009). However, the molecular signalling

1 To whom correspondence should be addressed (email [email protected]).Abbreviations: Dox, Doxorubicin; MCP, modified citrus pectin; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide; PTEN, phosphatase andtensin homologue deleted on chromosome 10; RT-PCR, real-time PCR.

Cell Biol. Int. (2012) 36, 601–610 (Printed in Great Britain)

Short Communication

E The Author(s) Journal compilation E 2012 International Federation for Cell Biology Volume 36 (7) N pages 601–610 N doi:10.1042/CBI20110309 N www.cellbiolint.org 601

involved in combination of Dox and PectaSol-mediated anti-

tumour activity has not been fully explored. Our strategy has been

to explore and understand the mechanisms of action of combined

Dox and PectaSol treatment. Genetic targeting or pharmaco-

logical manipulation of the cyclin-dependent kinase inhibitors, p27

and p21, and its major regulator, p53, which are important

regulators of cell cycle progression, and the ratio of Bax/Bcl-2 that

is in favour of apoptosis, might provide better strategies. Targeting

the expression of p53, p21, p27, Bax and Bcl-2 is shown here to

be a useful approach for investigating cell cycle arrest and

apoptosis.

2. Materials and methods

2.1. Cell lines and reagents

Human PCa DU-145 and LNCaP cells obtained from [NCBI

(National Cell Bank of I.R. Iran] were grown in RPMI 1640

medium supplemented with 10% heat inactivated FBS (fetal

bovine serum), L-glutamine 1%, penicillin 100 units/ml strep-

tomycin 100 mg/ml, and antibiotics at 37uC in a 5% CO2 in air

atmosphere at 90–95% humidity. A 10 mg stock solution of

PectaSol was obtained from EcoNugenics, Inc. (Santa Rosa,

CA), whereas Dox was obtained from (EBEWE Pharma Gmbh

Nfg). Antibodies to P53 and P27 were purchased from Santa

Cruz Biotechnology. The stock solutions were brought to their

final concentrations by dilution in medium immediately before

use.

2.2. Measurement of cell growth inhibition by MTT[3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide] assay

DU-145 and LNCaP cells were seeded at 16105 cells per well in

96-well microtitre culture plates. The cells were maintained in the

exponential growth phase after an overnight incubation by

removing the medium with a pipette and replacing it with a fresh

medium containing different concentrations of PectaSol (0.5, 1, 3

and 5 mg/ml), Dox (10.25, 50, 100, 250 and 500 nM) or a

combination of both. The cells were cultured for 24, 48 and

72 h. At each point, cell viability was determined by measuring

MTT absorbance dye; Sigma–Aldrich) at 570 nm by a multi-well

spectrophotometer. The required concentration necessary to

produce 50% cell growth inhibition (IC50) was determined by

interpolation from dose-response curves. The control wells were

untreated cells that only received fresh medium.

2.3. Measurement of expression of p53, p21, p27,Bcl-2 and Bax genes by RT-PCR (real-time PCR)in DU-145 and LNCaP cell lines

To determine gene expression, cDNA was generated. Total

RNA was reverse transcribed using Revert Aid First Strand

cDNA Synthesis Kit (Fermentas). One microgram of total RNA

was reversibly transcribed to cDNA in a reaction condition of

0.2 mg/ml Oligo (dt)18 primer, 4 ml 56 reaction buffer, 20 mg/ml

RibolockTM RNase inhibitor, 10 mM dNTP mix, 200 mg/ml MuLV

reverse transcriptase in 20 ml and incubated for 5 min at 65uC,

60 min at 42uC and the reaction stopped by incubating for

5 min at 70uC. To confirm cDNA, each cDNA was tested by PCR

using Taq DNA Polymerase master Mix Red (Amplicon).

PCR was carried out in 20 ml containing 50 ng of the resulting

cDNA, 20 pmol/ml of sense and antisense b-actin primer, 10 ml

of 26 Master Mix Red (0.5 unit/ml Taq polymerase, 1.5 mM

MgCl2, 150 mM Tris/HCl, 40 mM (NH4)2S04, 0.2% Tween 20

and 0.4 mM dNTP). The reactions were subjected to 30 cycles

of 94uC for 20 s (denaturation), 65uC for 10 s (annealing) and

72uC for 30 s (extension), followed by 10 min at 72uC (final

extension).

2.4. Real-time PCR

To quantify p53, p21, p27, Bcl-2, Bax and b-actin genes by

quantitative RT-PCR, approximately 50 ng of their cDNAs was

treated with 26 MaximaTM SYBR Green/ROX qPCR (quantitat-

ive PCR) Master Mix (Fermentas) and 10 mM of each primer in

20 ml. These reactions were performed on a Step-One-PlusTM

real-time (ABI Applied Biosystems). All assay efficiencies were

monitored using a standard curve. The resulting CTs (computed

tomographies) were normalized to the b-actin housekeeping

gene. All samples were analysed independently at least 3 times

for each gene. Primers sequences for the reactions are given in

Table 1.

2.5. Measurement of p53 and p27 protein expression

The cell lines were cultured at 16105 cells in 96-well plates. The

DU-145 and LNCaP cells were treated after overnight culture with

IC50 concentrations of Dox, 250 and 290 nM, and PectaSol 3 at

4 mg/ml alone or together for 48 h. At each time-point, the cells

were incubated for 2 h at 4uC with primary antibody against p53

and p27 in a 1:200 dilution (Dako and Santa Cruz Biotechnology).

The cells were thereafter washed once in PBS and incubated with

secondary FITC-linked antibody for 45 min at room temperature in

Table 1 Primer sequences

mRNA target Forward (5) primers Reverse (3) primers Amplicon size (bp)

Bcl2 59GCCTTCTTTGAGTTCGG39 59GGGTGATGCAAGCTCC39 286Bax 59GCATCGGGGACGAACTGG39 59GTCCCAAAGTAGGAGAGGA39 306p53 59GGCCCACTTCACCGTACTAA39 59GTGGTTTCAAGGCCAGATGT39 156P21 59GACACCACTGGAGGGTGACT39 59CAGGTCCACATGGTCTTCCT39 172P27 59TCTACTGCGTGGCTTGTCAG39 59C1TGTATTTGGAGGCAGAGCA39 240bactin 59GCAAGCAGGAGTATGACGAG39 59CAAATAAAGCCATGCCAATC39 144

Effect of Doxorubicin and PectaSol on prostate cancer cell lines

602 www.cellbiolint.org N Volume 36 (7) N pages 601–610 E The Author(s) Journal compilation E 2012 International Federation for Cell Biology

the dark. Finally, the cells were washed with PBS and fixed in

paraformaldehyde. Fluorescence was measured by FACScan

equipment (Becton Dickinson). p53 and p27 were detected by

flow cytometry using the Flow Max programme.

2.6. Cell cycle analysis

DU-145 and LNCaP cells were treated with PectaSol and Dox

either alone or in combination for 48 h. After treatment the cells

were trypsinized and treated with blocking solution (PBS–

ethanol: 70%) and incubated at 4uC for 2 h in the dark. The

cells were incubated in PI Master Mix (40 ml/ml PI, 950 ml/ml PBS

and 10 ml/ml RNase) at 37uC for 0.5 h in dark. Cell cycle

distribution was analysed by flow cytometry analysis of the Flow

Max program.

2.7. Statistical analysis

Statistical evaluation of the data was performed using the

parametric test of one-way ANOVA. P,0.05 was considered

statistically significant. All the experiments were repeated at least

three times, and the results are presented as means¡S.D. with

SPSS 13 software.

3. Results

3.1. Effects of PectaSol and Dox alone or incombination on DU-145 cell-growth inhibition

Treatment of DU-145 cells with PectaSol (0.5–5 mg/ml) resulted in

a significant reduction in proliferation and viability, ranging from

77.25 to 24.67% (P,0.001) after 48 h (optimum condition;

Table 2). Similar effects were obtained with Dox (10–500 nM),

ranging from 76.25–23.67% (P,0.001) after 48 h (optimum

condition; Table 2).

IC50 values were calculated from the cell proliferation plots.

Cytotoxicity increased in a time- and dose-dependent manner for

each agent. Greater cytotoxicity was observed at 48 h for each

agent, and the IC50 values of PectaSol and Dox in the DU-145 cell

lines were 3 mg/ml and 250 nM respectively (Table 2).

The cell growth suppressing effects of the PectaSol and Dox

combination in DU-145 cells by increasing concentrations of both

drugs at 48 h. In the first combination experiment, 100 and

250 nM of Dox (for 48 h) were added in combination with 3 mg/ml

(added for the last 24 h), and treatment with combination of

250 nM of Dox with 3 mg/ml resulted in a 29.4% viability of the

DU-145 cells by comparison with Dox alone 47.0% (Table 3 and

Figure 1).

IC50 values decreased 1.5-fold in the DU-145 cells (Table 3). In

the second combination, 250 nM Dox and 3 mg/ml PectaSol (IC50

dose) used together (for 48 h), the viability was 28.6% (P,0.001;

Table 3).

3.2. Effects of PectaSol and Dox alone or incombination on LNCaP cell-growth inhibition

The treatment of the LNCaP cells with PectaSol (1–10 mg/ml)

resulted in a significant reduction in proliferation/viability of LNCaP

cells ranging from 78.25 to 34.92% (P,0.001) after 48 h (optimum

condition) treatment.

Treatment of the LNCaP cells with Dox (10–500 nM) showed

decrease viability ranging from 85.42 to 32.53% (P,0.001) after

48 h (optimum condition; Table 2).

The respective IC50 values of PectaSol and Dox in LNCaP cells

were 4 mg/ml and 290 nM (Table 2).

Table 2 Effects of Dox and PectaSol on the viability of the DU145 and LNCaP cell lines after 48 h treatment

Cell lines Therapeutic agents Dose % Viability IC50 P value

DU145 Dox 10 nM500 nM

76.2523.67

250 nM 0.0010.001

PectaSol 0.5 mg/ml5 mg/ml

77.2524.67

3 mg/ml 0.001

LNCaP Dox 10 nM500 nM

85.4232.53

290 nM 0.0010.001

PectaSol 1 mg/ml10 mg/ml

78.2534.92

4 mg/ml 0.0010.003

Table 3 Effects of combination of Doxorubicin and PectaSol on viability of DU145 and LNCaP cell lines after 48 h treatmentDox+Pectasol treatment with Dox for first 24 h before adding PectaSol for second 24 h. Dox/Pectasolsimultaneous treatment with Dox and PectaSoltogether.

Cell lines Therapeutic agents Dose % Viability % IC50 decrease P value

DU145 Dox 100 nM250 nM

55.0247.04

0.0010.001

PectaSol 3 mg/ml 49.08 0.001Dox+PectaSol 100 nM+3 mg/ml

250 nM+3 mg/ml47.2429.36

1.5 fold

Dox/PectaSol 250 nM/3 mg/ml 28.6LNCaP Dox 100 nM

290 nM6252.25

0.0010.001

PectaSol 4 mg/ml 53.21 0.001Dox+PectaSol 100 nM+4 mg/ml

290 nM+4 mg/ml52.5032.50

1.3 fold

Dox/PectaSol 290 nM/4 mg/ml 31.6

Cell Biol. Int. (2012) 36, 601–610

E The Author(s) Journal compilation E 2012 International Federation for Cell Biology Volume 36 (7) N pages 601–610 N www.cellbiolint.org 603

In the first combination experiment, 100 and 290 nM of Dox for

48 h in combination with 4 mg/ml PectaSol (added for the last

24 h) was done, and treatment with combination of 290 nM of Dox

with 4 mg/ml resulted in 32.6% viability of the LNCaP cells by

comparison with Dox alone, 52.5%, (Table 3 and Figure 2).

The IC50 values decreased 1.3-fold in the LNCaP cells

(Table 3). In the second combination, 290 nM Dox and 4 mg/ml

PectaSol treatment of LNCaP cells were added for 48 h. Viability

was 31.6% (P,0.001; Table 3).

3.3. Effects of PectaSol and Dox on p53, p27 and p21gene expressions in DU-145 cells

In these experiments, the DU-145 cells were exposed to 250 nM

Dox (IC50) in the absence and presence of 3 mg/ml PectaSol for

48 h (IC50). RT-PCR showed that in the DU-145 cells, PectaSol

and Dox had no effect on the expression level of mutant p53

(Figure 3, Table 4).

RT-PCR demonstrated a significant decrease in the level of

p27 in the DU-145 cells exposed to both agents compared with

Dox alone (P,0.001; Figure 3 and Table 4). This shows that a

combined treatment compared with Dox alone down-regulated

p27 expression. This combination had no effect on p21

expression (Figure 3).

3.4. Effects of PectaSol and Dox on Bcl-2 and Baxand Bax/Bcl-2 gene expressions in DU-145 cells

The proteins of the Bcl-2 family play critical roles in the regulation

of apoptosis by functioning as promoters (e.g. Bax) or inhibitors

(Bcl-2 or Bcl-xL) of cell death process (Mantena et al., 2006). As

the levels of combination of Dox and PectaSol decreased the

viability of DU-145 cells compared with either agent alone,

the mechanisms underlying Dox/PectaSol decrease in viability is

probably through apoptosis. RT-PCR was used to detect Bcl-2

and Bax after Dox and PectaSol in combination. This had no effect

on the ratio of Bax/Bcl-2 compared with Dox alone, which

indicates that decreased viability probably relates to other

pathways of cell death (Figure 3, Table 4).

3.5. Effects of PectaSol and Dox on p53, p27, p21gene expression in LNCaP cells

A 290 nM/4 mg/ml combination of Dox and PectaSol significantly

increased the expression level of wild-type p53 in LNCaP cells

(P,0.05; Figure 4 and Table 4). An increase in p27 was found in

cells given a combination of both agents compared with PectaSol

and Dox alone (P,0.001). In these androgen-dependent PCa

cells, a combination of Dox and PectaSol had significant effect on

the level of p27 expression compared with either agent alone or

untreated controls (Figure 4 and Table 4).

3.6. Effects of PectaSol and Dox on Bcl-2, Bax andBax/Bcl-2 gene expression in LNCaP cells

RT-PCR used to detect Bcl-2 and Bax in the cells treated with Dox

or PectaSol or in combination showed that of the two together

Dox and PectaSol had no effect on the ratio of Bax/Bcl-2 in com-

parison with Dox alone, which may indicate a decrease in viability

due to other pathways of cell death (Figure 4 and Table 4).

3.7. Effects of PectaSol and Dox alone or incombination on p53 and p27 protein expressionin DU-145 and LNCaP cell lines

p53 and p27 expression in DU-145 and LNCaP were assessed in

cells exposed to 250 and 290 nM Dox (IC50 dose) in the absence

and presence of 3 and 4 mg/ml PectaSol for 48 h (IC50 dose).

PectaSol and Dox had no effect on the expression level of p53

protein (P,0.05; data not shown) (Figure 5).

In contrast with the above-mentioned lack of effects on Dox

and MCP (PectaSol), possible augmented effects of their

combination on the DU-145 and LNCaP cells were thereafter

examined with regard to p27 expression in response to either

agent or in combination. Flow cytometry clearly demonstrated a

significant decrease in the level of p27 in the DU-145 cells

exposed to a combination of both agents as compared with

Figure 1 MTT analysis for DU-145 cell line after 48 h treatment with PectaSol,Dox or a combination of both drugs

Determination of viability measured by MTT in DU-145 cell line after in vitro treatmentwith PectaSol or Dox either alone or in combination. *P,0.05 compared with control,"P,0.05 compared with 250 nM Dox+3 mg/ml PectaSol. IC50 of Dox is 250 nM andthat of PectaSol is 3 mg/ml in the DU-145 cell line.

Figure 2 MTT analysis for LNCaP cell line after 48 h treatment with PectaSol,Dox or a combination of both drugs

Determination of viability evaluated by MTT in LNCaP cell line after in vitro treatmentwith PectaSol or Dox either alone or in combination. *P,0.05 compared with untreatedcells (control). IC50 value of Dox is 290 nM and that of PectaSol 4 mg/ml in the LNCaPcell line.



Dox alone (P,0.001) and an increase in the level of p27 in the

DU-145 cells exposed to a combination of both agents

compared with PectaSol alone (P50.002) (Figure 6). These

results showed that a combination of Dox and PectaSol, in

comparison with Dox alone, down-regulates P27 expression

probably through the inhibition of Gal-3 anti-anoikis effect. In

androgen-dependent PCa (LNCaP), a combination of Dox and

PectaSol had no significant effect on the levels of P27

expression when compared with any other agent alone or

untreated control (data not shown).

3.8. Effects of PectaSol and Dox alone or incombination on cell cycle progression on theDU-145 cell line

PectaSol treatment showed sub-G1 arrest (47.0% compared with

17.3% in control; Figure 7A), whereas Dox caused G2/M arrest

(20.5% compared with 8.7% in the control; Figure 7D) after 48 h

of treatment. Interestingly, PectaSol treatment after Dox-induced

sub-G1 arrest (45.3%) compared to that caused by Dox alone

(12.2%; Figure 7A). Similarly, treatment of PectaSol-treated cells

Figure 3 Effect of PectaSol and Dox on gene expression of DU-145 cell line after 48 hDetermination of gene (p21, p27, p53, Bax and Bcl-2) expression in DU-145 cells after in vitro treatment with PectaSol or Dox alone or in combination.*P,0.05 compared with control, £P,0.05 compared with PectaSol, +P,0.05 compared with Dox, #P,0.05 compared with PectaSol/Dox.

Table 4 Means of p53, p21, p27, Bcl2 and Bax gene expression in DU145 and LNCaP cell lines after 48 h treatment

DU145 cell line LNCaP cell line

Dose

Control 250 nM 3 mg/ml 250 nM+3 mg/ml

Control 290 nM* 4 mg/ml{ 290 nM+4 mg/ml

Gene Dox PectaSol Dox PectaSolGenes whichinvolved incell cycle

P53P21P27

15161026

12961026

10961026

15461026

15961026

20661026

16261026

12461026

12161026

14361026

14061026

15161026

23061026

18261026

23261026

15961026

14361026

16761026

18861026

16361026

16861026

23861026

15961026

25561026

Genes whichinvolved inapoptosis

Bcl2BaxBax/Bcl2

15961026

17161026

10861026

20861026

22561026

10861026

18861026

18861026

11361026

16161026

19461026

12961026

20561026

21661026

11261026

15261026

16661026

10961026

16461026

20961026

12661026

23161026

21461026

9261026

* IC50 value of Doxorubicin is different between two cell line.{ IC50 value of PectaSol is different between two cell line.

Cell Biol. Int. (2012) 36, 601–610


with Dox led to a further increase in sub-G1 arrest (54.6%)

compared to that caused by Dox alone (12.2%; Figure 7A). In

contrast, when cells were simultaneously treated with both agents

for 48 h, a much stronger G1 arrest (35.5%) was evident at the

expense of both the sub-G1 and G2/M populations (Figure 7B).

These results suggest that a combination of PectaSol and Dox

causes a very strong sub-G1 arrest compared with these agents

alone, and that DU-145 cell growth inhibition in the combination

could be, in part, attributable to a stronger arrest in cell cycle

progression at the sub-G1.

3.9. Effects of PectaSol and Dox alone or incombination on cell cycle progression in LNCaPcells

PectaSol treatment produced sub-G1 arrest (21.7% compared

with 6.4% in control), whereas Dox caused G2/M arrest (53.6%

compared with 38.2% in control) after 48 h of treatment.

Treatment of PectaSol-treated cells with Dox led to a further

increase in sub-G1 arrest (16.3%) to that caused by Dox alone

(5.1%; Figure 8A). However, treatment of Dox-treated cells with

PectaSol led to a stronger G1 and S arrest (18.2% compared with

8.3% in Dox alone: Figure 8B: 1.7% compared with 6.4% in Dox

alone; Figure 8C respectively) was evident. When cells were

simultaneously treated with both agents for 48 h, this led to a

further increase in S arrest (24.1%) due to Dox alone (6.4%;

Figure 8C).

4. Discussion

PectaSol synergizes with Dox in the treatment of prostate carcinoma

DU-145 and LNCaP cells by decreasing the viability and proliferation

of cells. Combination of PectaSol and Dox led to a concentration-

dependent decrease of 1.3- and 1.5-fold in the IC50 value of in

LNCaP and DU-145 cells respectively. Dox side-effects, such as

immunosuppression and cardiomyopathy, which severely increases

in a dose-dependent manner, as well as development of primary or

secondary drug resistance in tumour cells, limit their clinical success

in cancer chemotherapy. In this regard, combination chemotherapy

has received more attention for the purpose of finding compounds

with a known mechanism of action that could increase the

therapeutic index and decrease effective dose of clinical anticancer

drugs (Tyagi et al., 2002). Other studies show that PectaSol MCP can

affect the rate-limiting steps in cancer metastasis, has anti-adhesion

properties and also increases apoptosis of tumour cells by

sensitizing them to this drug (Glinsky and Raz, 2009) and reducing

Dox IC50 by 10.7-fold in human ASA (angiosarcoma) and HAS

(hemangiosarcoma) respectively (Johnson et al., 2007).

Figure 4 Effect of PectaSol and Dox on gene expression in the LNCaP cell line after 48 hDetermination of gene (p21, p27, p53, Bax and Bcl-2) expression in LNCaP cells after in vitro treatment with either drug alone or in combination. *P,0.05compared with control, #P,0.05 compared with PectaSol/Dox.



To characterize the combined effects of PectaSol and Dox on

apoptosis and cell cycle progression, the cyclin-dependent kinase

inhibitors p27, p21, Bcl-2 and Bax genes and the major regulator,

p53, which are important regulators of apoptosis and cell cycle

progression genes were measured.

4.1. LNCaP

In LNCaP cells, PectaSol plus Dox therapy increased p53, p27

and Bcl-2 gene expression levels. Yan and Katz (2010) found Bim

(BH3-only), a pro-apoptotic gene downstream similar to Bax

(Multidomain) a pro-apoptotic gene in our study decreased.

Therefore, it seems the increase in gene expression of p53 and

consequently increase in gene expression levels of genes related

to p53 involved in apoptosis was not equivalent to an increase

in the cytotoxic effect of Dox and does not justify the overlap with

the MTT results. However, this activates the apoptosis pathways

related to p53. The expression of other genes involved in

apoptosis clearly need to be investigated.

Genes other than p53 increasing the cytotoxic effect of Dox in

combination with PectaSol, such as FasL by enhancing AP-1

(activator protein 1) DNA binding, increase cell death compared

with overexpression of Ras that decreased the amount of Fas,

thereby decreasing Dox-mediated aggressive cell death (Wang

et al., 2004). Increased cytotoxicity caused by Dox combination

therapy might not be mediated by inhibition of Bcl-2 expression

and probably other pathways including p53 are involved. Since

other pathways than p53 can be involved, Manna et al. (2010)

have shown in p53-negative cells that Dox was more cytotoxic

(faster and intensity).

4.2. DU-145

Not only were the observations similar to LNCaP, but also

expression of p53 was decreased, which probably is due to

other pathways than p53 being involved, such as MAPK

(mitogen-activated protein kinase) and PTEN (phosphatase and

tensin homologue deleted on chromosome 10)/Akt (also known

as protein kinase B) signalling pathways of central importance

for a particular tumour cell line to readily undergo apoptosis or

not, namely Ras. The results of the profiling of DU-145 and PC-3

support the notion that an intact PTEN–Akt pathway (as found in

DU-145 and 22RV1 cells) and the presence of active p38 are

responsible for the high sensitivity to apoptosis; and that neither

the androgen receptor nor the p53 status is of primary

importance for the differences observed with respect to

apoptosis induction (Iben et al., 2006). Manna et al. (2010)

reported that the basal expression of Fas was greater in p53-

negative cells compared with p53-positive cells and over-

expression of Ras decreased the amount of Fas in p53-negative

cells. In another study, it was reported that UNG (Uracil DNA

glycosylase) inhibition in DU-145 cells resulted in elevated p21,

although mutant p53 and Bax levels remained unchanged

(Pulukuri et al., 2009).

Another point is that in DU-145, unlike LNCaP, the expres-

sion of Bcl-2 was decreased and Bax increased, which is an

Figure 5 Effect of PectaSol and Dox on p53 protein expression in DU-145 and LNCaP cell linesDetermination of protein p53 expression in DU-145 and LNCaP cell lines after in vitro treatment with PectaSol or Dox either alone or in combination.£P,0.05 compared with PectaSol.

Cell Biol. Int. (2012) 36, 601–610


indicator of more pronounced effects of these two therapies on the

Bcl-2 and Bax pathways compared with LNCaP cells. However,

since the cytotoxic effects of combination therapy is greater, it is

probable that other pathways are also involved in apoptosis. Servida

et al. (2011) showed that mimicking Smac can induce apoptosis in

tumour cells. Evaluation of other genes in future studies is required.

Our findings suggest that the effects of combination of Dox

and PectaSol on p53 and p27 proteins and their genes in DU-145

cells are similar. The effect of Dox on the expression of p27 and

p53 proteins differ between cell types, so in MCF-7 cells, it

decreased p27 protein expression, whereas it up-regulated p53

and p21 levels. In contrast, in MDA-MB-231 cells, p27 levels were

unaffected by Dox treatment (Bar-On et al., 2007). Our results

showed that the combination of both drugs had no effect on

expression of p53, but resulted in a reduction in p27. Mutational

inactivation of p53 is frequently observed in various human

cancers (Wang et al., 2004). Other studies reported that Dox

triggers different pathways involved in cell death, such as the

activation of serine proteases, which occurs in parallel and

upstream of caspase activation (Grassilli et al., 2004).

In DU-145 and LNCaP cells, Dox causes G2/M arrest,

whereas PectaSol treatment showed sub-G1 arrest. PectaSol

seems to strongly synergize in its therapeutic effect with Dox in

advanced human PCa DU-145 cells by inducing more apoptosis

(sub-G1 arrest) and in LNCaP cells via G2/M arrest. Dox causes

G2/M arrest in DU-145 cells (Tyagi et al., 2002) and another

study showed that Dox induced G2/M arrest in MDA-MB-231

cells, but both G1/S and G2/M arrest in MCF-7 cells (Bar-On

et al., 2007). Pectin is capable of inducing apoptosis in

androgen-responsive (LNCaP) and androgen-independent

(LNCaP C4-2) human PCa cells (Jackson et al., 2007). MCP

also can increase the apoptotic response of tumour cells to

chemotherapy (Yan and Katz, 2010).

Our findings show that the combination effects of PectaSol

and Dox in DU-145 cells on cycle progression is not related to

p53 and p27 genes and their protein expression; however, it is

associated with p53 and p27 gene expression in LNCaP cells. p53

and p27 are important regulators of cell cycle progression, but

several other factors can induce arrest independent of p53

(Manna et al., 2010). Therefore, PectaSol synergy in combination

with Dox chemotherapy and its related effects on cyclin-

dependent kinase inhibitor function leads to the suggestion that

modulation of checkpoint regulators may contribute to the latter’s

cytotoxicity (Bar-On et al., 2007).

5. Conclusion

PectaSol effectively enhances the effects of Dox and may be

useful anticancer agent for PCa, as shown in the cell lines, LNCaP

and DU-145.

In LNCaP cells, the combination of PectaSol and Dox can

inhibit growth and cause apoptosis partially through the activation

Figure 6 Effect of PectaSol and Dox p27 protein expression in DU-145 and LNCaP cell linesDetermination of protein p27 expression in DU-145 and LNCaP cell lines after in vitro treatment with PectaSol or Dox either alone or in combination.*P,0.05 compared with untreated cells (control), £P,0.05 compared with PectaSol, #P,0.05 compared with PectaSol/Dox.



of p53 signal pathway and p27 expression, as well as G2/M arrest

in cell cycle progression. However, this combination had no effect

on expression of p53 and p27 in DU-145, in which other pathways

than p53 may be involved in induction of apoptosis (sub-G1

arrest). The findings demonstrated that PectaSol can synergisti-

cally enhance Dox toxicity in vitro independent of androgen

dependency. The data can support the role of this dietary

carbohydrate compound as a chemotherapeutic supplement that

could be given at relatively low doses of Dox, indicating that it is

worthwhile undertaking further clinical and basic science investi-

gations.

Figure 7 Effect of PectaSol and Dox alone and in combination on cell cycleprogression of DU-145 cell line

Cells were treated with either media alone, 250 nM Dox, 3 mg/ml PectaSol (pect),250 nM Dox and 24 h later with 3 mg/ml Pectasol, 3 mg/ml Pect and 250 nMDox24 h later; or a combination of both 250 nM Dox and 3 mg/ml Pect for 48 h. At theend of treatments, cells were harvested and stained with PI for flow cytometry. Thepercentage of cells in sub-G1 (A), G1 (B), S (C), or G2/M (D) phases represent means ofthree independent samples at each treatment, which were reproducible in threeindependent experiments.

Figure 8 Effects of PectaSol and Dox alone and in combination on cell cycleprogression in the LNCaP cell line

Cells were treated with either media alone (control), 290 nM Dox, 4 mg/ml Pectasol,290 nM Dox and 4 mg/ml Pectasol 24 h later, 4 mg/ml Pect and 290 nM Dox 24 hlater, or a combination of both for 48 h. At the end of treatments, cells were harvestedand stained with PI for flow cytometry. The data shown for the percentage of cells insub-G1 (A), G1 (B), S (C), or G2/M (D) phases are means of three independent samplesin each treatment, which were reproducible in three independent experiments.

Cell Biol. Int. (2012) 36, 601–610


Author contribution

Najmeh Tehranian is the main author. Houri Sepehri and Parvin

Mehdipour are the first and second supervisors. Firouzeh

Biramijamal and Arash Hossein-Nezad are the first and second

advisors. All other authors are collaborators.

Acknowledgments

We acknowledge the contribution of Ladan Delph, Ziba Maghboli,

Maryam Mobiny and Hossain Asgarian for their assistance.

Funding

This study was supported by a research grant from the Science

Faculty of Tehran University.

ReferencesBar-On O, Shapira M, Hershko DD. Differential effect of doxorubicin

treatment on cell cycle arrest and SKP2 expression in breastCancer cells. Anticancer Drugs 2007;18:1113–21.

Collins L, Zhu T, Guo J, Xiao ZJ, Chen C-Y. Phellinus Linteus sensitisesapoptosis induced by doxorubicin in prostate cancer. Br J Cancer2006;95:282–8.

Elsadek B, Graeser R, Esser N, Schafer-Obodozie C, Tsurumi C, AbuAjaj K. In vivo evaluation of a novel albumin-binding prodrug ofdoxorubicin in an orthotopic mouse model of prostate cancer(LNCaP). Prostate Cancer Prostatic Dis 2011;14:14–21.

Glinsky VV, Raz A. Modified citrus pectin anti-metastatic properties: onebullet, multiple targets. Carbohydr Res 2009;344:1788–91.

Grassilli E, Ballabeni A, Maellaro E, Del Bello B. Loss of MYC confersresistance to Doxorubicin-induced apoptosis by preventing theactivation of multiple serine protease- and caspase-mediatedpathways. J Biol Chem 2004;279:21318–26.

Guess BW, Scholz MC, Strum SB, Lam RY, Johnson HJ. Modified citruspectin (MCP) increases the prostate-specific antigen doubling timein men with prostate cancer: a phase II pilot study. Prostate CancerProstatic Dis 2003;6:301–4.

Jackson CL, Dreaden TM, Theobald LK, Tran NM, Beal TL, Eid M. Pectininduces apoptosis in human prostatic cancer cells: correlation ofapoptotic function with pectin structure. Glycobiology2007;17:805–19.

Johnson KD, Glinskii OV, Mossin VV, Turk JR. Galactin-3 as a potentialtherapeutic target in tumors arising from malignant. Neoplasia2007;9:662–70.

Kang J, Bu J, Hao Y, Chen F. Subtoxic concentration of doxorubicinenhances TRAIL-induced apoptosis in human prostate cancer cellline LNCaP. Prostate Cancer Prostatic Dis 2005;8:274–9.

Kim DW, Kim KO, Shin MJ, Ha JH. siRNA-based targeting ofantiapoptotic genes can reverse chemoresistance in P-glycoprotein expressing chondrosarcoma cells. Mol. Cancer2009:8:28.

Manna SK, Gangadharan C, Edupalli D. Ras puts brake doxorubicinmediated cell death in p53 expressing cells. J. Biol. Chem.2010;286:7339–47.

Mantena SK, Sharma SD, Katiyar SK. Berberine, a natural product,induces G1-phase cell cycle arrest and caspase-3-dependentapoptosis in human prostate carcinoma cells. Mol Cancer Ther2006;5:296–308.

Neheme A, Varadarajan P, Sellakumar G, Gerhold M, Niedner H, ZhangQ et al. Modulation of docetaxel induced apoptosis and cell cyclearrest by all-trans retinoic acid in prostate cancer cells. Br J Cancer2001;84:1571–1576.

Opel D, Westhoff M, Bender A, Braun V, Debatin K, Fulda V.Phosphatidylinositol 3-kinase inhibition broadly sensitizesglioblastoma cells to death receptor and drug induced apoptosis.Am Assoc Cancer Res 2008;68:6271–80.

Pulukuri S, Knost J, Estes N, Rao JS. Small interfering RNA (siRNA)-directed knockdown of uracil DNA glycosylase induces apoptosisand sensitizes human prostate cancer cells to genotoxic stres. MolCancer Res 2009;7:1285–93.

Rabi T, Bishayee A. d-Limonene sensitizes docetaxel-inducedcytotoxicity in human prostate cancer cells: generation of reactiveoxygen species and induction of apoptosis. J. Carcinog.2009:8–9.

Sanches C, Mendoza P, Contreras HR, Vergara J. Expression ofresistance proteins in prostate cancer is related with cell sensitivityto chemotherapeutic drugs. Prostate 2009;69:1448–59.

Servida F, Lecis D, Scavullo C. Novel second mitochondria-derivedactivator of caspases (Smac) mimetic compounds sensitize humanleukemic cell lines to conventional chemotherapeutic drug-inducedand death receptor-mediated apoptosis. Invest New Drugs2011;29:1264–75.

Tyagi AK, Singh RP, Agrawal C, Chan DCF, Agrawal R. Silibinin stronglysynergizes human prostate carcinoma DU-145 cells todoxorubicin-induced growth inhibition, G2-M Arrest, andapoptosis. Clin Cancer Res 2002;8:3512–9.

Wu XX, Kakehi Y, Mizutani Y, Kamoto T, Kinoshita H, Isogawa Y.Doxorubicin enhances TRAIL-induced apoptosis in prostatecancer. Int J Oncol 2002;20:949–54.

Wang S, Konorev EA, Kotamraju S, Joseph J, Kalivendi S, KalyanaramanB. Doxorubicin induces apoptosis in normal and tumor cells viadistinctly different mechanisms. J Biol Chem 2004;279:25535–43.

Yan J, Katz A. PectaSol-C modified citrus pectin induces apoptosis andinhibition of proliferation in human and mouse androgen-dependentand -independent prostate cancer cells. Integr Cancer Ther2010;9:197–203.

Received 25 May 2011/ 19 September 2011; accepted 4 January 2012

Published as Immediate Publication 4 January 2012, doi 10.1042/CBI20110309



Combination effect of PectaSol and Doxorubicin on viability, cell cycle arrest and apoptosis in...

Documents

Transcript of Combination effect of PectaSol and Doxorubicin on viability, cell cycle arrest and apoptosis in...