899

q 2000 The Society for the Study of Evolution. All rights reserved.

Evolution, 54(3), 2000, pp. 899–910

CLOSE GENETIC SIMILARITY BETWEEN TWO SYMPATRIC SPECIES OF TEPHRITIDFRUIT FLY REPRODUCTIVELY ISOLATED BY MATING TIME

JENNIFER MORROW,1 LEON SCOTT,2,3 BRADLEY CONGDON,2,4 DAVID YEATES,2 MARIANNE FROMMER,1 AND

JOHN SVED1,5

1Fruit Fly Research Centre, School of Biological Sciences, A12, University of Sydney, New South Wales 2006, Australia2Department of Zoology and Entomology and Cooperative Research Centre for Tropical Pest Management,

University of Queensland, Brisbane, Queensland 4072, Australia3Centre for Plant Conservation Genetics, Southern Cross University, P.O. Box 157, Lismore, New South Wales 2480, Australia

4School of Tropical Biology, James Cook University, P.O. Box 6811, Cairns, Queensland 4870, Australia5E-mail: jsved@mail.usyd.edu.au

Abstract. Two sibling species of tephritid fruit fly, Bactrocera tryoni and B. neohumeralis, occur sympatricallythroughout the range of B. neohumeralis in Australia. Isolation between the two species appears to be maintained bya difference in mating time: B. tryoni mates at dusk, whereas B. neohumeralis mates during the middle of the day. Amorphological difference in humeral callus color also distinguishes the two species. Despite clear phenotypic evidencethat B. tryoni and B. neohumeralis are distinct species, genetic differentiation as measured by four markers—nuclearDNA sequences from the white gene and the ribosomal internal transcribed spacer (ITS2), and mitochondrial DNAsequences from the cytochrome b (cytb) and cytochrome oxidase subunit II (COII) genes—is very small. Minor fixeddifferences occur in the ITS2 sequence, however, in all other cases the two species exhibit a high level of sharedpolymorphic variation. The close genetic similarity suggests either that speciation has occurred very rapidly andrecently in the absence of any mitochondrial DNA sorting or that the sharing of polymorphisms is due to hybridizationor introgression. A third species within the tryoni complex, B. aquilonis, is geographically isolated. Bactrocera aquilonisis also genetically very similar, but in this case there is clear differentiation for the mitochondrial loci. The threespecies form a group of considerable interest for investigation of speciation mechanisms.

Key words. DNA, fruit fly, mating isolation, speciation, sympatry, tephritid.

Received April 27, 1999. Accepted January 6, 2000.

The Queensland fruit fly Bactrocera tryoni (Diptera: Te-phritidae) is the most destructive pest of horticulture in east-ern Australia, due in part to its wide bioclimatic potential(Meats 1981) and its ability to lay eggs in almost all com-mercially grown fruit (Bateman 1991). The tryoni complex,a grouping of three sibling species native to Australia, alsoincludes the pest B. neohumeralis and the relatively benignB. aquilonis (Drew 1989).

Bactrocera tryoni and B. neohumeralis occur sympatrically,with the distribution of B. neohumeralis contained entirelywithin the wider distribution of B. tryoni. Whereas B. tryonihas shown its ability to expand its range as far as the NorthernTerritory (Osborne et al. 1997), B. neohumeralis has exhibiteda comparatively small increase in range and is limited to anarrow coastal strip of Queensland and northern New SouthWales. Within its range, B. neohumeralis may be as seriousa pest as B. tryoni. Both species utilize a large number ofendemic wild (forest) fruits and almost all cultivated fruits,with only some difference in the wild host fruit preference(R. A. I. Drew, pers. comm.). Indeed, larvae of both speciesare known to emerge from a single piece of fruit (Gibbs1967).

Morphologically, the two species can be differentiated bythe color of the humeral calli—yellow in B. tryoni and brownin B. neohumeralis; however, individuals with intermediatecoloring do occur in the wild at low frequency (Birch 1961;Wolda 1967a; Gibbs 1968; Birch and Vogt 1970). A differ-ence in mating times between the two species provides theonly apparent means of maintaining speciation. Mating of B.tryoni at dusk and B. neohumeralis in the middle of the dayis maintained under laboratory conditions. In both species

the timing is controlled by the interaction of light intensity(with a peak response elicited from B. tryoni at 9 lux and B.neohumeralis at over 10,000 lux) and a circadian clock mech-anism, which appears to be common between the two species(Smith 1979). The courtship behavior of B. tryoni often in-volves aggregating on the windward side of the canopy of ahost tree, although this aggregation is not essential for suc-cessful mating (Tychsen 1977), and then settling down tostridulate and release pheromone to attract females (Fletcher1968). Although B. neohumeralis does not appear to formaggregations, B. tryoni and B. neohumeralis share a similarstridulating behavior (Myers 1952) and identical chemicalmakeup of the male pheromones (Bellas and Fletcher 1979).

Despite the similarities, the difference in mating times isa significant prezygotic isolating mechanism. In the labora-tory, however, mating isolation is not absolute: Interspecificmatings can be made to occur and yield viable and fertilehybrids with an intermediate callus coloration, which is in-distinguishable from field-caught intermediates (Smith1979). The question of whether individuals with intermediatecoloration are species variants or interspecies hybrids wasdebated in the early literature. Birch (1961) collected fliesfrom Cairns and Brisbane and found that up to 11% wereintermediate forms, but no intermediates were found in thelarge Sydney samples examined. This result was taken toindicate hybridization occurring between B. tryoni and B.neohumeralis, and the species were the object of a classicstudy on effects of introgression (Lewontin and Birch 1966).However, Wolda (1967a) found no correlation between theproportions of intermediates and the relative numbers of B.tryoni and B. neohumeralis at those same localities, as would

900 JENNIFER MORROW ET AL.

be expected if the source were primarily hybridization. Fur-thermore, Wolda (1967b) argued that there exists ample var-iation within each of the two sympatric species to accountfor the range of humeral callus colors exhibited in wild flieslabeled as intermediates.

The third sibling species, B. aquilonis, is morphologicallyvery similar to B. tryoni, but has a narrower host range anda different endemic wild host range. The distribution of B.aquilonis is restricted to the north of the Northern Territoryand Western Australia and, for many years, did not overlapwith that of B. tryoni. Bactrocera aquilonis mates at dusk andis able to mate freely with B. tryoni to produce fertile off-spring in the laboratory (Drew and Lambert 1986).

Thus, there are two major problems relating to geneticdifferentiation of species within the tryoni complex. The firstis that the separate species status of B. tryoni and B. aquilonishas yet to be defined. The second is that the extent to whichgenetic introgression occurs between B. tryoni and B. neo-humeralis has not been firmly established so there is stilluncertainty as to whether flies with intermediate morphologyare species variants or hybrids. McKechnie (1975), usingisozymes to investigate genetic differentiation between B.tryoni and B. neohumeralis, found some differences in fre-quencies of polymorphic loci, but failed to find fixed differ-ences between the two species. Because isozymes are subjectto clear functional constraints and the two species are sosimilar in their interactions with environmental factors, itseems possible that the limited isozyme variation might occurin the presence of considerable genetic variation at the DNAlevel. The aim of the present study was to investigate, throughanalysis of DNA sequences of individual flies from variouspopulations, the extent of genetic differentiation between thethree sibling species of the tryoni complex.

Variation in DNA sequence between closely related specieshas been found in mitochondrial genes (Smith and Bush1997) and in coding and noncoding regions of nuclear DNA(Kliman and Hey 1993). We have taken a multilocus ap-proach to investigate the genetic basis of the speciation pro-cesses in the tryoni complex. Loci were selected to providea range of sequences with various evolutionary rates, in-cluding segments of the mitochondrial cytochrome b (cytb)and cytochrome oxidase subunit II (COII) genes, introns andexons of the white eye-color gene, and the ribosomal RNAgene internal transcribed spacer 2 (ITS2).

MATERIALS AND METHODS

DNA Extraction

Total DNA was extracted from individual flies by boilinga tissue grindate in a suspension of Chelex 100 resin (Walshet al. 1991; Moritz et al. 1992). The head of one fly wasplaced in a microcentrifuge tube on dry ice and mashed witha wooden stick; 1 ml of a suspension of 5% Chelex 100(BioRad Laboratories, Hercules, CA) in 10 mM Tris, 0.1 mMEDTA, pH 7.5, at close to 1008C, was added to the tube andvortexed briefly before boiling for 15 min. The extract wasstored in the presence of the Chelex 100 resin at 48C or2208C. Once DNA had been prepared, the remaining partsof the fly were stored individually at 2708C, cross-referencedto the DNA extract, and thus were available for morpholog-

ical examination subsequent to DNA analysis. The DNApreparations were centrifuged at 13,000 rpm for 3–5 min priorto removal of an aliquot for polymerase chain reaction (PCR).

Polymerase Chain Reaction Amplification and Sequencing

PCR amplification and subsequent direct sequencing of PCRproducts were performed using the following oligonucleotideprimers: cytb: CytB1: 59ACCAGCTCCAATTAATATTT-CAAGATGATGA 39 (Kocher et al. 1989) and CytB2: 59TA-CAGTTGCTCCTCAAAATGATATTTGTCCTCA 39 (Ko-cher et al. 1989); COII: TL2-J-3037: 59 ATGGCAGATTA-GTGCAATGG 39 (Simon et al. 1994) and TK-N-3785: 59GTTTAAGAGACCAGTACTTG 39 (Simon et al. 1994);white: W2: 59 GAGGACGAGAATGGATTTACA 39, Tron4a:59 GTCCCAGAAAGATCAGTCCA 39, and Tron5: 59GTGTCACAGCGATAAAGTC 39; ITS2: 5.8S: 59 TGTGAACTGCAGGACACAT 39 (Porter and Collins 1991) and 28S:59 TATGCTTAAATTCAGGGGGT 39 (Porter and Collins1991).

For amplification of the cytb and white fragments, 100 mlPCR reactions were prepared using the enzyme Tth Plus DNApolymerase (Biotech International, Acacia Ridge, Queensland,Australia), with the 103 reaction buffer supplied by the man-ufacturer. The cytb reactions contained 13 reaction buffer, 4mM MgCl2, 200 mM each dNTP, 0.3 mM each primer, 4 unitsDNA polymerase, and 5 ml DNA template. The white reactionscontained 13 reaction buffer, 1.5 mM MgCl2, 200 mM eachdNTP, 0.6 mM each primer, 2.5 units DNA polymerase, and12 ml DNA template. PCR was carried out in a Hybaid (Mid-dlesex, U.K.) Omnigene thermal cycler, with the followingprograms: cytb: one cycle of 948C for 3 min, 508C for 1 min,728C for 1 min; 35 cycles of 948C for 50 sec, 508C for 50 sec,728C for 50 sec; one cycle of 728C for 5 min; white: one cycleof 948C for 3 min, 608C for 1 min, 728C for 1 min; 35 cyclesof 948C for 1 min, 608C for 1 min, 728 for 1 min; one cycleof 728C for 5 min. PCR products were gel purified and directlysequenced using Sequenase version 2.0 (USB Corp., ClevelandOH,) or automated sequencing supplied by SUPAMAC (ABIModel 377, version 3.0, Perkin Elmer, Norwalk, CT).

For COII and ITS2, PCR amplifications were carried outin an FTS-1 Thermal Sequencer (Corbett Research, Sydney,Australia). The COII reactions (20 ml) contained 1.253 PCRbuffer (Boehringer, Mannheim, Germany), 1.9 mM MgCl2,250 mM each dNTP, 0.5 mM each primer, 1.25 units TaqDNA polymerase (Boehringer Mannheim), and 2 ml templateDNA. The ITS2 reactions (20 ml) contained 13 PCR buffer(Boehringer Mannheim), 2.5 mM MgCl2, 100 mM eachdNTP, 1 mM each primer, 2.5 units Taq DNA polymerase(Boehringer Mannheim), and 2 ml template DNA. Amplifi-cation programs comprised the following steps: COII: onecycle of 948C for 60 sec; 26 cycles of 948C for 10 sec, 558Cfor 10 sec, 728C for 90 sec; one cycle of 728C for 5 min;ITS2: initial denaturation of 948C for 2 min; 30 cycles of948C for 30 sec, 558C for 30 sec, 728C for 90 sec; finalextension at 728C for 5 min. PCR products were purifiedusing Microcon 100 microconcentrators (Millipore Corp,www.millipore.com/amicon). Direct sequencing of double-stranded PCR products was performed using a Prism-Ready

901GENETIC SIMILARITY OF SYMPATRIC SPECIES

FIG. 1. Map of mainland Australia showing geographic ranges ofBactrocera tryoni, B. neohumeralis, and B. aquilonis. Fruit fly sam-pling sites are Cairns (178S, 1458459E); Rockhampton (238309S,1508309E); Brisbane region including Nambour (268309S, 1538E),Brisbane (278309S, 1538E), Toowoomba (278459S, 1528E) and Tam-borine Mountain (278559S, 1538109E); Murwillumbah (288159S,1538309E); Gosford (338259S, 1518209E); and Young (348209S,1488209E). The B. aquilonis flies were sampled from a number oflocalities within their distribution in Western Australia (i.e., onlyareas to the west of the Northern Territory border).

reaction dye terminator cycle sequencing kit and an ABI373A automated sequencer (Perkin-Elmer).

Methods of Analysis

The low levels of difference found between species ne-cessitates the use of significance tests. We have carried outstatistical tests for differences between pairs of species in thefour loci examined. Analyses were made to test for differ-entiation between the two sympatric species with mating iso-lation, B. tryoni and B. neohumeralis, and between the twoallopatric species without mating isolation, B. tryoni and B.aquilonis. Two types of tests have been used (Hudson et al.1992). The first type uses the observed numbers of individualswith particular genotypes in the two species, but does nottake into account differences between the alleles. Probabil-ities for this frequency test were calculated directly from anexact Fisher’s 2 3 2 test program for the ITS2 sequence andMonte-Carlo program for R 3 C tables, both supplied by W.R. Engels (Department of Genetics, University of Wisconsin,Madison, WI 53705), and using the permutation test fromArlequin (http://anthropologie.unige.ch/arlequin). It shouldbe noted that a test for differences in frequencies, when ap-plied between species, is a very weak test.

The second type of test takes into account only the ge-notypes and not their frequencies. Two statistics have beencalculated for these gene distance tests. The first, the Beppitest (van Holst Pellekaan et al. 1998), classifies all pairs ofsequences, both within and between species, and tests wheth-er the proportion of between-species pairs rises as the numberof differences between sequences increases. The second test,which is a clustering test based on the median network anal-ysis of Bandelt et al. (1995), looks at the size of within-species clusters using a permutation test of sequences to judgesignificance. Computer programs to generate these statisticsare available on request. Results for the two tests (see below)show that they lead to similar abilities to judge significance,although the magnitudes of the probabilities given by the twotests vary somewhat.

Sequences were analyzed using neighbor-joining and par-simony trees from the PHYLIP program set (Felsenstein1993).

RESULTS

Mitochondrial Genes

Cytochrome b. Sequences of a 373-bp segment of the mi-tochondrial cytb gene were obtained for 36 individuals of B.tryoni and 33 individuals of B. neohumeralis, classified ac-cording to humeral callus coloration, sampled from a numberof locations spread over approximately 1500 km along thenortheastern coast of Australia (Fig. 1). Because B. tryoniflies are believed to have infested parts of the Northern Ter-ritory and to have hybridized with the local B. aquilonis flies,sequence analysis was carried out on nine individuals of B.aquilonis from a limited area of northern Western Australia,where there has been no evidence of B. tryoni invasion. Thesequences, listed in Figure 2 with the sampling locations, areextremely variable within species. Across the 373-bp product,33 polymorphic sites are present in the tryoni complex flies,

with an additional 23 sites when two B. jarvisi outgroupindividuals are included in the analysis.

Cytochrome oxidase II. The 30 tryoni complex flies se-quenced over this region (316 bp) showed 25 polymorphicsites, with 25 additional sites upon inclusion of two B. jarvisiindividuals (Fig. 3). The dataset includes 19 individuals (un-derlined in Figs. 2, 3) sequenced for both the cytb and COIIregions.

Nuclear Loci

White gene. A 434-bp segment of the white gene, ex-tending from exon 4B to exon 6 (Bennett and Frommer 1997),was amplified from genomic DNA using the primers W2 andTron5 and was sequenced directly using these primers andthe internal primer, Tron4a. Heterozygotes were found rou-tinely in the 29 individuals that were sequenced for this re-gion, particularly in B. tryoni and B. neohumeralis (Fig. 4).Except for isolated base substitutions in single flies, the samesites are polymorphic in all three species and there are nofixed differences between the species. The sequences appearto represent a set of haplotypes that arise by recombinationfrom an original pair of sequences. We could infer a limitednumber of recombination points that accounted for all ge-notypes. Three recombination points appear to be conservedbetween B. tryoni and B. neohumeralis, one of which is pre-sent in all three species (Fig. 4). However, the frequenciesof polymorphisms appear to differ between the three species,in particular between B. neohumeralis and B. aquilonis.

ITS2. In a set of 27 tryoni complex flies, no variation was

902 JENNIFER MORROW ET AL.

FIG. 2. Polymorphic sites within a segment of the mitochondrial cytochrome b gene. Individuals of the sibling species, Bactrocera tryoni, B.neohumeralis, and B. aquilonis, sourced from different geographic locations, were sequenced across the cytb region with nucleotides numberedfrom 1 to 373. Bactrocera jarvisi from Western Australia is included as an outlier group. This figure shows only the polymorphic sites andtheir position, with the designated common and alternative bases. Individuals also included in the COII dataset (Fig. 3) are underlined.

903GENETIC SIMILARITY OF SYMPATRIC SPECIES

FIG. 3. Polymorphic sites within a segment of the mitochondrial cytochrome oxidase II gene. Individuals of the sibling species,Bactrocera tryoni, B. neohumeralis, and B. aquilonis, and the outlier group, B. jarvisi, sourced from different geographic locations,were sequenced across the COII region with bases numbered from 1 to 316. This figure shows only the polymorphic sites and theirposition, with the designated common and alternative bases. This dataset shares some common individuals (shown here underlined)with the cytb set (Fig. 2).

found within any of the three species for the 550-bp ITS2sequence (Fig. 5). Bactrocera neohumeralis was distin-guished from B. tryoni and B. aquilonis by three sites, twosingle-nucleotide changes and a trinucleotide duplication.The outlier group B. jarvisi has 16 sites not found in any ofthe sibling species.

Analysis

Testing for population structure within species

The data for B. tryoni show no sign of geographic differ-entiation, although the limited number of individuals thatwere sequenced, combined with the high variability, reducethe power of any test to detect such differentiation. However,population subdivision within the range of Queensland, fromwhich most of the samples were taken, has also not beendetected using much more substantial microsatellite data (H.

Yu, M. Frommer, M. K. Robson, and J. A. Sved, pers.comm.).

For B. neohumeralis, the situation appears to be different.The data for COII (Fig. 3) indicate differences between theCairns (northern) and Nambour (southern) samples. Despitethe small sample size (11), this difference is significant atthe 1% level using the Beppi test. For the cytb locus, thedifferences are nonsignificant (0.10 , P , 0.20).

Testing for differentiation between species

Identical mitochondrial cytb genotypes from Figure 2 havebeen grouped in Figure 6. Sequences are grouped by phy-logenetic analysis as discussed below. The 78 tryoni complexindividuals are represented by 42 unique genotypes. Of these,22 genotypes occur in the B. tryoni flies, 21 in B. neohumeralisflies, and seven genotypes are present in the set of nine B.

904 JENNIFER MORROW ET AL.

FIG. 4. The polymorphic sites in the white gene sequences. Polymorphisms common to more than one individual in the tryoni complexare shown here, listed according to species and geographic origin. Position numbers relate to the polymerase chain reaction fragmentdefined by primers W2 and Tron5. The polymorphic sites can be classified in each individual as homozygous for the sequence obtainedfrom a Bactrocera tryoni library (lambda clone), a different homozygous nucleotide (alternative), or both nucleotides found in the diploidnuclear DNA (heterozygote). The shading highlights the shared polymorphisms and common points of recombination.

aquilonis flies. Seven of the 42 genotypes are shared betweenB. tryoni and B. neohumeralis, and one genotype is commonto a single fly from each B. neohumeralis and B. aquilonis.No genotypes are shared between B. tryoni and B. aquilonis.One A-to-G transition (site 166), which is rare in both B.tryoni and B. neohumeralis, is fixed in B. aquilonis. The B.aquilonis individuals are polymorphic for an A-to-G transi-tion at site 241, which is invariant in B. tryoni and B. neo-humeralis. These differences appear to indicate a distinct ge-netic divergence between B. aquilonis and the east coast flies,

which is confirmed by a statistical analysis of between-spe-cies and within-species variation. All 56 polymorphisms in-volve synonymous substitutions. Complete evolutionary con-servation of the cytochrome b protein exists within the tryonicomplex and the B. jarvisi outgroup.

The equivalent grouping for COII is shown in Figure 7.There were 23 unique mitochondrial genotypes, one of whichwas represented in both B. tryoni and B. neohumeralis. Bac-trocera tryoni exhibited 11 genotypes and B. neohumeralis12 genotypes. The three B. aquilonis individuals, each an

905GENETIC SIMILARITY OF SYMPATRIC SPECIES

FIG. 5. Summary of the ITS2 sequencing results. Limited polymorphisms are found within the tryoni complex flies, with no specificvariation within or between geographic locations. The number of individuals sequenced for each species from each region is shown tothe right of the polymorphic sites.

independent sample, displayed only one genotype, which wasnot observed in either B. tryoni or B. neohumeralis but thatdiffered by only one nucleotide from the most abundant ge-notype shared by the sympatric species. This is the only caseof a fixed difference between species in the mitochondrialdata.

Significance tests

For the comparison between B. tryoni and B. neohumeralis,results of the tests are summarized in Table 1. The ITS2 locusclearly differentiates the two species, but there is only onemarginally significant value in all comparisons between theother three loci. The fixed differences in ITS2 between thetwo species is in line with the species status. However, thelack of differentiation between species in the remaining threegenes is striking (see Brussard et al. 1985, table 3).

The frequency comparison between B. tryoni and B. neo-humeralis for cytb uses a contingency table with 36 rows andtwo columns, labeled Bt and Bn, based on the data presentedin Figure 6. The table contains 44 rows, but reduces to 36rows when those with no observations from B. tryoni and B.neohumeralis are excluded. The test gave a probability ofclose to 0.99 for finding the observed differences betweenthe two species under the null hypothesis of no difference,that is, a highly nonsignificant result. By removing rows witha unique observation, the probability falls to 0.37 (Table 1,row 1), which is still not significant. The equivalent test forCOII is a very weak one, due to the fact that only one se-quence is present in more than one individual (Fig. 7).

The significance tests for the white sequences are compli-cated by the fact that the sequencing involves diploid indi-viduals. We used the data from diploid individuals to con-struct the minimum number of gamete types (haplotypes) thatcould account for the observed genotypes in all three species.More than half of the sequences (16 of 29) could be assignedwithout ambiguity. We then used the inferred haplotypes andconstructed all possible haplotypes differing from these bya single recombination point. In this way we were able toaccount for all of the observed genotypes. There were manypossible assignments for the ambiguous genotypes. However,we carried out x2 tests for each assignment and found littlevariation between them. The same minimum number of hap-lotypes (nine) and the same potential recombination sites are

present regardless of the assignment in ambiguous cases. Thevalues in Table 1 (column 4) are based on one arbitrarilychosen assignment.

Equivalent results for the comparison between B. tryoniand B. aquilonis are summarized in Table 2. In this case allindividuals contain identical ITS2 genotypes. However, high-ly significant differences are revealed for the cytb locus.

We analyzed the cytb sequences using evolutionary treeprograms (Felsenstein 1993) for neighbour-joining, UPGMA,and maximum parsimony, despite the evidence from Table1 that such an approach will not differentiate B. tryoni andB. neohumeralis. Both programs showed a well-establisheddivergence of the mitochondrial types into at least three majorclasses. The genetic distance methods showed an additionalconsistent subdivision of one clade into two distinct clusters.The four clusters of sequence types are indicated in Figure6. Bactrocera tryoni and B. neohumeralis individuals werescattered among all four sequence clusters. In contrast, B.aquilonis individuals showed a much more restricted distri-bution, appearing in only one of the four clusters.

For the 19 individuals (as listed in Figs. 2, 3) that weresequenced for both mitochondrial genes, we tested for con-formity of the two datasets. For each pair of sequences, wecalculated a distance, in terms of numbers of substitutions,for each of the two genes. A correlation of only 0.25 wasfound between the two distance measures. In a permutationtest of the 19 sequences of each gene, we found that in morethan 10% of cases, random permutation of the sequencesproduced a higher correlation. This appears to indicate eitherthat the phylogenies for cytb and COII are not well establishedor that there has been some mitochondrial recombination thatdisassociated the two.

DISCUSSION

Comparison of Sympatric and Allopatric Species

The sibling species, B. tryoni and B. neohumeralis, aremaintained in sympatry by a clear isolating mechanism: B.tryoni mates within a small window of light intensities atdusk and B. neohumeralis mates in bright light during themiddle of the day. This implies that B. neohumeralis and B.tryoni must show significant genetic differentiation in genesthat determine mating time. Other genetic differences include

906 JENNIFER MORROW ET AL.

FIG. 6. Summary of mitochondrial cytochrome b genotypes. Identical genotypes from Figure 2 are grouped according to sequenceclusters identified by phylogenetic analyses. The number of individuals from each species having each genotype is listed to the right ofthe polymorphic sites (Bt, Bactrocera tryoni; Bn, B. neohumeralis; Ba, B. aquilonis; Bj, B. jarvisi).

those that determine callus color and probably genes thatdefine the climatic range of the species. Nonetheless, thesedemarcations occur in the absence of DNA sequence differ-entiation at three of the four loci studied. Sequences fromthe two mitochondrial genes, cytb and COII, and the nuclearwhite gene show high levels of polymorphism combined witha high degree of sharing of polymorphism. The most exten-sive data were obtained for the cytb locus. All significancetests for this locus, including frequency and genotype tests,were either negative or only marginally significant at the 5%level. The similarity between B. tryoni and B. neohumeralisfor the cytb gene is emphasized by the fact that there are

eight cases where mitochondrial genotypes are present inmore than a single copy, and in seven of these the genotypeis present in both species. The fourth locus, ITS2, shows lowlevels of polymorphism and three fixed differences betweenthe species. The fixed sequence difference is in line with themorphological differences between the species for humeralcallus colors and mating behavior, but this extent of differ-entiation in the rapidly evolving ribosomal ITS sequences isoften characteristic of population-level rather than species-level divergence (Bakker et al. 1992; Manguin et al. 1999).Thus, the principal interests of this paper lie in the compar-ison of the sympatric sibling species B. tryoni and B. neo-

907GENETIC SIMILARITY OF SYMPATRIC SPECIES

FIG. 7. Summary of mitochondrial cytochrome oxidase II genotypes. Identical genotypes from Figure 3 are grouped, with the columnson the right displaying the number of individuals from each species having each genotype (Bt, Bactrocera tryoni; Bn, B. neohumeralis;Ba, B. aquilonis; Bj, B. jarvisi).

TABLE 2. Significance tests for the difference between Bactroceratryoni and B. aquilonis. The values in the table are the probabilitiesof finding the observed differences between the two species under thenull hypothesis of no difference.

Sequence ITS2 cytb COII white

Frequencies 1.0 0.002 0.02 0.15Beppi test —1 0.0005 0.6 0.56Cluster test —1 0.0007 0.5 —2

1 There is only one sequence, and no test is possible in this case.2 The potential for recombination invalidates the clustering test.

TABLE 1. Significance tests for the difference between Bactroceratryoni and B. neohumeralis. The values in the table are the probabilitiesof finding the observed differences between the two species under thenull hypothesis of no difference.

Sequence ITS2 cytb COII white

Frequencies ,0.00001 0.37 —1 0.07Beppi test —2 0.11 0.12 0.09Clustering test —2 0.04 0.47 —3

1 As seen from Figure 7, most genotypes are unique and the frequency testhas no power.

2 Because there are only two sequence types, any test that does not takefrequencies into account lacks resolving power.

3 The potential for recombination invalidates the clustering test.

humeralis and in the explanation for their origin and coex-istence.

The geographically isolated species, B. tryoni (Queenslandfruit fly) and B. aquilonis (Northern Territory fruit fly), differin pest status, based on host fruit preferences, but show verylittle morphological differentiation. There is no evidence forthe evolution of any pre- or postzygotic isolation mechanism.However, some divergence has occurred in the mitochondrialgenes, with possibly a single nucleotide fixed difference inthe COII locus and substantial difference in the frequency oftwo variable sites in the cytb locus. Compared to the extensiveshared polymorphism between B. tryoni and B. neohumeralis,analysis of the polymorphic sites in the cytb sequences of B.tryoni and B. aquilonis showed a strikingly different picture.In this case, all three tests indicated species differentiation,

significant at the 1% or 0.1% level. Thus, the two speciesrepresent a pair of taxa that appear to have become geo-graphically isolated in very recent evolutionary time, withsome divergence of mitochondrial lineages. There may alsobe a difference in the frequency of haplotypes for the whitegene, although numbers are not sufficient to show a statis-tically significant divergence. There is no evidence for con-tinued coexistence of B. tryoni and B. aquilonis within thesame geographic region, so that, if brought into sympatry,gene flow is likely to occur between the two species with theexpected homogenizing effect.

The Mechanism of Species Formation and Maintenance

The picture given by the two species B. tryoni and B. neo-humeralis is difficult to fit into the framework of conventionalspeciation theory. In the classical view (e.g., Mayr 1963),

908 JENNIFER MORROW ET AL.

speciation occurs in allopatry over a long period of time,during which postmating isolation evolves. Reinforcement ofpremating isolation occurs when the populations subsequent-ly come into contact. Numerous examples that contradict thisview have been cited by Tauber and Tauber (1989), and thisspecies pair seems to provide another example of this kind.

At least two aspects of the B. tryoni–B. neohumeralis spe-cies coexistence are inconsistent with the classical view ofallopatric speciation. First, the molecular results show highersimilarity than would be consistent with a period of allopatricisolation (Coyne and Orr 1997), as confirmed by the levelsof differentiation displayed by the isolated species B. aqui-lonis. Secondly, although there is a well-defined prematingisolation mechanism, there is little sign of substantial post-mating isolation. Forced mating in the laboratory leads toviable and fertile hybrids, which are compatible with bothparents (Gibbs 1968). In this respect, the species are consis-tent with the norm, in that Coyne and Orr (1989, 1998) haveshown that premating isolation generally evolves faster thanpostmating isolation, especially in sympatric species. Themechanism whereby premating isolation has occurred in thepresent case, via divergence of mating time, may also be onethat evolves more efficiently than mechanisms that dependon independent sets of genes in the two sexes (Sved 1981).

There are at least three ways of escaping from the dilemmaposed by the classical allopatric model. The first is that thespeciation process has been much more rapid than generallypostulated under the classical view. In recent years, the lit-erature has provided many examples of rapid speciation, forexample, in Hawaiian Drosophila (DeSalle et al. 1986) andcichlid fishes in Lake Victoria (Mayer et al. 1998). Manyexamples exist of near instantaneous speciation in parthe-nogenetic organisms (for a recent review, see Parker andNiklasson 2000). Bush (1969) has demonstrated speciationthrough host fruit preference in the genus Rhagoletis. All ofthese are, or may be, either cases of limited mobility (Ha-waiian Drosophila) or cases where a more efficient parti-tioning of resources is favored and where the mating mech-anism (such as mating on the host plant) facilitates diver-gence, with postmating isolation (Feder and Bush 1989; Bier-baum and Bush 1990). The difficulty in envisioning a veryrecent sympatric speciation event for B. tryoni and B. neo-humeralis lies in the lack of any known behavioral differencethat might have preceded or enhanced the genetic differen-tiation of the mating isolation mechanism. Both are highlypolyphagous rainforest species that eat the same range ofhost fruits, with only a small difference in the native hostfruit preference.

A second explanation is that speciation occurred at sometime in the more distant evolutionary past, with concomitantgenetic differentiation, but that hybridization is now occur-ring so that genetic differentiation is breaking down. Thisexplanation seems improbable because there is no indicationof any increase in the frequency of individuals with hybridmorphology or behavior (Birch 1961; Pike 1999) over a pe-riod of more than 50 yr since the separate species status ofB. tryoni and B. neohumeralis was first suggested (Perkins1933).

The third explanation is that some exchange of genes hasbeen occurring between the two species, despite the main-

tenance of the species status. The appearance of individualsof hybrid callus color (Wolda 1967a) favors the notion thatsome gene exchange is occurring between the two species.Such exchange could account for the lack of genetic differ-entiation, including the high degree of shared polymor-phisms.

The gene exchange explanation is also favored by the com-parison with the B. tryoni–B. aquilonis comparison. In thisspecies pair, where gene exchange is unlikely due to the lackof overlap, more differentiation has occurred for the mito-chondrial loci than for the B. tryoni–B. neohumeralis speciespair. The lack of behavioral differences in mating betweenB. tryoni and B. aquilonis suggests that this species pair di-verged more recently that did B. tryoni and B. neohumeralis.The failure of differentiation to occur in a greater period oftime for the latter pair therefore argues for a reduction indivergence due to gene exchange.

The data for nuclear sequences are also compatible with ahypothesis of gene flow between the two species, althoughthe data could equally result from a very recent divergence.The white gene results, with sharing of polymorphic sites thatcomprise a set of defined haplotypes in strong linkage dis-equilibrium, as well as sharing of probable sites of recom-bination, strongly reinforce the view that gene flow existsbetween the two species. Some apparent difference (nonsig-nificant) in the frequency of common haplotypes of the whitegene is indicative of a degree of genetic isolation. The fixeddifferences in the ITS2 locus could be maintained in the faceof a low level of gene flow by concerted evolution resultingfrom the well-known gene conversion events in the ribosomalgene arrays (Hillis and Dixon 1991).

The explanation of maintenance of species identity in theface of genetic introgression is supported by the fact that, asmentioned previously, hybridization can occur under labo-ratory conditions and that individuals with intermediate lev-els of callus color are seen in the wild (Wolda 1967a; Gibbs1968; Smith 1979). Little is known about the manner in whichthe mating-time difference between the two species is main-tained. However, the intriguing possibility exists that thisdifference is maintained by a small number of genes or generegions and that the differentiation can persist in the face ofgene flow affecting genes at unlinked loci. A similar con-clusion has been drawn for the case of genetic isolation be-tween the species Drosophila pseudoobscura and D. persi-milis (Wang et al. 1997), which also show varying degreesof differentiation at different loci.

If it is accepted that introgression is occurring on a regularbasis, the existence in sympatry of the two species becomesproblematic. It may be the fact that dusk mating behavior inB. tryoni is dominant to the B. neohumeralis mating behavior(Smith 1979; Pike 1999), which preserves the identity of B.neohumeralis. Hybrid individuals may disappear into the poolof B. tryoni, leaving B. neohumeralis unaffected. However,the long-term maintenance of the two species in sympatrywould presumably still need some currently undetermineddifference in resource partitioning.

The consequences of asymmetrical gene exchange are noteasily distinguished from the consequences of symmetricalgene exchange. Both could explain the high degree of sharedpolymorphisms between the species. Asymmetrical gene ex-

909GENETIC SIMILARITY OF SYMPATRIC SPECIES

change might be expected to lead to a higher variance in therecipient species, in this case B. tryoni. For both of the mi-tochondrial markers, the variance is marginally higher in B.neohumeralis, the opposite of what would be expected unlessthe one-way exchange is primarily via the female B. tryoni3 male B. neohumeralis cross. The data from the white locus(Fig. 4) also show little sign of higher variability in B. tryoni,but are not based on enough individuals to allow this questionto be answered with any certainty.

ACKNOWLEDGMENTS

We are indebted to two reviewers for their comments onthe manuscript, to R. A. I. Drew for assistance with identi-fication of flies, C. Bennett for designing the white gene prim-ers, and M. Robson for organising fly collections and main-tenance of fly databases. We thank F. Christiansen, J. A.Coyne, E. Craddock, R. A. I. Drew, I. Emelianov, S. Gilchrist,J. Hey, J. Mallett, and A. Meats for helpful discussions andinformation.

LITERATURE CITED

Bakker, F. T., J. L. Olsen, W. T. Stam, and C. van den Hoek. 1992.Nuclear ribosomal DNA internal transcribed spacer regions(ITS1 and ITS2) define discrete biogeographic groups in Cla-dophora albida (Chlorophyta). J. Phycol. 28:839–845.

Bandelt, H.-J., P. Forster, B. C. Sykes, and M. B. Richards. 1995.Mitochondrial portraits of human populations using median net-works. Genetics 141:743–753.

Bateman, M. A. 1991. The impact of fruit flies on Australian hor-ticulture. Horticultural Policy Council Report no. 3. Dept. ofPrimary Industries, Canberra.

Bellas, T. E., and B. S. Fletcher. 1979. Identification of the majorcomponents in the secretion from the rectal pheromone glandsof the Queensland fruit flies Dacus tryoni and Dacus neohu-meralis (Diptera: Tephritidae). J. Chem. Ecol. 5:795–803.

Bennett, C. L., and M. Frommer. 1997. The white gene of thetephritid fruit fly Bactrocera tryoni is characterised by a longuntranslated 59 leader and a 12kb first intron. Insect Mol. Biol.6:343–356.

Bierbaum, T. J., and G. L. Bush. 1990. Genetic differentiation inthe viability of sibling species of Rhagoletis fruit flies on hostplants and the influence of reduced hybrid viability on repro-ductive isolation. Entomol. Exp. Appl. 55:105–118.

Birch, L. C. 1961. Natural selection between two species of tephritidfruit fly of the genus Dacus. Evolution 15:360–374.

Birch, L. C., and W. G. Vogt. 1970. Plasticity of taxonomic char-acters of the Queensland fruit flies Dacus tryoni and Dacus neo-humeralis (Tephritidae). Evolution 24:320–343.

Brussard, P. F., P. R. Ehrlich, D. D. Murphy, B. A. Wilcox, and J.Wright. 1985. Genetic distances and the taxonomy of checker-spot butterflies (Nymphalidae: Nymphalinae). J. Kans. Entomol.Soc. 58:403–412.

Bush, G. L. 1969. Sympatric host race formation and speciation infrugivorous flies of the genus Rhagoletis (Diptera, Tephritidae).Evolution 23:237–251.

Coyne, J. A., and H. A. Orr. 1989. Patterns of speciation in Dro-sophila. Evolution 43:362–381.

———. 1997. ‘‘Patterns of speciation in Drosophila’’ revisited.Evolution 51:295–303.

———. 1998. The evolutionary genetics of speciation. Phil. Trans.R. Soc. Lond. B. Biol. Sci. 353:287–305.

DeSalle, R., L. V. Giddings, and K. Y. Kaneshiro. 1986. Mito-chondrial DNA variability in natural populations of HawaiianDrosophila. II. Genetic and phylogenetic relationships of naturalpopulations of D. silvestris and D. heteroneura. Heredity 56:87–96.

Drew, R. A. I. 1989. The tropical fruit flies (Diptera: Tephritidae:

Dacinae) of the Australasian and Oceania region. Monogr. Qld.Mus. 26:1–521.

Drew, R. A. I., and D. M. Lambert. 1986. On the specific status ofDacus (Bactrocera) aquilonis and D. (Bactrocera) tryoni (Dip-tera: Tephritidae). Ann. Entomol. Soc. Am. 79:870–878.

Feder, J. L., and G. L. Bush. 1989. Gene frequency clines for hostraces of Rhagoletis pomonella in the midwestern USA. Heredity63:245–266.

Felsenstein, J. 1993. PHYLIP (phylogeny inference package) vers.3–5c. Distributed by the author. Department of Genetics, Univ.of Washington, Seattle, WA.

Fletcher, B. S. 1968. Storage and release of a sex pheromone bythe Queensland fruit fly, Dacus tryoni (Diptera: Trypetidae). Na-ture 219:631–632.

Gibbs, G. W. 1967. The comparative ecology of two closely related,sympatric species of Dacus (Diptera) in Queensland. Aust. J.Zool. 15:1123–1139.

———. 1968. The frequency of interbreeding between two siblingspecies of Dacus (Diptera) in wild populations. Evolution 22:667–683.

Hillis, D. M., and M. T. Dixon. 1991. Ribosomal DNA: molecularevolution and phylogenetic inference. Q. Rev. Biol. 66:411–453.

Hudson, R. R., D. D. Boos, and N. L. Kaplan. 1992. A statisticaltest for detecting population subdivision. Mol. Biol. Evol. 9:138–151.

Kliman, R. M., and J. Hey. 1993. DNA sequence variation at theperiod locus within and among species of the Drosophila me-lanogaster complex. Genetics 133:375–387.

Kocher, T. D., W. K. Thomas, A. Meyer, S. V. Edwards, S. Paabo,F. X. Villablanca, and A. C. Wilson. 1989. Dynamics of mito-chondrial DNA evolution in animals: amplification and sequenc-ing with conserved primers. Proc. Natl. Acad. Sci. USA. 86:6196–6200.

Lewontin, R. C., and L. C. Birch. 1966. Hybridization as a sourceof variation for adaptation to new environments. Evolution 20:315–336.

Manguin, S., R. C. Wilkerson, J. E. Conn, Y. Rubio-Palis, J. A.Danoff-Burg, and D. R. Roberts. 1999. Population structure ofthe primary malaria vector in South America, Anopheles darlingi,using isozyme, random amplified polymorphic DNA, internaltranscribed spacer 2, and morphologic markers. Am. J. Trop.Med. Hyg. 60:364–376.

Mayer, W. E., H. Tichy, and J. Klein. 1998. Phylogeny of Africancichlid fishes as revealed by molecular markers. Heredity 80:702–714.

Mayr, E. 1963. Animal species and evolution. Belknap Press, Cam-bridge, MA.

McKechnie, S. W. 1975. Enzyme polymorphism and species dis-crimination in fruit flies of the genus Dacus (Tephritidae). Aust.J. Biol. Sci. 28:405–411.

Meats, A. 1981. The bioclimatic potential of the Queensland fruitfly, Dacus tryoni, in Australia. Proc. Ecol. Soc. Aust. 11:151–161.

Moritz, C., C. J. Schneider, and D. Wake. 1992. Evolutionary re-lationships within the Ensatina enchscholtzii complex confirmthe ring species interpretation. Syst. Biol. 41:271–291.

Myers, K. 1952. Oviposition and mating behaviour in the Queens-land fruit-fly (Dacus (Strumeta) tryoni (Frogg.)) and the Solanumfruit-fly (Dacus (Strumeta) cacuminatus (Hering)). Aust. J. Sci.Res. Series B. 5:264–281.

Osborne, R., A. Meats, M. Frommer, J. A. Sved, R. A. I. Drew,and M. K. Robson. 1997. Australian distribution of 17 speciesof fruit flies (Diptera: Tephritidae) caught in cue lure traps inFebruary 1994. Aust. J. Entomol. 36:45–50.

Parker, E. D., and M. Niklasson. 2000. Genetic structure and evo-lution in parthenogenetic animals. Ch. 23 in R. Singh and C.Krimbas, eds. Evolutionary genetics from molecules to mor-phology. Cambridge Univ. Press, Cambridge, U.K.

Perkins, F. A. 1933. New Australian Trypetidae with notes on pre-viously described species. Proc. R. Soc. Qld. 45:41–44.

Pike, N. 1999. The influence of hybrids on the specific integrity ofthe sympatric fruit fly species, Bactrocera tryoni and Bactrocera

910 JENNIFER MORROW ET AL.

neohumeralis. M.Sc. thesis, University of Sydney, Sydney, Aus-tralia.

Porter, C. H., and F. H. Collins. 1991. Species-diagnostic differ-ences in a ribosomal DNA internal transcribed spacer from thesibling species Anopheles freeborni and Anopheles hermsi (Dip-tera: Culicidae). Am. J. Trop. Med. Hyg. 45:271–279.

Simon, C., F. Frati, A. Beckenbach, B. Crespi, H. Liu, and P. Flook.1994. Evolution, weighting, and phylogenetic utility of mito-chondrial gene sequences and a compilation of conserved poly-merase chain reaction primers. Ann. Entomol. Soc. Am. 87:651–701.

Smith, J. J., and G. L. Bush. 1997. Phylogeny of the genus Rha-goletis (Diptera: Tephritidae) inferred from DNA sequences ofmitochondrial cytochrome oxidase II. Mol. Phylogenet. Evol. 7:33–43.

Smith, P. H. 1979. Genetic manipulation of the circadian clock’stiming of sexual behaviour in the Queensland fruit flies, Dacustryoni and Dacus neohumeralis. Physiol. Entomol. 4:71–78.

Sved, J. A. 1981. A two-sex polygenic model for the evolution ofpremating isolation. I. Deterministic theory for natural popu-lations. Genetics 97:197–215.

Tauber, C. A., and M. J. Tauber. 1989. Sympatric speciation ininsects: perception and perspectives. Pp. 307–344 in D. Otte andJ. A. Endler, eds. Speciation and its consequences. Sinauer, Sun-derland, MA.

Tychsen, P. H. 1977. Mating behaviour of the Queensland fruit fly,Dacus tryoni (Diptera: Tephritidae), in field cages. J. Aust. En-tomol. Soc. 16:459–465.

van Holst Pellekaan, S. M., M. Frommer, J. A. Sved, and B. Boettch-er. 1998. Mitochondrial control region sequence variation inaboriginal Australians. Am. J. Hum. Genet. 62:435–449.

Walsh, P. S., D. A. Metzger, and R. Higuchi. 1991. Chelex 100 asa medium for simple extraction of DNA for PCR-based typingfrom forensic material. Biotechniques 10:506–513.

Wang, R. L., J. Wakeley, and J. Hey. 1997. Gene flow and naturalselection in the origin of Drosophila pseudoobscura and its closerelatives. Genetics 147:1091–1106.

Wolda, H. 1967a. Reproductive isolation between two closely re-lated species of Queensland fruit fly, Dacus tryoni (Frogg.) andD. neohumeralis Hardy (Diptera: Tephritidae). I. Variation inhumeral callus pattern and the occurrence of intermediate colourforms in the wild. Aust. J. Zool. 15:501–513.

———. 1967b. Reproductive isolation between two closely relatedspecies of Queensland fruit fly, Dacus tryoni (Frogg.) and D.neohumeralis Hardy (Diptera: Tephritidae). II. Genetic variationin humeral callus pattern in each species as compared with lab-oratory-bred hybrids. Aust. J. Zool. 15:515–539.

Corresponding Editor: L. Stevens