Cloning, Expression and Purification of Xylanase

Cloning, Expression and Purification of Xylanase

3.1 Introduction The advancement of genetic engineering approaches has made the

expression of foreign proteins in Esherichia coli a routine task. Because of its

long history as a model system, E. coli is very well characterized and many tools

have been developed to facilitate gene cloning and expression of foreign proteins.

The bacterium is one of the most extensively used prokaryotic organisms for the

industrial production of proteins of therapeutic use or of commercial interest. In

comparison to the other well established and newly emerging systems, E. coli

offers unparalleled advantages including growth on inexpensible carbon sources,

rapid biomass accumulation, amenability to high-cell density fermentations and

simple process scale up. If heterologous proteins do not require any post­

translational modifications, and are expressed in soluble form, E. coli remains the

preferred host among the choices available to obtain enough material for

biochemical and/or structural studies.

Xylanases (family 11) are small, single domain f3-sheet rich protein and

have been expressed in a wide variety of host including Bacteria, Fungi and plant

(Kulkarni, et a/., 1999). Richardson and Richardson (2002) have proposed that

these xylanases are evolutionary designed to minimize aggregation using edge

protection strategies to avoid contact between the f3-sheets, thus preventing

aggregation. However, at higher temperatures close to the temperature optima the

enzyme undergoes an irreversible aggregation (Davoodi, et ai., 1998). Molecular

dynamics studies have shown that temperature induced irreversible aggregation

correlates with the temperature optimum of the enzyme (Murakami et a/., 2005).

Below the temperature optimum of the enzyme the protein adopts a closed

conformation with the "thumb" covering most of the active site. However, at

temperatures at or higher the optimum temperature the thumb domain moves for

allowing the access of the substrate to the active site pocket (Murakami, et ai.,

2005). Protection of the active site by the thumb domain is necessary because the

exposed active site is rich in aromatic acid residues and in the absence of the

44

Cloning, Expression and Purification of Xylanase

substrate these sticky patches from one molecule might come in close contact

with the other molecules and thus lead to aggregation.

The xylanase used in this study (obtained from Bacillus coagulans) does

not go under any post-translational modifications and is devoid of any disulphide

bridges or free cysteines. Hence we decided to carry out the expression and

purification of the protein from E. coli for subsequent use in biochemical and

biophysical analyses. The soluble expression of a protein in the crowded

cytoplasmic milieu puts additional constrains and requires multi-step purification

process to remove the contaminating proteins of E. coli. However, in the

periplasmic space of E. coli relatively very few proteins are present and thus

targeting of the recombinant proteins expressed in E. coli to the periplasm makes

the purification process simpler. Therefore the xylanase gene was cloned in fusion

with its natural signal peptide as well as with the PelB leader peptide from

Erwinia crysenthimum (available in commercial vectors of the pET series from

Novagen) for the targeting of the xylanase to the periplasmic space. In addition,

an N-terminal hexahistidine tag fusion construct was also made so as to aid the

purification of the recombinant enzyme.

3.2 Materials and Methods

3.2.1 Reagents and Chemicals

Media for the growth and cultivation of bacterial cells were obtained from

HiMedia (Mumbai). Common chemicals used in the preparation of buffers and

salt solutions used in study were obtained either from Merck (Mumbai) or SRL

(Mumbai) and were of analytical grade. 3,5 dinitro salicylic acid was from CDH

chemicals (New Delhi). Agarose, Tris, Acrylamide, Pre- equilibrated PCI,

dNTP's, RBB-xylan and oat spelt xylan were from Sigma (USA). Restriction

enzymes and Pfu polymerase were obtained from MBI Fermentas (USA).

45

Cloning, Expression and Purification of Xylanase

E. coli DH5a and E. coli XLI Blue cells were used respectively for plasmid

maintenance and cloning. For protein expression studies E. coli BLR(DE3) or E.

coli BL21(DE3) cells were used. The characteristics and source of the strains used

in the study are listed in table 3.1. Table 3.2 lists the various plasmids used in the

study.

Table-3.1 Plasmids Used in the Study

Plas~ids/Strains

pUC I 9-xylanase

pRSETB

pET-22b(+)

pRXX

pRSX

pEPX

pEXX

Specification Source

pUC-19 vector containing ~1.3 Kb fragment Unpublished work

of genomic DNA of Bacillus coagulans (K.J.Mukherjee)

having the xylanase gene with its native signal

sequence and promoter region.

2.9 kb, T7 promoter based expression vector,

Ampr

5.5 kb, T7 promoter based expression vector,

Ampr

pRSET B vector having xylanase gene along

with its native signal sequence.

pRSET B vector with xylanase gene in fusion

with the hexa-histidine tag present in vector.

pET -22b( +) vector having mature xy lanase gene downstream of the PelB leader peptide.

pEPX vector in which the PelB leader peptide has been replaced by native signal sequence of xylanase.

46

Invitrogen

Novagen

This study

This study

This study

This study

Cloning, Expression and Purification of Xylanase

Table-3.2 Bacterial Strains Used in the Study

E. coli Strains Specification Source

DH5a P-endA 1 glnV44thr1relA 1 gyrA96nupGrecA 1 supE44Ll(lacZY A -argPV 169) deoR <I>801a cZ Invitrogen LlM15endAhsdR17(rK-mK+).

XLI-Blue P' ::TnlO proA+B+ lacIQ Ll(lacZ)M15/ recAl endAl gyrA96 (NaIr) thi hsdR17 Stratagene (rK-mK+) supE44gln V 44 relA llac thi- 1

BL2l(DE3) P- ompT gal[dcm][lon]hsdSB(rB-mB-;an E. coli B strain) with DE3, a A. prophage Novagen carrying the T7 RNA polymerase gene.

BLR(DE3) BL2l recA mutant; stabilizes tandem repeats Novagen

3.2.2 Preparation of Competent E. coli Cells

The competent cells were prepared with a slight modification in the

standard protocol (Sam brook and Russel, 2001). A glycerol stock of E. coli cells

was streaked on LB agar plate under aseptic conditions. A single colony from the

overnight grown (37 DC) plate was picked and inoculated in 5 ml ofLB broth and

incubated 12-16 hrs. (37 DC, 220 rpm). After 16 hours, 500 J.ll of the culture was

used to inoculate 50 ml LB broth. Cells were grown to an OD600 of 0.3-0.5 and

then were chilled on ice cold water for 30-45 min. The culture was transferred to

a sterile ice cold 50 ml polypropylene tube under aseptic conditions and

centrifuged at (4 DC, 10 min, 4000 g). The supernatant was discarded and the

pellet was gently resuspended in 20 ml of ice cold 0.1 M CaCh and incubated on

ice for 20-30 minutes. The cells were again centrifuged (4 DC, 10 min, 4000 g)

and the pellet obtained was resuspended in 5 ml of 100 mM CaCh and 50%

glycerol was added to it to a final concentration of 15 %. The cells were kept on

ice for 2-3 hours and were finally stored at - 70DC as 200 J.l\ aliquots. The

47

Cloning, Expression and Purification of Xylanase

efficiency of the competent cells was checked by transforming it with lOng of

the control plasmid (pUC 19).

3.2.3 Transformation of E. coli Cells

A 200 gl aliquot of competent cells stored at - 70°C was thawed on ice.

10 ng of plasmid DNA was added to the thawed cells and incubated on ice for 30

minutes. The cells were subjected to heat shock (42°C, 90 seconds) in a water

bath and were immediately transferred to ice cold water and allowed to chill for

2-3 minutes. 800 /-LI of LB was added and the cells were allowed to grow (37°C,

60 min, 220 rpm). 100 /-LI of culture was plated on a LB agar plate containing an

appropriate antibiotic for selection of transformants and grown overnight (37°C,

12-16 hours).

When transformations were done for the recombinant constructs after

ligation, j3-mercaptoethanol at a final concentration of 25 mM was added to the

thawed cells (incubated for 10 min) prior to the addition of the ligation reaction

mixture to aid in increasing the transformation efficiency.

3.2.4 Plasmid Isolation (Mini Preparation)

Plasmid DNA for use as a template in PCR, vector backbone for cloning

and for expression studies were obtained using plasmid mini preparations A total

of 5 ml of the overnight grown culture (37°C, 220 rpm) was centrifuged (12,000

g, 5 min, RT) in microfuge tubes. The supernatant was discarded and the cell

pellet was resuspended in 250 /-Ll of solution I (50 mM glucose, 25 mM Tris HCl

pH 8.0, 10 mM EDT A pH 8.0) by vigorous vortexing. 400 /-Ll of freshly prepared

solution II (0.2 N NaOH, 1 % SDS) was then added and mixed gently by

inverting the microfuge tube. Finally 350 /-LI of ice-cold solution III (5M

potassium acetate, glacial acetic acid) was added, mixed well and incubated on ice

for 15-20 minutes. The microfuge tube was then centrifuged at (12,000 g, 20-30

min, 4 0c) and the supernatant was transferred to a fresh tube. PCI mixture

(Phenol Chloroform Isoamyl alcohol) was added in equal volume to that of the

supernatant and mixed by vortexing and then centrifuged again (12,000 g, 15-20

48

Cloning, Expression and Purification of Xylanase

min, 4°C). The upper aqueous phase was pipetted carefully into a new microfuge

tube and 0.7 volumes of isopropanol was added and mixed well at room

temperature. The mixture was centrifuged again (12,000 g, 30 min) either at 4 °C

or at room temperature. The pellet obtained was washed twice with 100 III 70%

ethanol and allowed to dry at room temperature. The dried pellet was finally

suspended in 75-100 III of TE buffer. The dissolved plasmids were treated with

Ribonuclease A (MBI Fermentas) at a final concentration of 1-2 Ilg/I00 III to get

rid of the RNA present.

3.2.5 peR Amplification 20-30 ng of plasmid DNA was used as template and amplified using the

respective forward and reverse primers. The primers used in the study are listed

in table 3.3. The final concentrations of the forward and reverse primers were 1-2

IlM and of the dNTP's were 200 IlM. The reaction was set in a final reaction

volume of 50 Ill. PCR amplification were carried out using high-fidelity Pfu DNA

polymerase in standard reaction buffer supplied along with the polymerase.

Amplifications were carried out on a programmable thermal cycler (MyCycler™,

Bio-Rad, USA) using the running parameters listed below.

peR conditions:

Initial denaturation 95 cC, 5 min.

Denaturation 94 cC, 45 sec.

Annealing 55 cC, 60 sec.

Extension* 72 cC, 60-90 sec.**

Final extension 72 cC, 15 min.

*/** Extension time for fragments less than 500 bp were kept 60 sec. For larger

fragments extension time was set to 0.5 Kb/ min.

Reactions were carried out for 30 cycles and the amplified product was

purified after being resolved on 0.8 -1.5% agarose gel for subsequent use in

restriction digestion and ligation.

49

Cloning, Expression and Purification of Xylanase

Table-3.3 List of Primers Used in This Study

Name' Sequence (5'-3')

M13 forward TGTAAAACGACGGCCAG

T7 forward TAATACGACTCACTATAGG

XylF GGAGGTAACATATGTTTAAGTITAAAA AG (Nde I)

XylR CCC T AA AGCTTTTACCACACAGTTACA IT AG (Hind III)

XylSigR GCCATCACCCATGGAGGCGGT TGCCGAAAAC (Nco I)

3.2.6 Agarose Gel Electrophoresis

Agarose gel electrophoresis was carried out in a horizontal gel apparatus

with IX TAE as electrophoresis buffer. Agarose (0.8% - 1.0 %) was dissolved in

IX TAE buffer by gentle heating it in a boiling water bath. After cooling to about

40- 45°C, ethidium bromide at a final concentration of 1 lJ.g/ml was added. The

gel was set by pouring into a casting tray in which the wells were formed by

combs of the desired tooth size. After the gel had set, the comb was removed and

. the gel was transferred to the gel tank filled with the electrophoresis buffer. DNA

samples mixed with 6X loading dye solution (MBI Fermentas) in a ratio of 5:1

were loaded into the wells. The gel was run at a voltage of 50 -80 volts till the

lower dye front reached to the other end (opposite to that of the well) of the gel.

The DNA bands were visualised under UV light in gel documentation system

(Bio-Rad, USA). Approximate concentration of DNA bands were estimated

taking the faintest visible band as -5 ng/1J.1.

3.2.7 Restriction Digestion of DNA DNA samples were digested with restriction endonucleases (MBI

Fermentas) in the appropriate buffers supplied by the manufacturer. For preparing

the vector backbone or inserts from the plasmid DNA 500-1000 ng of plasmid

DNA was digested with 1.0 U each of the restriction enzymes. The common

buffer which had the optimum activity for both the enzymes (section 3.3.1) was

used in the reaction. The reactions were set in a final volume of 20 IJ.l. For

50

Cloning, Expression and Purification of Xylanase

preparing the inserts from PCR amplified gene fragments the restriction digestion

was set in a reaction volume of 50 ,....1. The digestion was allowed to complete at

37°C for 1-2 hrs.

3.2.8 Purification of DNA Fragments (Gel Elution From Agarose Gels) The DNA fragments after restriction digestion were gel purified prior to

their subsequent use. For this the reaction mixture was firstly heat inactivated at

65°C for 20 min. The digested products were then resolved on a 0.8-1.0 %

agarose gel. The purification was done using Gel DNA Extraction Kit (Novagen,

USA) as per manufacturer's instruction. The concentration of the purified DNA

fragments were determined as described in section 3.2.6.

3.2.9 Ligation of DNA Fragments

The purified DNA fragments were ligated in a 4-6 fold excess molar ratio

of the insert over the vector. One unit ofT4 DNA ligase (MBI Fermentas) in final

IX T4 DNA ligase buffer was used to set the reaction in 10-20 ,....1 volume. The

ligation was carried out by incubating the reaction mixture at 22°C in a water

bath for 16-18 hours. The reaction mixture was heat inactivated at 65 °c for 20

min prior to transforming competent cells.

3.2.10 Colony PCR Preliminary screening of E. coli transformants obtained after ligation was

carried out to check for the putative positive clones using colony PCR. A small

amount of cells were directly transferred to PCR tubes from the colonies obtained

after the transformation of the ligation mixture to E. coli XLI Blue. PCR

amplification was set in a reaction volume of 25 ,....1 with T7 forward and XylR

primers.

3.2.11 DNA Sequencing

The nucleotide sequences of the various constructs were verified by

automated DNA sequencing. The sequencing was carried out on ABI PRISM

51

...

Cloning, Expression and Purification of Xylanase

sequencers (Model 3730, Version 3.0) at the commercial facility available at

University of Delhi (South campus) .

3.2.12 Expression of the Recombinant Xylanase

The expression of the recombinant xy lanase was checked either in BL21

(DE3) or BLR (DE3) E. coli cells. Competent E. coli cells were transformed with

the expression plasmid and single colonies obtained after an overnight growth

were inoculated into 10 ml of LB media supplemented with 100 Ilg/ml of

ampiciIlin and grown for 12-16 hrs (37°C, 220 rpm). 500 III of this culture was

inoculated to 25 ml of LB media supplemented with 100 Ilg/ml of ampiciIlin and

cells were induced at OD600 of 0.6, 0.8 and 1.0. with varying concentrations of

IPTG to a final value of 0.2, 0.4, 0.6, 0.8 and 1.0 mM. One ml of the culture

media was collected at the time of induction and upto 5-6 hrs post induction. The

culture was centrifuged (10,000 g for 5 min) and cell pellet was used for the

expression analysis on SDS-PAGE.

3.2.13 Protein Gel Electrophoresis

Polyacrylamide gel electrophoresis under denaturing condition was

performed according to the method described by Laemmli (1970). A 12-15%

Polyacrylamide gel was utilized for the electrophoretic separation of proteins.

For stacking of proteins, 5% gel was used. 1 ml of culture aliquots were taken

and the cells were harvested by centrifugation at 5000 g for 5 minutes at room

temperature. The pellet was re-suspended in 100 III of 1 X SDS gel loading dye

and was heated in water bath (95-100 °c, 10 min). The sample was allowed to

cool and then centrifuged (12000 g, 10 min) at room temperature. 10 III of the

supernatant and standard molecular weight markers (MBI Fermentas, USA)

were loaded into the wells of the polyacrylamide gel and resolved at 100-120

volts in a mini protean system (Bio-Rad, USA). The resolved proteins were

visualized by staining the gels with coomassie brilliant blue R-250 followed by

destaining the gels to remove excess of stain.

52

Cloning, Expression and Purification of Xylanase

3.2.14 Coomassie Brilliant Blue Staining

The Polyacrylamide gel was stained with coomassie brilliant blue R-250

(CBB R250) staining solution prepared by dissolving 0.1 % (w/v) CBB R250 in

40 % (v/v) methanol and 10% (v/v) glacial acetic acid in water. Protein bands

were made visible by destaining the gel in water-methanol- glacial acetic acid

solution (45:45:10 v,v).

3.2.15 Western Blot Analysis

Proteins were separated on a 12 % SDS PAGE and transblotted onto a

nitrocellulose membrane in a buffer containing 25 mM Tris pH 8.3, 192 mM

glycine and 20 % methanol. After the transfer of proteins to the nitrocellulose

membrane the membrane was incubated in PBS containing 2 % BSA for 90

minutes to block additional protein binding sites. After a brief wash with washing

buffer (PBS with 0.05% Tween 20 and 0.05 % BSA), the membrane was

incubated with HRP linked anti-His monoclonal antibodies (Sigma, USA) at a

concentration of 1 ~glml for 1-1.5 hr at room temperature with gentle shaking.

Membrane was washed thrice for 10 min each in wash buffer and then developed

in dark until the bands developed to the desired intensity. The developing solution

consisted of 10 mg DAB (Sigma, USA) and 15 ~l H20 2 solution in 10 ml of 100

mM Tris buffer (pH 7.6).

3.2.16 Protein Expression, Subcellular Localization and Purification

For purification of the recombinant xylanase 500-1000 ml of culture

media was grown as described in 3.2.12. Cell pellet was harvested (10,000 g for

5 min) after 4-6 hrs of induction with IPTG (final concentration 1 mM) at OD6oo

of 0.6-0.8.

For subcellular location of the expressed protein, the cell pellet was

resuspended in 50 mM sodium phosphate buffer (pH 7.0) in lIl0th of the original

culture volume and sonicated. The sonicated sample was centrifuged (15,000 g,

53

Cloning, Expression and Purification of Xylanase

30 min, 4 0C) and the pellet and supernatant fractions obtained were analyzed on

SDS-PAGE for the presence of expressed recombinant protein.

For purification purpose a column packed with 10 ml of 50% Ni-NTA

resin was equilibrated (5-10 column volumes) with lysis buffer (50 mM Sodium

phosphate, pH 8.0, 200 mM NaCl, 1 mM PMSF, and 10 mM imidazole). The cell

pellet obtained from 1 Itr. of culture broth of the expressed recombinant protein

was resuspended in 50 ml of lysis buffer (50 mM Sodium phosphate, pH 8.0,

200 mM NaCl, 1 mM PMSF, and 10 mM imidazole). After sonication, the sample

was centrifuged at 15,000 g for 30 min at 4°C. The supernatant obtained was

loaded on to the Ni-NTA column (repeatedly 4 times). The column was washed

with 100 ml of lysis buffer (50 mM Sodium phosphate, pH 8.0, 200 mM NaCl, 1

mM PMSF, and 10 mM imidazole). A second wash was given with 30 ml of lysis

buffer with a higher concentration of imidazole (50 mM Sodium phosphate, pH

8.0,300 mM NaCl, 1 mM PMSF, and 20 mM imidazole).

The protein was eluted in a step gradient manner in elution buffer (50 mM

sodium phosphate, pH 8.0, 300 mM NaCl, 1 mM PMSF) with varying

concentrations of imidazole from 50 to 250 mM. 10 fractions of 1 ml each were

collected and analyzed on 12 % SDS-PAGE for expression. Xylanase activity

was checked in each of the fraction. Active fractions were checked for purity by

SDS-PAGE and similar fractions were pooled and dialyzed against 20 mM

sodium phosphate buffer (pH 7.0, 4°C). The protein was concentrated using

centriplus YM-l 0 (Millipore) and stored at 4 °C for further analysis.

3.2.17 Protein Estimation

The concentration of the purified protein was estimated using the method

of Bradford (1976). The Bradford dye was obtained from Bio-Rad (USA) and

used as per manufacturer's instruction. BSA was used to generate a standard

curve and quantify the protein.

54

Cloning, Expression and Purification of Xylanase

3.2.18 Silver Staining

The protein sample was electrophoresed on a 15 % SDS gel and

stained according to the method of Morrissey (1981) after a thorough wash with

Milli Q water. The gel was first incubated in a fixative solution (Ethanol, acetic

acid, Milli Q water in ratio of 40: 10:50) for 30 min and then washed in 30 %

ethanol solution. After a brief wash with Milli Q water the gel was incubated with

0.02 % of sodium thiosulphate solution (Na2S203.2H20) for one minute. After the

incubation the gel was washed again with Milli Q water (2-3 times) and incubated

for 20 min in a mixed solution of 0.2 % of Silver nitrate and 0.2 % (v/v)

formaldehyde. Again after a thorough wash with Milli Q water gel was incubated

with a solution of 3 % sodium carbonate, 0.5 % (v,v) formaldehyde and 0.005 %

sodium thiosulphate for 15 min or until the bands developed to desired intensity.

The reaction was immediately stopped by the addition of 0.5 % glycine solution.

All the incubations were carried out with gentle shaking in dark. The gel was

finally stored in 50 % methanol, 10 % acetic acid and 10 % glycerol solution.

3.2.19 DNS Reagent and Substrate Preparation

The DNS reagent was prepared according to the modified method of

Miller (1959). The reagent consisted of 1 % of 3,5-dinitrosalicylic acid, 0.2 %

phenol, 0.05 % sodium sulphite and 1 % sodium hydroxide. All the components

except that of sodium hydroxide were mixed and dissolved simultaneously by

gentle shaking or stirring with the required volume of sodium hydroxide. The

solution was stored in dark and not used beyond one month.

The substrate for the enzyme activity was prepared according to the

method described by Kenealy and Jeffries (2003) with slight modifications. Oat

spelt xylan (5 % w/v in sterile deionized water) was stirred at room temperature

for at least 72 hrs. The solution was centrifuged (5000 g, 30 min) and the

supernatant was stored in aliquots at -20°C. This solution was approx. 2 % of

soluble xylan and was used in xylanase activity assays.

55

Cloning, Expression and Purification of Xylanase

3.2.20 Xylanase Activity Assay

Xylanase activity assay was carried out with modifications in the method described by Bailey et ai., (1992) as follows:

• 250 III of the substrate was added to the blank test tubes.

• 50 III of appropriate buffer was added from a buffer stock of 500 mM.

• Volume was made up to 500 III with deionized water.

• The solution was pre-warmed to the desired temperature (60°C for

optimum activity) in a water bath.

• An aliquot of the enzyme (2-5 Ill) was added and incubated in water bath

at the same temperature for 5 min.

• One ml of DNS reagent was added and incubated in boiling water for 10

min.

• To this one ml of 40 % Rochelle salt solution (sodium potassium tartarate)

was added and allowed to cool at room temperature.

• The absorbance was measured against appropriate blank solution (same as

that of reaction described above but minus of the enzyme solution) at 540

nm.

The number of equivalents of reducing end generated was quantified from the

standard curve using D-xylose as a standard. One international unit (IV) of

xylanase activity was defined as the amount of enzyme that produced one micro

mole of xylose equivalent per min under the assay conditions. Specific activity

was defined as IV per mg of the protein.

56

Cloning, Expression and Purification of Xylanase

3.3 Results:

3.3.1 Cloning of the Xylanase Gene:

The xylanase gene to be cloned was obtained from a construct (pUC-19 xylanase)

available in our laboratory. The construct was obtained from the screening of

genomic library ofaxylanase producing strain of Bacillus coagulans (Chauhan, et

aI. , 2006; Choudhury, et aI. , 2006) constructed in pUC19 vector in E. coli . The

colonies obtained on a LB agar plate supplemented with 0.5 % oat spelt xylan

were screened for xylanolytic activity by staining and destaining with congo red

and NaCI solution respectively (Unpublished work, KJ. Mukherjee). The

complete nucleotide sequence of the gene fragment was obtained from automated

DNA sequencing of the construct using M13 forward and M13 reverse primers.

The schematic representation of the construct is shown in Fig 3.1.

AmpR

pUC19-xylanase

ari

Fig. 3.1: Schematic representation of the construct pUC 19-xylanase.

57

Cloning, Expression and Purification of Xylanase

The genomic DNA fragment coding for xylanase was located in between

the EcoR 1 and Hind 111 sites. The xylanase gene fragment along with its signal

sequence was flanked by upstream and downstream regions from the genomic

DNA. The translation start ~ite at the 5' end of the signal peptide coding region

was A TG of the CA TA TG Nde 1 site upstream of xylanase signal peptide coding

region. The complete xylanase pro-peptide is 213 amino acid long. The signal

peptide region is 28 (1-28) amino acids while the mature xylanase region is 85

(29-213) amino acids long. A Pst 1 restriction site is located at the junction of

signal and the mature peptide and interestingly the cut site is situated such that it

exactly separates the coding regions of the signal peptide and mature xylanase

region. One restriction site each for Nde 1 and Nco 1 found to be located in the

mature peptide coding region at nucleotide positions 395-400 and 549-554

respectively (Numbering from the translation start site at Nde 1 upstream of the

signal peptide).

The complete xylanase gene fragment was amplified using M 13 forward

and XylR primers (Table 3.3) and was cloned after partial digestion with Nde 1

and Hind 111 into pRSET B vector pre-digested with the same set of restriction

enzymes. This construct was designated as pRXX (Qlasmid Recombinant

KYlanase signal KYlanase).

For the construction of hexahistidine fused xylanase, xylanase gene was

amplified using T7 forward and XylR primers (Table 3.3) using pRXX as a

template. The PCR product was digested with Pst 1 and Hind 111 restriction

enzymes and was cloned into pRSET B vector pre-digested with the same set of

restriction enzymes. This construct was designated as pRSX (QRSET KYlanase).

Earlier in our laboratory we have successfully obtained the extracellular

export of asparaginase using PelB leader peptide fusion (Khushoo, et ai., 2004).

The PelB leader sequence-xylanase fusion construct was made by directly cloning

the Bam HI-Hind 111 fragment from pRSX into pET-22b(+) vector pre-digested

58

Cloning, Expression and Purification of Xylanase

with the same set of restriction enzyme and the construct was designated as

pEPX Ci!Kf-22b(+) relB KYlanase).

Another construct in which the pelB leader peptide in pEPX was replaced by the

native signal sequence of xylanase was designated as pEXX ~T-22b(+)

KYlanase signal KYlanase). The construct was made in two steps: I). replacement

of the Nde I-Nco I fragment in pET-22b(+) coding for PelB leader sequence by

the xylanase signal sequence amplified from pRXX using XylF and XylSigR

primers (Table 3.3). Cloning the mature region of xylanase in the pET-22b(+)

xylanase signal construct as in the construction of pEPX.

The schematic representation of all the constructs is shown is Fig 3.2. The

constructs were verified by restriction analysis and nucleotide sequencing. The

nucleotide sequences of the cloned region of all the four constructs along with the

translational start and stop sites (marked with red overbar), important restriction

sites (underlined and labeled in blue) are shown in Fig. 3.3-3.6. Important features

(hexahistidine fusion tag, signal sequence region and the Nand C-terminal of the

mature region of the xylanase) are shown with overbars in color schemes similar

to that used in the schematic representations (Fig. 3.2). The pEXX nucleotide

sequence was available only up to the second last amino acid of the mature

xylanase protein. The last amino acid, stop codon and Hind III sites shown in Fig.

3.6 have been added from the other sequenced constructs for the comparison.

59

0-o

A AmpR

pRXX

C AmPRr

f1 ori

pEPX pBR3220ri

Tuum

T 7 pro", -,

,~" "Stop eodoo '-'11111<110

Pol'

~'C Hind III

........... P~I ..,' IMmHI _ ._. Nco I

-_Nde I

Xbel

ArnpR

pl:UUllori

.~/~ B /

pRSX

pEXX

l1JeI

""" .. Mtlndlll

·-~H<Io1

"Is "9 ! Xp'_ ~ (nlO' ..........

\ \8_111

\

Xhol $"", 811'"

\Pat I

D

~ ttI"dlll

___ ~ ... stl " IMmll! ~ .. i _'-__ I Nco I

Fig. 3.2: Schematic representation of the construction of different plasm ids. A). pRXX, B). pRSX. C). pLPX, D). pEXX

~ ::: ~.

~ 'ti

a '" ~. ::: ;::,

~ ~ ... 'S; ~. ~ ::: ~ 2:: §-::: ~ ~

""

0\

1 i.., GM GG ··G~;';: '~.~'f'" -:v G7 20 Nde I

' 'v<AAA G.''\,\TtcT~A G'l'GGGA:I 'NCGOC,;GCr '~C '"'G 'C r.;:rC·,GCATG T"TI' CGXAACCGCCTC 'lGCAOCTGOC,·-c: G

40 50 60 70 90 100 Pst I 110

CGGG~ GGXOCCG · TGG C,oj. r OO ; T ' ';''''T G:C TT , ATATOO CTQ3 ACGAG ITCGCCCC " C':":cG A"; ~~ ~';TGTGGTGGNrTC;,TGGGGTACTT;..cA G.·, CC T "CCGG 'co , 280 290 II 330 350 360 370 380

\ C' GGC;....v.;.T'l GG 'C 1 Ie

",GG .:.cCG'; :'; ; G.' .j ' \

fiyy {I J~ '0M .. ~

1£1:IG ;TCCGGC~C"'AAC AAAGC CC G;;': 00 1-. .

Hind III 680 650

~A~ Fig. 3.3:.Nucleotide sequence of the cloned region of pRXX construct marked along with important features,

C OC TGC.

530

£1 ::: ~.

~ 't:j

~ ~.

::: I:l ::: I:l.

~ ... 'Si ,., I:l g. ::: ~ ~ is" ::: a ""

0\ N

AGGMGJIf' ~ ACA l' ATGC GGGG'IT CTCA T CAT CA T CA TC.-rCATGGTAT GGC'l'AGCA ~G 'C TGG" 'GGlC,;(l CAAA TGa:; TCGOO ATC TGTACG.i\CG ATGACG ATM GG;.1\XG i'l> C'I'CG UiATCTGCi ,oc TGGCI

I Nde I 20 ], 4n 50 60 "10 80 9 100 Bam HI 120 Pst I • .It'

'"ATGTA"CTG TGTGGTAA ~G 'lTCCGGCTG CTAAC;AAGC CCG;,AA a:;AAGCTG,;(l 'TOG

&~' 6 II' Hind III 'oe 710 7 "130

\~ ·ifffrtxhJfm 'fl -~ Fig. 3.4: .Nucleotide sequence of the cloned region of pRSX construct marked along with important features,

Q <::> :: S' ~

~ ~

~ ~' :: I:l :: I:l.

~ .., 'Si r> I:l ~. :: ~ ~ S" :: ~ '"

0\ W

., ' ~Tr~GT'I"l1~'C T~r;"\G ~OOM;;:; "-'C, GC rG CCGiCCGC 'GC ':GCTGG 'C"TGC ':GCTa: T'CGC " 'GCcC~l.GCCGOCG ""m~ '~T '-CGG :"

.l 20 )1 Nde I 50 60 70 80 90 Nco I 110

,'l'C 'iGC ' OC TG OC ·C';·.G ·T'! ··C· GG C, · ·'""GG 'C '-C; '.CGOO 00 CGOO .C;'GT' ·,".COC"'£; r c. iGGC ""C'I GGCGG :.,r, ,,c. .G GT T,,,'TTGGI'CT\A7 :C CGOO · - 'XG ""G GGI ' .• - GOCTGG;C

Pst I 150 160 180 ~' 210 220 ~ li 240 250 27

whv'~NA''1if1'N~.:" '~·~~M''' IW. NV\,~',,M&~'~;MVWt NWWtfwf& , ~( '1' \C '(lGC 'J'CGCC,' 1"'"' .~~G ·,',C·· " ~C ., "" " OC COO TG T'IT GGGCGCCG " 1OO C,Y, O'GG"- ', r Gl"Cr':'T T ""GOCTGG'C G ',G!"CGCCCC'l'CATC'G" ~ , 'IT" TGGG'GG,

o 280 320 340 350 360 370

Mrfl"NwMMfl':n' A ' ,~' fi' ~ ,A,r&A~tfNlAMfu fi {{y{lNffit& 6'f;'ir!rMPM~Y;fi1J I:::.G ,CC , ;CCGG . .co

410 420 ~ GG- '.CC G ,

I'

G"G" G TG G;,GG~ '.C.'· ~ ;TG ,.c'~ ~

,; 450 Nde I 460

v'.i,~ ;,aCAGCGG '" GTIC T;;' l'G MC "'G J'G':GGTTAAA OC ':"'" G C

670 690 Hind III

~

. ,," ,c. '.CG ,C .CG7-' '!' ,ACGC,:,CC T 'l'CC;~ ;'r G , GGCG .';: "

~90 500 CGC G 520

c orGG G TG~G

Fig. 3.5: .Nucleotide sequence of the cloned region of pEPX construct marked along with important features.

Q ~ ::: ;:' ~

~ 'i:i

~ ~' ::: t:o ::: t:o..

~ .... 'S; ,., ~ ~' ::: ~ ~ i:r ::: a "'

0\ ~

't ',' TG .. ·-r ..... C 'ITTAAGMGG"<l 'll'; T".C·' TLTGTTT."".G T....,.AAMAAG;W-C ~T\G7GG~JTAMCGG C.; GC 'ITro TG;GTATC" ... GC;,TG7" -rcGOC: c,CC GCC 'XC" :OO , !(J'CGG " ~T)· "e GG

Nde I ~' 50 60 70 80 100 110 Nco I l' eam

; M GG '" ~ AOC;GCGG; G 'C7AA . Gr ,' ~C - GTG

'.:9

" ~/)pJ\ ~~

Hind III

Fig. 3.6: ,Nucleotide sequence of the cloned region of pEXX construct marked along with important features,

a <:> :: :::. ~

~ "ti

~ c' ::: I:> ::: ~

~ ~

'Si t") I:> ~. :: ~ ~ is'" :: ~ ~

Cloning, Expression and Purification ofXylanase

3.3.2 Expression, Localization, Purification, Western Blot and Silver Staining

Among the four constructs, even after repeated attempts no viable

transformants were obtained with pRXX either in E. coli BL(2 I )DE3 or

BLR(DE3) competent cells. Even when transformed to E.coli DH5a cells the

transformants in case of pRXX showed a very poor growth as compared to the

other constructs (pRSX, pEPX, pEXX). Similar results were obtained by Lapidot

et aI., (1996) and Gat et al., (1994) for constructs in which xylanase was fused to

its native signal peptide and the toxicity to E. coli cells was attributed to signal

sequence of xylanase.

Viable transformants were obtained with the pEXX construct but the

presence of xylanase signal sequence might affect the growth and the biomass

yield of the E. coli cells (due to its observed and reported toxic effects) and in

turn the yields of the expressed recombinant protein. Hence this construct was not

used in further studies. The possibility of export of xylanase to extracellular

medium by the pelB leader peptide (as in the case of asparaginase, Khushoo et aI.,

2004) was checked using plate assay with RBB xylan, however with negative

results. The protein levels of the recombinant xylanase expressed by the two

constructs pRSX and pEPX were at higher levels as compared to the native

cytosolic proteins of E. coli as judged on SDS-PAGE (Fig. 3.7 and 3.8). The

length of the histidine tagged recombinant xylanase is 223 amino acids which

corresponds to a calculated molecular weight of 24.48 kD while that of pEPX is

199 corresponding to 21.68 kD (22 I amino acid, 23.89 kD along with the signal

sequence). Both the constructs showed soluble cytoplasmic expression of the

recombinant xylanase and the expression profiles did not change much with the

variation of inducer (IPTG) concentration used from 0.2 -1.0 mM (data not

shown).

65

116 --+

66.2 --+

45 --+

35 --+

25 --+

18.4 --+

14.4 --+

116 --

66.2 --

45 --35 -25 --

18.4 --14.4 --

C1ollillg. Expression and Purificatioll (I{Xylallase

1 2 3 4 5 7 8 9

Fig. 3. 7: SOS-PAGE (12 % gel) analysis of whole cell lysate of pRSX after induction. Lane 1. Mol. wt. marker. Lane 2. Uninduced sample. Lane 3-8. Post induction samples ( 1-6 hrs).

1 2 3 4 5 6 7

Fig. 3.8: SOS-PAGE(12 % gel) analysis of whole cell lysate of pEPX after induction. Lane I. Mol. wt. marker. Lane 2. Uninduced sample. Lane 3-6. Post induction samples ( 1-4 hrs). Lane 7. whole cell lysate of expressed pRSX.

66

Xylanase (pRSX)

Xylana,e pRSX pEPX

C/onillg, Expression alld Purification of Xylallase

Since the pRSX construct allowed the xylanase to be expressed in fusion

with N-terminal hexahistidine tag, it provided an ease of purification over the

recombinant xylanase expressed by pEPX. Further the properties of the

hexahistidine tagged recombinant xylanase were found to be similar to those of

the native xylanase (section 4.3.2 and 4.3.3). The expression of the hexahistidine

fused xylanase was checked by western blotting with anti-His monoclonal

antibodies conjugated to horseradish peroxidase (Fig. 3.9). Bands were observed

at positions corresponding to the expressed protein bands in Fig. 3.7. No other

band was observed. The occurrence of band at positions similar to that in Fig. 3.7

thus confirms that the expressed protein which is of the size of recombinant

xylanase is fused to histidine tag.

1 2 3 4 5 6

Fig. 3.9: Western blot analysis of expressed protein from pRSX. Lane I. Uninduced sample. Lane 2-6. Post induction samples 1-5 hrs.

Preliminary purification of the recombinant xylanase was carried out using

IMAC (immobilized metal ion affinity chromatography) with Ni-NT A as a matrix

using a gradient elution. The active fractions were located in the imidazole

gradient of 50-100 mM with the highest activity in 100 mM fraction. Fig . .3.10

shows the elution profile of recombinant xylanase as a function of imidazole

67

Cloning, Expression and Purification ofXylanase

concentration. The 100 mM fraction contains the major protein band and is 111

consistence with the highest activity of this fraction.

Fig. 3.10: Western blot of recombinant xylan-2 3 4 5 6 7 8 ase (from pRSX) eluted from Ni-NT A column

using imidazole gradient. Lane 1-2. Fraction eluted with 50 m:vl imidazole. Lane 3-6. Fraction eluted with 100 m:vl imidazole. Lane 7-8. Fraction eluted with 150 m:vl imidazole.

Final purifications were carried out USIng step elution with 100 mM

imidazole. The SDS-PAGE and western blot analysis of the purification arc

shown in Fig. 3.11 and Fig. 3.12 respectively. The purified protein showed no

other visible protein band as judged on the SDS-PAGE (Fig. 3.11) by coomassic

brilliant blue stainimr.

1 2 3 4 5 6 7 8 9

116 --66.2 --45 --35 -- -25 --

18.4 --Fig. 3.11: SDS-PAGE (12 % gel) analysis of protein samples showing expression, localization and purification of recombinant xylanase from pRSX. Lane I. Mol. wt. marker. Lane 2. Whole cell lysate of expressed sample Lane 3. Supernatant fraction obtained after sonication. Lane 4. Pellet fraction obtained after sonication. Lane 5. Flow through. Lane 6. Unbound fraction (wash with lysis buffer having 10 mM imidazole. Lane 7-8. wash with lysis buffer having 20 mM imidazole. Lane 9. Purified protein eluted from Ni-NT A column using imidazole gradient

68

Purified recombinant

xylanase from pRSX

Cloning, Expression and Purification olXylanase

1 2 3 4 5 6 7 8 9

Fig. 3.12: Western blot analysis of protein samples showing expression, localization and purification of recombinant xylanase from pRSX. The legends for the lanes of the blot are same as that of Fig. 3.11.

However, since the coomassie brilliant blue stain is not highly sensiti\l~

hence it was decided to check for other contaminating proteins in the purified

protein samples by silver staining. Fig. 3.13 shows the silver stained gel of

varying amounts of purified recombinant xylanase. The bands were visible upto a

100 fold dilution of the stock protein, but no other protein band was observed and

thus indicates a highly pure protein sample. The total protein recovery was about

71.3 % with a fold purification of7.83.

69

Cloning, Expression and Pur(/ication of Xylanase

1 2 3 4 5

Fig. 3.13: Silver stained SDS-PAGE (15 % gel) of purified recombinant xylanase expressed from pRSX. Lane 1. Mol. wt. marker (as in Fig. 3.7 and 3.8) Lane 2. Purified recombinant xylanase. Lane 3. 1:5 dilution of the protein in lane 2. Lane 4. 1: 1 0 dilution of the protein in lane 2. Lane 5. 1: 1 00 dilution of the protein in lane 2

3.3.3 Enzyme assay and Specific Activity

The enzyme activity assays were carried out at 60°C in 50 mM sodium

phosphate buffer, pH 7.0 as described in section 3.2.20. The specific activity of

the enzyme was ~ 7720 IU/mg using oat speJt xylan as a substrate.

3.4 Discussion: The xylanase from Bacillus coagulans was successfully cloned into

various vector combinations with or without the signal peptide. Xylanase along

with its native signal peptide (pRXX construct) showed a lethal effect on E. coli

cells as observed earlier by various authors (Gat, ef al.. 1994, Lapidot. ef al ..

1996). However successful expression of the recombinant xylanase was achieved

in two constructs pEPX and pRSX. The molecular masses of the two proteins

were of the expected size as judged on SDS-PAGE in comparison to the standard

70

Cloning, Expression and Purification of Xylanase

molecular weight markers (Fig. 3.7 & Fig. 3.8). However, the pEPX construct

showed an expressed band of slight higher molecular mass (Fig. 3.8) which was

approximately of same size as of that expressed by pRSX. This band could be due

to the accumulation of xylanase fused with unprocessed pelB leader sequence

which increases the length of the polypeptide chain coded by pEPX from 199 to

221 amino acids. The corresponding increase in molecular weight of the

expressed protein is 21.68 to 23.89 kD. The increased mass of the unprocessed

polypeptide chain (221 amino acids, 23.89 kD) is very close to that of the protein

expressed by pRSX (223 amino acids, 24.48 kD). Thus, the appearance of protein

band of increased molecular mass in pEPX construct (Fig. 3.7) shows that the

processing of the pelB leader peptide is not complete. Xylanase remains fused to

the pelB leader sequence which appears as the protein band of slightly higher

molecular weight (Fig. 3.7). The protein was thus purified from pRSX construct

which coded for a hexahistidine tagged xylanase. The presence of the histidine tag

did not seem to affect the enzyme very much and the kinetic parameters of the

recombinant xylanase and its pH and temperature optimum (section 4.3.2 and

4.3.3) are similar to that of the native xylanases (Nath and Rao, 2001a; Chauhan,

et al., 2006; Choudhury, et al., 2006). The purified recombinant xylanase was

more than 90-95 % pure as judged by silver staining (Fig. 3.13) and was used in

subsequent biochemical and biophysical analyses on the studies on the effect of

DMSO on protein structure and dynamics.

71