Cloning, Expression, and Characterization of a New ... · HCl (pH 8.0-9.0), and 0.1 M glycine-NaOH...
Transcript of Cloning, Expression, and Characterization of a New ... · HCl (pH 8.0-9.0), and 0.1 M glycine-NaOH...
![Page 1: Cloning, Expression, and Characterization of a New ... · HCl (pH 8.0-9.0), and 0.1 M glycine-NaOH (pH 9.0-12.0). The pH stability of recombinant XYN7C was determined at pH 8.0 and](https://reader033.fdocuments.in/reader033/viewer/2022042016/5e74cacda479200adf780130/html5/thumbnails/1.jpg)
J. Microbiol. Biotechnol. (2011), 21(8), 861–868doi: 10.4014/jmb.1102.02024First published online 15 June 2011
Cloning, Expression, and Characterization of a New Xylanase from Alkalophilic Paenibacillus sp. 12-11
Zhao, Yanyu1,2
, Kun Meng1, Huiying Luo
1, Peilong Yang
2*, Pengjun Shi
1, Huoqing Huang
1, Yingguo Bai
1,
and Bin Yao1*
1Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of AgriculturalSciences, Beijing 100081, P. R. China2Department of Microbial Engineering, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, P. R.China
Received: February 16, 2011 / Revised: May 17, 2011 / Accepted: May 19, 2011
A xylanase gene, xyn7c, was cloned from Paenibacillus sp.
12-11, an alkalophilic strain isolated from the alkaline
wastewater sludge of a paper mill, and expressed in
Escherichia coli. The full-length gene consists of 1,296 bp
and encodes a mature protein of 400 residues (excluding
the putative signal peptide) that belongs to the glycoside
hydrolase family 10. The optimal pH of the purified
recombinant XYN7C was found to be 8.0, and the enzyme
had good pH adaptability at 6.5-8.5 and stability over a
broad pH range of 5.0-11.0. XYN7C exhibited maximum
activity at 55o
C and was thermostable at 50o
C and below.
Using wheat arabinoxylan as the substrate, XYN7C had a
high specific activity of 1,886 U/mg, and the apparent Km
and Vmax
values were 1.18 mg/ml and 1,961 µmol/mg/min,
respectively. XYN7C also had substrate specificity towards
various xylans, and was highly resistant to neutral
proteases. The main hydrolysis products of xylans were
xylose and xylobiose. These properties make XYN7C a
promising candidate to be used in biobleaching, baking,
and cotton scouring processes.
Keywords: Alkaline xylanase, Paenibacillus sp., Escherichia
coli, protease resistance
Xylanase (E.C. 3.2.1.8) randomly catalyzes the hydrolysis
of the main polysaccharide chain present in xylan to
produce xylooligosaccharides and xylose [6]. According to
the primary structures, xylanases are confined to glycosyl
hydrolase families 10 and 11 [10]. Xylanases have been
applied in a variety of industrial processes [2]. In the pulp
and paper industry, xylanases are amended to conventional
processes to reduce the use of chlorine and/or chlorine
dioxide in bleaching [1]. In the food industry, xylanases
are used as food additives to improve the dough handling
and the quality of baked products [21]. Xylanases are also
used in feed, bioconversion of lignocellulosic materials,
clarification of juices, and brewing industries [33]. Combination
of xylanases and other glycosyl hydrolases is common in
various fields for better effect [2].
Numerous xylanases have been isolated and characterized
from fungi [31] and bacteria [11]. The pH optima of fungal
xylanases are around 5, whereas that of bacterial xylanases
is generally slightly higher [40]. Ideal industrial xylanases
for specific applications should possess favorable properties.
For example, thermophilic and alkaline xylanases are
preferred in biobleaching.
Microbes from extreme or special environments have
been the good sources of xylanases in the recent years. In
the present work, we isolated an alkalophilic Paenibacillus
strain having significant xylanase activity from the alkaline
wastewater sludge of a paper mill. The related gene was
cloned and expressed. The recombinant xylanase had some
superior properties, and had potentials for application in
various industries.
MATERIALS AND METHODS
Microorganism Isolation
The alkaline wastewater sludge was collected from the discharge of
a paper mill in Henan Province, China. It was stored at -20oC before
use. The pH value of the sample was determined to be pH 9.0. The
enrichment medium for selection of xylan-degrading strains contained
*Corresponding authorB. YaoPhone: +86 10 82106063; Fax: +86 10 82106054;E-mail: [email protected]. YangPhone: +86 10 82106063; Fax: +86 10 82106054;E-mail: [email protected]
![Page 2: Cloning, Expression, and Characterization of a New ... · HCl (pH 8.0-9.0), and 0.1 M glycine-NaOH (pH 9.0-12.0). The pH stability of recombinant XYN7C was determined at pH 8.0 and](https://reader033.fdocuments.in/reader033/viewer/2022042016/5e74cacda479200adf780130/html5/thumbnails/2.jpg)
862 Zhao et al.
1% birchwood xylan, 0.5% peptone, and 0.5% NaCl. After incubation
at 37oC for 36 h with agitation, the dilute suspension was spread
onto agar plates containing 0.5% birchwood xylan, 0.5% peptone,
and 0.1% KH2PO4 (pH 10.0) [17]. Pure cultures obtained through
repeated streaking were tested for xylanase activity by flooding
plates with 0.1% Congo red [39]. One strain, namely 12-11, with
significant xylanase activity was selected for further study. The
taxon of strain 12-11 was identified by comparison of the 16S rDNA
sequence amplified using primers 27f and 1492r [27] with that in
GenBank.
Strains, Vectors, and Materials
The pGEM-T Easy vector (Promega, USA) and pET-22b (+) (Novagen,
Germany) were used for gene cloning and expression, respectively.
Escherichia coli JM109 (TaKaRa, Japan) was used for the construction
and propagation of recombinant plasmids. E. coli BL21 (DE3)
(Novagen) was used as the host for heterogeneous expression. The
DNA purification kit, LA Taq DNA polymerase with buffer, and
restriction endonucleases were purchased from TaKaRa. T4 DNA
ligase and buffer were obtained from NEB (USA). Substrates oat
spelt xylan, birchwood xylan, beechwood xylan, CMC-Na, Avicel,
barley β-glucan, PNP-cellobioside, and PNP-xylopyranoside; and
proteases trypsin (from bovine), α-chymotrypsin (type II from bovine),
proteinase K, subtilisin A (type VIII from Bacillus licheniformis), and
collagenase (type IV from Clostridium histolyticum) were purchased
from Sigma (USA). Wheat arabinoxylan was obtained from Megazyme
(Australia). All the other chemicals were of analytical grade and
commercially available.
Gene Cloning
Genomic DNA of strain 12-11 was extracted using a genome-
extracting kit (TIANGEN, China) and used as the template for PCR
amplification. Based on the conserved blocks (D-W-D-V-[V/C/N]-
N-E-V and [D/H]-[G/A/C]-[I/V/L]-G- [M/F/L/I]-Q-[S/G/M/C]-H, 85
amino acids between) of glycosyl hydrolase family 10 xylanases,
X10-R [36] and XF1 (Table 1) were designed and used to amplify
the partial xylanase gene from strain 12-11. The PCR conditions
were as follows: 95oC for 4 min, 12 cycles of 95
oC for 30 s, 56-
50oC for 30 s (decreasing 0.5oC per cycle), and 72oC for 1 min,
followed by 26 cycles of 95oC for 30 s, 50oC for 30 s, and 72oC for
30 s. The resulting amplified fragment was gel-purified, ligated with
pEASY-T3 Easy vector, transformed into E. coli JM109 cells, and
sequenced by Biomed (China). The partial sequence was subjected
to BLAST analysis. Thermal asymmetric interlaced (TAIL)-PCR
[20] was conducted with a genome walking kit (TaKaRa) to obtain
the 5' and 3' flanking regions. The nested insertion-specific primers
for TAIL-PCR are listed in Table 1.
Sequence Analysis
Sequence analysis and assembly, and molecular mass prediction of
the mature peptide were performed with Vector NTI 7.0 software
(InforMax, USA). Homology searches against NCBI database were
performed using the BLAST server (http://www.ncbi.nlm.nih.gov/
BLAST). The signal peptide was predicted using SignalP (http://
www.cbs.dtu.dk/services/SignalP/). The three-dimensional structure
was predicted using the SWISS-MODEL with xylanase B from
Clostridium stercorarium F9 (2DEP_A) as the template. Multiple
alignments of protein sequences were conducted using the ClustalW
program (http://www.ebi.ac.uk/clustalW) and GeneDoc software.
Expression of xyn7c in E. coli
The gene fragment without the signal peptide coding sequence was
PCR amplified with two expresssion primers, pET22-7-c-EF and
pET22-7-c-XR (Table 1). The PCR conditions were as follows:
4 min at 95oC, followed by 32 cycles of 30 s at 94oC, 30 s at 55oC,
and 2 min at 72oC, with a final extension at 72
oC for 10 min. The
PCR product was gel purified, digested with EcoRI and XhoI, and
cloned into the EcoRI-XhoI site of pET-22b(+). The recombinant
plasmid, pET-xyn7c, was transformed into E. coli BL21 (DE3)
competent cells by hot shock. Positive transformants harboring the
gene xyn7c were grown in Luria-Bertini broth containing 100 µg/ml
ampicillin overnight at 37oC with agitation of 250 rpm to an OD600
of approximately 0.6. The cultures were then induced with isopropyl-
β-D-1-thiogalactopyranoside (IPTG) to the final concentration of
0.8 mM at 18oC for 16-18 h. The culture having the highest xylanase
activity in the supernatant was subjected to purification and further
characterization.
Purification of the Recombinant Xylanase
The induced culture was centrifuged at 10,000 ×g, 4oC, for 10 min to
remove cell debris. The cell-free supernatant was concentrated with
a Hollow Fiber Membrane Module (Motian, China). The crude enzyme
(5-10 ml) was applied to a Ni-NTA chelating column (Qiagen,
Germany) equilibrated with buffer A [20 mM Tris-HCl, 500 mM
NaCl, and 10% (w/v) glycerol, pH 7.6]. Elution was carried out with
a gradient of imidazole (0, 20, 40, 60, 80, 100, 200, and 500 mM)
Table 1. Primers used in this study.
Primers Sequences (5'→3')a
XF1 GATTGGGACGTNGTNAAYGARGT
pET22-7-c-EF CCGGAATTCGCGTGACAAGCCCCCCGCCGAAA
pET22-7-c-XR CCGCTCGAGCTCAGATCCTGCCGCCTTAACA
d1 CGAGCGAATGGTATAAAATAGCCGGTACTGATTACATCG
d2 CGAAGCTTTATATTAACGATTACGGCACGGATAACCCTG
d3 GTGAAAAATTTGCTGGAGCAAGGTGTTCCGATCGAC
u1 CGGAACACCTTGCTCCAGCAAATTTTTCACAAGCTG
u2 CAGGGTTATCCGTGCCGTAATCGTTAATATAAAGCTTCG
u3 CGTTGCGATGTAATCAGTACCGGCTATTTTATACCATTCGaRestriction sites are underlined. R represents A or G; N represents A, C, G, or T; and Y represents C or T.
![Page 3: Cloning, Expression, and Characterization of a New ... · HCl (pH 8.0-9.0), and 0.1 M glycine-NaOH (pH 9.0-12.0). The pH stability of recombinant XYN7C was determined at pH 8.0 and](https://reader033.fdocuments.in/reader033/viewer/2022042016/5e74cacda479200adf780130/html5/thumbnails/3.jpg)
A XYLANASE FROM ALKALOPHILIC PAENIBACILLUS SP. 863
in buffer B (20 mM sodium phosphate, 500 mM NaCl, pH 7.6), and
fractions with enzyme activity were pooled.
Protein expression and purification were analyzed by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 12%
running gel [15]. The protein concentration was determined by
using the Bradford method [3] with bovine serum albumin as a
standard. The bands were visualized by staining with Coomassie
Brilliant Blue G250. Purified protein was analyzed using matrix-
assisted laser desorption/ionization time-of-flight mass spectrometry
(MALDI-TOF/MS) for peptide fingerprinting, at the Institute of
Zoology, Chinese Academy of Sciences.
Enzyme Activity Assay
Xylanase activity was determined by the 3.5-dinitrosalicylic acid
(DNS) method [26]. To prepare 1% (w/v) xylan solution, 1 g of
xylan was suspended in 100 ml of Tris-HCl (pH 8.0) and heated in
a boiling water bath for 5 min. The supernatant was collected by
centrifugation (10,000 ×g, 5 min) and used in the following tests.
The standard reaction system contained 0.1 ml of appropriately diluted
enzyme and 0.9 ml of 1% (w/v) soluble xylan. After incubation at
55oC for 10 min, the reaction was terminated with 1.5 ml of DNS
reagent. The mixture was then boiled for 5 min and cooled to room
temperature, and the absorption at 540 nm was measured. One unit
of xylanase activity was defined as the amount of enzyme that
released 1 µmol of reducing sugar equivalent to xylose per minute
under the assay conditions.
Biochemical Characterization of the Purified Recombinant
XYN7C
The effect of pH on xylanase activity of purified recombinant
XYN7C was evaluated at 55oC over the pH range of 4.0-12.0. The
buffers used were 0.1 M McIlvaine buffer (pH 3.0-8.0), 0.1 M Tris-
HCl (pH 8.0-9.0), and 0.1 M glycine-NaOH (pH 9.0-12.0). The
pH stability of recombinant XYN7C was determined at pH 8.0 and
55oC after pre-incubation of the enzyme solution in the buffers
mentioned above without substrate at 37oC for 1 h. The temperature
optimum of XYN7C was determined at the optimum pH by varying
the temperature from 20oC to 70
oC. The thermostability of XYN7C
was determined at pH 8.0 and 55oC after pre-incubation of the
enzyme solution at temperatures 45oC, 50oC, and 55oC for various
periods without substrate.
Proteolytic resistance of purified recombinant XYN7C was also
determined. XYN7C was incubated with trypsin (pH 7.0), α-chymotrypsin
(pH 7.0), proteinase K (pH 7.5), subtilisin A (pH 7.5), or collagenase
(pH 7.4) in 0.1 M Tris-HCl at a ratio of protease:xylanase of 0.1:1
(w:w) at 37oC for 1 h. The residual enzyme activity was determined
under standard conditions (pH 8.0, 55oC, 10 min).
To determine the effects of various metal ions and chemical reagents
on the activity of purified recombinant XYN7C, the enzyme was
assayed under standard conditions in the presence of 5 or 10 mM of
NaCl, KCl, CaCl2, LiCl, CoCl2, CrCl3, NiSO4, CuSO4, MgCl2, FeCl3,
MnSO4, ZnCl2, SDS, EDTA, or β-mercaptoethanol. The system without
any chemicals was treated as the blank control. Each experiment
included three replicate samples.
Substrate Specificity and Kinetic Parameters
The substrate activity of purified recombinant XYN7C was tested
by measuring its enzyme activity against oat spelt xylan, birchwood
xylan, beechwood xylan, wheat arabinoxylan, CMC-Na, Avicel,
barley β-glucan, PNP-cellobioside, and PNP-xylopyranoside in 0.1 M
Tris-HCl (pH 8.0), respectively. The Km and Vmax values of XYN7C
were determined by using 1-10 mg/ml oat spelt xylan and wheat
arabinoxylan, and the data were plotted according to the Lineweaver-
Burk method [18]. Each experiment was repeated three times.
Analysis of Hydrolysis Product
Oat spelt xylan and beechwood xylan as grass and hardwood xylan
representatives, respectively, were selected for hydrolysis product
analysis. The reaction mixture containing 3 U of the purified
recombinant XYN7C and 2 mg/ml oat spelt xylan or beechwood
xylan in 400 µl of 0.1 M Tris-HCl (pH 8.0) was incubated at 37oC
for 24 h. After hydrolysis, the enzyme was removed from the
reaction using the Nanosep Centrifugal 3 K Device (Pall, USA).
The hydrolysis products were analyzed by high-performance anion-
exchange chromatography (HPAEC) with a Dionex model 2500
system (USA) [17]. Xylose, xylobiose, xylotriose, xylotetraose, and
xylopentaose were used as standards.
Nucleotide Sequence Accession Numbers
The nucleotide sequences of the Paenibacillus sp. 12-11 16S rDNA
and xylanase gene (xyn7c) have been deposited in the GenBank
database under the accession numbers HQ688784 and HQ688783,
respectively.
RESULTS
Microorganism Identification
Strain 12-11 showed optimal growth at pH 10.0. The culture
supernatant had xylanase activity of 6.8 U/ml at pH 6.0
and 9.0, and retained 40% of the maximal activity at pH
11.0. Colonies of strain 12-11 formed white, translucent,
and mucoid colonies on LB plates. Cells were rod-shaped
or cylindrical. Comparison of the full-length 16S rDNA gene
of strain 12-11 (1,508 bp) with that in the GenBank database
classified this strain in the genus Paenibacillus [99%
identity with that of Paenibacillus sp. S39 (AB043867.1)].
Strain 12-11 was deposited in the Agricultural Culture Collection
of China under the registration number ACCC05615.
Cloning and Sequence Analysis of the Xylanase Gene
xyn7c
A 257 bp gene fragment was obtained by PCR with
degenerate primers XF1 and X10-R. Based on the sequence
of this core region, 6 specific primers were designed and
used to clone the 5' and 3' flanking regions. By using
TAIL-PCR, fragments of 670 bp and 369 bp were obtained
and assembled with the core region to yield an open
reading frame (ORF) of 1,296 bp. The ORF of xyn7c DNA
encoded a 431-amino-acids polypeptide and a stop codon of
TGA. SignalP analysis indicated the presence of a signal
peptide at residues 1-31 (Fig. 1). The mature protein had a
calculated molecular mass of 45.4 kDa and an estimated pI
of 5.01. The ratio of acidic/basic residues of deduced XYN7C
was 1.65, and the frequency of Asp and Glu was 15.51%.
![Page 4: Cloning, Expression, and Characterization of a New ... · HCl (pH 8.0-9.0), and 0.1 M glycine-NaOH (pH 9.0-12.0). The pH stability of recombinant XYN7C was determined at pH 8.0 and](https://reader033.fdocuments.in/reader033/viewer/2022042016/5e74cacda479200adf780130/html5/thumbnails/4.jpg)
864 Zhao et al.
The deduced amino acid sequence of XYN7C showed
high identities to putative family 10 glycosyl hydrolases from
Geobacillus sp. Y412MC10 (ACX65538.1; 88% identity)
and Paenibacillus sp. JDR-2 (ACT02870.1; 63% identity)
and identified xylanases from C. stercorarium F9 (PDB:
2DEP_A, 69% identity), Bacillus halodurans (PDB: 2UWF_A,
55% identity), B. halodurans C-125 (NP_242986.1, 54%
identity), and alkalophilic Bacillus sp. Ng-27F10 (PDB:
2FGL_A, 53% identity) (Fig. 1). Based on BLAST and
analysis, the deduced XYN7C contained a catalytic domain
typical of glycosyl hydrolase family 10, and had a (α/β)8-
fold structure. The two conserved catalytic glutamate residues
(Glu-230 and Glu-338) of family 10 members [6] were
identified.
Expression and Purification of Recombinant XYN7C
The gene fragment coding for the mature protein without
signal peptide was amplified from Paenibacillus sp. 12-11
and used to construct the recombinant plasmid. After
transformation into E. coli BL21 (DE3) and induction with
0.8 mM IPTG for 18 h at 18oC, distinct xylanase activity
(17.2 U/ml) was detected in the culture supernatant of cells
harboring pET22-xyn7c, whereas the uninduced transformant
or transformant harboring the empty vector pET-22b (+)
showed no xylanase activity.
Recombinant His6-tagged XYN7C was purified to
electrophoretic homogeneity by metal chelate affinity
chromatography. The specific activity of purified recombinant
XYN7C towards oat spelt xylan was 1,340 U/mg. The
purified enzyme migrated one band of about 55 kDa on
SDS-PAGE (Fig. 2), which was higher than with the weight
of the predicted molecular mass plus His tag. The band was
analyzed using MALDI-TOF/MS. The amino acid sequences
obtained from the mass peaks (LYINDYGTDNPVKR,
SDYGQDLPQDILNLQADR, NLLEQGVPIDGVGHQ, and
THIDIYGPSVDSIITSMR matched the amino acid sequence
of deduced XYN7C, indicating that the purified protein
was indeed recombinant XYN7C.
Characterization of Recombinant Purified XYN7C
Purified recombinant XYN7C exhibited the highest
xylanase activity at pH 8.0 (Fig. 3A). More than 90% of
the maximum activity was retained between 6.5 and 8.5,
and about 40% of activity was retained at 9.0. The enzyme
Fig. 1. Amino acid sequence alignment of XYN7C with its close homologs. The abbreviation of sequences, microbial sources, and GenBank accession numbers are given as follows: XYN7C: Paenibacillus sp. 12-11, HQ688783,
S91-A428; C-Ge: Geobacillus sp. Y412MC10, ACX65538.1, S94-E429; C-Pa: Paenibacillus sp. JDR-2, ACT02870.1, S80-L419; X-Cl: Clostridium
stercorarium F9, 2DEP_A, S7-S344; X-C125: Bacillus halodurans C-125, NP_242986.1, S56-D396; X-B: B. halodurans, 2UWF_A, S10-D350; and X-Ng:
Bacillus sp. Ng-27, 2FGL_A, S10-D354. The putative signal peptide of XYN7C is underlined. The sequences used for primer design are indicated by
arrows. The similar and identical residues are marked in black and grey, respectively. The predicted catalytic glutamate residues are indicated by the asterisk.
![Page 5: Cloning, Expression, and Characterization of a New ... · HCl (pH 8.0-9.0), and 0.1 M glycine-NaOH (pH 9.0-12.0). The pH stability of recombinant XYN7C was determined at pH 8.0 and](https://reader033.fdocuments.in/reader033/viewer/2022042016/5e74cacda479200adf780130/html5/thumbnails/5.jpg)
A XYLANASE FROM ALKALOPHILIC PAENIBACILLUS SP. 865
was stable at pH 5.0 to 11.0, retaining more than 85% of
the initial activity after incubation at 37oC for 1 h (Fig. 3B).
XYN7C showed maximum activity at 55oC (Fig. 3C). The
thermostability of XYN7C was determined at 45oC, 50oC,
and 55oC, respectively. No activity was lost after incubation
at 45oC and 50oC for 60 min, and more than 40% of the
initial activity was retained after incubation at 55oC for
20 min (Fig. 3D).
As shown in Fig. 4, the purified recombinant XYN7C
exhibited strong resistance to neutral proteases. After treatment
with trypsin, α-chymotrypsin, collagenase, subtilisin A,
and proteinase K at 37oC for 60 min, the enzyme retained
almost all of its activity. The effects of various metal ions
and chemical reagents on enzyme activity were also
Fig. 2. SDS-PAGE analysis of the expression and purification ofrecombinant XYN7C. Lanes 1, molecular mass standard; 2, culture supernatant of the induced
transformant harboring the empty plasmid pET-22b (+); 3, culture
supernatant of the induced transformant harboring pET-xyn7c; 4, purified
XYN7C using Ni2+
-NTA metal chelating affinity chromatography.
Fig. 3. Characterization of the purified recombinant XYN7C. A. Effect of pH on XYN7C activity. The assay was performed at 55
oC in buffers ranging from pH 5.0 to 11.0. B. pH stability of XYN7C. After pre-
incubating the enzyme at 37oC for 1 h in buffers of pH 4.0-12.0, the activity was measured in 0.1 M Tris-HCl (pH 8.0) at 55
oC. C. Effect of temperature on
XYN7C activity measured in 0.1 M Tris-HCl (pH 8.0). D. Thermostability of recombinant XYN7C. The enzyme was pre-incubated at 45oC, 50
oC, and 55
oC
in 0.1 M Tris-HCl (pH 8.0) without substrate, and aliquots were removed at specific time points for the measurement of residual activity at 55oC.
Fig. 4. Proteolytic resistance of purified recombinant XYN7C. The residual activity was determined in 0.1 M Tris-HCl (pH 8.0) at 55
oC
after incubation with protease at a ratio of 10:1 (w/w) at 37oC for 30 min
(30 min sample) and 60 min (60 min sample). Purified recombinant
XYN7C was also incubated without proteases under the same conditions
for 30 min (30 min ck) or 60 min (60 min ck), and the residual activity was
measured as the control sample (100% of activity).
![Page 6: Cloning, Expression, and Characterization of a New ... · HCl (pH 8.0-9.0), and 0.1 M glycine-NaOH (pH 9.0-12.0). The pH stability of recombinant XYN7C was determined at pH 8.0 and](https://reader033.fdocuments.in/reader033/viewer/2022042016/5e74cacda479200adf780130/html5/thumbnails/6.jpg)
866 Zhao et al.
determined (data not shown). The activity of recombinant
XYN7C was significantly enhanced by about 1.2-fold in
the presence of 10 mM β-mercaptoethanol, and was strongly
inhibited by Cu2+, Fe2+, SDS, Ni+, Cr3+, Mn2+, and Zn2+.
The other chemicals had no effects on the enzyme activity
of XYN7C.
Substrate Specificity and Kinetic Parameters
With the activity of purified recombinant XYN7C towards
oat spelt xylan defined as 100%, the enzyme exhibited
high activity to wheat arabinoxylan (141%), followed by
beechwood xylan (96%) and birchwood xylan (80%)
(Table 2). No activity towards CMC-Na, Avicel, barley β-
glucan, PNP-cellobioside, and PNP-xylopyranoside was
detected.
Kinetic parameters were determined for oat spelt xylan
and wheat arabinoxylan. The calculated Km and apparent
Vmax were 4.43 mg/ml and 1,639 µmol/mg/min, respectively,
for oat spelt xylan, and 1.18 mg/ml and 1,961 µmol/mg/min,
respectively, for wheat arabinoxylan.
Hydrolysis Product Analysis
The hydrolysis products of beechwood xylan and oat spelt
xylan by purified recombinant XYN7C were determined
by HPAEC. The hydrolysis products of oat spelt xylan
comprised 14.83% xylose, 40.46% xylobiose, and 44.71%
xylan polymer, and the composition of the hydrolysis
products of beechwood xylan was 15.57% xylose, 41.36%
xylobiose, and 43.07% xylan polymer.
DISCUSSION
Microorganisms of extreme environments have attracted much
attention owing to their habitat-related adaptive properties
[6]. For example, alkaline xylanases have been isolated from
microbes and plants of alkaline or neutral environments.
To obtain the ideal alkaline xylanase for the textile and pulp
and paper industries, we selected the alkaline wastewater
sludge from a paper mill as the source material for
microorganism isolation. Strains were screened based on
xylanase activity, and one alkalophilic strain, Paenibacillus
sp. 12-11, showed significant xylanase activity. Many
Paenibacillus strains have been exploited for the production
of xylanolytic enzymes, including two xylanase genes of
family 10 and 11 [16], a family 10 xylanase with high activity
towards aryl-xylosides [7], and several xylanases with
different physical and kinetic properties [12]. All of these
strains were from neutral or acidic environments. However,
only two Paenibacillus strains have been reported that have
alkaline xylanase activity. One is from the black liquor of
the kraft pulping process and exhibits xylanase activity
under alkaline condition [14], and the other is from the
rearing farm of wood-eating oriental horned beetles and
produces an alkaline xylanase of family 10 [12]. In the
present work, Paenibacillus sp. 12-11 showed optimal
activity at pH 10.0 and grew well even at pH 11.0, which
might be a good microbial source of alkaline xylanase.
A xylanase gene, xyn7c, was cloned from strain 12-11
and successfully expressed in E. coli. The molecular mass of
recombinant XYN7C (~55 kDa) was higher than the calculated
value (45.4 kDa), probably because of the occurrence of
unknown post-translation modifications. Compared with
the family 10 xylanases from Dictyoglomus thermophilum
Rt46B.1 [8], Bacillus sp. NG-27 [24], B. halodurans S7
[22], G. mesophila KMM 241 [9], Cohnella laeviribosi
HY-21 [13], Anoxybacillus sp. E2 [37], Streptomyces
megasporus DSM 41476 [29], Paenibacillus sp. HPL-001
[12], and P. curdlanolyticus [34] that had pH optima at pH
5.5 to 9.5 and exhibited good pH stability, XYN7C has
some similar alkaline properties, such as a pH optimum at
pH 8.0, and good pH adaptability (retaining above 90% of
its maximum activity at pH 6.5 to 8.5) and stability
(retaining more than 60% of the maximum activity at pH
5.0-12.0). Xylanases from S. megasporus DSM 41476
and C. laeviribosi HY-21 are stable over a broad pH range
as XYN7C is, but their specific activities towards oat spelt
xylan are only 242.1 and 88.6 U/mg, respectively, far lower
than that of XYN7C (1,340 U/mg) [13, 29]. Furthermore,
XYN7C has an optimum temperature of 55oC and was
highly stable at 50oC and below, which is considered as a
conventional temperature for enzyme treatment to unbleached
pulp [5]. For other applications, enzyme modifications
through site-directed mutagenesis or protein engineering
[30] will make XYN7C functional at higher temperatures.
In addition, it is known that cellulase activity may result in
poor fiber mechanical strength in pulp bleaching, and
therefore xylanases used for pulp treatment should be free
of cellulase activity [32]. XYN7C was identified as a
cellulase-free xylanase. Therefore, combination of the
Table 2. Substrate specificity and kinetic parameters of the purified recombinant XYN7C.
Substrate Specific activity (U/mg)a Relative activity (%) Vmax
(µmol/mg/min) Km (mg/ml) K
cat (/s)
Oat spelt xylan 1,340 ± 3 100 1,639 4.43 1,309
Wheat arabinoxylan 1,886 ± 4 141 1,961 1.18 1,565
Beechwood xylan 1,292 ± 4 96 - - -
Birchwood xylan 1,073 ± 2 80 - - -
aValues represent the means ± SD (n = 3).
![Page 7: Cloning, Expression, and Characterization of a New ... · HCl (pH 8.0-9.0), and 0.1 M glycine-NaOH (pH 9.0-12.0). The pH stability of recombinant XYN7C was determined at pH 8.0 and](https://reader033.fdocuments.in/reader033/viewer/2022042016/5e74cacda479200adf780130/html5/thumbnails/7.jpg)
A XYLANASE FROM ALKALOPHILIC PAENIBACILLUS SP. 867
alkaline properties and the cellulase-free nature of XYN7C
implied its potential as an alternative to biobleaching
agents for production of high-quality pulp.
The strong resistance of XYN7C against neutral proteases
and its wide substrate specificity make it an important
candidate for the cotton scouring process or baking [2]. In
the cotton scouring process, conventional alkaline scouring
can be substituted by enzymatic scouring (including neutral
cellulase, protease, and xylanase) owing to its ecofriendly,
energy-saving, and clean advantages [28, 38]. In the process
of breadmaking, different enzymes, such as α-amylases,
xylanases, and proteases, are combined and used to soften
the texture of transglutaminase-supplemented pan breads,
consequently leading to the improvement of shape and
volume and void fraction in loaves [4]. More than that,
arabinoxylans are the major non-starch polysaccharides of
barley grain, and XYN7C showed higher specific activity
towards wheat arabinoxylans than to other xylans. These
properties of XYN7C make it a potential for application in
the flour industry.
In recent years, researchers have been striving to explore
the mechanisms of pH properties of alkaline xylanases
based on the knowledge of protein structure and function
[25]. Liu et al. [19] established a computational method to
analyze responsible dipeptides for the optimum pH of
xylanase, and Mamo et al. [23] reported that the composition
of amino acids can influence the pH adaptability of alkaline
xylanases to a great degree. Here, we compared the amino
acid composition of XYN7C with that of some typical
xylanases such as 2UWF [22], 2F8Q [24], 1ISV [35], and
1B30 [31]. Negatively charged Asp and Glu are thought to
form salt bridges of Arg-Asp or Arg-Glu to establish a
more stable structure under alkaline conditions. In the case
of alkaline xylanases 2UWF and 2F8Q that had optimal
pH at 9.5 and 8.4, respectively, the proportions of Asp and
Glu were over 17%. XYN7C had an optimal pH at 8.0, and
contained 15.5% of Asp and Glu, significantly higher than
that of acidic xylanases 1ISV (pH optimum 5.7, 9.0%) and
1B30 (pH optimum 5.6, 8.5%) [31, 35]. In addition, the
charge ratio (the number of negatively charged residues to
that of positively charged residues) might play a key role
in pH optima [23]. The charge ratios of 2UWF, 2F8Q,
XYN7C, 1ISV, and 1B30 were 1.76, 1.83, 1.65, 1.08, and
0.96, respectively. This trend might reflect the electrostatic
potential generated for xylanases at extreme pH environments.
The amino acid composition of XYN7C is consistent with
the nature of alkaline enzymes, and can be used as material
for the basic research of alkaline xylanases.
Acknowledgments
This work was supported by the China Modern Agriculture
Research System (CARS-42) and the Key Program of
Transgenic Plant Breeding (2008ZX08003-002) and the
Agricultural Science and Technology Conversion Funds
(2009GB23260444).
REFERENCES
1. Bajpai, P. 1999. Application of enzymes in the pulp and paper
industry. Biotechnol. Prog. 15: 147-157.
2. Beg, Q. K., M. Kapoor, L. Mahajan, and G. S. Hoondal. 2001.
Microbial xylanases and their industrial applications: A review.
Appl. Microbiol. Biotechnol. 56: 326-338.
3. Bradford, M. M. 1976. A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the
principle of protein-dye binding. Anal. Biochem. 72: 248-254.
4. Caballero, P. A., M. Gómez, and C. M. Rosell. 2007. Improvement
of dough rheology, bread quality and bread shelf-life by enzymes
combination. J. Food Process Eng. 81: 42-53.
5. Christov, L. P., G. Szakacs, and H. Balakrishnan. 1999. Production,
partial characterization and use of fungal cellulase-free xylanases
in pulp bleaching. Process Biochem. 34: 511-517.
6. Collins, T., C. Gerday, and G. Feller. 2005. Xylanases, xylanase
families and extremophilic xylanases. FEMS Microbiol. Rev. 29:
3-23.
7. Gallardo, O., P. Diaz, and F. I. J. Pastor. 2003. Characterization
of a Paenibacillus cell-associated xylanase with high activity on
aryl-xylosides: A new subclass of family 10 xylanases. Appl.
Microbiol. Biotechnol. 61: 226-233.
8. Gibbs, M. D., R. A. Reeves, and P. L. Bergquist. 1995. Cloning,
sequencing, and expression of a xylanase gene from the extreme
thermophile Dictyoglomus thermophilum Rt46B. 1 and activity
of the enzyme on fiber-bound substrate. Appl. Environ. Microbiol.
61: 4403-4408.
9. Guo, B., X. Chen, C. Sun, B. Zhou, and Y. Zhang. 2009. Gene
cloning, expression and characterization of a new cold-active
and salt-tolerant endo-β-1,4-xylanase from marine Glaciecola
mesophila KMM 241. Appl. Microbiol. Biotechnol. 84: 1107-1115.
10. Henrissat, B. and A. Bairoch. 1996. Updating the sequence-based
classification of glycosyl hydrolases. Biochem. J. 316: 695-696.
11. Huang, J., G. Wang, and L. Xiao. 2006. Cloning, sequencing
and expression of the xylanase gene from a Bacillus subtilis strain
B10 in Escherichia coli. Bioresour. Technol. 97: 802-808.
12. Hwang, I. T., H. K. Lim, H. Y. Song, S. J. Cho, J. S. Chang,
and N. J. Park. 2010. Cloning and characterization of a
xylanase, KRICT PX1 from the strain Paenibacillus sp. HPL-
001. Biotechnol. Adv. 28: 594-601.
13. Kim, D. Y., M. K. Han, H. W. Oh, K. S. Bae, T. S. Jeong, S. U.
Kim, et al. 2010. Novel intracellular GH10 xylanase from
Cohnella laeviribosi HY-21: Biocatalytic properties and alterations
of substrate specificities by site-directed mutagenesis of Trp
residues. Bioresour. Technol. 101: 8814-8821.
14. Ko, C. H., W. L. Chen, C. H. Tsai, W. N. Jane, C. C. Liu, and
J. Tu. 2007. Paenibacillus campinasensis BL11: A wood material-
utilizing bacterial strain isolated from black liquor. Bioresour.
Technol. 98: 2727-2733.
15. Laemmli, U. K. 1970. Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227: 680-
685.
![Page 8: Cloning, Expression, and Characterization of a New ... · HCl (pH 8.0-9.0), and 0.1 M glycine-NaOH (pH 9.0-12.0). The pH stability of recombinant XYN7C was determined at pH 8.0 and](https://reader033.fdocuments.in/reader033/viewer/2022042016/5e74cacda479200adf780130/html5/thumbnails/8.jpg)
868 Zhao et al.
16. Lee, H., D. Shin, N. Cho, H. Kim, S. Shin, S. Im, H. Blaise
Lee, S. Chun, and S. Bai. 2000. Cloning, expression and
nucleotide sequences of two xylanase genes from Paenibacillus
sp. Biotechnol. Lett. 22: 387-392.
17. Li, N., K. Meng, Y. Wang, P. Shi, H. Luo, Y. Bai, P. Yang, and
B. Yao. 2008. Cloning, expression, and characterization of a new
xylanase with broad temperature adaptability from Streptomyces
sp. S9. Appl. Microbiol. Biotechnol. 80: 231-240.
18. Lineweaver, H. and D. Burk. 1934. The determination of
enzyme dissociation constants. J. Am. Chem. Soc. 56: 658-666.
19. Liu, L., X. Li, and W. Shao. 2004 Computational analysis of
responsible dipeptides for optimum pH in G/11 xylanase.
Biochem. Biophys. Res. Commun. 321: 391-396.
20. Liu, Y. and R. F. Whittier. 1995. Thermal asymmetric interlaced
PCR: Automatable amplification and sequencing of insert end
fragments from P1 and YAC clones for chromosome walking.
Genomics 25: 674-681.
21. Maat, J., M. Roza, J. Verbakel, H. Stam, M. J. Santos Da Silva,
M. Bosse, et al. 1992. Xylanases and their application in
bakery, pp. 349-360. In J. Visser, M. A. Kusters van Someren,
G. Beldman, and A. G. J. Voragen (eds.). Xylans and Xylanases.
Progress in Biotechnology, No. 7. Elsevier Science Publishers,
Amsterdam, The Netherlands.
22. Mamo, G., R. Hatti-Kaul, and B. Mattiasson. 2006. A thermostable
alkaline active endo-β-1-4-xylanase from Bacillus halodurans
S7: Purification and characterization. Enzyme Microb. Technol.
39: 1492-1498.
23. Mamo, G., M. Thunnissen, R. Hatti-Kaul, and B. Mattiasson.
2009. An alkaline active xylanase: Insights into mechanisms of
high pH catalytic adaptation. Biochimie 91: 1187-1196.
24. Manikandan, K., A. Bhardwaj, N. Gupta, N. K. Lokanath, A.
Ghosh, V. S. Reddy, and S. Ramakumar. 2006. Crystal structures
of native and xylosaccharide-bound alkali thermostable xylanase
from an alkalophilic Bacillus sp. NG-27: Structural insights into
alkalophilicity and implications for adaptation to polyextreme
conditions. Protein Sci. 15: 1951-1960.
25. Mchunu, N. P., S. Singh, and K. Permaul. 2009. Expression of
an alkalo-tolerant fungal xylanase enhanced by directed evolution
in Pichia pastoris and Escherichia coli. J. Biotechnol. 141: 26-
30.
26. Miller, G. L. 1959. Use of dinitrosalicylic acid reagent for
determination of reducing sugar. Anal. Chem. 31: 426-428.
27. Monis, P. T., S. Giglio, and C. P. Saint. 2005. Comparison of
SYTO9 and SYBR Green I for real-time polymerase chain
reaction and investigation of the effect of dye concentration on
amplification and DNA melting curve analysis. Anal. Biochem.
340: 24-34.
28. Ossola, M. and Y. M. Galante. 2004. Scouring of flax rove with
the aid of enzymes. Enzyme Microb. Technol. 34: 177-186.
29. Qiu, Z., P. Shi, H. Luo, Y. Bai, T. Yuan, P. Yang, S. Liu, and B.
Yao. 2010. A xylanase with broad pH and temperature adaptability
from Streptomyces megasporus DSM 41476, and its potential
application in brewing industry. Enzyme Microb. Technol. 46:
506-512.
30. Roberge, M., F. Shareck, R. Morosoli, D. Kluepfel, and C.
Dupont. 1998. Site-directed mutagenesis study of a conserved
residue in family 10 glycanases: Histidine 86 of xylanase A
from Streptomyces lividans. Protein Eng. 11: 399-404.
31. Schmidt, A., A. Schlacher, W. Steiner, H. Schwab, and C. Kratky.
1998. Structure of the xylanase from Penicillium simplicissimum.
Protein Sci. 7: 2081-2088.
32. Subramaniyan, S. and P. Prema. 2000. Cellulase-free xylanases
from Bacillus and other microorganisms. FEMS Microbiol. Lett.
183: 1-7.
33. Subramaniyan, S. and P. Prema. 2002. Biotechnology of microbial
xylanases: Enzymology, molecular biology, and application. Crit.
Rev. Biotechnol. 22: 33-64.
34. Sudo, M., M. Sakka, T. Kimyra, K. Ratanakhanokchai, and K.
Sakka. 2010. Characterization of Paenibacillus curdlanolyticus
intracellular xylanase Xyn10B encoded by the xyn10B gene.
Biosci. Biotechnol. Biochem. 74: 2358-2360.
35. Sun, H. J., S. Yoshida, Y. Kawabata, N. H. Park, and I.
Kusakabe. 2002. Separation of two functional domains of the
family F/10 β-xylanase from Streptomyces olivaceoviridis E-86
limited proteolysis with papain and some of their properties.
Biotechnol. Lett. 24: 595-601.
36. Wang, G., Y. Wang, P. Yang, H. Luo, H. Huang, P. Shi, K.
Meng, and B. Yao. 2010. Molecular detection and diversity of
xylanase genes in alpine tundra soil. Appl. Microbiol. Biotechnol.
87: 1383-1393.
37. Wang, J., Y. Bai, P. Yang, P. Shi, H. Luo, K. Meng, H. Huang,
J. Yin, and B. Yao. 2010. A new xylanase from thermoalkaline
Anoxybacillus sp. E2 with high activity and stability over a
broad pH range. World J. Microbiol. Biotechnol. 26: 917-924.
38. Wang, Q., X. Fan, W. Gao, and J. Chen. 2006. Scouring of
knitted cotton fabrics with compound enzymes. J. Text. Res. 27:
27-30.
39. Wood, P. J., J. D. Erfle, and R. M. Teather. 1988. Use of
complex formation between Congo red and polysaccharides in
detection and assay of polysaccharide hydrolases. Methods
Enzymol. 160: 59-74.
40. Yu, E. K. C., L. U. L. Tan, M. K. H. Chan, L. Deschatelets, and
J. N. Saddler. 1987. Production of thermostable xylanase by a
thermophilic fungus, Thermoascus aurantiacus. Enzyme Microb.
Technol. 9: 16-24.