Eur. J . Biochem. 201,289-294 (1991) ((> FEBS 1991

001429569100634V

Cloning and expression of human ciliary neurotrophic factor Alcssandro NEGRO ’, Emanuela TOLOSANO’, Stephen D. SKAPER3, Irene MARTINI ’, Lanfranco CALLEGARO’, Lorenzo SILENG04, Ferdinand0 FIORINI and Fiorella ALTRUDA4 ’ Advanced Technology Division, and ’ Dipartimento di Biologia Animale, and

(Received March 7/May 24, 1991) - EJB 91 0316

Fidia Research Laboratories, Abano Terme, Italy Dipartimento di Genetica, Biologia e Chimica Medica, Universiti di Torino, Italy

Ciliary neurotrophic factor (CNTF) is a survival factor for avian ciliary ganglion neurons and a variety of other neuronal cell types in vitro. We report here the cloning of the entire genomic sequence encoding human CNTF and its primary structure.

Biologically active CNTF has been expressed in Chinese hamster ovary cells from a human genomic DNA clone. Human CNTF has no significant sequence similarity to any previously reported protein, although approxi- mately 84% similarity exists compared with rat and rabbit CNTF. The lack of both an N-terminal signal sequence and consensus sequences for glycosylation or hydrophobic regions, and the fact that active CNTF is expressed but not released into the culture medium of transfected cells, argue in favour of human CNTF as a cytosolic protein. These data provide a basis for understanding the role of CNTF in nervous system physiology and pathology.

The survival and phenotypic development of neurons is strongly dependent on the availability of target-tissue-derived chemical (trophic) signals. In the case of sympathetic and neural-crest-derived sensory neurons, good evidence indicates that such trophic effects are mediated by nerve growth factor (NGF) [ l , 21. The neurotrophic actions of NGF also extend to basal forebrain cholinergic neurons [3]. Other trophic proteins have been identified : brain-derived neurotrophic factor [4], ciliary neurotrophic factor (CNTF) [5 - 81 and neurotrophin-

CNTF, originally characterized as a survival factor for cultured embryonic chick parasympathetic neurons, also dis- plays trophic activity for embryonic sympathetic and sensory ganglion neurons [5,6,12]. It has also been shown to promote the differentiation of sympathetic neuroblasts by inhibiting their proliferation and inducing expression of vasoactive intes- tinal peptide [13], and to induce cholinergic differentiation in cultured sympathetic neurons from newborn rats [14]. More- over, CNTF promotes the differentiation of the type-2 astro- cyte cell lineage in vitro [15]. In vivo, CNTF is reported to prevent the degeneration of motor axons after axotomy [16]. The expression of CNTF mRNA is regulated in the peripheral nervous system during development, reaching maximal levels after postnatal day 13 [S]. To better understand which of these actions CNTF exerts in vivo, it is necessary to determine its primary structure, cellular expression and localization. Re-

3 [9-111.

Correspondence to F. Altruda, Dip. di Genetica, Biologia e Chimica Medica, Via Santena 5 bis, 1-10129 Torino, Italy

Abbreviations. CNTF, ciliary neurotrophic factor; NGF, nerve growth factor; PCR, polymerase chain reaction; CHO, Chinese ham- ster ovary; DRG, dorsal root ganglion; E, days after conccption.

Note. The novel nucleotide sequence data published here have been submitted to the EMBL sequence data bank(s) and are available under accession number(s) X60477 and X60478 for CNTF exon 1 and 2, respectively.

cently, both CNTF protein and its cDNA have been charac- terized in rabbit [7] and rat [S]. We report here the molecular cloning of the entire genomic sequence coding for human CNTF and its expression in eukaryotic cells. The genomic organization and the activity of the recombinant product obtained are shown.

MATERIALS AND METHODS

Screening of u genomic library

Genomic clones were isolated according to Benton and Davis [17] from a human genomic library in the phage EMBL3, prepared from partial EcoRI digests of human DNA. The probe was radiolabelled by random priming [18]. Hy- bridization was carried out at 65°C in 0.6 M NaCl and 0.06 M sodium citrate pH 7.0, 0.1% SDS and 10% Denhardt’s solu- tion. DNA amplifications by polymerase chain reaction (PCR) were carried out according to Saiki et al. [19]. The following oligonucleotides were synthesized on an Applied Biosystems DNA synthesizer: oligonucleotide A, 5’-CAGG- GCCCGAACAAGAACATCAAC-3‘; oligonucleotide B, 5’- TTGTCGACTACATTTCCTTGACGTTAG-3’; oligonu- cleotide C, 5’-AACCATGGCTTTCATGGAGCATTCAG- CCATCTGAC-3’; oligonucleotide D, 5’GATAAGCTTGA- AGGTTCTCTTG-3’; oligonucleotide E , 5’-TTGAATTCA- GGGATGGCTTTC-3’; oligonucleotide F, 5’-AAGTCGAC- AGAGGGACTAACTGCTACAT-3’.

Sequence analysis

Nucleotide sequences for both strands were determined by the dideoxy-chain-termination method [201 using synthetic oligonucleotides as primers. DNA and deduced amino acid sequences were analysed with either the Beckman Microgenie

290

BamHI BamHI HindllI BamHI EcofU 1 Human M A F T E H S P L T P H R R D L C S R S I W L A R K I R S R a t A . Q T L . . R a b b i t . . . M . . . A . . . . . . E : . . . T . . . . . . . . .

A BamHI v w v 7 v ATG . . . . . . . . . . . . . . . . . . . . . . - --- +-=- --it--- - y t - - - - -

+-b

E C

B i

51

101

151

201

251

301

351

1301

1351

1401

1451

1501

1551

1601

1651

+ e A D

4-4-

B F 100 bp H

ttgattccacaggcacaaaatccacagccaggaatttgctacctcctctg

agtcaggcagggcgtgggggtggggtgcacaatcccattagtagagaatg

cccagtgggtttagtctttgagagtcacatctcttatttggaccagtata

gacagaagtaaacccagctgacttgtttcctgggacagttgagttaaggg

ATGGCTTTCACAGAGCATTCACCGCTGACCCCTCACCGTCGGGACCTCTG

TAGCCGCTCTATCTGGCTAGCAAGGAAGATTCGTTCAGACCTGACTGCTC

TTACGGAATCCTATgtaagttgcctattttgctgttatctgaaaaccctt

cat - -900 bp--catgggtatgacagaagatgtgttttcctgtatcctc

ggccagGTGAAGCATCAGGGCCTGAACAAGAACATCAACCTGGACTCTGC

GGATGGGATGCCAGTGGCAAGCACTGATCAGTGGAGTGAGCTGACCGAGG

CAGAGCGACTCCAAGAGAACCTTCAAGCTTATCGTACCTTCCATGTTTTG

TTGGCCAGGCTCTTAGAAGACCAGCAGGTGCATTTTACCCCAACCGAAGG

TGACTTCCATCAAGCTATACATACCCTTCTTCTCCAAGTCGCTGCCTTTG

CATACCAGATAGAGGAGTTAATGATACTCCTGGAATACAAGATCCCCCGC

AATGAGGCTGATGGGATGCCTATTAATGTTGGAGATGGTGGTCTCTTTGA

GAAGAAGCTGTGGGGCCTAAAGGTGCTGCAGGAGCTTTCACAGTGGACAG

30 D L T A L T E S Y V K H Q G L N K N I N L D S A D G M P V . . . . . M . . . . . . . . . . . . . . . . . V . . V . . . . . . . . . . . . . . . . . . . . . . . . . V . . V . M

59 A S T D Q W S E L T E A E R L Q E N L Q A Y R T F H V L L . . . . R . . . M . . . . . . . . . . . . . . . . Q G M . . . . . . . . . . . . . . . . . . . . . . . . . . . I M .

88 A R L L E D Q Q V H F T P T E G D F H Q A I H T L L L Q V T K . . . . . R . . . . . . . . . . . . . . . . . M . . . . . . . . . . . . . . . . A . . . H F . . . . . . . . . .

117 A A F A Y Q I E E L M I L L E Y K I P R N E A D G M P I N S . . . . . L . . . . V . . . Q . . . E . . . . . . . A T . . . . . . . . . . . V . . . C N . . P K D . . . T . V I

146 V G D G G L F E K K L W G L K V L Q E L S Q W T V R S I H

6 . . . . . . . . . . . . . . . . . . . H . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

175 D L R F I S S H Q T G I P A R G S H Y I A N N K K M . . . V . . . . . M . . S . L E . . . G . K D . Q . . . . V . . C . . . . . . . H . . . . . . . D . E .

Fig. 2. Comparison between human CNTF amino acid sequence and the corresponding rat and rabbit sequences. Amino acid residues are given in the one-letter code. Identical residues in the three sequences are indicated by dots

1701 TAAGGTCCATCCATGACCTTCGTTTCATTTCTTCTCATCAGACTGGGATC protein concentration was determined by the bicinchoninic acid protein assay kit (Pierce). Biological activity of CNTF 1751 CCAGCACGTGGGAGCCATTATATTGCTAACAACAAGAAAATG%lCagtt

1801 agtccct tc tc tc t tcc t tgc t t tc tc t tc taa tggaa

Fig. 1. Genomic organization and D N A sequence of the CNTF gene. (A) Genomic organization of the CNTF gene. The coding region is indicated by an open box; introns and untranslated regions are represented by thin lines; the initiating codon is indicated. Oligo- nucleotides used as primers for PCR amplification are represented by arrows, and their sequence is reported in the text. Restriction enzyme sites are indicated. (B) DNA sequence. Capital letters indicate coding sequences; lower-case letters indicate intron and untranslated regions. The stop codon is underlined. The intron’s sequence is partial, and the gap is indicated by the dotted line. 200-bp upstream the ATG codon, containing the TATA box and the CAAT box, is indicated

sequence analysis Program or with the University of Wisconsin Genetics Computer Group sequence analysis software package on a VAXjVMS system. Sequence searches were performed using the National Biomedical Research Foundation protein sequence data base and the EMBL nucleotide data base.

Protein expression

The entire genomic fragment encoding CNTF was cloned in the plasmid pSVT7 [21] and introduced into Chinese ham- ster ovary (CHO) cells. Each 60-mm culture dish was trans- fected with 10 pg vector by the lipofectin method [22]. After 48 h in culture, the supernatant was removed, the cells washed two times with 10 mM phosphate buffer and 150 mM NaCI, pH 7.4 (NaCI/Pi), collected in NaC1/Pi and lysed by sonica- tion. After centrifugation at 16000 g for 30 min the lysate

was analyzed as described below.

Bioassay of CNTF

The activity of the recombinant protein was evaluated by the well-described ability of CNTF to maintain neurons from embryonic day 10 (E10) chick dorsal root ganglion (DRG), but not from E8 DRG [ S , 6, 12, 141. Briefly, DRGs were removed from 8 - 10-day-old chick embryos, dissociated, enriched by a plating step and added to 96-well microtiter tissue culture dishes at 4000 neurons/well. Wells were coated sequentially with polyornithine (100 pg/ml in 15 mM borate, pH 8.4) and laminin (10 pg/ml). Medium consisted of Dulbecco’s minimal essential medium supplemented with 100 U/ml penicillin, 2 mM L-glutamine and 10% (by vol.) heat-inactivated fetal calf serum [23, 241. Surviving neurons were counted after 24 h of culture.

RESULTS

Isolation of genomic clones

To isolate the gene for human CNTF, a fragment derived from PCR amplification of human genomic DNA was used as a probe to screen a genomic library constructed in the EMBL3 I vector. The oligonucleotides used as primers were synthesized on the basis of the deduced DNA sequence coding for the rabbit CNTF [7]. Oligonucleotides A and B (Fig. 1 A) were synthesized in sense and antisense orientations and used for the first amplification. The fragment obtained by PCR with human genomic DNA as template was 482 bp and should

29 1

A-A t ransfected

W E X T R A C T ] cell

cwj E X T R A C T control

I - I 1 I 1 I

O : : 1 :20 1:40 1 : 8 0 1:160 1:320 u Z P FOLD DILUTION B + I

Fig. 3. CNTFgene expression in CHO cells. (A) Expression plasmid pSVCNTFh. The complete gene of CNTF has been cloned in the EcoRI and Sun sites of the expression vector pSVT7. Black boxes represent the exons; the dotted box represents the intron; open boxes represent the regulatory regions [simian virus 40 (SV40) enhancer/promoter; simian virus 40 splicing poly(A); origin of replication]. The coding region of ampicillin-resistance factor (AMP') is also indicated by an open box. Restriction enzyme sites are indicated. (B) Survival of cultured E l 0 chick DRG neurons in the presence of different concentrations of extracts and supernatants of trdnsfected CHO cells. Day 10 DRG neurons were grown in the presence of extracts (0 ) and supernatants (A) of CHO cells transfected with pSVCNTFh. The control assay was performed with extracts from CHO cells transfected with pSVT7 (0). The values are the means f SD of triplicate determination. Neuronal survival was calculated with respect to cultures treated with NGF at a concentration of 5 ng/ml. Kb, kb

correspond to the C-terminal region of the protein; this frag- ment was labelled and used to screen the human genomic library. 10 clones out of 6 x lo5 phage plaques were isolated and shown to be positive in a second screening. In order to identify the clone(s) containing the complete gene coding for CNTF, DNA from the 10 positive clones was ternplated for PCR amplification, using as primers two oligonucleotides : one deduced from the sequence of seven amino acid residues starting from the initiating methionine of the rabbit protein (oligonucleotide C, Fig. 1A); the other from a sequence of eight amino acids, residues 74-81 of the rabbit protein (oligonucleotide D, Fig. 1 A). The amplified fragment should correspond to the N-terminal part of CNTF. One of the clones obtained by this amplification (CNF8) yielded a fragment of 1350 bp and was chosen for further analysis.

Nucleotide sequence To verify that clone CNF8 contained the gene for CNTF,

sequence analysis was performed. DNA extracted from CNF8 was digested with restriction enzymes, subcloned in pBlueScript (Stratagene and Vector Cloning) and sequenced in both orientations. The genomic organization of the CNTF gene is illustrated in Fig. 1A and the DNA sequence in Fig. 1B. The amino acid sequence deduced from the DNA sequence of CNF8 matches the sequence obtained for rabbit CNTF [7], demonstrating that the isolated clone contains the corresponding human gene. The organization of the CNTF gene appears very simple, with two exons separated by an intron. The first exon contains an open reading frame of 114 bp, coding for 38 amino acid residues in the N-terminal region; the intron is 1000 bp and is followed by the second

292

Table 1 . Neuronal specgicity of CNTF Values shown are means k SD (n = 6) of the numbers of neurons counted after 24 h in culture with 5000 neurons seeded/6-mm well. CNTF ( 1 :20 dilution) was from CHO cells transfected with pSVCNTFh DNA. NGF (5 ng/ml) was from mouse submaxillary gland

Trophic factor added

Neurons from DRG on

E8 El 0

neurons . well -’ . 24 h - ‘

None 1 4 6 k 42 450 130 CNTF 174+ 85 3072 + 450 NGF 1195 & 221 3758 &- 502

exon of 486 nucleotides coding for the remaining 162 amino acids, until a stop codon is reached. The exon-intronjunctions show the consensus sequences of splicing. The analysis of 500 bp upstream the ATG codon showed a TATA box and a CAAT box, in correct positions relative to one another: the TATA box is at 54 bp from the ATG codon, the CAAT box is 67 bp upstream the TATA box. Computer-aided analysis revealed no consensus sequence for known transcription factors. Southern blot analysis using CNF8 as a probe and human genomic DNA digested with EcoRI showed a single hybridizing 12-kb fragment, consistent with a single-copy gene (not shown).

Amino acid sequence

The entire coding sequence synthesizes a protein of 200 amino acids with a calculated molecular mass of 22860 Da and a p l of 6.00, in agreement with the previously reported acidic nature of the protein [5]. No signal peptide or glycosyla- tion sites are present. A single cysteine residue at position 17 was found, in agreement with the rat CNTF protein [8]. Comparison with other known protein sequences was performed using the EMBL and NBRF databases, but no significant similarity was found. Comparison of the DNA sequence with the corresponding CNTF from rat [8] revealed 85% similarity. The amino acid sequence of human CNTF was 83.6% similar with the rat protein and 84.1% with the rabbit CNTF. The alignment of the three proteins is shown in Fig. 2. Two major regions of similarity between the human and rat CNTF sequences can be seen, one of 23 consecutive residues at the N-terminus (amino acids 12 -34) and a second of 32 residues at the C-terminus (residues 146- 177). More- over, the residues that differ between human and rat or rabbit CNTF are conservative changes. The hydropathic index for human CNTF was calculated according to Kyte and Doolittle [25] : hydropathy analysis of the amino acid sequence revealed no significant stretches with hydrqphobic characteristics, con- sistent with the proposed cytosolic location of the protein.

Expression of’ the CNTF gene The authenticity of the cloned gene for CNTF was verified

by its expression in CHO cells. In CHO cells, no endogenous CNTF mRNA can be detected. The entire gene fragment, including the intron sequence, was amplified by PCR, using as primers the oligonucleotides E and F (Fig. IA), corre- sponding to the most 5’ and 3’ regions of the CNTF gene, respectively. The resulting DNA fragment was then digested

Fig. 4. Effect of recombinant human CNTFon the survival of EIO chick DRG neurons. Cells were cultured for 24 h in medium only (A), with 5 ng/ml NGF (B), or with a 1 : 20 dilution of extract from pSVCNTFh- DNA-transfected CHO cells (C). Bar, 25 pm

using restriction enzymes and inserted into the eukaryotic expression vector pSVT7 under the control of the simian virus 40 early promoter (Fig. 3A). Analysis of the specific CNTF mRNA was carried out after transfection of CHO cells by the lipofectin method. Total RNA was reverse-transcribed and the cDNA specific for CNTF was amplified by PCR using oligonucleotides E and F. Subsequent sequence analysis showed that the mRNA for CNTF is correctly spliced with a donor site at nucleotide 315 and an acceptor site at nucleotide 1306, in agreement with the observed genomic organization.

293

Expression of CNF8 DNA in CHO cells resulted in the production of a biologically active protein. 48 h after transfec- tion, cell extract and culture medium were assayed for their ability to support survival of El0 chick DRG neurons. As Table 1 shows, extracts from pSVCNTFh-DNA-transfected cells supported El0 DRG neurons, but not E8, whereas NGF maintained both E8 and El0 DRG neurons. The trophic action of human CNTF was dose-dependent (Fig. 3B). Ex- tracts from CHO cells transfected with the control vector pSVT7 or from untransfected cells were inactive (Fig. 3B). Active CNTF was not released into the culture medium of pSVCNTFh-transfected CHO cells, indicating that CNTF is likely a cytoplasmic protein. The DRG neurons supported by human CNTF appeared morphologically similar to those cultured in the presence of NGF (Fig. 4). These results thus show that the protein encoded by the RNA transcribed from the cloned genomic fragment has the properties of CNTF.

DISCUSSION

We have isolated a genomic clone that allowed us to estab- lish the complete amino acid sequence for human CNTF and the genomic organization of this gene. The expression of the genomic DNA gave rise to a biologically active protein.

In the 5' regulatory region of the CNTF gene, the two consensus sequences for the initiation complex of transcrip- tion (TATA box and CAAT box) are present, immediately upstream of ATG codon, indicating an unique start site of transcription with a relatively short 5' untranslated sequence. The identification of a human cell line expressing CNTF mRNA will enable us to point out the exact start site of transcription.

A comparison of the human, rat and rabbit CNTF nucleo- tide and amino acid sequences shows a striking degree of conservation, implying that the biological function(s) of CNTF is also highly conserved among species, thus dictating a strong selection pressure for maintenance of the sequence.

Recombinant human CNTF, like the previously charac- terized rat and rabbit proteins, shows the features of a cytosolic protein : the absence of a signal peptide, glycosyla- tion sites and hydrophobic regions. The likelihood that human CNTF is a cytoplasmic protein also comes from our obser- vation that CNTF was detected only in cell extracts, not in culture medium, when it was expressed in CHO cells. We cannot, however, exclude that CNTF is secreted by an uncon- ventional release mechanism, such as recently reported for interleukin 3p [26]. An analogous situation has been described for fibroblast growth factor, where no release mechanism has been established [27], although this growth factor exerts sev- eral effects on cultured cells.

Another interesting feature of the human CNTF is the presence of two basic residues, Argl3 and Argl4 (conserved also in rat and rabbit), that might, theoretically, constitute an endopeptidase-cleavage site, as occurs for NGF. In agreement with this hypothesis is the fact that CNTF purified from natural sources is present in two major forms with a molecular mass of 22-24 kDa [12].

The physiological roles of CNTF in the nervous system remain to be elucidated. In vitro studies have demonstrated that CNTF inhibits proliferation and induces differentiation of embryonic chick sympathetic neurons [I 31, promotes cho- linergic differentiation of rat sympathetic neurons [I 41, and is involved in type-2 astrocyte differentiation [I 51. It is not known if CNTF also displays some of these activities in vivo.

The observation that the level of CNTF is high in the chick embryo muscle cells innervated by ciliary ganglion neurons [28], and that it increases during the period of ciliary neurons developmental death [29], suggests that CNTF is necessary to support these neurons. This trophic activity has been verified on ciliary neurons in culture [5, 61, but has not been proven in vivo. In contrast, exogenous NGF is able to prevent the natural developmental death of DRG neurons in the chick embryo [30]. Moreover, analysis of CNTF mRNA expression in rat sciatic nerve shows that it becomes detectable only by day 4 after birth [8] when target-regulated neuronal cell death is already complete. CNTF thus seems to be not involved in the normal development of the nervous system.

Alternatively, CNTF could exert its action under patho- physiological conditions. Recently, Sendtner et al. [16] have reported that local application of CNTF prevented the lesion- induced death of motor neurons in the newborn rat facial brain-stem nucleus. According to these authors, CNTF could be a lesion factor, present in large quantities in non-neuronal cells of peripheral nerves of adult animals, and released after axonal injury. In the early postnatal period, however, the levels of CNTF would normally be inadequate to prevent neuronal loss. If substantiated, the hypothesis of CNTF as a factor involved in repairing axonal lesions may provide a new therapeutic strategy for the treatment of motoneurons degenerative diseases: the availability of human CNTF may then be a tool for pharmacological evaluation in the clinical setting. In order to elucidate the physiological role(s) of CNTF, it is important to distinguish between its differentiative effects in vitro and its action under physiological conditions. This issue may be addressed by the analysis of transgenic mice, where the CNTF gene can be silenced through homologous recombination or controlled by specific promoters activated in different tissues or at different times during embryonic development. Our work provides a basis for defining the mo- lecular actions and functions of CNTF in the nervous system and, eventually, for analyzing its pharmacological potentiali- ties.

We wish to thank Cristina Miiiozzi for expertise in preparing the cultures used for bioassay. This work was supported by Progetto Finalizzato Biotecnologie e Biostrumentuzioni, Consiglio Nazionale delle Ricerche.

REFERENCES I .

2. 3. 4.

5.

6.

I .

8.

9.

10.

Thoenen, H., Bandtlow, C. & Heumann, R. (1987) Rev. Physiol.

Levi-Montalcini, R. (1987) EMBO J . 6, 1145-1154. Dreyfus, C. F. (1989) Trends Phurrnucol. Sci. 10, 145- 149. Barde, Y.-A., Edgar, D. &Thoenen, H. (1982) EMBOJ. 1,549 -

Barbin, G., Manthorpe, M. & Varon, S. (1984) J . Neurochem. 43,

Manthorpe, M., Skaper, S. D., Williams, L. R. & Varon, S. (1 986) Brain Res. 367, 282 -286.

Lin, L.-F. H., Mismer, D., Lile, J . D., Armcs, L. G., Butler 111, E. T., Vannice, J. L. & Collins, F. (1989) Science 246, 1023- 1025.

Stockli, K. A., Lottspeich, F., Sendtner, M., Masiakowski, P., Carroll, P., Gotz, R., Lindholm, D. & Thoenen, H. (1989) Nature 342,920-923.

Hohn, A., Leibrock, J., Bailey, K . & Barde, Y.-A. (1990) Nuture

Maisonpierre, P. C., Belluscio, L., Squinto, S., Ip, N. Y., Furth, M. E., Lindsay, R. M. & Yancopoulos, G. D. (1990) Science

Biochem. Pharmacol. 109, 145 - 178.

553.

1468 - 1478.

344,339 - 341.

247,1446-1451.

294

11. Rosenthal, A., Goeddel, D. V., Nguyen, T., Lewis, M., Shih, A., Laramee, G. R., Nikolics, K. & Winslow, J. W. (1990) Neuron

12. Lin, L.-F. H., Armes, L. G., Sommer, A,, Smith, D. J. & Collins,

13. Ernsberger, U., Sendtner, M. & Rohrer, H. (1989) Neuron 2,

14. Saadat, S., Sendtner, M. & Rohrer, H. (1989) J . Cell Biol. 108,

15. Lillien, L. E., Sendtner, M., Rohrer, H., Hughes, S. M. & Raff,

16. Sendtner, M., Kreutzberg, G. W. & Thoenen, H. (1990) Nature

17. Benton, W. D. & Davis, R. W. (1977) Science 196, 180-182. 18. Feinberg, A. P. & Vogelstein, B. (1983) Anal. Biochem. 132, 6 -

13. 19. Saiki, R. K., Scharf, S., Faloona, F., Mullis, K. B., Horn, G. T.,

Erlich, H. A. & Arnheim, N. (1985) Science 230, 1350- 1354. 20. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Nut1 Acud.

Sci. USA 74, 5463 - 5467. 21. Sambrook, J . , Fritsch, E. F. & Maniatis, T. (1989) in Molecular

cloning, a laboratory manual, 2nd edn (Nolan, C. , ed.) Cold Spring Harbor Laboratory, Cold Spring Harbor NY.

4,767 - 773.

F. (1990) J . Biol. Chem. 265,8942-8947.

1275- 1284.

1807-1816.

M. C. (1988) Neuron I , 485-494.

345,440 - 441.

22. Felgner, P. L., Gadek, T. R., Holm, M., Roman, R., Chan, H. W., Wenz, M., Northrop, J. P., Ringold, G. M. & Danielsen, M. (1987) Proc. Natl Acad. Sci. USA 84,7413-7417.

23. Skaper, S. D. & Varon. S. (1986) Dev. Brain Res. 24, 39-46. 24. Skaper, S. D., Facci, L., Milani, D., Leon, A. & Toffano, G.

(1990) in Methods in neurosciences (Conn, P. M., ed.) vol. 2, pp. 17-33, Academic Press, Orlando.

25. Kyte, J . & Doolittle, R. F. (1982) J . Mol. Biol. 157, 105-132. 26. Rubartelli, A,, Cozzolino, F., Talio, M. & Sitia, R. (1990) EMBO

27. Abraham, J. A,, Whang, J . L., Tumolo, A,, Mergia, A., Friedman, J., Gospodarowicz, D. & Fiddes, J. C . (1986) EMBO J . 5,

28. Adler, R., Landa, K. B., Manthorpe, M. & Varon, S. (1979)

29. Landa, K., Adler, R., Manthorpe, M. & Varon, S . (1980) Dev.

30. Hamburger, V., Brunso-Bechtold, J. K. & Yip, J . W. (1981) J .

J . 9 , 1503-1510.

2523 - 2528.

Science 204,1434- 1436.

Biol. 74,401 -408.

Neurosci. I , 60 - 71.