Class-IIS restriction enzymes â a review

Gene, 100 (1991) 13-26 0 1991 Elsevier Science Publishers B.V. 0378-l 119/91/$03.50

GENE 0403 1

13

Class-IIS restriction enzymes - a review

(Recombinant DNA; endonucleases; methyltransferases; probes; recognition and cleavage domains; trimming vectors)

Waclaw Szybalski”, Sun C. Kim”, Noaman Hasan” and Anna J. Podhajskab

a McArdle Laboratory for Cancer Research, University of Wisconsin, Madison, WI 53706 (U.S.A.) Tel. (608)262-2047, and b Department of Microbiology, University of Gdarisk, ul. Kladki 24, 80-822 Gdarisk (Poland) Tel. and Fax (48-58)31-28-07

Received by G.G. Wilson: 9 January 1991 Accepted: 18 January 1991

SUMMARY

Class-IRS restriction enzymes (ENases-IIS) interact with two discrete sites on double-stranded DNA: the recognition site, which is 4-7 bp long, and the cleavage site, usually l-20 bp away from the recognition site. The recognition sequences of ENases-IIS are totally (or partially) asymmetric and all of the characterized ENases-IIS are monomeric. A total of 35 ENases-IIS are described (80, if all isoschizomers are taken into consideration) together with ten related ENases (class IIT), and 15 cognate methyltransferases (MTases-IIS). The physical, chemical, and molecular properties of the ENases-IIS and MTases-IIS are reviewed and many unique applications of this class of enzymes are described, including: precise trimming of DNA; retrieval of cloned fragments; gene assembly; use as a universal restriction enzyme; cleavage of single-stranded DNA; detection of point mutations; tandem amplification; printing-amplification reaction; and localization of methylated bases.

I. INTRODUCTION

Restriction endonucleases (ENases) belong to three broad classes, I, II (including IIS) and III. Unlike the ENases of class I, which cut at widely varying distances from their recognition sites, and class-II ENases, which cleave within recognition sites, class-IIS ENases (ENases-IIS), a subgroup of class-II, cleave DNA at rather

Correspondence to: Dr. W. Szybalski, McArdle Laboratory for Cancer Research, University of Wisconsin, Madison, WI 53706 (U.S.A.) Tel. (608)262-1259; Fax (608)262-2824.

Abbreviations: AdoMet, S-adenosylmethionine; ARP, amplification employing restriction enzyme and polymerase; bp, base pair(s); ds, double strand(ed); ENase, restriction endonuclease; ENase-IIS, class-IIS ENase; MB, mung-bean nuclease; MCS, multiple cloning site (polylinker); MTase (symbol M .), methyltransferase; N, A or C or G or T; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; PCR, polymerase chain reaction; Pollk, Klenow (large) fragment of E. coli DNA polymerase I; R, purine; RF, replicative form; ss, single strand(ed); W, A or T; wt, wild type; Y, pyrimidine; for nomenclature of genes encoding ENases and MTases, see Sz3.

precise distances outside their recognition sites. Thus, the ENases-IIS have separate recognition and cleavage domains, a property which makes them somewhat similar to class-III ENases. The major difference between classes IIS and III is that in the case of class IIS, the ENases and MTases are separate molecules, while for class III they form a single multidomain moiety (see e.g., Kel). At present, few ENases in classes I and III are known, whereas there are over 1000 ENases in class II, of which 35 belong to class IIS (80, if all isoschizomers are considered; see Table I, not including ten more enzymes related to ENases-IIS). The major difference between the class-II and IIS specificities can be summarized as follows:

Class II 5’-G’AATT - C C-TTAA,G

(e.g., EcoRI)

(cuts within the symmetric recognition site; 5’-to-3’ sequences are identical for both strands)

Class IIS 5’-GGATGNNNNNNNNN’NNNN - NN..

(e.g., F&I) CCTACNNNNNNNNN-NNNN,NN..

14

TABLE I

Properties of ENases-IIS

No. ENase-IIS a Recognition site b Protruding Species Co-produced Described Commercial References

(isoschizomers) ends E (strain)d ENases ’ MTases-IIS’ availability s Sequence bp [C or A]

(1) (2) (3) (4) (5) (6) (7) (8) (9) (10)

1. NWI 5'-GGATC(P), 5

WJW (.GtaIr)'

CCTAG(N)5

2.

3.

1.

NNXI 5'-GCAGC(w~ (.Gbm CGTCGW),, :

Al&61 5'-GTCTC(W, 5 (B+nuI) CWXG(W,

Bb#I 5'-GuGACW)* WbVII) CTTCTGW6

5. SbvI 5'-GCAGCW), (A.MW (Gba11091~~

CGTCG(W,,

(Bap4321)

6. EbVII 5'-GAAGACW2 6 CTTCTG(U),

7. BCafI 5*-AcGGC(W,,-13 5 TGCCGW,,-I,

s. BC.21 5'-CCwC(W)? 5 Sacteroides GGTAG(G)? c.ccae

9. SW 5'-(U)+ZAG6TCG(S)12 3'H2

(W12~~W(WlO 3'N2

10.

?l.

12.

13.

Bill1 5'-ooATC(S), 5 Wfl) (stbrr)~

cCTAGw5

m*?. 5'-GGTCTC(Njz 6 (SUO311)j

CC==(N),

S.GI 5'-GTGCXG(N)16 6 uEoTc(W1,

S_ 5 ’ -GTCTC (W) I 5 (Alw261) CaGAG(N),

II. -*I 5'-ACCTGCW), TGGWGW, (!)

15. B&C1 5'-CTCTTC(N), 6 Wsp6321) G==GW),

16. Lc0311 (.GmI)j

5v-GGTCTC(11)I 6 CCAGAGR)s

11.

16.

19.

20.

I@1 5'-CGTCTC(W), 6 W(S)5

#%"I 5'-CCCGC(N), 5 GGGCGW),

r&u 5'-OoLTGOOp (SinGUII)

25. K&321 (ZUI) (.G#zm)i

5 ’ -CT= (G) 16 GaCCTC 00 II

5'-GuxC(N,5 CTGCGW),,

5'-GGwm(I)9 CCTaC(WIj

5'-GGTGA(*)~ CC=X(*),

5-N.

5'N,

5'N,

5'N(

5'S,

5'N1

5'S,

3'N2

5-N.

5'N,

5'Ng

5'N,

3')r2

5'1,

5'N2

5'1,

Acinetobacter

lwofii

Acinetobacter lrofii X

(WBbvIl (C-51

Acinetobacter W*Alw261 lwofii WL26 [C-5 and A-N61

Bacillus brevis (ATCC 9999)

*VI1 WBbVI

(C-51

Sacillus c0agu1ano (NEB 566)

Sifidobacterim inrantis

Bacillus stsarotbermo- pbilur 6-55

Sacillus sphaericus GC

Bncillvs stearo- themophilus A664 (NEB 461)

Bacillus species H (NkB 356)

mlterobacter .mx**nes (NEG 450)

Sschexichia coli RrL31

Snrini* ap RpL3 Y.Ssp31 (C-5, a-N6,

Navobaetarium aquatili

Ilavobacteriw M.RYkI okeanokoites (A-N61

6 3'N2 Gluconobactes S dioxyacotonicu.3

G-15T

BbVI

N. z

Id~LCO3lI tC;:N6;Ild

Y.Sca571 [A-W61

bkx?. Ire3

NO6

011, SiZ

Mo2, NO3

BM, DOI, 5x72, 012, Gi3, Sal, Sab, Ne3, SC2, "al

S"1, BUZ, DOZ, Ma4

WI, vez

NO2

8. mm*, NO3

Boz, *I, Khz

SC2

Chl, X01, Ne3

EN, x12, Ri*, ml, Mc2, x02, I&Q, MO7 Na3

No3, Po3

Si2. S"3

a2, 5a3, FM, Pa2

Sa4, Na2, Sa3, Sal, -2, xii, M3, xi., xis, xis, Ki7, Krl, Lal, Lol, LUl, Ial, &3, Mel, Ne3, NM, POl, POI, Pod, PO6. Sc3, SC& Ski, Su2, su3. su4, SZl. ve3, Vd, Nil

ail, Jai, Pel, Pe2

-4, Brl, m-6, x04, ==I, MOW, N.1, Ne3, Sul, Tal, Pal, Grl

Na2

811, Cal, 1c11, W2, Ne3, Rol

BOl

15

TABLE I (continued)

No. ENase-IIS * Recognition site b Protruding Species Co-produced Described Commercial References (isoschizomers) ends ’ (strab$r ENases’ MTases-IIS ’ availability s

Sequence [C or A]

(1) (2) (3) p4p) (5) (6) (7) (8) (9) (10)

26. &oII 5'-oLlolr(P), 3'$ CTTCT(W7

27. _I

29. -11

29. NpoVrII (apb1)

30. PIa1

31. RhN

32. sapr

33. SIaNI (.BscaI)~

34. l%qII

35. TthlllII

~'-TCCRX(W),O 6 3'U* mxTG(W,,

5'-CCTC(W, S'W, GGu(W6-7 (:I

5'-GGTGA(G)* 5 ll.d. cmCT(W,

5'-GAGTc(w~ 5'li1 CTCAGW), As

+%a~;;;12 9 6 3'1,

s'-GCTCTTC(*)I 7 CGAG=G(~),

5-w,

5'-GCATC(x?), 5 5'Ll, CGTAGW,

5'-GACCGA(IO,, 6 3't?* CTGGCTP),

5'-CACcu(n)II GTCGGT(U),

5'-C~?.~Ca(tV11 6 3'N2 GTTYGTW,

MOLoL-usll. bovis (ATCClOSOO)

Wthylopbilus mthyltrophus

Morue11a nonliquefaciens (ATCC17953)

Ps."dano"ss 1amoignei (t?m416)

Streptococcus fascalis ND547

Thermus aquaticus

-1 w&d1 B,G,I.*,P,‘J.Z Rd. .Gr3, Bss, ma. [A-W61 Gal, Gal, Iid, Mel,

Jlc3, Xal, Iia2, Na2, ne3, SCl, Sd, sml

Y*II II &3, Nl

W. *ial.

x02

" Mob, Ne3

1(

w,z

u

ves

-2, Ne3

Ba*, ua3, 205, POb, sc2, sc3, 205, sp1

-2. MY1

l-t*1111 Y, 6 S&l, Sh2

36. BsnI 19 (A@SRI)'

5'-GMTGC(& 6 S'U, Bacillus *team- Gil, Ed, Inl, MO?',

CTTAC~W_, 8 thermophilus l&l, n*3, PaI HUB36

a Class-IIS restriction endonucleases (ENases-IIS) as listed (Eel; Ro2). Isoschizomers are listed in parentheses (very recently discovered or incompletely characterized isoschizomers are in footnotes i-k). An ENase-IIS is defined as an enzyme which cuts at precise distance away from its recognition site, without cleaving this site. Enzymes in lines 36 and 37 (BsmI, Esr, six Asp, and BscCI) do not fit this detinition because one of the two cuts is within the recognition site, but they were included because several of their properties and applications are quite similar to those of enzymes l-35. ENase in line 29 (NgoVIII) was not described, but the M .NgoVIII MTase appears to match the HphI MTase (M . HphI). Genes coding for E&71 and E&I were cloned (Ja3; Wil). ENases BcgI, Eco571 and GsuI (and their isoschizomers?) require or are stimulated by AdoMet. b The recognition sequences are asymmetric [with exception of those marked S (in bp column) which display a partial symmetry (which might be incidental)], and are oriented so that the cut sites are to the right (downstream) of them. E.g., GGATC(N)4 (line l), indicates that the cut on the upper CCTAG(N)

5 strand is between 4th and 5th nt beyond C; on the lower strand the cut is between 5th and 6th nt beyond G. Length of the recognition site is given in bp, and the symbols + or - below it indicate whether the purified enzyme cuts ( + ) or does not cut ( - ) ss DNA. N, A or C or G or T; R, A or G; Y, C or T. ’ As deduced from cut sites (see column 3). nd., not determined. d Strains which produce the specified ENases-IIS. e Other unrelated ENases produced by the same strain. r MTases-IIS isolated from the same strain. Genes bbvIM, eco57ZM, fokIM, hguIM, mboIIM and sfaNIM (coding for M .BbvI, M. Eco571, M .FokI, M. HgaI, M. MboII, and M. SfaNI, respectively; Sz3) were cloned @al; Boo; Ja3; WI). MTases with the same site specificity, but produced by another strain, are in parentheses. Methylated bases (mSC or mN6A) are shown in brackets (as C-5 or A-N6, respectively). g A, Amersham Buchler, Buckinghamshire (U.K.); B, BRL/Life Technologies, Gaithersburg, MD; F, ESP Fermentas, 2328 Vilnius, Lithuania (U.S.S.R.) (some also available from N); G, Anglian Biotechnology, Colchester (U.K.); I, IBI/Intemational Biotechnology, New Haven, CrT; M,

Boehringer/Mannheim, Mannheim (F.R.G.); N, New England Biolabs, Beverly, MA; P, PL-Pharmacia, Milwaukee, WI; S, Stratagene, La Jolla, CA; U, Dept. of Microbiology, University of Gdansk, Gdansk (Poland); Y, NY Biolabs, New York, NY; Z, see American Chemical Society Biotech Buyers’ Guide (1991). Parentheses indicate that the ENase is produced, but not yet commercially available. h These enzymes do not formally belong to class IIS (see footnote a). They are also designated IIT (Eel); IN)_, indicates a cut within the recognition site in the lower strand (see arrowhead). i Cuts unknown (see Ro2). j Also28additionalENases: ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Ecol911, Eco2031, Eco2041, Eco2051, Eco2171, Eco2251, Eco2331, Eco2391, Eco2401, Eco2411, Eco2461, Eco2471, PpaI, Saul21, which have the same recognition sequence, but for most of them cuts are unknown (see Ro2). EpuI has the same cuts as Eco311 (Ne3): ’ Also additional isoschizomers Asp26H1, Asp27H1, Asp36H1, Asp40H1, AspSOH (RoZ), and BscCI (from Bacillus sp. 2G).

16

[cuts outside the asymmetric recognition site at a precise distance from it (of 9 and 13 nt in this case); 5’-to-3’ recognition sequences are different for each strand, because the recognition site is asymmetric; arrowheads indicate cuts].

Whereas the recognition sites of ENases-II are symmetric and the active forms of the enzymes are usually dimers (or tetramers?), the class-IIS recognition sites are mostly asymmetric and the active enzyme forms are monomers. MTases-IIS comprise two MTases, one for methylating each strand of the recognition site. In the case of M . F&I, two MTases are fused into a single protein (Lol; Su3); in the case of M - HgaI, they are separate, independent proteins (Ba4). By analogy, ENases-IIS might have two cutting domains, one for each strand.

The first four ENases-IIS discovered were HguI, HphI, MboII, and MnlI; their identification preceded the reali- zation that they cleave DNA at some distance from their recognition sites. HguI was described in 1974 by Takanami (Tul) followed in 1976/77(?) by HphI (ZGI; Mil), Mb011 (Gel) and A4nlI (2~2; Myl). Their recognition and cleavage sites were sequenced, starting in 1976 for HphI (HZ) and Mb011 (Ba3; Br4; Br5; Brd), and followed for HgaI (Brd), and MnlI (2~1); sequences of all four restriction sites were specified in a 1978 compilation of Roberts (Rol), who listed another three ENases-IIS (BbvI, SfaNI, TuqII) but did not specify their entire recognition sequences and relationship to cut sites.

Thus, in 1974 only one of the ENases-IIS was known (Z’ul) with their number increasing to seven in 1978 (Rol), eleven in 1985 (Szl), and about 80 at present (Table I).

Because of the separation between the recognition and cleavage sites, ENases-IIS permit one to perform many novel operations, not possible for most of the conventional class-II ENases. The major features are (i) the possibility of using three-component systems with a specially designed adapter or probe (see Szl; Pol), (ii) the repeated use of the recognition site, since it is not damaged during cleavage, and (iii) possibility of studying enzyme-DNA binding without concurrent cleavage, even in the presence of Mg* + , when one uses a precut DNA fragment. The aim of this review is to prepare a detailed account of the properties and unique applications of the ENases-IIS.

II. PROPERTIES OF ENases-IIS AND MTases-IIS

(a) Recognition and cleavage sites in the target DNA

The unique aspect of ENases-IIS is that the cleavage site is separate from the recognition sequence. This pertains to the 35 enzymes listed in Table I (and probably to the additional 45 isoschizomers in footnotes i and j).

(1) Recognition site

Most of the recognition sequences are 5 or 6 bp long; one (MnlI) is only 4 bp, and one is 7 bp long (SupI). All are asymmetric, although seven [AZwXI (or BbvI), BsgI, Eco571 (or BsuI), G.suI, and PleI] show partial (maybe functionally spurious) symmetries. Two enzymes (TuqII and Tth 11111) permit l- or 2-bp variability in the recognition sequence, and one (BcgI) has an N, insertion in the center of its largely asymmetric 6-bp recognition site.

The recognition sites show polarity, i.e., the cut sites are located on only one side of the asymmetric recognition site; thus, there is generally only one ds cut per ENase-IIS recognition site. An exception is BcgI, where the recognition site directs two ds cuts at a distance of lo/12 nt both to the left and to the right of the recognition site, generating a 34-bp fragment with two 2-nt 3’ cohesive ends (Table I, line 8). Other examples of bidirectional cuts are the artifi- cially branched DNA molecules (as exemplified by the one shown in Fig. 7B, C; Ki5); however, such bidirectional ds cuts directed by a single recognition site seem to be the property of the unusual DNA substrate, rather than that of the ENase-IIS.

(2) Cleavage site

The distance between the recognition sequence and the proximal cut site varies from 1 to 20 nt, with a distance of 1 to 5 nt between staggered cuts, thus producing l-5-nt ss cohesive ends, with 5’ or 3’ termini (Table I). It might be significant that hardly any ENases-IIS produce blunt ends, with perhaps the exception of MnZI, which was reported to produce either 1-nt cohesive 3’-ends or blunt ends (Br2; sc3; Vii).

Usually, the distance from the recognition site to the cut site is quite precise for each ENase-IIS (Kil), with only a few exceptions, such as BcefI, which cuts with up to 2-nt variability depending on the sequence. MnlI appeared to be another example of up to 1-nt variability, but the most recent data (Ba5; Br2) clearly indicate the presence of 1-nt cohesive ends (see also Viz). Imprecise cutting could also sometimes be induced with artificial heteroduplex templates that are not perfectly base-paired in the region between the recognition and cut sites (e.g., for FokI, Ki4; KS). More- over, the effects of unusual nt sequences (dR/dY; Z-form, etc.; Mi2; WuZ) located between the recognition and cut sites were never systematically evaluated, and might also affect the ‘measuring’ ability of the ENase when positioning its cutting vs. recognition domains.

Cleavage is not affected by the presence of methylated or thionylated nt in the cut site (in the case of P’okI; Po5; Ki4; Ki5, and section IIIj). The effects of mispairing are discussed in section IIIf.

17

(b) Recutting of filled-in ends

Cleavage with FokI generates 4-nt 5’ ss ends which can be filled-in with PolIk in the presence of the required dNTPs. Although only one cut site on one strand is present in such truncated molecules, they are again cleaved by FokI, releasing 4-nt oligos (Ki5). More surprisingly, tilling-in with only 2 or 3 nt still provides a substrate for FokI, with the release of a di- or trinucleotide. However, filling-in with only 1 nt does not restore the capacity to act as a substrate for FokI cleavage. Similarly, a few other ENases-IIS were evaluated for such a reaction, and it was found that tilling-in the A/w1 1-nt ss end led to efficient recutting, whereas recutting was rather inefficient for the filled-in PleI 1-nt end, or for the HgaI 5-m ss cohesive terminus filled-in with 3,4, or even all 5 nt (Ki4; KiS). However, the presence of only one more bp beyond the distant cut resulted in efficient re-cutting.

Filling-in, followed by recutting, is the basis of a novel amplification reaction (ARP), as outlined in section IIIj.

(c) Cohesive ends

The actual sequence of the ss ends does not depend on the ENases-IIS, but is determined by the nt sequence that happens to be present between the two ss cuts. Depending on the distance between the ss cuts, the number of such sequences is as follows:

Length of cohesive end: 123 4 5 nt Number of combinations: 4 16 64 256 1024

(d) AdoMet requirements

ENases-IIS generally do not require AdoMet, but there are a few known exceptions. BcgI requires AdoMet (Kol), whereas GsuI and Eco571 (and its isoschizomers?) are stimulated twofold and loo-fold, respectively, by AdoMet (Pe2).

(e) Cation and salt requirements

All ENases-IIS require Mg2 + (about 10 mM), which for some ENases-IIS (FokI) or Mn2 + , Fe2 + , Co2 + or Ca2 + (MboII), can be replaced by Mn2 + , Ni2 + , Zn2 + or Co2 + ,

with a decrease in activity (Kul; Sel). Significant activity is observed at the following concentration ranges of KCl: O-150mM (FokI and MboII), 50-100mM (Ksp6321; Bol), or 120-150 mM (Tth 11111; Shl). The suggested con- centrations of KC1 are 0 mM (50 mM K + acetate) for A/WI, BbvI (Gi3), BinI, EarI, and PleI; 10 mM for HphI and MboII; 20 mM for Eco571 and GsuI; 25 mM for Eco311; 50 mM for BsmI, HgaI and MnlI; 90 mM for FokI; and 150 mM for BsmAI, BspMI, BsrI and 5”NI (for most of the data see Ne3 and other manufacturers’ catalogues).

(f) Temperature, p1, and pH ranges

All listed ENases-IIS are used at 37°C except the thermophilic enzymes, BsaI (60°C) BsmI (65 “C), BsmAI (5O”C), BsrI (65°C) (Ne2), Fad (60-65°C; Del and pers. comm.) TaqII (65°C; Bu2), and 7’th 11111(65-70°C; SJrZ) under denaturing conditions. FokI is fairly stable for a few hours at 27-45°C but a significant loss of activity is observed at higher temperatures. Mb011 is inactivated within 15 min at 50°C (Sel). The optimal pH for Bceff, Eco311, FokI, Mb011 and TthI is around 7.5, with a range of up to 7.0-9.0 for Ksp6321. The p1 is 9.4 for FokI, 8.3 for MboII, and 7.7 for Tth 11111.

(g) ENase-IIS structure

All studied enzymes are monomers with sizes of 47 kDa (MboII; Sel), 66 kDa (FokI; Kal; Kid; Ki7), 95 kDa (TthlllII; SAI), 101 kDa (MmeI; Sk2), and up to 104-108 kDa (Eco571; Ju3; Pe2). Only the Eco571-, FokI- and HgaI-encoding genes (both R and M) have been cloned and sequenced (Bu4; Ja3; Ki6; Lol; Nwl; Su3; Wil).

(h) Methyltransferases (MTases-IIS)

Most probably all ENases-IIS have a cognate MTase-IIS, but only three mN6A MTases-IIS[ M - Eco571 (Ju3; Pe2); M * FokI (Lul; Lol; Po6; Su3), and M *MboII], and three m5C MTases [M * BbvI (Dd); M * HgaI (Bud; Nwl); M. HphI (Ne2)] have been identified. Three MTases (M eAfw261; M * Eco3 11; M * Esp31) methylate N6A on one strand and ‘C on another (Bi2). Two MTases-IIS appear to methylate only one strand of the recognition sequence (M . HphI; M * MboII), and six are known to methylate both strands (M *Alw261; M * BbvI; MaEco311; MeEsp31; MmFokI; M*HgaI; Bud; Bi2). M * FokI consists of two mN6A MTases fused in tandem. The full-length protein methylates both strands of the recognition sequence (Lal; Lol; Su3); the N-terminal M * FokI fragment methylates the upper strand and the C-terminal fragment the lower strand (Ku2; Lol; Po5; Po6; ,943) of the 5’-~~~~~ sequence.

E. coli RFL57 produces two mN6A MTases-IIS. One (RM. Eco571) is a part of a joint 108-kDa ENase. MTase-IIS protein and the other is the 63-kDa MTase-IIS designated M * Eco571. Both recognize sequence 5’-CTGAAG and methylate an (unknown) A residue (Ja3; Pe2). There are two M. HguI MTases-IIS, each of which methylating an internal C in one of two strands (Bad). In the case of M. BbvI, there is only one MTase-IIS which recognizes a 5’-GGGC ds sequence and methylates the internal C on each strand (Bad).

Dam methylation (GATC) inhibits MboII, HphI and AlwI, and the Dcm methylation (5’-CCWGG) blocks A/WI, Eco311, FokI, GsuI and HphI, whenever the recognition sequences for ENase and MTase overlap (Bal; Bu3; Nel; Po4).

18

Mboll adapter III. UNIQUE APPLICATIONS OF ENases-IIS AND COGNATE

MTases

(a) Historical perspective (1978-1985) The availability of ENases-IIS and their unique ability to

cut DNA without destroying their recognition sites led to several early proposals and applications during the years 1978 to 1985. These will be mentioned here only briefly in the form of a historical introduction. The first application, published in 1979 by Moses and Horiuchi (MO@, described perfect reassembly of phage fl RF DNA out of six HguI fragments, taking advantage of the fact that each 5-nt cohesive site was unique. The proposed second application was the use of Mb011 (and HphI) for retrieving and trimming adapters published in 1980 (Nul) and 1982 (Br3, Scl). The third application was the gene assembly method patented by Cohen for HphI in 1981 (Cal). According to Narang et al. (Nal), this idea was discussed as early as 1978. Another procedure for gene assembly used HguI (Ko4) and also provided a method for precise excision (retrieval) of the synthetic fragments, not only employing HgaI, HphI, or Mb011 (Ko4; Nul; 02; Br3), but also using BbvII (Do2) and S’NI (Spl). The above methods were used in the construction of synthetic genes. In 1985, a proposal was made to convert ENases-IIS to universal restriction enzymes by constructing special ss oligo adapters with strategically designed recognition (ds hairpin) and cutting sites (Szl, Pal). These early studies stimulated general interest in ENases-IIS, leading to the many new applications, which are described below.

(b) Precise trimming Whereas various exonucleases (including BAL 31 and

E. coli and A exonucleases) are widely used to trim DNA in a time-controlled imprecise fashion, ENases-IIS permit precise trimming of DNA. The trimming can be unidirectional or bidirectional, in either a single-step or multicycle fashion.

(1) Unidirectional trimming (i) Single-use adapters. Narang and collaborators (JVuZ)

have proposed the use of synthetic Mb011 and HphI adapters, which permit cleavage of DNA 8 nt away from the recognition sites. Such an Mb011 adapter was synthesized and used in the specific tr imming step during construction of the svnthetic gene encoding human insulin (Br3; Scl). . I I

In this method (Fig. l), the symmetric 5’-~~~~~

adapter (Mb011 recognition sequences are underlined) was ligated to the 5’-end of DNA coding for the insulin A-chain, followed by Mb011 digestion, and PolIk-mediated blunting of the protruding 3’-nucleotide. Only a single ligation followed by a singleMboI1 cleavage was described (Br3; Scl). Another example is the construction of the FokI recognition

Mboll

5’ TCnmS + 5’AATTCAT&N AGAAGCTTCT lTAAGTACCNNN@NNWNNNNWWW

T4 DNA ligase

Mboll +

5’TCTT&&ATTCA~NNW- AC3WX?TC~AAGTACCNNNNNNNNNNNNNNNhhMNN

t 12)i Mboll

Fig. 1. Single-use synthetic adapter for unidirectional trimming. To cleave the DNA at the precise point indicated by the black arrowhead, the following operations were performed: (1) Mb011 synthetic adapter (as shown) was ligated to DNA, (2) ligated product was cleaved withMboI1, (3) protruding 3’ nt was removed by the treatment with PolIk + dCTP, resulting in the desired blunt-ended terminus ready for subsequent ligation(s). See Br3; Ha3; Nal; Scl.

sequence by ligation of a BamHI linker, ending with GG, to the 5’-ATG sequence 10 bp upstream from the boxA in the I nutL fragment, and using it for directing deep cuts in boxA (Hu3).

(ii) Multi-cycle trimming. This technique employs a plasmid in which a unique ENase-IIS recognition site is present in the MCS. Thus, a DNA fragment cloned in the MCS could be progressively trimmed from one end, by carrying out multiple cycles of (I) cleavage, (2) MB digestion and (3) religation. Employing the BspMI enzyme, 4 bp could be removed per cycle (Fig. 2) (Hal), whereas, when using a pair of enzymes, FokI and MboII, and the FokI/MboII cassette (Ha2), there was a choice for removal of 12 bp (FokI + MboII), 4 bp (FokI) or 1 bp (MboII). A special vector containing the MboII/FokI cassette upstream from the MCS was constructed (Ha2). This multicycle method was used to introduce deletion in phage 3, pk-qut region (Kul). Intermediate numbers of bp could also be removed by using a PolIk-mediated fill-in reaction with the proper kinds of dNTPs (Hal; Hu2) followed by MB blunting. The same vectors could be used for the synthesis of repeat oligos using the reactions described in section IIIi.

(2) Bidirectional trimming (deletions and fusions) (i) Single-use adapters. By synthesizing an adapter with

two outwardly oriented recognition sites, it is possible to cut DNA both to the right and to the left of the adapter. Such a symmetric linker was designed for the BspMI enzyme (j&,). 5’-GCAGGTA CGTCCATggZ$$ (recognition sequences- are

underlined). In conjunction with MB digestion and subsequent ligation, up to 8 bp were removed (Fig. 3). A somewhat analogous adapter was designed for BsmI (Gil).

19

First cycle

Second cycle

Third cycle

B~~MI

t

Sphl %Hindttl.

5 ’ - ACCTG GGCATGCAAGCT-TGGCGTAATCATGGT

GGACG CCGTACGl-TCGWXGCAl-fAGTACCA

BspMl (1) CBspMt

ATGCAAGCT-TGGCGTAATCATGGT

BspMl

5 ’ - ACCTG GGC

b

AAGCT-TGGCGTAATCATGGT GGAC TCCG T-TCGAACCGCATTAGTACCA

(3) 1 b-3

Hindlll

+

GG’JTGGCGTAATCATGGT

A4

A8

GGCCGTAATCATGGT A12

Fig. 2. Multicycle-unidirectional trimming of DNA (e.g., plasmid pUC19). Each cycle consists of three steps: (1) BspMI cleavage, (2) MB digestion of the 4-nt ss ends, and (3) blunt-end ligation. In each cycle, 4 bp are deleted (Hal). The progress of trimming could be followed by restriction enzyme digestion: in the first cycle (44) the SphI site is lost, in the second cycle (d8) the Hind111 site is lost; and in the third cycle (412) a new Hue111 site is created. A similar procedure, using two ENases-IIS (MboII and F&I), permits deletion of up to 12 bp per cycle (4 bp for F&I alone or 1 bp for Mb011 alone). See Ha2.

Excision linker (I ) BspMI, Circular plasmid

5’-GCAGGTACCTGC-3’ + 3’-CFTGGACG-5

WA

BspMl

Y

Unique restriction site

(1) ENa= lrgase

Integration of excision linker

Circular plasmid

(2) I I%?‘or exonuclease

=&I ligase

Excised linker and flanking DNA

Circular plasmid

Fig. 3. Single-use synthetic adapter (excision linkers) for trimming. (1) An excision linker containing two divergent BspMI sites is inserted into a target DNA at a unique site. (2) Digestion of the target DNA with BspMI results in cleavage within the upstream and downstream sequences. Blackened and hatched boxes represent an excision linker and DNA fragment to be excised, respectively. See Gil, Mol.

Actually, the symmetric Mb011 adapter described in section IIIbli above (Nul; Br3; Scl) could be used for bidirectional cleavage. Since BcgI introduces two ds cuts (up stream and downstream from its recognition sequence), it could also be used for the same purpose (Kol).

(ii) Multicycle deletions andfusions. A special fusion plasmid was designed for constructing precise fusions (Ki2). It uses a I;bkI/BspMI cassette which directs leftward deletions when using FokI (whose recognition site was enlarged from 5 to 7 bp by double methylation; see Pod), and rightward deletions when employing BspMI (Fig. 4). Because two different enzymes are used, deletions could be bidirectional and the deletion cycle can be repeated many times, first cutting with one enzyme (followed by MB and ligation) and then with the other. After leftward and rightward trimming, the FokI/BspMI cassette is excised by digestion with both enzymes, followed by MB treatment and the final pre-planned ligation to obtain the desired fusion. Each cycle removes 4 bp when using either FokI or BspMI. In principle, similar fusions could be accomplished using two unidirectionally trimming plasmids (Hal ; Hu2), each for one of two genes, followed by fusion (ligation and recloning) of the 5’- and 3’-trimmed products.

5 ‘. TAACGCCCGGCTlCATCCGGAl-T ASTGCGGGCCGAAGTAGGCCTAA

es-

1

Fokf Mspl

Clone into Hincll-cut M13mp18

1

from ;L DNA

4 WC 5 ‘- TAACGCCCGGCTKATCCGGATTGACCTGCAGGCATGCAAGCTTGG

l-TGCCGGCCGAAGTAGGCCTAACTGGACGTCCGTACGl-KGAACC

t

Fig. 4. Vector for bidirectional t rimming of DNA using multi-cycle deletions and fusions. A cassette with two unique class-IIS ENase sites, 5’-ACCTGC-3’ (BspMI) (Hal) and 5’-CCGGATG-3’ (MspI/FokI) arranged back-to-back in a divergent manner, is inserted at the HincII site of the MCS of plasmid pUC18. The DNA fragments to be fused are cloned into the MCS on each side of the cassette. The BspMI or MspI/FokI sites are used to generate unidirectional deletions of each DNA fragment. The presence of the overlapping MspI site (5’-CCGG), in conjunction with prior M .hfspI methylation, increases F&I specificity from 5 bp to 7 bp (Po4). The precisely adjusted genes are then fused with T4 DNA ligase after the cassette is excised by digestion with BspMI and F&I ENases. See Ki2.

20

3 Smal_

5’-AGGATGCGGATCCCCGGGAAI-EACATCCG- -TCCTACGCCTAGGGGCCClTAAGTG~C-

(I)& Smal

3

5 -AGGATGCGGATCCCC GGGAATTCACATCCG- TCCTACGCCTAGGGG CCCTTAAGTG_TAGGC-

Y -Fokl

~-~~~TNN~~~~~~~NNNUUUUUGCGC (2) TATANUUUUNUUUUUUUNUUUCGCG

clone blunt-ended DNA fragment

Fokl f + 5 - PI?GCGGATCCCCATATUUUUUUUUUUUUUUUUUGCGCGGGMTCACATCCG-

TCCTACGCCTAGGGGTATAUUUUNNUUUNUNUNUNNCGCGCCC~TAAGTG~GCGC-

(3)14_ 4 Fokl

+ Fokl

5-ATATNNUUUUUNUUNNUUNNU NNUUNUNUUUNUUUNNUCGCG

Fokl (DNA fragments with unique ends)

5 - AGGATGCGGATCCCC GCGCGGGAATTCACATCCG- TCCTACGCCTAGGSGTATA CCCTTAAGTGEGC-

Fokl -__

Vector

Fig. 5. Cloning and a precise excision of DNA fragments with unique cohesive ends. The vector contains a specially designed cassette, with two class-IIS restriction sites facing each other and a unique site (,SmaI) in between. (1) The plasmid was cut at the SmaI site. (2) The blunt-ended DNA fragment (bold letters) is cloned into the SmaI site. (3) Digestion of the plasmid with F&I produces DNA fragments with unique cohesive ends derived from the insert DNA. Various plasmids containing cassettes analogous to the one shown here (pWM500, Mel) were constructed (pZP18, Pal; pBBV, Ko4; pSSC1, Ku2). When using pWM500, any DNA fragment cloned into the SmaI site can be excised precisely with unique cohesive ends by F&I digestion; these can be ligated in a single step when constructing agene. See Brl; Do2; Ko3; Ko4; Ku2; Mal; Pal; Spl; Url; Ve3; Ve4.

(c) Precise excision (fragment retrieval) By placing two inward-facing class-IIS adapters at both

ends of a DNA fragment or by cloning such a fragment into a unique site between two class-IIS restriction sites, it is possible to retrieve the fragment in a precise manner without any part of the recognition sequences of the retrieving ENase (Fig. 5). This principle was used in various con- structs using sites recognized by HgaI (Url; Brl; Kd), BbvII (Do2), &“NI (Spl), F&I (Ku2, h4u2, Ve3, Ve4) or BsmI (Pal).

(d) Gene assembly About ten ENases-IIS have been used in various phases

of the assembly of synthetic genes from individual oligos. These include several studies already cited, but from a more systematic point of view they include vectors adapted for single or successive additions of synthetic oligos, as described below:

(I) Generation of unique cohesive ends Using HgaI adapters, 5-nt cohesive ends were created for

cloning synthetic oligos with complementary cohesive ends for gene assembly (Brl; Kd; Krl; Ku2). A similar strategy was designed for the BbvII (D02; Kd) and FokI (Mul; A&2; Ku2) enzymes. It was also proposed that class-IIS restriction sites could be incorporated into the hairpin ends of long selfpriming (filled-in and ds) oligos, so as to create cohesive ends while removing the recognition site (Uhl).

(2) Successive insertions In a 1981 patent, Cohen (Cal) described a plasmid per-

mitting the successive addition of oligos into the unique HphI cleavage site (see also section IIIa). Other plasmids of this kind were described using either the Mb011 (Gal), BsmI (Hu6) or BbsI sites (S.A. Narang, pers. commun).

(e) Universal restriction enzyme

The novel concept of using an ENase-IIS-oligo complex as a restriction enzyme, with the specificity residing in the oligo sequence, was proposed in 1985 (Pal; Szl; Sz2). The adapter consists of a ds DNA portion, which carries the enzyme recognition site (e.g., 5’-zg;fz for FokI) flanked

by 2-3 bp, and an ss portion, complementary to the ss target DNA and extending through the cleavage site (e.g., 9 or 13 nt from the recognition site for FokI). By proper design of the ss portion of the adapter, the ss target DNA can be cut at any predetermined position. The target is the ss DNA, and the product can be ss DNA (Pal) or a ds DNA fragment (Kil) (Fig. 6).

In this system, the enzyme-adapter complex becomes a new DNA-containing enzyme, where the specificity resides in the ss portion of the adapter. Such DNA-containing enzymes have not been found in nature, although RNA- containing nucleases that specifically process tRNA were identified several years ago (see, e.g., MI). The role of the RNA in such enzymes, also including telomerase (Grl), is more complex, since in some cases the RNA also plays the role of ribozyme (AII, Gel).

Adapters were prepared for three other ENases-IIS besides FokI (HgaI, HphI, and MboII) and designed to direct cuts in the ss target DNA (S.C.K., E. Grimes and W.S., unpublished). Only those ENases-IIS which do not cut ss DNA are suitable for this procedure (Pal).

Two other kinds of adapters designed to cut one strand of ds DNA are being evaluated:

(I) An attempt is being made to bind the ss segment of the adapter to denatured circular ds molecules, followed by renaturation, with a view to cutting one strand of such ds molecules (A.J.P. and W.S., in progress).

(2) Experiments have been designed in which the ss domain of the adapter consists only of pyrimidines able to form a triple helix with the complementary dPy * dPu run on

21

(A) Adapter (4 Target sequences for an adapter

s c

,:;:,G.:,,AGGGT;CA-r I B CCTTGCTCCCATCGTTGCCGATGTCTCCGAAAC

GC 13&o

C A 1330

C

Normal-type *

!WXTCACTAGCAACCTCAAACAGACACCATGGTGCACCTGACTCCTGAGGA

Mutant 0

S-GIXACTAGCAACCTCAAACAGACACCACCATGGTGCACCTGACTCCTGTGGA

(6) Adapter-primer 1 Polk dNTPs

m 1 Fokl Second cut

5’ ---.________ AACGAG

3’ ---......... TTGGTCGCAT GGTAGCAACGGCTACAGAGGCT

CGTTGCCGATGTCTCCGA -_-----

Polk dNTPs

3’ 5’

CD) 5’ --_._ _..- _-- AACGAGGGTA GGTAGCAACGGCTACAGAGGCT.------ ---- 3’

3’ . . ..-..-.-w. TTGCTCGCAT CCAITCGTTGCCGATGTCCTCCGA

.------ 1 ---- 5’

Fig. 6. Universal restriction enzymes: the design of the four-component system (adapter-primer, ss target DNA, F&I enzyme, and PolIk) for obtaining ds DNA fragments with one predetermined end. (A)The adapter is a 34-mer oligo with a IO-bp hairpin ds domain carrying the F&I recognition site (boxed) and a 14-nt ss domain complementary to nt 1339-1352 of phage M13mp7 ss target DNA. This 34-mer adapter is directing the F&I-mediated cleavages, as shown by vertical arrows. (B) The 3’ end of the 34-mer adapter-primer is elongated by the PolIk enzyme and all four dNTPs, thus converting the M13mp7 ss target to ds DNA. (C) Addition of F&I resulted in staggered cleavages creating a predetermined end, the position of which depends solely on the design and the sequence of the adapter-primer. (D) Because of the presence of PolIk and four dNTPs, the cohesive ends are filled-in. The bold letters represent the adapter and the outlined letters indicate the ss target DNA. The figure is adapted from KiZ. See also KiZ; PoZ; SzZ.

a specially constructed ds plasmid (Mel). Studies are underway to test whether the triplex formed under such circumstances will result in cleavage by F&I, and whether such cuts will be precise (M. Koob, S.C.K. and W.S., in progress).

(f) Detection of mutations

Another application of the adapter-enzyme complex is for the detection of mutations (Fig. 7). In this method (Ki5), the ss domain of the adapter is complementary to the region where the mutation (e.g., the mutation conferring sickle-cell anemia) occurs in such a manner that the mutation in the target DNA atfects base pairing between the adapter and denatured target DNA in the cutting domain (in such a system no restriction sites have to overlap the mutation site, since the recognition sequence is present in the ds domain

(B) Adapter n 5%

4

3’-CAAGTGATCGTTGGAGTTTGG ‘GACTGAGGACTCCT-Y

(C) Adapter/target (normal-type) complex

n

3’-CAAGTGATCGTTdGAGTTTGG cGACTGAGGCT-S

5’-GTTCACTAGCAACCTCAAAC CTGACTCCTGAGGA-3

t t *

Fig. 7. Detection of point mutations using a two-arm FokI adapter. (A) Target sequences are of the human hemoglobin-encoding gene [both normal (wt) and mutant]. Asterisks indicate the site of the mutation conferring sickle-cell anemia. (B) The adapter consists of an internal ds section containing the FokI recognition site and long ss termini (3’ and 5’ ss segments) complementary to the target DNA (underlined in A) and including cleavage sites. (C) The 3’ ss domain (left arm) is hybridized perfectly to the target DNA and 5’ ss domain (right arm) is designed in such a way that it hybridizes perfectly to the denatured target DNA in the wt, but with mismatches in the mutant DNA. Depending on the numbers and position of mismatches on the 5’ ss domain (overlined sequence GGACTC), FokI cleaves the mismatched cutting domain with different efficiencies. By proper design of the adapter, one could distinguish the wt from the mutant target DNA based on the amount of labelled 5’-end fragments released from the adapter after FokI digestion (Ki5). The reason for two arms is to increase the specificity of hybridiza- tion between adapter and target: the right arm cannot be longer than 14 nt if the released fragment is to be only 3 nt long, and thus easy to detect.

of the adapter). Using F&I, which produces two ss staggered cuts 4 nt apart, it was found that single-bp mismatches in the cutting domain have little effect on cleavage efficiency, but some double (or triple) mismatches reduce cutting by a factor of approximately greater than or equal to ten (Ki5). By proper design of the adapter and labelling its ss terminus, one can distinguish the wt from the mutant target DNA by the release vs. no release of a labelled nt or a very short oligo from its terminus; this approach lends itself to convenient automation of the screening procedure. An amplification reaction (ARP) could greatly increase the sensitivity of this detection method, as described in section IIIj.

22

(g) Cleavage of ss DNA and an attempt to cleave ss RNA (i) Synthesis of repeat sequences

The oligo-adapter-enzyme complex, as described in section IIIe, is the agent of choice for the precise cleavage of ss DNA. Using this system as a model, an attempt was made to design a FokI adapter with an ss domain complementary to in vitro-synthesized RNA, and to then cleave this RNA. The first attempt appeared promising, but soon it was realized that commercial FokI ENase displays some RNase H-like activity, cleaving the RNA within the adapter DNA : RNA duplex, independent of the ds recognition site on the adapter (G. Pbsfai and W.S., unpublished). Thus, there is no evidence at present for specific ss RNA cleavage by the FokI-adapter complex.

In section IIIblii, multicycle trimming of a DNA fragment was reviewed using special BspMI and FokI/MboII plasmids (Hal; Hu2). These vectors could also be utilized for synthesis of any 4-bp repeat sequence by designing a special sequence at the cleavage site, and modifying the enzymatic cycle to (a) cleavage, (b) PolIk-mediated till-in reaction, and (c) ligation. Such a cycle would result in the

.I _

duplication of the 4-bp cut site (e.g., from $1;;: to -CTTCCTTC- -GAAGGAAG-’

with each cycle adding another $f;Ig

module). In the example shown, long stretches of oligo(R) :

oligo(Y) could be obtained (see Hal; Ha2), or other repeating sequences synthesized, including Z DNA (Mi2; Wul).

(h) Tandem amplification of DNA fragments A special plasmid was designed which permits tandem

amplification of a cloned fragment, using two complementary and asymmetric cohesive ends (Ki3) (Fig. 8). These two ends are created by two class-IIS recognition sites (e.g., BspMI; Ki3) with identical, asymmetric, 4-bp cleavage sites. Thus, a DNA fragment between two BspMI sites (including an MCS and a cloned gene) could be con- verted to tens of identically oriented tandem fragments, useful for several applications, e.g., preparing calibration ladders or amplifying gene expression. Specific applications of this method have been described (&I).

pSK3 1.2-kb EcoAl-Sal1

fragment of IuxA

EcoRI+Sall

pstl,

-++ BspMl

5’ ---ACCTGCAGGCATGC---------------ACCTGCAGGCATGC--- __.TGGACGTCCGTACG_!!%!!__.TGGACGTCCGTACG--- 5’ pSK3lwA-’

+ I + U)& BspMl

s

5’ ATGC--,i-i-r-ACCTGCAGGC -------TGGACGTCCGTACG 5

(2) 1 ligase

Pstl

Bse

( 5’ ATGC------------ACCAGGC

___!!!-X-!!___TGGACGTCCGTACG 5 ) ,,

(34

Che int0 BspMI-cut pUC18 or pSK3

Fig. 8. Amplification of cloned DNA as tandem multimers. An ampliica- tion plasmid was constructed in which a MCS is flanked by two @MI recognition sites with identical cut sites, creating asymmetric, but complementary, 5’-ATGC and 5’-GCTA ss cohesive ends. Any DNA fragment cloned into the MCS could be amplified using the following steps: (1) excision with BspMI, and fragment isolation; (2) sell-ligation of the fragments using T4 DNA ligase and selection of multimers of desired length; and (3) cloning them into the original BspMI-digested plasmid. The plasmids were stable since all the repeat units were in the same orientation. See Ki3; Stl.

(i) Amplification reaction (ARP) As described in section IIb, the 4-nt cohesive end, when

tilled-in using 4 dNTPs + PolIk, could again be recut by FokI, since the unchanged FokI recognition site remains on this fragment (Fig. 9). When both DNA polymerase (+ dNTPs) and FokI are present, copious amounts of tetramer (complementary to the cohesive 4-nt end) can be produced. The reaction is fast, eficient, and selfsustaining until most of the dNTPs are used up. This is a novel example of an alternating two-enzyme amplification reaction, with FokI displacing DNA polymerase, and vice versa, in succession (S.C.K. and W.S., unpublished). No thermal cycling is required for this reaction. DNA polymerase must be processive and free of 5’- and 3’-exo- nucleolytic activity, so as not to digest the ss products. Although only tetranucleotides are produced in the case of

Fok I t

5’7 C_3* GTGCCTACACTNNN@&JT~ACGNNNMNNNUNNNNN

(1) f

Fokl

CA&%yGTGANNNNNN c

Fok I

GTGCCTACACTNNNNihTACG

(2) dATP, dTTP, dGTP, dCTP

f

Fok I +

c + Pol (no Y-5’ exonuclease activity)

CA~~GTGAMWWATGC GTGCCTACACTNNNNNNTACG.

(3) t Fok I

c

+ Fokl

CAO%%TGWNNWN

GTGCCTACACTNNNNNNTACG

+ ATGF PRINTING

(4) Fokl

+ Pol + labelled dNTP

(AMPLIFICATION)

(ARP)

many en ymatic f

cycles I

+ Z. lo” copies of labelled ATGC _J

Fig. 9. Amplification employing restriction enzyme (ENase-IIS) and polymerase (ARP). The 5’-protruding cohesive ends produced by ENase-IIS could be amplified by the following reactions: (1) cleavage of DNA fragments by F&I produces the 4-nt 5’ ss cohesive ends; (2) cohesive ends could be filled-in with DNA polymerase (Pol) in the presence of the required dNTPs; (3)tilled-in 5’ ss cohesive ends were again cleaved by F&I, releasing 4-nt oligos. (4) Steps (2) and (3) were repeated until most of the dNTPs were used up.

23

&‘&I, the reaction could be used for the efficient detection of mutations by the adapter technique, as discussed in section IIIf.

By using ss adapters with chemically modified nt at the cut site (so as to protect them from being cut), it might be possible to produce large quantities of much longer oligos complementary to the target DNA. This could form the basis of a new method of gene amplification, replacing in some cases the PCR reaction. (For amplification of long oligos, however, thermal cycling might become necessary.) One of the advantages of such a linear amplification procedure is that the same template is used throughout the reaction, preventing the propagation of replication errors. Thus, this is not a semiconservative replication reaction, as in the case of PCR, but rather a ‘printing’- or ‘stamping’-like reaction, the proposed acronym for which is ARP (for Amplification employing Restriction enzyme and DNA Polymerase). Many variants of such an ARP reaction are possible (Ki5).

Instead of using chemically modified (e.g., thionylated) nt, another approach to protect one of the two DNA strands from being cut in the ARP reaction, would be the development of mutants of the ENases-IIS that would cut only one specific DNA strand (nicking mutant). This might be feasible if separate ENase-IIS domains directed cutting of each of the DNA strands. Such ENases might even exist in nature, but have been overlooked by the present screening techniques. Enzymes which nick the specific DNA strand at the ori site of the ds RF molecule of the small ss DNA phages (e.g., the products of gene II of phage Ml3 or gene,4 of $X174) might be prototypes of such ENases.

(k) Localization of methylated bases Since the cuts generated by ENases-IIS are at a precise

distance from the recognition sites, it is possible to dissect the recognition sites of MTases to determine whether a radiolabelled CH, group is to the left or to the right of a given cut. This was done in the case of methylation by M * FokI (Po5; P06) and by M * BspRI (P06). Suitable natural nt sequences with the proper arrangement of the methylation and cut sites were selected by searching the GenBank sequences. Alternatively, the suitable sequences could also be specially designed and then synthesized in vitro.

(1) Use of the recognition site for affinity purification of ENases-IIS

Since ENases-IIS can bind to the recognition site without cleaving the DNA (if the cutting site is absent or already cleaved), it should be possible to use such DNA as a component of affinity columns, and purify the enzyme in the presence of M$ + . This would not be possible for those

class-II restriction enzymes which destroy their recognition sites by cleavage. Such a purification was recently used (Del).

(m) Other nonspecific applications ENases-IIS can be used for all or most of the applica-

tions which normally employ class-II enzymes. These include restriction analysis, various genetic constructions, and ‘Achilles’ heel cleavage’ @‘ok1 recognition sites can be created by a single mutation in one of the versions of the luc0 operator; Ko2, and unpublished). However, it is not the purpose of this review to list all common applications of the ENases-IIS, but only those unique to the nature of these enzymes.

ACKNOWLEDGEMENTS

We are grateful to New England Biolabs for their finan- cial support during our early studies on the class-IIS restriction enzymes, and for unpublished data supplied by Drs. I. Schildkraut, G.G. Wilson, J. Barsomian, B.E. Slatko, and R.D. Morgan. Moreover, Drs. SK. Degtyarev, F.L. Graham, C. Kessler, M. McClelland, S.A. Narang, R.J. Roberts, and P. Skowron, made helpful suggestions and provided corrections for this review.

Supported by NIH grant GM39715 (to W.S.) and National Cancer Institute core grant 5-P30-CA-07175

REFERENCES

All

Bal

Ba2

Ba3

Ba4

BaS

Bil

Bi2

BOO

Altman, S.: Ribonuclease P: an enzyme with a catalytic RNA subunit. Adv. Enzymol. 62 (1989) l-36. Backman, K.: A cautionary note on the use of certain restriction endonucleases with methylated substrates. Gene 11 (1980) 169-171. Barker, D., Hoff, M., Oliphant, A. and White, R.: A second type II restriction endonuclease from Thermus aquaticus with an unusual sequence specificity. Nucleic Acids Res. 12 (1984) 5567-5581. Barrell, B.G., Air, G.M. and Hutchinson III, C.A.: Overlapping genes in bacteriophage +X174. Nature 264 (1976) 34-41. Barsomian, J., Landry, D., Moran, L., Slatko, B., Feehery, G., Jack, W., Nwankwo, D. and Wilson, G.: Organization and evolu- tion of type-IIS methyltransferases. Second New England Biolabs Workshop on Biological DNA Modification. Berlin, 1990, p. 11. Bautista, D.S. and Graham, F.L.: Insertional mutagenesis using a synthetic lac operator. Gene 82 (1989) 201-208. BitinaitC, J., Kersulyte, D., Butkus, V. and Janulaitis, A.: cited in Kel and Ro2.

Bitinaite, J., Maneliene, Z., Grigaite, R., Menkevicius, S., Butkus, V. and Janulaitis, A.: AIw261, Eco311, and Esp31-type IIS methyltransferases capable of modifying different bases in complementary DNA strands. Second New England Biolabs Workshop on Biologi- cal DNA Modification. Berlin, 1990, p. 128. Bocklage, H., Heeger, K. and MBller-Hill, B.:Cloning and characterization of the Mb011 restriction-modification system. Nucleic Acids Res. 19 (1991) 1007-1013.

24

Bol Bolton, B.J., Schmitz, G.G., Jarsch, M., Comer, M.J. and Kessler, C.: Ksp6321, a novel class-IIS restriction endonuclease from Kluyveru sp. strain 632 with the asymmetric hexanucleotide recognition sequence: 5’-CTCTTC(N)l-3’ Gene 66 (1988) 31-43.

3’-GAGAAG(N).,-5”

Bo2 Bonventre, J.: cited in KeZ and Ro2. Bo3 Boyd, A.C., Charles, LG., Keyte, J.W. and Brammar, W.J.: Iso-

lation and computer-aided characterization of MmeI, a type II restriction endonuclease fromMethylophilus methylotrophus. Nucleic Acids Res. 14 (1986) 5255-5274.

BrZ Brake, A.J., Merryweather, J.P., Coit, D.G., Heberlein, U.A., Masiarz, F.R., Mullenbach, G.T., Urdea, MS., Valenzuela, P. and Barr, P.J.: a-Factor-directed synthesis and secretion of mature foreign proteins in Sacchnromyces cerevisiue. Proc. Natl. Acad. Sci. USA 81 (1984) 4642-4646.

Br2 Brinkley, P., Bautista, D.S., and Graham, F.L.: The cleavage site of restriction endonuclease MnlI. Gene 100 (1991) 263-264.

Br3 Brousseau, R., Scarpulla, R., Sung, W., Hsiung, H.M., Narang, S.A. and Wu, R.: Synthesis of a human insulin gene, V. Enzymatic assembly, cloning and characterization of the human proinsulin DNA. Gene 17 (1982) 279-289.

Br4 Brown, N.L., Hutchinson III, CA. and Smith, M.: Cited in Ba3. Br5 Brown, N.L., Hutchinson III, CA. and Smith, M.: The specific

non-symmetrical sequence recognized by restriction endonuclease MboII. J. Mol. Biol. 140 (1980) 143-148.

Br6 Brown, N.L. and Smith, M.: Cleavage specificity of the restriction endonuclease isolated from Haemophilus gallinarum (HgaI). Proc. Nat]. Acad. Sci. USA 74 (1977) 3213-3216.

Bul Bunina, Z.F., Kramarov, V.M., Mazanov, A.L., Pachkunov, D.M., Smolyaninov, V.V. and Matvienko, N.N.: BbvII, a new site specific endonuclease from Bacillus brevic 80. Bioorg. Khim. 9 (1983) 1578-1580.

Bu2 Burton, W.G., Roberts, R.J., Myers, P.A. and Sager, R.: A site- specific single-stranded endonuclease from the eukaryote Chlamy-

domonas. Proc. Natl. Acad. Sci. USA 74 (1977) 2687-2691. 8~3 Butkus, V., Bitinaite, J., Kersulytb, D. and Janulaitis, A.: A new

restriction endonuclease Eco311 recognizing a non-palindromic sequence. Biochim. Biophys. Acta 826 (1985) 208-212.

Gel Cech, T.R.: The chemistry of self-splicing RNA and RNA enzymes. Science 236 (1987) 1532-1539.

Ce2 Chen, Z.: cited in Kel and Ro2. CoZ Cohen, S.N.: Method for synthesizing DNA sequentially. U.S.

Patent No. 4,293,652 (1981). Del Degtyarev, S.K., Kolykhalov, A.A., Rechkunova, N.I. and Dedkov,

V.S.: Determination of the substrate specificity of restriction endonuclease FauI. Bioorg. Khim. 15 (1989) 130-132.

DoZ Dobritsa, A.P. and Dobritsa, S.V.: DNA protection with the DNA methylase M . BbvI from Bacillus brevir var. GB against cleavage by the restriction endonucleases PstI and PvuII. Gene 10 (1980) 105-l 12.

Do2 Dobrynin, V.N., Korobko, V.G., Shingarova, L.N., Bystrov, V.S., Filippov, S.A., Boldyreva, E.F., Kolosov, M.N., Matvienko, N.I. and Kramarov, V.M.: Plasmid vectors pBBV for the cloning and regeneration of DNA fragments with any terminal nucleotide sequence. Dokl. Akad. Nauk SSSR 278 (1984) 1002-1005.

MI Ehrlich, M. and Wang, R.Y.-H.: 5-Methylcytosine in eukaryotic DNA. Science 212 (1981) 1350-1357.

EnZ Endow, S.A.: Analysis of Drosophila melanogaster satellite IV with restriction endonuclease MboII. J. Mol. Biol. 114 (1977) 441-449.

Gal Gayle III, R.B., Auger, E.A., Gough, G.R., Gilham, P.T. and Bennett, G.N.: Formation of Mb011 vectors and cassettes using asymmetric Mb011 linkers. Gene 54 (1987) 221-228.

Gel Gelinas, R.E., Myers, P.A. and Roberts, R.J.: Two sequence- specific endonucleases from Moraxella bovti. J. Mol. Biol. 114 (1977) 169-179.

Gil Gihnartin, P.M. and Chua, N.-H.: A novel method for factor binding site mutagenesis. Nucleic Acids Res. 17 (1989) 4901.

Gi2 Gingeras, T.R. and Roberts, R.J.: cited in KeZ and Ro2. Gi3 Gingeras, T.R., Milazzo, J.P. and Roberts, R.J.: A computer

assisted method for the determination of restriction enzyme recognition sites. Nucleic Acids Res. 5 (1978) 4105-4127.

GIZ GIivonauskaitC, R., Bitinaite, J., PetruSyt&, M., Butkus, V., Manelient, Z. and Janulaitis, A.: cited in KeZ and Ro2.

GrZ Greider, C.W. and Blackburn, E.H.: A telomeric sequence in the RNA of Tetrahymena telomerase required for telomere repeat synthesis. Nature 337 (1989) 331-337.

Gr2 Gruenbaum, Y., Cedar, H. and Razin, A.: Restriction enzyme digestion of hemimethylated DNA. Nucleic Acids Res. 9 (1981) 2509-25 15.

Hal Hasan, N., Kim, S.C., Podhajska, A.J. and Szybalski, W.: A novel multistep method for generating precise unidirectional deletions using BspMI, a class-IIS restriction enzyme. Gene 50 (1986) 55-62.

Ha2 Hasan, N., Kur, J. and Szybalski, W.: An MboII/FokI trimming plasmid allowing consecutive cycles of precise I-to-12-base-pair deletions in cloned DNA. Gene 82 (1989) 305-311.

Ha3 Hasan, N. and Szybalski, W.: Boundaries of the nurL antitermi- nator of coliphage lambda and effects of mutations in the spacer region between boxA and boxB. Gene 50 (1986) 87-96.

Ha4 Hattman, S., Brooks, J.E. and Masurekar, M.: Sequence specificity of the PI modification methylase (M*EcoPl) and the DNA methylase (M.Eco dam) controlled by the Escherichia coli dam

gene. J. Mol. Biol. 126 (1978) 367-380. Ha5 Hattman, S., Keister, T. and Gottehrer, A.: Sequence specificity of

DNA methylases from Bacillus amyloliquefaciens and Bacillus brevis.

J. Mol. Biol. 124 (1978) 701-711. Ha6 Hayden, M.A. and Mandecki, W.: Gene synthesis by serial cloning

of oligonucleotides. DNA 7 (1988) 571-578. ZnZ Inagaki, K., Kobayashi, F., Dou, D., Nomura, Y., Kotani,

H., Kishimoto, N., Sugio, T. and Tano, T.: Isolation and identification of restriction endonuclease Asp35HI from Acidophilum

species 35H. Nucleic Acids Res. 18 (1990) 6155. JaZ Janulaitis, A., Bitinaite, J. and JaskeleviEiene, B.: A new sequence-

specific endonuclease from Gluconobacter suboxydans. FEBS Lett. 151 (1983) 243-247.

Ja2 Janulaitis, A., KazlauskienC, R., LazareviEiutt, L., Gilvonauskaitb, R., SteponaviEienB, D., JagelaviEius, M., PetruSytC, M., Bitinaitt, J., VeieviEiIitk, Z., KiudulienC, E. and Butkus, V.: Taxonomic specificity of restriction-modification enzymes. Gene 74 (1988) 229-232.

Ja3 Janulaitis, A., Vaisvila, R., Klimasauskas, S., PetruSytC, M., Manelien&, Z. and Butkus, V.: Cloning and sequencing of the genes coding Eco571 restriction-modification system - prototype of type IV enzymes. Second New England Biolabs Workshop on Biological DNA Modification, Berlin, 1990, p. 12.

KaZ Kaczorowski, T., Skowron, P. and Podhajska, A.J.: Purification and characterization of the Fo/cI restriction endonuclease. Gene 80 (1989) 209-216.

Ka2 Kaczorowski, T., Sektas, M., Skowron, P. and Podhajska, A.J.: Overproduction, purification and properties of the FokI methyltransferase and its deletion derivatives. Second New England Biolabs Workshop on Biological DNA Modification, Berlin, 1990, p. 138.

KeZ Kessler, C. and Manta, V.: Specificity of restriction endonucleases and DNA modification methyltransferases - a review (Edition 3). Gene 92 (1990) l-248. [see also Edition 2, Gene 47 (1986) l-1531.

KhZ Khosaka, T.: cited in KeZ and Ro2.

Kh2 Khosaka, T. and Kiwaki, M.: BinI: a new site-specific endonuclease from Bifidobacterium infantis. Gene 31 (1984) 251-255.

KiZ Kim, S.C., Podhajska, A.J. and Szybalski, W.: Cleaving DNA at

Ki2

Ki3

Ki4

Ki5

Ki6

Ki7

KII

KoI

Ko2

Ko3

Ko4

Ko5

Kvl

KU1

Ku2

La1

Lo1

LUl

any predetermined site with adapter-primers and class-IIS restriction enzymes. Science 240 (1988) 504-506. Kim, SC., P6sfai, G. and Szybalski, W.: A novel gene-fusing vector: construction of a 5’-GGmCC-specific chimeric methyltransferase, M.BspRI/M.BsuRI. Gene 100 (1991) 45-50. Kim, S.C. and Szybalski, W.: Amplification of cloned DNA as tandem multimers using &MI-generated asymmetric cohesive ends. Gene 71 (1988) l-8. Kim, S.C. and Szybalski, W: Precision and sequence requirements for the oligodeoxynucleotide-instructed FokI cuts. (1991) in preparation. Kim, S.C. and Szybalski, W.: Detection of point mutations using adapters and FokI restriction enzyme. (1991) in preparation. Kita, K., Kotani, H., Sugisaki, M. and Takanami, M.: The FokI restriction-modification system, I. Organization and nucleotide sequences of the restriction and modification genes. J. Biol. Chem. 264 (1989) 5751-5756. Kita, K., Kotani, H., Hiroaka, N., Nakamura, T. and Yonaha, K.: Overproduction and crystalization of FokI restriction endonuclease. Nucleic Acids Res. 17 (1989) 8741-8753. Kleid, D., Humayun, Z., Jeffrey, A. and Ptashne, M.: Novel properties of a restriction endonuclease isolated from Huemophilus

parahaemolyticus. Proc. Natl. Acad. Sci. USA 73 (1976) 293-297. Kong, H., Morgan, R.D. and Chen, Z.: A new type II restriction endonuclease, BsmAI, from Bacillus stearothermophiius. Nucleic Acids Res. 18 (1990) 686. Koob, M., Grimes, E. and Szybalski, W.: Conferring operator specificity on restriction endonucleases. Science 241 (1988) 1084-1086. Korch, C., Hagblom, P. and Normark, S.: Type III 5-methylcytosine modification of DNA in Netiseriu gonowhoeae. J. Bacterial. 161 (1985) 1236-1237.

Korobko, V.G., Dobrynin, V.N., Severtsova, I.V., Boldyreva, E.F., Vystrov, N.S. and Kolosov, M.N.: Oligonucleotide adaptors cleavable by endonuclease HgaI and their use in the synthesis of DNA. Bioorg. Khim. 8 (1982) 830-839. Korobko, V.G., Dobrynin, V.N., Severtsova, I.V., Boldyreva, E.F., Shingarova, L.N., Chuvpilo, S.A., Filippova, L. Yu., Zvonok, N.M., Vasil’eva, T.E. and Kolosov, M.N.: New approach to obtaining DNA from synthetic oligonucleotides. Synthesis of DNAs coding the repeating antigenic determinant of the virus of foot-and-mouth disease. Bioorg. Khim. 13 (1987) 69-81. Kravchenko, V.V., Serpinskii, O.I., Silvolobova, G.F. and Shchubina, T.N.: Plasmid vector for cloning determined by nucleotide sequence and directed assembly of DNA fragments. Mol. Biol. Mosk. 21 (1987) 194-199. Kur, J., Hradecna, Z., Hasan, N. and Szybalski, W.: The role ofthe direct repeat in qut-controlled antitermination in phage rl. Virology 176 (1990) 629-632. Kuznedelov, K.D., Kolocheva, T.I. and Rivkin, M.I.: Plasmid vector pSSC1 for cloning synthetic polynucleotides and their regeneration with a unique nucleotide. Bioorg. Khim. 12 (1986) 842-844. Landry, D., Looney, M.C., Feehery, G.R., Slatko, B.E., Jack, W.E., Schildkraut, I. and Wilson, G.G.: M. Fo/cI methylates adenine in both strands of its asymmetric recognition sequence. Gene 77 (1989) l-10. Looney, M.C., Moran, L.S., Jack, W.E., Feehery, G.R., Benner, J.S., Slatko, B.E. and Wilson, G.G.: Nucleotide sequence of the FokI restriction-modification system: separate strand-specificity domains in the methyltransferase. Gene 80 (1989) 193-208. Lunnen, K.D., Barsomian, J.M., Camp, R.R., Card, C.O., Chen, S.-Z., Croft, R., Looney, M.C., Meda, M.M., Moran, L.S., Nwankwo, D.O., Slatko, B.E., Van Cott, E.M. and Wilson, G.G.: Cloning type-11 restriction and modification genes. Gene 74 (1988) 25-32.

Ma1

Ma2

Ma3

Ma4

Mel

Me2

MC3

Mil

Mi2

Mol

Mel

25

Mandecki, W. and Boiling, T.J.: FokI method of gene synthesis. Gene 68 (1988) 101-107. Mandecki, W., Hayden, M.A., Shallcross, M.A. and Stotland, E.: A totally synthetic plasmid for general cloning, gene expression and mutagenesis in Escherichia coli. Gene 94 (1990) 103-107. Matvienko, N.I., Kramarov, V.M. and Trismetov, A.A.: Isolation and characterization of a DNA methylase from Flavobucterium

okeanokoites. Bioorg. Khim. 11 (1985) 953-956. Matvienko, N.I., Pachkunov, D.M. and Kramarov, V.M.: The recognition sequence of site-specific endonuclease BbvII from Bacillus brevis 80. FEBS Lett. 177 (1984) 23-26. McClelland, M. and Nelson, M.: The effect of site-specific methylation on restriction endonucleases and DNA modification methyltransferases - a review. Gene 74 (1988) 291-304. McClelland, M. and Nelson, M.: cited in Kel and Ro2.

McClelland, M., Nelson, M. and Cantor, C.R.: Purification of Mb011 methylase (GAAG”‘A) from Moraxellu bovis: site specific cleavage of DNA at nine and ten base pair sequences. Nucleic Acids Res. 13 (1985) 7171-7182. Middleton, J.H., Stankus, P.V., Edgell, M.H. and Hutchinson III, C.A.: cited in Kel and Ro2.

Mitsui, Y., Langridge, R., Shortle, B.E., Cantor, C.R., Grant, R.C., Kodama, M. and Wells, R.D.: Physical and enzymatic studies on poly d(I-C) . poly d(I-C), an unusual double helical DNA. Nature 228 (1970) 1166-1169. Morgan, A.R. and Wells, R.D.: Specificity of the three-stranded complex formation between double-stranded DNA and single- stranded RNA containing repeating nucleotide sequences. J. Mol. Biol. 37 (1968) 63-80. Morgan, R.D.: cited in Kel and Ro2, and personal communication.

Mo3 Morgan, R.D. and Bonventre, J.: cited in Kel and Ro2.

Mo4 Morgan, R.D. and Hotfman, L.: cited in Kel and Ro2.

Mo5 Morgan, R.D. and Soltis, A.: cited in Kel and Ro2.

Mo6 Morgan, R.D., Stote, R. and Schildkraut, I.: cited in Kel and Ro2. Mo7 Mormeneo, S., Knott, R. and Perlman, D.: Precise nucleotide

sequence modifications with bidirectionally cleaving class-IIS excision linkers. Gene 61 (1987) 21-30.

Mo8 Moses, P.B. and Horiuchi, K.: Specific recombination in vitro promoted by the restriction endonuclease HgaI. J. Mol. Biol. 135 (1979) 517-524.

MYI Nal

Na2

Nel

Ne2

Ne3

Nwl

Pal

Pel

Pe2

Myers, P.S. and Roberts, R.J.: cited in Kel and Ro2.

Narang, S.A., Brousseau, R., Hsiung, H.M., Sung, W., Scarpulla, R.C., Ghangas, G., Lau, L., Hess, B. and Wu, R.: Synthesis of the human insulin gene. Part IV. New synthetic deoxyribooligonucleotide adaptors and primer for DNA cloning and sequence analysis. Nucleic Acids Res., Symposium Series No. 7 (1980) 377-385. Nardone, G. and Blakesley, R.: A new type II restriction enzyme from Huemophilus intuenzae. Fed. Proc. 40 (1981) 1848. Nelson, M.: cited in Kel and Ro2.

Nelson, M., Christ, C. and Schildkraut, I.: Alteration of apparent restriction endonuclease recognition specificities by DNA methylases. Nucleic Acids Res. 12 (1984) 5165-5173. New England BioLabs Catalogue, 1990-1991, Beverly, MA 01915-5599, 1990. Nwankwo, D. and Wilson, G.: Cloning of two type II methylase genes that recognize asymmetric nucleotide sequences: FokI and HgaI. Mol. Gen. Genet. 209 (1987) 570-574. Pan, Z. and Bostock, C.J.: A cloning vector allowing excision of inserts with original termini irrespective of their sequence. Nucleic Acids Res. 16 (1988) 8182. PetruSyte, M.P., Bitinaite, J.B., Kersulyte, D.R., MenkeviEiuS, S.J., Butkus, V.V. and Janulaitis, A.A.: Restriction endonucleases of a new type. Dokl. Akad. Nauk SSSR 295 (1987) 1250-1253. PetruSytC, M., Bitinaitt, J., MenkeviEiuS, S., Klimasauskas, S.,

26

PO1

PO2

PO3

PO4

PO5

PO6

Rol

Ro2

Ro3

SC1

SC2 SC3 SC4

SC5 Se1

Shl

Sh2

Sk1

Sk2

Sd SPl

St1

Sul

Su2

Butkus, V. and Janulaitis, A.: Restriction endonucleases of a new type. Gene 74 (1988) 89-91. Podhajska, A.J. and Szybalski, W.: Conversion of the FokI endonuclease to a universal restriction enzyme: cleavage of phage Ml3mp7 DNA at predetermined sites. Gene 40 (1985) 175-182. Polisson, C. and Morgan, R.D.: BsrI, a unique restriction endonuclease from Bacilhu stearothermophilw which recognizes 5’ACTGG3’. Nucleic Acids Res. 16 (1988) 5205. Polisson, C. and Morgan, R.D.: EarI, a restriction endonuclease from Enterobacter aerogenes which recognizes 5’CTC’MC3’. Nucleic Acids Res. 16 (1988) 9872. P6sfai, G. and Szybalski, W.: Increasing the FokI cleavage specificity from 5 to 7 base pairs by two-step methylation. Nucleic Acids Res. 16 (1988) 6245. P6sfai, G. and Szybalski, W.: A simple method for locating methylated bases in DNA as applied to detect asymmetric methylation by M*FokIA. Gene 69 (1988) 147-151. Pbfai, G. and Szybalski, W.: A simple method for locating methylated bases in DNA using class-IIS restriction enzymes. Gene 74 (1988) 179-181. Roberts, R.J.: Restriction and modification enzymes and their recognition sequences. Gene 4 (1978) 183-193. Roberts, R.J.: Restriction enzymes and their isoschizomers. Nucleic Acids Res. 17 (1989) r347-r387, and 1991 computer printout. Roberts, R.J.: cited in Kel and Ro2.

Scarpulla, R.C., Narang, S. and Wu, R.: Use of a new retrieving adaptor in the cloning of a synthetic human insulin A-chain gene. Anal. Biochem. 121 (1982) 356-365. Schildkraut, I.: cited in KeZ and Ro2, and personal communication. Schildkraut, I. and Greenough, L.: cited in Kel and Ro2. Schildkraut, I., Morgan, R. and Looney, M.C.: cited in Kel and Ro2.

Sciaky, D. and Roberts, R.J.: cited in Kel and Ro2. Sektas, M., Kaczorowski, T. and Podhajska, A.J.: Purification and properties of the MboII, a class-IIS restriction endonuclease. (1991) in preparation. Shinomiya, T., Kobayashi, M. and Sato, S.: A second site-specific endonuclease from Thermus thermophilus 111, Tth 11111. Nucleic Acids Res. 8 (1980) 3275-3285. Shinomiya, T., Kobayashi, M., Sato, S. and Uchida, T.: A new aspect of a restriction endonuclease Tth 111 I. It has a degenerated specificity (Tth 111 I *). J. Biochem. (Tokyo) 92 (1982) 1823-1832. Skowron, P., Kaczorowski, T. and Podhajska, A.J.: Atypical DNA-binding properties of the FokI class-IIS restriction endonuclease: evidence for recognition of cognate sequence by monomeric protein. Gene (1991) in press. Skowron, P., Tucholski, J. and Podhajska, A.J.: Is the large size of MmeI related to the long distance between its recognition and cleavage sites? (1991) in preparation. Smith, L., Blakesley, R. and Chirikjian, J.: cited in Kel and Ro2. Sproat, B.S. and Gait, M.J.: Chemical synthesis of a gene for somatomedin C. Nucleic Acids Res. 13 (1985) 2959-2977. Stahl, S., Sjiilander, A., Hansson, M., Nygren, P.-A. and Uhltn, M.: A general strategy for polymerization, assembly and expression of epitope-carrying peptides applied to the Plasmodium falciparum

antigen Pfl55/RESA. Gene 89 (1990) 187-193. Sugisaki, H.: Recognition sequence of a restriction endonuclease from HaemophUus gallinarum. Gene 3 (1978) 17-28. Sugisaki, H. and Kanazawa, S.: New restriction endonucleases

su3

su4

Szl

sz2

sz3

Tal

To1

UhI

Url

Val

Vel

Ye2

Ye3

Ve4

Ye5

Vi1

Wal

Wil

Zal

from Flavobacterium okeanokoites (FokI) and Micrococcus luteus

(MZuI). Gene 16 (1981) 73-78. Sugisaki, H., Kita, K. and Takanami, M.: The FokI restriction- modification system, II. Presence oftwo domains in FokI methylase responsible for modification of different DNA strands. J. Biol. Chem. 264 (1989) 5757-5761. Sugisaki, H., Maekawa, Y., Kanazawa, S. and Takanami, M.: Screening of type II restriction endonucleases, I. Isolation and characterization of enzymes from fifteen bacterial strains. Bull. Inst. Chem. Res. Kyoto Univ. 60 (1982) 328-335. Szybalski, W.: Universal restriction endonucleases: designing novel cleavage specificities by combining adapter oligodeoxynucleotide and enzyme moieties. Gene 40 (1985) 169-173. Szybalski, W.: Universal restriction endonuclease. U.S. Patent No. 4,935,357 (June 19, 1990). Szybalski, W., Blumenthal, R.M., Brooks, J.E., Hattman, S. and Raleigh, E.A.: Nomenclature for bacterial genes coding for class-11 restriction endonucleases and DNA modification methyltransferases. Gene 74 (1988) 279-280. Takanami, M.: Restriction endonucleases AP, GA, and H-I from three Haemophilus strains. Methods Mol. Biol. 7 (1974) 113-133. Tolstoshev, C.M. and Blakesley, R.W.: RSITE: a computer pro- gram to predict the recognition sequence of a restriction enzyme. Nucleic Acids Res. 10 (1982) l-17. Uhlmann, E.: An alternative approach in gene synthesis: use of long selfpriming oligodeoxynucleotides for the construction of double-stranded DNA. Gene 71 (1988) 29-40. Urdea, MS., Merryweather, J.P., Mullenbach, G.T., Coit, D., Heberlein, U., Valenzuela, P. and Barr, P.J.: Chemical synthesis of a gene for human epidermal growth factor urogastrone and its expression in yeast. Proc. Natl. Acad. Sci. USA 80 (1983) 7461-7465. Vanyushin, B.F. and Dobritsa, A.P.: On the nature of the cytosine- methylated sequence in DNA of Bacillus brevis var. G-B. Biochim. Biophys. Acta 407 (1975) 61-72. Venetianer, P. and Orosz, A.: Bceff, a new type IIS restriction endonuclease. Nucleic Acids Res. 16 (1988) 3053-3060. Venetianer, P. and Orosz, A.: Isolation and characterization oftwo new restriction endonucleases (BepI and Bceff). Gene 74 (1988) 99. Vermersch, P.S. and Bennett, G.N.: Selectable FokI cassettes for linker mutagenesis and DNA replacement experiments. Fed. Proc. 45 (1986) 1851. Vermersch, P.S. and Bennett, G.N.: The use of a selectable FokI

cassette in DNA replacement mutagenesis of the R388 dihydro- folate reductase gene. Gene 54 (1987) 229-238. Vesely, Z., Mtlller, A., Schmitz, G.G., Kaluza, K., Jarsch, M. and Kessler, C.: RZeAI: a novel class-IIS restriction endonuclease from Rhizobium leguminosarum recognizing ::I~~$$$$~;?‘. Gene 95 (1990) 129-131. Vissel, B. and Choo, K.H.: Altered activity of restriction endonuclease MnZI cleavage of mouse satellite DNA. Nucleic Acids Res. 16 (1988) 4731. Wang, A., H.-J., Quigley, G.J., Kolpak, F.J., Crawford, J.L., Van Boom, J.H., Van der Marel, G. and Rich, A.: Molecular structure of a left-handed double helical DNA fragment at atomic resolution. Nature 282 (1979) 680-686. Wilson, G.G.: Cloned restriction-modification systems - a review. Gene 74 (1988) 281-289. Zabeau, M., Greene, R., Myers, P.A. and Roberts, R.J.: cited in Kel and Ro2.

Class-IIS restriction enzymes â a review

Documents

Transcript of Class-IIS restriction enzymes â a review